changeset 0:5531deeabd2c draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/blob/master/tools/khmer/ commit be9a20423d1a6ec33d59341e0e61b535127bbce2
author iuc
date Wed, 11 Nov 2015 09:46:18 -0500
parents
children 73314e26dcfd
files filter-below-abund.py macros.xml normalize-by-median.xml test-data/normalize-by-median.c2.report.txt test-data/normalize-by-median.paired.report.txt test-data/normalize-by-median.report.txt test-data/random-20-a.fa test-data/random-20-a.fa.part test-data/random-20-a.part.extract.fa test-data/test-abund-read-2.fa test-data/test-abund-read-2.fa.below test-data/test-abund-read-2.large.oxlicg test-data/test-abund-read-2.large.oxlicg.info test-data/test-abund-read-2.oxlicg test-data/test-abund-read-2.oxlicg.info test-data/test-abund-read-paired.fa tool_dependencies.xml
diffstat 17 files changed, 3004 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/filter-below-abund.py	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,87 @@
+#! /usr/bin/env python
+# This file is part of khmer, https://github.com/dib-lab/khmer/, and is
+# Copyright (C) 2011-2015, Michigan State University.
+# Copyright (C) 2015, The Regents of the University of California.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are
+# met:
+#
+#     * Redistributions of source code must retain the above copyright
+#       notice, this list of conditions and the following disclaimer.
+#
+#     * Redistributions in binary form must reproduce the above
+#       copyright notice, this list of conditions and the following
+#       disclaimer in the documentation and/or other materials provided
+#       with the distribution.
+#
+#     * Neither the name of the Michigan State University nor the names
+#       of its contributors may be used to endorse or promote products
+#       derived from this software without specific prior written
+#       permission.
+#
+# THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
+# "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
+# A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT
+# HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,
+# SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT
+# LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE,
+# DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY
+# THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
+# (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
+# OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+#
+# Contact: khmer-project@idyll.org
+from __future__ import print_function
+import sys
+import os
+import khmer
+from khmer.thread_utils import ThreadedSequenceProcessor, verbose_fasta_iter
+
+WORKER_THREADS = 8
+GROUPSIZE = 100
+
+CUTOFF = 50
+
+###
+
+
+def main():
+    counting_ht = sys.argv[1]
+    infiles = sys.argv[2:]
+
+    print('file with ht: %s' % counting_ht)
+    print('-- settings:')
+    print('N THREADS', WORKER_THREADS)
+    print('--')
+
+    print('making hashtable')
+    ht = khmer.load_countgraph(counting_ht)
+    K = ht.ksize()
+
+    for infile in infiles:
+        print('filtering', infile)
+        outfile = os.path.basename(infile) + '.below'
+
+        outfp = open(outfile, 'w')
+
+        def process_fn(record, ht=ht):
+            name = record['name']
+            seq = record['sequence']
+            if 'N' in seq:
+                return None, None
+
+            trim_seq, trim_at = ht.trim_below_abundance(seq, CUTOFF)
+
+            if trim_at >= K:
+                return name, trim_seq
+
+            return None, None
+
+        tsp = ThreadedSequenceProcessor(process_fn, WORKER_THREADS, GROUPSIZE)
+
+        tsp.start(verbose_fasta_iter(infile), outfp)
+
+if __name__ == '__main__':
+    main()
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,148 @@
+<macros>
+    <token name="@WRAPPER_VERSION@">2.0</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@WRAPPER_VERSION@">khmer</requirement>
+        </requirements>
+    </xml>
+    <xml name="version">
+        <version_command><![CDATA[@BINARY@ --version 2>&1 | tail -n 1 | cut -d ' ' -f 2]]></version_command>
+    </xml>
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" level="fatal" />
+        </stdio>
+    </xml>
+    <token name="@TABLEPARAMS@">
+<![CDATA[
+#if $parameters.type == "simple"
+  --ksize=20
+  --n_tables=4
+  --max-tablesize=$parameters.tablesize
+#else
+  --ksize=$parameters.ksize
+  --n_tables=$parameters.n_tables
+  --max-tablesize="$parameters.tablesize_specific"
+#end if
+]]>
+    </token>
+    <token name="@THREADS@">--threads \${GALAXY_SLOTS:-4}</token>
+    <xml name="tableinputs">
+        <conditional name="parameters">
+            <param name="type" type="select" label="Advanced Parameters"
+                help="ksize, n_tables, a specific tablesize" >
+                <option value="simple" selected="true">Hide</option>
+                <option value="specific">Show</option>
+            </param>
+            <when value="simple">
+                <param name="tablesize" type="select" label="Sample Type" display="radio">
+                    <option value="1e9" selected="true">Microbial Genome</option>
+                    <option value="2e9">Animal Transcriptome</option>
+                    <option value="4e9">Small Animal Genome or Low-Diversity Metagenome</option>
+                    <option value="16e9">Large Animal Genome</option>
+                </param>
+            </when>
+            <when value="specific">
+                <param name="ksize" type="integer" value="20" label="k-mer size" help="k-mer size to use" />
+                <param name="n_tables" type="integer" min="1" value="4" label="n_tables" help="number of tables to use" />
+                <param name="tablesize_specific" type="text" value="1000000.0" 
+                    label="tablesize" help="(--max-tablesize) upper bound on the tablesize to use" />
+            </when>
+        </conditional>
+    </xml>
+    <xml name="input_sequences_filenames">
+        <param  name="inputs" multiple="true" type="data" format="fasta,fastq"
+            label="Sequences in FASTA or FASTQ format"
+            help="Put in order of precedence such as longest reads first." />
+    </xml>
+    <xml name="input_sequence_filename">
+        <param  name="input_sequence_filename" type="data" format="fasta,fastq"
+            label="Sequence in FASTA or FASTQ format" />
+    </xml>
+    <xml name="input_countgraph_filename">
+        <param  name="input_countgraph_filename" type="data" format="oxlicg"
+            label="the k-mer countgraph to query"
+            help="The abundances of the k-mers in the input nucleotide sequence file will be calculated using the kmer counts in this k-mer countgraph." />
+    </xml>
+    <xml name="abundance-histogram-output">
+        <data name="output_histogram_filename" format="txt"
+            label="${tool.name} k-mer abundance histogram. The
+                columns are: (1) k-mer abundance, (2) k-mer count, (3)
+                cumulative count, (4) fraction of total distinct k-mers." />
+    </xml>
+    <xml name="output_sequences">
+        <data name="output" format_source="inputs"
+            label="${tool.name} processed nucleotide sequence file">
+            <discover_datasets pattern="__designation_and_ext__" directory="output" visible="true"/>
+        </data>
+    </xml>
+    <xml name="output_sequences_single">
+        <data name="output" format_source="input_sequence_filename"
+            label="${tool.name} processed nucleotide sequence file" />
+    </xml>
+    <xml name="input_zero">
+        <param name="zero" type="boolean" truevalue="" falsevalue="--no-zero" checked="true"
+            help="Output zero count bins (--no-zero)" />
+    </xml>
+    <xml name="input_bigcount">
+        <param  name="bigcount" type="boolean" truevalue="" falsevalue="--no-bigcount"
+            checked="true" help="Count k-mers past 255 occurences (--no-bigcount)" />
+    </xml>
+    <token name="@HELP_FOOTER@"><![CDATA[
+(from the khmer project: http://khmer.readthedocs.org/en/v@WRAPPER_VERSION@/ )]]></token>
+    <xml name="software-citation">
+        <citation type="bibtex">@article{khmer2015,
+     author = "Crusoe, Michael R. and Alameldin, Hussien F. and Awad, Sherine
+  and Bucher, Elmar and Caldwell, Adam and Cartwright, Reed and Charbonneau,
+  Amanda and Constantinides, Bede and Edvenson, Greg and Fay, Scott and Fenton,
+  Jacob and Fenzl, Thomas and Fish, Jordan and Garcia-Gutierrez, Leonor and
+  Garland, Phillip and Gluck, Jonathan and González, Iván and Guermond, Sarah
+  and Guo, Jiarong and Gupta, Aditi and Herr, Joshua R. and Howe, Adina and
+  Hyer, Alex and Härpfer, Andreas and Irber, Luiz and Kidd, Rhys and Lin, David
+  and Lippi, Justin and Mansour, Tamer and McA'Nulty, Pamela and McDonald, Eric
+  and Mizzi, Jessica and Murray, Kevin D. and Nahum, Joshua R. and Nanlohy,
+  Kaben and Nederbragt, Alexander Johan and Ortiz-Zuazaga, Humberto and Ory,
+  Jeramia and Pell, Jason and Pepe-Ranney, Charles and Russ, Zachary N and
+  Schwarz, Erich and Scott, Camille and Seaman, Josiah and Sievert, Scott and
+  Simpson, Jared and Skennerton, Connor T. and Spencer, James and Srinivasan,
+  Ramakrishnan and Standage, Daniel and Stapleton, James A. and Stein, Joe and
+  Steinman, Susan R and Taylor, Benjamin and Trimble, Will and Wiencko, Heather
+  L. and Wright, Michael and Wyss, Brian and Zhang, Qingpeng and zyme, en and
+  Brown, C. Titus"
+     title = "The khmer software package: enabling efficient nucleotide
+  sequence analysis",
+     year = "2015",
+     month = "08",
+     publisher = "F1000",
+     url = "http://dx.doi.org/10.12688/f1000research.6924.1"
+  }</citation>
+    </xml>
+    <xml name="diginorm-citation">
+        <citation type="bibtex">@unpublished{diginorm,
+    author = "Brown, C Titus and Howe, Adina and Zhang, Qingpeng and Pyrkosz,
+Alexis B and Brom, Timothy H",
+    title = "A Reference-Free Algorithm for Computational Normalization of
+Shotgun Sequencing Data",
+    year = "2012",
+    eprint = "arXiv:1203.4802",
+    url = "http://arxiv.org/abs/1203.4802",
+}</citation></xml>
+    <xml name="graph-citation">
+        <citation type="bibtex">@article{Pell2012,
+  doi = {10.1073/pnas.1121464109},
+  url = {http://dx.doi.org/10.1073/pnas.1121464109},
+  year  = {2012},
+  month = {jul},
+  publisher = {Proceedings of the National Academy of Sciences},
+  volume = {109},
+  number = {33},
+  pages = {13272--13277},
+  author = {J. Pell and A. Hintze and R. Canino-Koning and A. Howe and J. M. Tiedje and C. T. Brown},
+  title = {Scaling metagenome sequence assembly with probabilistic de Bruijn graphs},
+  journal = {Proceedings of the National Academy of Sciences}
+  }</citation>
+    </xml>
+    <xml name="counting-citation">
+        <citation type="doi">10.1371/journal.pone.0101271</citation>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/normalize-by-median.xml	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,139 @@
+<tool id="khmer_normalize_by_median" name="Normalize By Median" version="@WRAPPER_VERSION@.0">
+    <description>Filters a fastq/fasta file using digital normalization via median k-mer abundances</description>
+    <macros>
+        <token name="@BINARY@">normalize-by-median.py</token>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <expand macro="version" />
+    <command><![CDATA[
+set -xu &&
+#for $num, $input in enumerate($inputs)
+    ln -s ${input} sequence-${num} &&
+#end for
+mkdir output &&
+cd output &&
+normalize-by-median.py
+${paired_switch}
+${force_single_switch}
+@TABLEPARAMS@
+--cutoff=${cutoff}
+#if $unpaired_reads_filename
+    --unpaired-reads=${unpaired_reads_filename}
+#end if
+#if $save_countgraph
+    --savegraph=${countgraph}
+#end if
+#if $countgraph_to_load
+    --loadgraph=${countgraph_to_load}
+#end if
+--report=${report}
+../sequence-*
+]]>
+    </command>
+    <inputs>
+        <expand macro="input_sequences_filenames" />
+        <param name="paired_switch" type="boolean" checked="false" truevalue="--paired" falsevalue=""
+            label="Require all sequences be properly paired?"
+            help="(--paired) The tool will fail if given improperly paired reads and this option is selected." />
+        <param name="force_single_switch" type="boolean" checked="false" truevalue="--force_single" falsevalue=""
+            label="Ignore all pairing information?"
+            help="(--paired) By default this tool process reads in a pair-aware manner. This option disables that behavior." />
+        <param name="unpaired_reads_filename" type="data" format="fasta,fastq,fastqsanger,fastqsolexa,fastqillumina" optional="true"
+            label="Extra unpaired reads"
+            help="(--unpaired-reads) If all but one of your sequence files are interleaved paired end reads you can include one unpaired file to be processed last without regard to pairing." />
+        <param name="countgraph_to_load" type="data" format="oxlicg" optional="true"
+            label="Optional k-mer countgraph"
+            help="(--loadgraph) The inputs file(s) will be processed using the kmer counts in the specified k-mer countgraph file as a starting point." />
+        <param name="save_countgraph" type="boolean" label="Save the k-mer countgraph(s) in a file" help="(--savegraph)" />
+        <param name="cutoff" type="integer" min="1" value="20" label="Cutoff" help="(--cutoff)" />
+        <expand macro="tableinputs" />
+    </inputs>
+    <outputs>
+        <data name="countgraph" format="oxlicg" label="${tool.name} k-mer countgraph">
+            <filter>save_countgraph == True</filter>
+        </data>
+        <data name="report" format="txt" label="${tool.name} report" />
+        <collection name="sequences" type="list">
+            <discover_datasets pattern="__name__" directory="output" />
+        </collection>
+    </outputs>
+    <tests>
+        <test>
+            <param name="inputs" value="test-abund-read-2.fa"/>
+            <param name="type" value="specific" />
+            <param name="cutoff" value="1" />
+            <param name="ksize" value="17" />
+            <output name="report" file="normalize-by-median.report.txt" />
+            <output_collection name="sequences" type="list">
+                <element name="sequence-0.keep">
+                    <assert_contents>
+                        <has_text text="GGTTGACGGGGCTCAGGGGG" />
+                    </assert_contents>
+                </element>
+            </output_collection>
+        </test>
+        <test>
+            <param name="inputs" value="test-abund-read-2.fa" />
+            <param name="type" value="specific" />
+            <param name="cutoff" value="2" />
+            <param name="ksize" value="17" />
+            <output name="report" file="normalize-by-median.c2.report.txt" />
+            <output_collection name="sequences" type="list">
+                <element name="sequence-0.keep">
+                    <assert_contents>
+                        <has_text text="GGTTGACGGGGCTCAGGGGG" />
+                        <has_text text="GGTTGACGGGGCTCAGGG" />
+                    </assert_contents>
+                </element>
+            </output_collection>
+        </test>
+        <test>
+            <param name="inputs" value="test-abund-read-paired.fa" />
+            <param name="type" value="specific" />
+            <param name="cutoff" value="1" />
+            <param name="ksize" value="17" />
+            <param name="paired" value="true" />
+            <output name="report" file="normalize-by-median.paired.report.txt" />
+            <output_collection name="sequences" type="list">
+                <element name="sequence-0.keep">
+                    <assert_contents>
+                        <has_text text="GGTTGACGGGGCTCAGGGGG" />
+                        <has_text text="GGTTGACGGGGCTCAGGG" />
+                    </assert_contents>
+                </element>
+            </output_collection>
+        </test>
+    </tests>
+    <help><![CDATA[
+Do digital normalization (remove mostly redundant sequences)
+
+Discard sequences based on whether or not their median k-mer abundance lies
+above a specified cutoff. Kept sequences will be placed in <fileN>.keep.
+
+By default, Paired end reads will be considered together; if either read will
+be kept, then both will be kept. (This keeps both reads from a fragment, and
+helps with retention of repeats.) Unpaired reads are treated individually.
+
+If `--paired` is set then proper pairing is required and the tool will exit on
+unpaired reads, although `--unpaired-reads` can be used to supply a file of
+orphan reads to be read after the paired reads.
+
+`--force_single` will ignore all pairing information and treat reads
+individually.
+
+With `-s`/`--savegraph`, the k-mer countgraph will be saved to the specified
+file after all sequences have been processed. `--loadgraph` will load the
+specified k-mer countgraph before processing the specified files.  Note
+that the countgraph is in same format as those produced by
+`load-into-counting.py` and consumed by `abundance-dist.py`.
+
+@HELP_FOOTER@
+]]>    
+    </help>
+    <citations>
+        <expand macro="software-citation" />
+        <expand macro="diginorm-citation" />
+    </citations>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/normalize-by-median.c2.report.txt	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,2 @@
+total,kept,f_kept
+1001,2,0.001998
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/normalize-by-median.paired.report.txt	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,2 @@
+total,kept,f_kept
+6,2,0.3333
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/normalize-by-median.report.txt	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,2 @@
+total,kept,f_kept
+1001,1,0.000999
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/random-20-a.fa	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,198 @@
+>35
+CGCAGGCTGGATTCTAGAGGCAGAGGTGAGCTATAAGATATTGCATACGTTGAGCCAGC
+>16
+CGGAAGCCCAATGAGTTGTCAGAGTCACCTCCACCCCGGGCCCTGTTAGCTACGTCCGT
+>46
+GGTCGTGTTGGGTTAACAAAGGATCCCTGACTCGATCCAGCTGGGTAGGGTAACTATGT
+>40
+GGCTGAAGGAGCGGGCGTACGTGTTTACGGCATGATGGCCGGTGATTATGGGGGACGGG
+>33
+GCAGCGGCTTTGAATGCCGAATATATAACAGCGACGGGGTTCAATAAGCTGCACATGCG
+>98
+ACCAGATGCATAGCCCAACAGCTGAGACATTCCCAGCTCGCGAACCAAGACGTGAGAGC
+>17
+CCCTGTTAGCTACGTCCGTCTAAGGATATTAACATAGTTGCGACTGCGTCCTGTGCTCA
+>89
+GCGAGATACTAGCAAAGGTTCATCAACAGCTACACCCGACGAACCCCGAGAAATTGGGA
+>30
+GTTATGGTCCAGGATGAATGCGCGTACCGGGCGCCTATCACTCCTCTTGTCATTCAGAA
+>82
+ATGCACTATATTTAAGAGGTCTAGAGTGTAAAAAGTGTACCCTTCGGGGTGGAGCTGTT
+>60
+GTTTTTGTCATCGTGCATAAAGCGGGACAGAGTTCAACGGTATTCGAATGCACACCCTA
+>83
+CCTTCGGGGTGGAGCTGTTAATGAACTCAAGTGGCGATGGAGGCTAAAACGATACGTTG
+>12
+AGCCAATTGTAACCATATGGTATCCAGTTTCCGTAGCAGCAATGCGCGACGGGCAATCG
+>85
+CGTGATATGATTACTAAAGGGGCCCGCAAAAACCCATTCACTGAGGGCTCTGTCCGTAC
+>2
+CCCGTGGGGCGGGCTAATTTTAAAGGCAGGTTGCTACACGTCAACTCTACCCAAGCTCC
+>45
+ATACGCCACTCGACTTGGCTCGCCCTCGATCTAAAATAGCGGTCGTGTTGGGTTAACAA
+>11
+GCAGCAGACCAACATCCAACACTTTTCACAAGAGGCTGACAGCCAATTGTAACCATATG
+>39
+CAATTGACTTCCATGTGGGTCGGCTGTCAAGTCTAAACCGGGCTGAAGGAGCGGGCGTA
+>26
+AACATCTTAACCTCTGATCCCAACATGAGGGACATGAGTTTTCAAAGTAACGATGCGCA
+>75
+GTCGGTGCCCGCGTGCGGAGCAGTCTTGATCCGGCGCGCTCTTACCTATGGTCGGCACG
+>81
+GGCTACTGGTTGATAAGCGTACGTAAAAGGCGAGTCTTACATGCACTATATTTAAGAGG
+>97
+ATTAGTGTGACTAGCCGAGTGCCCCAGCGTTTATCCAATGACCAGATGCATAGCCCAAC
+>13
+AATGCGCGACGGGCAATCGCGTCTGCGTTGATCGTCGCCCCTATTGTCGCTCCCTTAGT
+>92
+ATCAGGGCAAATTTGCTCGTGACTAAATGGTAATACTACCCGGGACAGTAAACTTTTGG
+>56
+AGATCTGCTTGGGTGTATCCCCATTCAGAGATACCAGATCTAAGCGACCATCAGAAACA
+>61
+TATTCGAATGCACACCCTAACATACTGGAAGATTCACTCTATATACCGGGAACTACTAA
+>96
+ATTAGACCGCTATCAACTCTTGCGAGGAAGGTCTGGGCCTATTAGTGTGACTAGCCGAG
+>31
+CTCCTCTTGTCATTCAGAAGGAATTTGATTAATTACCTGGGCTGACTCGCGCCCCCTGC
+>29
+TGGAAGCGCCCTCCGCTCAGGCGTTTTAGTAGATCCCAGTGTTATGGTCCAGGATGAAT
+>54
+TGGATGAGGTCCTTAAGGCCTAATTGACCAATCGCCCCAAGATTGGTGGTGAATGACTC
+>0
+TAGTGATCAGCGGCTAGTGTCGCCCCTCTTAGCACCTTGCGATCATCGAATCGGGCTGT
+>90
+GAACCCCGAGAAATTGGGAAGCCTGGAGGCAGTACAGTCATCCAGTCTGCTGCTCAAAG
+>34
+TCAATAAGCTGCACATGCGTGGTTGTGGCACGATCAGTTCCGCAGGCTGGATTCTAGAG
+>43
+AGGACTCGACGTCCGCCCCATGCTTGAGAGAAGGTTTCGGCCAACCATGGTAGGTTAGG
+>8
+ACACACAAGGCCAGACACCAACTTGGCCGTGGAATTTATCAACACTTCTGAGACGAAGG
+>37
+TGTGCGCTGTGAGATACAACTATAGGCACCGGGTTGCTGGCTAATAACCATTTAGAGTC
+>51
+ACACAATGGACGCGTTAAGGAGAACCGGTCGCAACCAGGTTGAAAATGCCTGATATACG
+>32
+GCTGACTCGCGCCCCCTGCAGGCTGCTATGATTGAGTGCGGCAGCGGCTTTGAATGCCG
+>78
+TCTGGGGCGAGATCCCCTCTGCTCACTTTCTTGTAGTAAATACACCGAAGGGGCGAACC
+>18
+CGACTGCGTCCTGTGCTCAGTTCGTGACGCCGAACTCAAGGACGCGGTACGAAGAACTG
+>36
+TTGCATACGTTGAGCCAGCGCCGCCCGTATACACAGGGTCTGTGCGCTGTGAGATACAA
+>53
+ATATAAGTTTTTTAGATGTAAAAAATTTTTTATGGCGGCCTGGATGAGGTCCTTAAGGC
+>24
+AAGAAACAGGCTAGGTCTTCCATGCAATGGTTCTCACAGTGTAGTCGCGCATCAACTCC
+>7
+AAACGTCTAAGTAATCATGCGACCGGCGCCTCGATTGGACACACACAAGGCCAGACACC
+>9
+AACACTTCTGAGACGAAGGTCATTTACGATTGGGACACTTTCTCGAACTCCGGTTAATT
+>47
+CTGGGTAGGGTAACTATGTAGCCATCGCTCAGTGGATTCTTCCGGGATAGGGTGTGCGA
+>62
+ATATACCGGGAACTACTAAAATTTTGGGCTACTCTATGCTTACAGCCCAACATGCGCAA
+>79
+TACACCGAAGGGGCGAACCCTGTCTACATTCGCAAATGCATCCTACCTGAGAGGCTTCG
+>48
+TCCGGGATAGGGTGTGCGAATGTGCCGGGCATTCAGCTCCTTAGAGACGAGTTACGAGC
+>66
+GGCGCGACCAATATTCATTTGATGAGAATTGAAATCGACTGAATCACGGGATTTATACA
+>25
+GTAGTCGCGCATCAACTCCGCCAGTTTTATCGAAGCGCCCAACATCTTAACCTCTGATC
+>5
+TCATTACGGGGTGTCCATCTAGAGAAAGTGGGTTTCCCTTATAGAAATGAGGAGGATTC
+>72
+ATAAAAAACGACTTCTAAAGCGACACTGGTTTTATCCTTCCCTGTTTTCCTCGCCCCAT
+>76
+CTTACCTATGGTCGGCACGATTCCATTGGCGGATATAGGATTGATTACGTGTGTTTACT
+>69
+GCAGCGAGGTATTTAAACTGTTCAATCGGCGCAACCGAAAATCTGCTACCGTGGTTGCT
+>87
+CAGTATACGCCCGTTGAGAAACAGGTGGTGGCGCAGTGTCGATTACTTCGTAATAATTT
+>27
+TTCAAAGTAACGATGCGCAGATTGAATAATGCCATATCTGCGCGAGAGGTTTCAGGTAC
+>77
+TTGATTACGTGTGTTTACTATACCGGTAGAAGCCTTCAGTTCTGGGGCGAGATCCCCTC
+>95
+TACGTGTGGCATCGTTGCACCCTAATTCGCATTATTAAGTATTAGACCGCTATCAACTC
+>63
+TACAGCCCAACATGCGCAACAACTATAAGCTGCTGCTGACAGATCCGTTTGTTCCGGAC
+>38
+CTAATAACCATTTAGAGTCGCCCGCGGTGATGAGTAATCGCAATTGACTTCCATGTGGG
+>20
+GTGCCTACCGTACCTGTCGAGCCAGTGCGATCAGTAAAACTACCGATTCGTGGCCTCCC
+>88
+GATTACTTCGTAATAATTTGAGGGTGCTGCCGCGTGTTCCGCGAGATACTAGCAAAGGT
+>49
+TTAGAGACGAGTTACGAGCCACTCTTGGATCGTCATGCATACCTCGCAGATCGGCAGAG
+>91
+TCCAGTCTGCTGCTCAAAGTCCATCTACATGTAAAGAACCATCAGGGCAAATTTGCTCG
+>86
+CTGAGGGCTCTGTCCGTACGTGTACTATAGATCCTTGCTCCAGTATACGCCCGTTGAGA
+>42
+CATATTTCAGGCGTGCGCCAACTTACGATTCTTGAATCCAAGGACTCGACGTCCGCCCC
+>70
+ATCTGCTACCGTGGTTGCTTCGACCATGGTAAACTGAGTAAGCCCTTATGAGTTGCGGG
+>19
+GACGCGGTACGAAGAACTGCTCCAGCAACAGCATTCCTTGGTGCCTACCGTACCTGTCG
+>84
+AGGCTAAAACGATACGTTGTATACTAAGAACTGTCTACATCGTGATATGATTACTAAAG
+>52
+TGAAAATGCCTGATATACGAAGATTAAGCGGCTTTGGATCATATAAGTTTTTTAGATGT
+>71
+AGCCCTTATGAGTTGCGGGTCGTGCTGTTAGACTGAACACATAAAAAACGACTTCTAAA
+>93
+CGGGACAGTAAACTTTTGGTGATGCCAGCACGACCAGCGCAGGGTCAAGAAAACTATTA
+>58
+TCGTGGTACACCCGGAGTCTCGAAAGGAGCTTGCAAAGCTTTTCAGCATGGGTCGCATT
+>22
+TTCATTCCCCTGTAACGTTTCGAACTCAACTTGCTTGCCCGACATATGGCGGTACGCGG
+>50
+ACCTCGCAGATCGGCAGAGAACGGTTTGGTCTGTTTGCGTACACAATGGACGCGTTAAG
+>21
+TACCGATTCGTGGCCTCCCGTTCGTCGCAATGAACGGCTTTTCATTCCCCTGTAACGTT
+>73
+CCTGTTTTCCTCGCCCCATGCAATGGTAACTAATATACCGCCCCATAGTCTTAATAACC
+>68
+CTGTCCCAACGGTAACAATGGAGGCACTATACCGACGCTCGCAGCGAGGTATTTAAACT
+>23
+GACATATGGCGGTACGCGGGCTCAGCGCTCCGCCAGTAAGAAGAAACAGGCTAGGTCTT
+>94
+AGGGTCAAGAAAACTATTAATTTAAGCGCTGTTTAGTAACTACGTGTGGCATCGTTGCA
+>10
+TCTCGAACTCCGGTTAATTTGCAATCCGGGGGTTTGCTCAGCAGCAGACCAACATCCAA
+>41
+GGTGATTATGGGGGACGGGTATAGTACTAATAGTTTTGGGCATATTTCAGGCGTGCGCC
+>80
+TCCTACCTGAGAGGCTTCGACTAAAGAATGCGGGTATACTGGCTACTGGTTGATAAGCG
+>64
+AGATCCGTTTGTTCCGGACGGTCGTCGTACCCACCCCTTGTCGATAGGTAAAGGAGTAA
+>57
+TAAGCGACCATCAGAAACACAGCATCAGCTTACCAGCCTTTCGTGGTACACCCGGAGTC
+>1
+GATCATCGAATCGGGCTGTCGCCAAAGGCCGACCAAGGTTCCCGTGGGGCGGGCTAATT
+>55
+GATTGGTGGTGAATGACTCACAAAATGCTCATAGAATATTAGATCTGCTTGGGTGTATC
+>67
+GAATCACGGGATTTATACATCATTTATAGCTAAATTACACCTGTCCCAACGGTAACAAT
+>14
+CTATTGTCGCTCCCTTAGTTGTTGGGCGTAGTCCGCACCTAGAGTCCAACCAGGCCTCG
+>15
+AGAGTCCAACCAGGCCTCGACAATCCTTTGTCCTGTCCCCCGGAAGCCCAATGAGTTGT
+>59
+TTTCAGCATGGGTCGCATTCCTACCTAAGGCTAGGGGCATGTTTTTGTCATCGTGCATA
+>28
+CGCGAGAGGTTTCAGGTACCTATCGGGACAGACTTGTTTCTGGAAGCGCCCTCCGCTCA
+>74
+CCCCATAGTCTTAATAACCGACACCGAGACGCTACATGGCGTCGGTGCCCGCGTGCGGA
+>4
+TGTAACCTGTGTGGGGTCGGTCCTGGGGAAACTTTGGGTTTCATTACGGGGTGTCCATC
+>65
+TCGATAGGTAAAGGAGTAAGCGTCCGACTCCCTCTTACTTGGCGCGACCAATATTCATT
+>6
+ATAGAAATGAGGAGGATTCACAGACACGTCAGTCACCATCAAACGTCTAAGTAATCATG
+>44
+CCAACCATGGTAGGTTAGGAAAGCCGCCAAATAAGTTCTTATACGCCACTCGACTTGGC
+>3
+TCAACTCTACCCAAGCTCCTTGCATCTCGGTACCCCCCCTTGTAACCTGTGTGGGGTCG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/random-20-a.fa.part	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,198 @@
+>35	2
+CGCAGGCTGGATTCTAGAGGCAGAGGTGAGCTATAAGATATTGCATACGTTGAGCCAGC
+>16	2
+CGGAAGCCCAATGAGTTGTCAGAGTCACCTCCACCCCGGGCCCTGTTAGCTACGTCCGT
+>46	2
+GGTCGTGTTGGGTTAACAAAGGATCCCTGACTCGATCCAGCTGGGTAGGGTAACTATGT
+>40	2
+GGCTGAAGGAGCGGGCGTACGTGTTTACGGCATGATGGCCGGTGATTATGGGGGACGGG
+>33	2
+GCAGCGGCTTTGAATGCCGAATATATAACAGCGACGGGGTTCAATAAGCTGCACATGCG
+>98	2
+ACCAGATGCATAGCCCAACAGCTGAGACATTCCCAGCTCGCGAACCAAGACGTGAGAGC
+>17	2
+CCCTGTTAGCTACGTCCGTCTAAGGATATTAACATAGTTGCGACTGCGTCCTGTGCTCA
+>89	2
+GCGAGATACTAGCAAAGGTTCATCAACAGCTACACCCGACGAACCCCGAGAAATTGGGA
+>30	2
+GTTATGGTCCAGGATGAATGCGCGTACCGGGCGCCTATCACTCCTCTTGTCATTCAGAA
+>82	2
+ATGCACTATATTTAAGAGGTCTAGAGTGTAAAAAGTGTACCCTTCGGGGTGGAGCTGTT
+>60	2
+GTTTTTGTCATCGTGCATAAAGCGGGACAGAGTTCAACGGTATTCGAATGCACACCCTA
+>83	2
+CCTTCGGGGTGGAGCTGTTAATGAACTCAAGTGGCGATGGAGGCTAAAACGATACGTTG
+>12	2
+AGCCAATTGTAACCATATGGTATCCAGTTTCCGTAGCAGCAATGCGCGACGGGCAATCG
+>85	2
+CGTGATATGATTACTAAAGGGGCCCGCAAAAACCCATTCACTGAGGGCTCTGTCCGTAC
+>2	2
+CCCGTGGGGCGGGCTAATTTTAAAGGCAGGTTGCTACACGTCAACTCTACCCAAGCTCC
+>45	2
+ATACGCCACTCGACTTGGCTCGCCCTCGATCTAAAATAGCGGTCGTGTTGGGTTAACAA
+>11	2
+GCAGCAGACCAACATCCAACACTTTTCACAAGAGGCTGACAGCCAATTGTAACCATATG
+>39	2
+CAATTGACTTCCATGTGGGTCGGCTGTCAAGTCTAAACCGGGCTGAAGGAGCGGGCGTA
+>26	2
+AACATCTTAACCTCTGATCCCAACATGAGGGACATGAGTTTTCAAAGTAACGATGCGCA
+>75	2
+GTCGGTGCCCGCGTGCGGAGCAGTCTTGATCCGGCGCGCTCTTACCTATGGTCGGCACG
+>81	2
+GGCTACTGGTTGATAAGCGTACGTAAAAGGCGAGTCTTACATGCACTATATTTAAGAGG
+>97	2
+ATTAGTGTGACTAGCCGAGTGCCCCAGCGTTTATCCAATGACCAGATGCATAGCCCAAC
+>13	2
+AATGCGCGACGGGCAATCGCGTCTGCGTTGATCGTCGCCCCTATTGTCGCTCCCTTAGT
+>92	2
+ATCAGGGCAAATTTGCTCGTGACTAAATGGTAATACTACCCGGGACAGTAAACTTTTGG
+>56	2
+AGATCTGCTTGGGTGTATCCCCATTCAGAGATACCAGATCTAAGCGACCATCAGAAACA
+>61	2
+TATTCGAATGCACACCCTAACATACTGGAAGATTCACTCTATATACCGGGAACTACTAA
+>96	2
+ATTAGACCGCTATCAACTCTTGCGAGGAAGGTCTGGGCCTATTAGTGTGACTAGCCGAG
+>31	2
+CTCCTCTTGTCATTCAGAAGGAATTTGATTAATTACCTGGGCTGACTCGCGCCCCCTGC
+>29	2
+TGGAAGCGCCCTCCGCTCAGGCGTTTTAGTAGATCCCAGTGTTATGGTCCAGGATGAAT
+>54	2
+TGGATGAGGTCCTTAAGGCCTAATTGACCAATCGCCCCAAGATTGGTGGTGAATGACTC
+>0	2
+TAGTGATCAGCGGCTAGTGTCGCCCCTCTTAGCACCTTGCGATCATCGAATCGGGCTGT
+>90	2
+GAACCCCGAGAAATTGGGAAGCCTGGAGGCAGTACAGTCATCCAGTCTGCTGCTCAAAG
+>34	2
+TCAATAAGCTGCACATGCGTGGTTGTGGCACGATCAGTTCCGCAGGCTGGATTCTAGAG
+>43	2
+AGGACTCGACGTCCGCCCCATGCTTGAGAGAAGGTTTCGGCCAACCATGGTAGGTTAGG
+>8	2
+ACACACAAGGCCAGACACCAACTTGGCCGTGGAATTTATCAACACTTCTGAGACGAAGG
+>37	2
+TGTGCGCTGTGAGATACAACTATAGGCACCGGGTTGCTGGCTAATAACCATTTAGAGTC
+>51	2
+ACACAATGGACGCGTTAAGGAGAACCGGTCGCAACCAGGTTGAAAATGCCTGATATACG
+>32	2
+GCTGACTCGCGCCCCCTGCAGGCTGCTATGATTGAGTGCGGCAGCGGCTTTGAATGCCG
+>78	2
+TCTGGGGCGAGATCCCCTCTGCTCACTTTCTTGTAGTAAATACACCGAAGGGGCGAACC
+>18	2
+CGACTGCGTCCTGTGCTCAGTTCGTGACGCCGAACTCAAGGACGCGGTACGAAGAACTG
+>36	2
+TTGCATACGTTGAGCCAGCGCCGCCCGTATACACAGGGTCTGTGCGCTGTGAGATACAA
+>53	2
+ATATAAGTTTTTTAGATGTAAAAAATTTTTTATGGCGGCCTGGATGAGGTCCTTAAGGC
+>24	2
+AAGAAACAGGCTAGGTCTTCCATGCAATGGTTCTCACAGTGTAGTCGCGCATCAACTCC
+>7	2
+AAACGTCTAAGTAATCATGCGACCGGCGCCTCGATTGGACACACACAAGGCCAGACACC
+>9	2
+AACACTTCTGAGACGAAGGTCATTTACGATTGGGACACTTTCTCGAACTCCGGTTAATT
+>47	2
+CTGGGTAGGGTAACTATGTAGCCATCGCTCAGTGGATTCTTCCGGGATAGGGTGTGCGA
+>62	2
+ATATACCGGGAACTACTAAAATTTTGGGCTACTCTATGCTTACAGCCCAACATGCGCAA
+>79	2
+TACACCGAAGGGGCGAACCCTGTCTACATTCGCAAATGCATCCTACCTGAGAGGCTTCG
+>48	2
+TCCGGGATAGGGTGTGCGAATGTGCCGGGCATTCAGCTCCTTAGAGACGAGTTACGAGC
+>66	2
+GGCGCGACCAATATTCATTTGATGAGAATTGAAATCGACTGAATCACGGGATTTATACA
+>25	2
+GTAGTCGCGCATCAACTCCGCCAGTTTTATCGAAGCGCCCAACATCTTAACCTCTGATC
+>5	2
+TCATTACGGGGTGTCCATCTAGAGAAAGTGGGTTTCCCTTATAGAAATGAGGAGGATTC
+>72	2
+ATAAAAAACGACTTCTAAAGCGACACTGGTTTTATCCTTCCCTGTTTTCCTCGCCCCAT
+>76	2
+CTTACCTATGGTCGGCACGATTCCATTGGCGGATATAGGATTGATTACGTGTGTTTACT
+>69	2
+GCAGCGAGGTATTTAAACTGTTCAATCGGCGCAACCGAAAATCTGCTACCGTGGTTGCT
+>87	2
+CAGTATACGCCCGTTGAGAAACAGGTGGTGGCGCAGTGTCGATTACTTCGTAATAATTT
+>27	2
+TTCAAAGTAACGATGCGCAGATTGAATAATGCCATATCTGCGCGAGAGGTTTCAGGTAC
+>77	2
+TTGATTACGTGTGTTTACTATACCGGTAGAAGCCTTCAGTTCTGGGGCGAGATCCCCTC
+>95	2
+TACGTGTGGCATCGTTGCACCCTAATTCGCATTATTAAGTATTAGACCGCTATCAACTC
+>63	2
+TACAGCCCAACATGCGCAACAACTATAAGCTGCTGCTGACAGATCCGTTTGTTCCGGAC
+>38	2
+CTAATAACCATTTAGAGTCGCCCGCGGTGATGAGTAATCGCAATTGACTTCCATGTGGG
+>20	2
+GTGCCTACCGTACCTGTCGAGCCAGTGCGATCAGTAAAACTACCGATTCGTGGCCTCCC
+>88	2
+GATTACTTCGTAATAATTTGAGGGTGCTGCCGCGTGTTCCGCGAGATACTAGCAAAGGT
+>49	2
+TTAGAGACGAGTTACGAGCCACTCTTGGATCGTCATGCATACCTCGCAGATCGGCAGAG
+>91	2
+TCCAGTCTGCTGCTCAAAGTCCATCTACATGTAAAGAACCATCAGGGCAAATTTGCTCG
+>86	2
+CTGAGGGCTCTGTCCGTACGTGTACTATAGATCCTTGCTCCAGTATACGCCCGTTGAGA
+>42	2
+CATATTTCAGGCGTGCGCCAACTTACGATTCTTGAATCCAAGGACTCGACGTCCGCCCC
+>70	2
+ATCTGCTACCGTGGTTGCTTCGACCATGGTAAACTGAGTAAGCCCTTATGAGTTGCGGG
+>19	2
+GACGCGGTACGAAGAACTGCTCCAGCAACAGCATTCCTTGGTGCCTACCGTACCTGTCG
+>84	2
+AGGCTAAAACGATACGTTGTATACTAAGAACTGTCTACATCGTGATATGATTACTAAAG
+>52	2
+TGAAAATGCCTGATATACGAAGATTAAGCGGCTTTGGATCATATAAGTTTTTTAGATGT
+>71	2
+AGCCCTTATGAGTTGCGGGTCGTGCTGTTAGACTGAACACATAAAAAACGACTTCTAAA
+>93	2
+CGGGACAGTAAACTTTTGGTGATGCCAGCACGACCAGCGCAGGGTCAAGAAAACTATTA
+>58	2
+TCGTGGTACACCCGGAGTCTCGAAAGGAGCTTGCAAAGCTTTTCAGCATGGGTCGCATT
+>22	2
+TTCATTCCCCTGTAACGTTTCGAACTCAACTTGCTTGCCCGACATATGGCGGTACGCGG
+>50	2
+ACCTCGCAGATCGGCAGAGAACGGTTTGGTCTGTTTGCGTACACAATGGACGCGTTAAG
+>21	2
+TACCGATTCGTGGCCTCCCGTTCGTCGCAATGAACGGCTTTTCATTCCCCTGTAACGTT
+>73	2
+CCTGTTTTCCTCGCCCCATGCAATGGTAACTAATATACCGCCCCATAGTCTTAATAACC
+>68	2
+CTGTCCCAACGGTAACAATGGAGGCACTATACCGACGCTCGCAGCGAGGTATTTAAACT
+>23	2
+GACATATGGCGGTACGCGGGCTCAGCGCTCCGCCAGTAAGAAGAAACAGGCTAGGTCTT
+>94	2
+AGGGTCAAGAAAACTATTAATTTAAGCGCTGTTTAGTAACTACGTGTGGCATCGTTGCA
+>10	2
+TCTCGAACTCCGGTTAATTTGCAATCCGGGGGTTTGCTCAGCAGCAGACCAACATCCAA
+>41	2
+GGTGATTATGGGGGACGGGTATAGTACTAATAGTTTTGGGCATATTTCAGGCGTGCGCC
+>80	2
+TCCTACCTGAGAGGCTTCGACTAAAGAATGCGGGTATACTGGCTACTGGTTGATAAGCG
+>64	2
+AGATCCGTTTGTTCCGGACGGTCGTCGTACCCACCCCTTGTCGATAGGTAAAGGAGTAA
+>57	2
+TAAGCGACCATCAGAAACACAGCATCAGCTTACCAGCCTTTCGTGGTACACCCGGAGTC
+>1	2
+GATCATCGAATCGGGCTGTCGCCAAAGGCCGACCAAGGTTCCCGTGGGGCGGGCTAATT
+>55	2
+GATTGGTGGTGAATGACTCACAAAATGCTCATAGAATATTAGATCTGCTTGGGTGTATC
+>67	2
+GAATCACGGGATTTATACATCATTTATAGCTAAATTACACCTGTCCCAACGGTAACAAT
+>14	2
+CTATTGTCGCTCCCTTAGTTGTTGGGCGTAGTCCGCACCTAGAGTCCAACCAGGCCTCG
+>15	2
+AGAGTCCAACCAGGCCTCGACAATCCTTTGTCCTGTCCCCCGGAAGCCCAATGAGTTGT
+>59	2
+TTTCAGCATGGGTCGCATTCCTACCTAAGGCTAGGGGCATGTTTTTGTCATCGTGCATA
+>28	2
+CGCGAGAGGTTTCAGGTACCTATCGGGACAGACTTGTTTCTGGAAGCGCCCTCCGCTCA
+>74	2
+CCCCATAGTCTTAATAACCGACACCGAGACGCTACATGGCGTCGGTGCCCGCGTGCGGA
+>4	2
+TGTAACCTGTGTGGGGTCGGTCCTGGGGAAACTTTGGGTTTCATTACGGGGTGTCCATC
+>65	2
+TCGATAGGTAAAGGAGTAAGCGTCCGACTCCCTCTTACTTGGCGCGACCAATATTCATT
+>6	2
+ATAGAAATGAGGAGGATTCACAGACACGTCAGTCACCATCAAACGTCTAAGTAATCATG
+>44	2
+CCAACCATGGTAGGTTAGGAAAGCCGCCAAATAAGTTCTTATACGCCACTCGACTTGGC
+>3	2
+TCAACTCTACCCAAGCTCCTTGCATCTCGGTACCCCCCCTTGTAACCTGTGTGGGGTCG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/random-20-a.part.extract.fa	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,198 @@
+>35	2
+CGCAGGCTGGATTCTAGAGGCAGAGGTGAGCTATAAGATATTGCATACGTTGAGCCAGC
+>16	2
+CGGAAGCCCAATGAGTTGTCAGAGTCACCTCCACCCCGGGCCCTGTTAGCTACGTCCGT
+>46	2
+GGTCGTGTTGGGTTAACAAAGGATCCCTGACTCGATCCAGCTGGGTAGGGTAACTATGT
+>40	2
+GGCTGAAGGAGCGGGCGTACGTGTTTACGGCATGATGGCCGGTGATTATGGGGGACGGG
+>33	2
+GCAGCGGCTTTGAATGCCGAATATATAACAGCGACGGGGTTCAATAAGCTGCACATGCG
+>98	2
+ACCAGATGCATAGCCCAACAGCTGAGACATTCCCAGCTCGCGAACCAAGACGTGAGAGC
+>17	2
+CCCTGTTAGCTACGTCCGTCTAAGGATATTAACATAGTTGCGACTGCGTCCTGTGCTCA
+>89	2
+GCGAGATACTAGCAAAGGTTCATCAACAGCTACACCCGACGAACCCCGAGAAATTGGGA
+>30	2
+GTTATGGTCCAGGATGAATGCGCGTACCGGGCGCCTATCACTCCTCTTGTCATTCAGAA
+>82	2
+ATGCACTATATTTAAGAGGTCTAGAGTGTAAAAAGTGTACCCTTCGGGGTGGAGCTGTT
+>60	2
+GTTTTTGTCATCGTGCATAAAGCGGGACAGAGTTCAACGGTATTCGAATGCACACCCTA
+>83	2
+CCTTCGGGGTGGAGCTGTTAATGAACTCAAGTGGCGATGGAGGCTAAAACGATACGTTG
+>12	2
+AGCCAATTGTAACCATATGGTATCCAGTTTCCGTAGCAGCAATGCGCGACGGGCAATCG
+>85	2
+CGTGATATGATTACTAAAGGGGCCCGCAAAAACCCATTCACTGAGGGCTCTGTCCGTAC
+>2	2
+CCCGTGGGGCGGGCTAATTTTAAAGGCAGGTTGCTACACGTCAACTCTACCCAAGCTCC
+>45	2
+ATACGCCACTCGACTTGGCTCGCCCTCGATCTAAAATAGCGGTCGTGTTGGGTTAACAA
+>11	2
+GCAGCAGACCAACATCCAACACTTTTCACAAGAGGCTGACAGCCAATTGTAACCATATG
+>39	2
+CAATTGACTTCCATGTGGGTCGGCTGTCAAGTCTAAACCGGGCTGAAGGAGCGGGCGTA
+>26	2
+AACATCTTAACCTCTGATCCCAACATGAGGGACATGAGTTTTCAAAGTAACGATGCGCA
+>75	2
+GTCGGTGCCCGCGTGCGGAGCAGTCTTGATCCGGCGCGCTCTTACCTATGGTCGGCACG
+>81	2
+GGCTACTGGTTGATAAGCGTACGTAAAAGGCGAGTCTTACATGCACTATATTTAAGAGG
+>97	2
+ATTAGTGTGACTAGCCGAGTGCCCCAGCGTTTATCCAATGACCAGATGCATAGCCCAAC
+>13	2
+AATGCGCGACGGGCAATCGCGTCTGCGTTGATCGTCGCCCCTATTGTCGCTCCCTTAGT
+>92	2
+ATCAGGGCAAATTTGCTCGTGACTAAATGGTAATACTACCCGGGACAGTAAACTTTTGG
+>56	2
+AGATCTGCTTGGGTGTATCCCCATTCAGAGATACCAGATCTAAGCGACCATCAGAAACA
+>61	2
+TATTCGAATGCACACCCTAACATACTGGAAGATTCACTCTATATACCGGGAACTACTAA
+>96	2
+ATTAGACCGCTATCAACTCTTGCGAGGAAGGTCTGGGCCTATTAGTGTGACTAGCCGAG
+>31	2
+CTCCTCTTGTCATTCAGAAGGAATTTGATTAATTACCTGGGCTGACTCGCGCCCCCTGC
+>29	2
+TGGAAGCGCCCTCCGCTCAGGCGTTTTAGTAGATCCCAGTGTTATGGTCCAGGATGAAT
+>54	2
+TGGATGAGGTCCTTAAGGCCTAATTGACCAATCGCCCCAAGATTGGTGGTGAATGACTC
+>0	2
+TAGTGATCAGCGGCTAGTGTCGCCCCTCTTAGCACCTTGCGATCATCGAATCGGGCTGT
+>90	2
+GAACCCCGAGAAATTGGGAAGCCTGGAGGCAGTACAGTCATCCAGTCTGCTGCTCAAAG
+>34	2
+TCAATAAGCTGCACATGCGTGGTTGTGGCACGATCAGTTCCGCAGGCTGGATTCTAGAG
+>43	2
+AGGACTCGACGTCCGCCCCATGCTTGAGAGAAGGTTTCGGCCAACCATGGTAGGTTAGG
+>8	2
+ACACACAAGGCCAGACACCAACTTGGCCGTGGAATTTATCAACACTTCTGAGACGAAGG
+>37	2
+TGTGCGCTGTGAGATACAACTATAGGCACCGGGTTGCTGGCTAATAACCATTTAGAGTC
+>51	2
+ACACAATGGACGCGTTAAGGAGAACCGGTCGCAACCAGGTTGAAAATGCCTGATATACG
+>32	2
+GCTGACTCGCGCCCCCTGCAGGCTGCTATGATTGAGTGCGGCAGCGGCTTTGAATGCCG
+>78	2
+TCTGGGGCGAGATCCCCTCTGCTCACTTTCTTGTAGTAAATACACCGAAGGGGCGAACC
+>18	2
+CGACTGCGTCCTGTGCTCAGTTCGTGACGCCGAACTCAAGGACGCGGTACGAAGAACTG
+>36	2
+TTGCATACGTTGAGCCAGCGCCGCCCGTATACACAGGGTCTGTGCGCTGTGAGATACAA
+>53	2
+ATATAAGTTTTTTAGATGTAAAAAATTTTTTATGGCGGCCTGGATGAGGTCCTTAAGGC
+>24	2
+AAGAAACAGGCTAGGTCTTCCATGCAATGGTTCTCACAGTGTAGTCGCGCATCAACTCC
+>7	2
+AAACGTCTAAGTAATCATGCGACCGGCGCCTCGATTGGACACACACAAGGCCAGACACC
+>9	2
+AACACTTCTGAGACGAAGGTCATTTACGATTGGGACACTTTCTCGAACTCCGGTTAATT
+>47	2
+CTGGGTAGGGTAACTATGTAGCCATCGCTCAGTGGATTCTTCCGGGATAGGGTGTGCGA
+>62	2
+ATATACCGGGAACTACTAAAATTTTGGGCTACTCTATGCTTACAGCCCAACATGCGCAA
+>79	2
+TACACCGAAGGGGCGAACCCTGTCTACATTCGCAAATGCATCCTACCTGAGAGGCTTCG
+>48	2
+TCCGGGATAGGGTGTGCGAATGTGCCGGGCATTCAGCTCCTTAGAGACGAGTTACGAGC
+>66	2
+GGCGCGACCAATATTCATTTGATGAGAATTGAAATCGACTGAATCACGGGATTTATACA
+>25	2
+GTAGTCGCGCATCAACTCCGCCAGTTTTATCGAAGCGCCCAACATCTTAACCTCTGATC
+>5	2
+TCATTACGGGGTGTCCATCTAGAGAAAGTGGGTTTCCCTTATAGAAATGAGGAGGATTC
+>72	2
+ATAAAAAACGACTTCTAAAGCGACACTGGTTTTATCCTTCCCTGTTTTCCTCGCCCCAT
+>76	2
+CTTACCTATGGTCGGCACGATTCCATTGGCGGATATAGGATTGATTACGTGTGTTTACT
+>69	2
+GCAGCGAGGTATTTAAACTGTTCAATCGGCGCAACCGAAAATCTGCTACCGTGGTTGCT
+>87	2
+CAGTATACGCCCGTTGAGAAACAGGTGGTGGCGCAGTGTCGATTACTTCGTAATAATTT
+>27	2
+TTCAAAGTAACGATGCGCAGATTGAATAATGCCATATCTGCGCGAGAGGTTTCAGGTAC
+>77	2
+TTGATTACGTGTGTTTACTATACCGGTAGAAGCCTTCAGTTCTGGGGCGAGATCCCCTC
+>95	2
+TACGTGTGGCATCGTTGCACCCTAATTCGCATTATTAAGTATTAGACCGCTATCAACTC
+>63	2
+TACAGCCCAACATGCGCAACAACTATAAGCTGCTGCTGACAGATCCGTTTGTTCCGGAC
+>38	2
+CTAATAACCATTTAGAGTCGCCCGCGGTGATGAGTAATCGCAATTGACTTCCATGTGGG
+>20	2
+GTGCCTACCGTACCTGTCGAGCCAGTGCGATCAGTAAAACTACCGATTCGTGGCCTCCC
+>88	2
+GATTACTTCGTAATAATTTGAGGGTGCTGCCGCGTGTTCCGCGAGATACTAGCAAAGGT
+>49	2
+TTAGAGACGAGTTACGAGCCACTCTTGGATCGTCATGCATACCTCGCAGATCGGCAGAG
+>91	2
+TCCAGTCTGCTGCTCAAAGTCCATCTACATGTAAAGAACCATCAGGGCAAATTTGCTCG
+>86	2
+CTGAGGGCTCTGTCCGTACGTGTACTATAGATCCTTGCTCCAGTATACGCCCGTTGAGA
+>42	2
+CATATTTCAGGCGTGCGCCAACTTACGATTCTTGAATCCAAGGACTCGACGTCCGCCCC
+>70	2
+ATCTGCTACCGTGGTTGCTTCGACCATGGTAAACTGAGTAAGCCCTTATGAGTTGCGGG
+>19	2
+GACGCGGTACGAAGAACTGCTCCAGCAACAGCATTCCTTGGTGCCTACCGTACCTGTCG
+>84	2
+AGGCTAAAACGATACGTTGTATACTAAGAACTGTCTACATCGTGATATGATTACTAAAG
+>52	2
+TGAAAATGCCTGATATACGAAGATTAAGCGGCTTTGGATCATATAAGTTTTTTAGATGT
+>71	2
+AGCCCTTATGAGTTGCGGGTCGTGCTGTTAGACTGAACACATAAAAAACGACTTCTAAA
+>93	2
+CGGGACAGTAAACTTTTGGTGATGCCAGCACGACCAGCGCAGGGTCAAGAAAACTATTA
+>58	2
+TCGTGGTACACCCGGAGTCTCGAAAGGAGCTTGCAAAGCTTTTCAGCATGGGTCGCATT
+>22	2
+TTCATTCCCCTGTAACGTTTCGAACTCAACTTGCTTGCCCGACATATGGCGGTACGCGG
+>50	2
+ACCTCGCAGATCGGCAGAGAACGGTTTGGTCTGTTTGCGTACACAATGGACGCGTTAAG
+>21	2
+TACCGATTCGTGGCCTCCCGTTCGTCGCAATGAACGGCTTTTCATTCCCCTGTAACGTT
+>73	2
+CCTGTTTTCCTCGCCCCATGCAATGGTAACTAATATACCGCCCCATAGTCTTAATAACC
+>68	2
+CTGTCCCAACGGTAACAATGGAGGCACTATACCGACGCTCGCAGCGAGGTATTTAAACT
+>23	2
+GACATATGGCGGTACGCGGGCTCAGCGCTCCGCCAGTAAGAAGAAACAGGCTAGGTCTT
+>94	2
+AGGGTCAAGAAAACTATTAATTTAAGCGCTGTTTAGTAACTACGTGTGGCATCGTTGCA
+>10	2
+TCTCGAACTCCGGTTAATTTGCAATCCGGGGGTTTGCTCAGCAGCAGACCAACATCCAA
+>41	2
+GGTGATTATGGGGGACGGGTATAGTACTAATAGTTTTGGGCATATTTCAGGCGTGCGCC
+>80	2
+TCCTACCTGAGAGGCTTCGACTAAAGAATGCGGGTATACTGGCTACTGGTTGATAAGCG
+>64	2
+AGATCCGTTTGTTCCGGACGGTCGTCGTACCCACCCCTTGTCGATAGGTAAAGGAGTAA
+>57	2
+TAAGCGACCATCAGAAACACAGCATCAGCTTACCAGCCTTTCGTGGTACACCCGGAGTC
+>1	2
+GATCATCGAATCGGGCTGTCGCCAAAGGCCGACCAAGGTTCCCGTGGGGCGGGCTAATT
+>55	2
+GATTGGTGGTGAATGACTCACAAAATGCTCATAGAATATTAGATCTGCTTGGGTGTATC
+>67	2
+GAATCACGGGATTTATACATCATTTATAGCTAAATTACACCTGTCCCAACGGTAACAAT
+>14	2
+CTATTGTCGCTCCCTTAGTTGTTGGGCGTAGTCCGCACCTAGAGTCCAACCAGGCCTCG
+>15	2
+AGAGTCCAACCAGGCCTCGACAATCCTTTGTCCTGTCCCCCGGAAGCCCAATGAGTTGT
+>59	2
+TTTCAGCATGGGTCGCATTCCTACCTAAGGCTAGGGGCATGTTTTTGTCATCGTGCATA
+>28	2
+CGCGAGAGGTTTCAGGTACCTATCGGGACAGACTTGTTTCTGGAAGCGCCCTCCGCTCA
+>74	2
+CCCCATAGTCTTAATAACCGACACCGAGACGCTACATGGCGTCGGTGCCCGCGTGCGGA
+>4	2
+TGTAACCTGTGTGGGGTCGGTCCTGGGGAAACTTTGGGTTTCATTACGGGGTGTCCATC
+>65	2
+TCGATAGGTAAAGGAGTAAGCGTCCGACTCCCTCTTACTTGGCGCGACCAATATTCATT
+>6	2
+ATAGAAATGAGGAGGATTCACAGACACGTCAGTCACCATCAAACGTCTAAGTAATCATG
+>44	2
+CCAACCATGGTAGGTTAGGAAAGCCGCCAAATAAGTTCTTATACGCCACTCGACTTGGC
+>3	2
+TCAACTCTACCCAAGCTCCTTGCATCTCGGTACCCCCCCTTGTAACCTGTGTGGGGTCG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-abund-read-2.fa	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,2002 @@
+>895:1:37:17593:9954/1
+GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGATTTCCGGGGCGGAGGCCGCAGACGCGAGTGGTGGAGGGAGAAGGCCTGACG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
+>seq
+GGTTGACGGGGCTCAGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-abund-read-2.fa.below	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,2 @@
+>895:1:37:17593:9954/1
+GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGATTTCCGGGGCGGAGGCCGCAGACGCGAGTGGTGGAGGGAGAAGGCCTGACG
Binary file test-data/test-abund-read-2.large.oxlicg has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-abund-read-2.large.oxlicg.info	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,4 @@
+through test-abund-read-2.fa
+Total number of unique k-mers: 83
+fp rate estimated to be 0.000
+
Binary file test-data/test-abund-read-2.oxlicg has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-abund-read-2.oxlicg.info	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,4 @@
+through /home/mcrusoe/khmer/tests/test-data/test-abund-read-2.fa
+Total number of unique k-mers: 98
+fp rate estimated to be 0.000
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-abund-read-paired.fa	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,12 @@
+>895:1:37:17593:9954/1
+GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGATTTCCGGGGCGGAGGCCGCAGACGCGAGTGGTGGAGGGAGAAGGCCTGACG
+>895:1:37:17593:9954/2
+GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGATTTCCGGGGCGGAGGCCGCAGACGCGAGTGGTGGAGGGAGAAGGCCTGACG
+>895:1:37:17593:9954 1::FOO
+GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGATTTCCGGGGCGGAGGCCGCAGACGCGAGTGGTGGAGGGAGAAGGCCTGACG
+>895:1:37:17593:9954 2::FOO
+GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGATTTCCGGGGCGGAGGCCGCAGACGCGAGTGGTGGAGGGAGAAGGCCTGACG
+>895:1:37:17593:9954/1
+GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGATTTCCGGGGCGGAGGCCGCAGACGCGAGTGGTGGAGGGAGAAGGCCTGACG
+>895:1:37:17593:9954/2
+GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGATTTCCGGGGCGGAGGCCGCAGACGCGAGTGGTGGAGGGAGAAGGCCTGACG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Wed Nov 11 09:46:18 2015 -0500
@@ -0,0 +1,6 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="khmer" version="2.0">
+        <repository changeset_revision="f257b2dba774" name="package_khmer_2_0" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
+    </package>
+</tool_dependency>
&a5:"o^JX"q Ly˒:JMx>ڊaؔ Neg9,^/ynmK.uֲdL'u$8! xĞB)17v>mDՌLk) s|Ջ8ѬG4Zc-8"Fk8+HF/><郓: #?t!rP|)hωr֠=]=g0ZV ,mCեjo灧 5P=m䣶qƐ.nT@IƽJβ\P8' d44 4>;Ea@QdϩhδǛcgV56: /.9sm6TdҀ^+*)cI:o|#gbO0 $cSԪ$La!ɨ\9v ))ȋUSov{@V4y[Rnњb0,IO%{p=pǕgYb@^4^V8c] OZ4&Im)_ד7& pӿX)lXu!ΐj &͓CƢ\٢ mΎ9iVTK`ŭKw.tA7窷v;=el.`dE޽5iFpM5Ϊ"u>wQ*L7} z'$!Ʈjvk֥֪ܕ!ZVSd!d)rb#jGYsKHKҤfKZ1!q| gɯ>VO]JP9m:4;UiQz)r6O.cy<496Q0a5>b9~):oyMtblEyk:ׅ^U $lɛbBcټ^lDhŲ60uMCCK+G3b(zKta6`s mL '+9hh{\1wM~n֠P"XylIzc0Q5 }nxFÊy+_HOma34Zj &ܶ6XYeјUf,b0WjB6St8fIҺN֢2#銄lr%[Jݬ'h3 1#n:CѯËM&OO$VfǼl*4B$gKזj .hg{=_w"W’e!4J xO>jn<׺^$覰и\Va7*" 3}:QTYhCݢUd+V"P>hi:l>%`hbp.`l٦P:,3ȩ2)#K==JX!/1y鑍ΰmR3,ٟ"ךѾZ؝cAUT&C/A =8r2ABjk D8b:g[8夷<y[s $̶6~\p:Q aVɔmg-yц1He}"]9R*NuZW]  ||{RhMnNaq= 4SʌR =#X^Q ˌ]AܻR%ztڼgL-, "U|b94h$)#}Ud˶t# 3 Z0--a[42|z}5PT- vC)8u>ڪC>rSqϔUֵ5>cW0g@խ:Mz &m|mUoH/f&Ll@ M`VkBQ,FjͫZ*p0#KkeH,q>u8x~Je|8=cUVDM Z/&V蕇,<;!fhf~yUVUS PgǙ1S!ᑽz'VE,[\VGap O^cER Wѡ'&F֚kIת }弘E =e^uEiL2`{=V %qy||+ /]lԖmrTg(T[1c="UgGjJ2XP57tՏtgx YoFң;edvWMl~o6ֵ Q%d~XN 7z.0zF83-E4eB΍ƆV":$_5 p}}B\کLRUٌ9F7`@Eq-,"_]4V<\/1M(={0H#5䈄e=T@ k>M(<-A]’j=j z $Ӭ 8XklHl NUiА (xyib3d\.'pBu/8W hFK|1Gh!QJG%=iD3wX^$Zi) _O=۪S޷WCC0zMOu+j8D>Wf(2]?5ۇY` 0LD4^=!0pN&L4l\yUCJ^WL}7!A!ˬ ͑2Z%"8 ]z\cɮ9-c`͟YujO>5ZŻ͖vq` nܫiPQu.:|~dOD*Rʙ]6'cxYIsv(FSՊ1l jͩ }d@IJG,cVIYАN_]hX1XqZq˫\%YH-h?mJ!K`#w3y<90Vưf8#HJmHBk#Wi0*Gx^oS2уSK$ T[2/PVmr yAi՜>6-96#ka<K Y։pɯ#Ʒqg6[n"T9Mj4yDy(GPmӉb 1ŀ^1t^t:ExBuilE3 K$lCƖOXYmL_:Fg[>fh4PXFX-sa7{k':}SY?<a~b0߶&a7Q5eʘl q| gSDḙAT{z?4F! ()/g~nxd2c@qRMWoIO9<^|)u.HC\sUzKN+jvClD_e-`Z@9S_@=h |@6IN1:xfmRaŭbH&JJYFQ1Z[WLJ0۬t/t)IO:O3 5iP6ê.z0, 0IXh8m}bq`;\k3©{:^7u՟!fָtդbVV%֝fCiGs'hua5=gdz 'cDpg̾WT˗Pw͕ͬ/1 :Y"s56؃@i`}351iTcʰ UBcgNxkUt n1Fr49k+*e\H͜pǢ_2-i XΠ9 679R(h̚FZ֜s:QzZFҰ`=fShΤg`D[FJLd& li)IhP3KcmσKY162gw*'`pC!,:SwzD+S c<ҙJgG9ʰR2Fo U9؜Q`5%Xhو 1 حGśy c=TGؾ2 g'kf't;)+$X3-3 Eix(N g^a>;,c@lrqx5j<%P&dpk5EՕ" c[U:}ʖGI>:hSW1:]XG}ut:L:tRdvS D)p'>qL)FLC::Ѯ0l鰳zU#kWl^V VX%wqe$4hL2iFt.>1R i0Re|HuU\'j돬f`[3 =<NJ2+94ⲼAwTx-b@0>` o3rF WL /DY w`W):)Rè3XaXg+߇*h-kV׷b%a GՌj0&TLQ JתSM#JHlLnY%?͑~cLk1. M`8>ڑÈL*[e(zkwҰpf^2"ij@#U3 +{o׽& q4 ,(HkhyIq8|Y`뮟߰1hEX_/ *])cF،BrBZ`LF2Ŏ9ũ(T1kI7%?w(W1=v4UX1`)d-|9TUɡ{NqdϣMըi-% ׮+yfRΣjO[.zҺs^7j0{k c Misx6k Sb5dӝkg"{qCO.F hקXhDē6cb5KbcopS(c1gϴ{Pzx<Z7^,_O3aͪaѿ}{pᡉ7d͓ iϒH3v{'ѡՓ,!IϜFFu 9%G9ie,[jb'hd7O "X29m:ӭX"X񙰰C啨},jĉEsRwf➽J $ br77yqYa.Z* !J$J`%-RaČQ!e?6_nCF1{Q+(ldilnwk=N#'k3F('7ַܑk+ǭ]+M^ MPx3 Ӝ'?nՄqbq?z/Fњp}/ZEVee2'Xz%` @ g <27pCdɋ8QX :W) Sˮ~Rn+yݳcRO[mi¨-U zDφ({@Ϭ`>+;?xK5Rmb0J/BdW{'aT%̠LSi?OٽGYrv_;#ݛ2%y$…Bnn2W޼5aM<B1O|42[s4Icώ]rJgOW,Fljբ0H f6D̂ʹ8M3έS5Ib hև>Lgj]+N-70${dG˙mVb 3dA¶5KX('][cs6*a!4jj`UDes%beyd48KFc氍 #k1bX$,#]-BMr =]Nصep#r婫Xg=rM=Qs5. #>#c:dDZi 2v lzT1[X():٨LR(dlc9ZasTߨ9X̌"N*s]'uwJ^,9V \O+rFj O0[Xfem'jF/#eTC8]1=Ϝ t/SbBZRHXOfE>ʻKl`d][tB|.Y$V[>EτZRF~D23 ьbY\-ip{N6gPj6I2|rn7zDgf1dM+eT7Xڽadv7P1x ˻K6S-㟵˘6^B@Gf@;OQpxfoƪ(?f xlOF 3fݢ؏6 8/Z,uԱ;&H uѾ y$oζl9ӅM= $ЮM9XlZMx%pd98ӨQB84_(y^udrB+)LJL:JLeAJŒYؕhȬyϻ , f|~^Vӏw#K}8/"<⩙rA0.|d!(58Kť0+ ֭dcU$Ĥd 0!*•%7K }iԌm;89Riˮz܏jZDCH q솖Un,sI >$&ɝiLb0bɀAвeS1hq:md/Iy s_78DQE2р']6N\iY)b,KJIM{PJL<"/4+Rɑrju zAl|ҘYf%g 1 /ަLC))m^ag0lՍ|7 )X1|utz3lqCl'ntpWpb3Uȸ}E=Av$1قTNx`Րrjk o\#QW\N^g.\%qq-EF³=x!)2o]=(|DV|-UCMkdux$ aT@`A>ƏY$yM]7Tʶ3`Mw6H3UFɴG0HBg(ƸӡyAFiVUz3]t9vl^@S`S> ":ϕ=*輙R `֫b\CFԞFflexsuy#XBj~%"븆LG>`fO /:{B{FE 3筓t2l̯6XVt@7̕LhHx-YZ7\GaS -^2/%UƧQrLf/t:#t6 RjIFpëU4ɤ`5 fZ\z1}9LͲ᤟b+К GE62&C'ζz$ڬx P37(f3[n/cf@]M 3sS/;y҈WF~XƖQ"@.kl颽yby]sptxǫZHe {X\lY6rb,ܘ {ܽr`njz=ՠS띿6d#qbGWQ!^O,rA,5RRh>Oie) %֣?{V$GH&>b/3D2C>BFeưWf^5뚜6k38Ԑaɨ۞XQwJ2[`MjFЬB?/t!rk~3W59":XptQFD X˝ZQB8hinLV5x8 FgVԡYܨrAM:ܰeg;9FI~ALSV5q[˾Й{6aL+̉l(Xzm)b챘{v5>Zp8iiŌw_LwZS*:Qh4> F,%jџJજcc؋Gc,"]zU3z!c//:R0JםU['&;B$#\vF`0dD^wchm96K|;@QIsF&b5jZvV{M*f,lc2*mDs_A I,=n9 [ajjrKAH=J#?sQ$1k’>gB|XhgՄ3ЃI/W奜.Z'~p`挳WlJ?ԯꏱffvIQ}Hz ~sN;vڞ}f^v1ME[IԎ*8q2L7pɌ~\fҼ,m&M*3aO1<\`Q5yƛXD}JV2^ $-^|=(3\ tR&U|p8jSKVs-N͆$UE5sԦ6{rqO=EHTh"۵lp_^i)݆.%t#b/ۏXMkYHH-}a2j׶e`f~>ܟYTuN\^䀤qeie& hBOM:=WL8aZh26Dk[]W=58͡E fwyVşV|XK`YFkÜbEayr¿[%}ag L;*"_wJb:O*š2T{٣WL&I|us wIVׄcc"֧R(x 0CFWgaW7bS`ԶBXAEa7fFJy<f>,=0~%` QMaUE oަÎ#fF+uF^(! pc 1p94<$:M,\IkJU% :'WJKAAiqmx8!l@"lKMd)Xx`{\b CDy2D",-dZ+VŊ=rV m"Vs<%{kY&p9(":CdhЮ(R b,-Q y|a%0iPeQ]/\|w'MymNfwoJs6Wv/TU ֫#cj^Je̅f5Rr+=+ZqhK9M75QCFF'Cdè4UDLe&7У/ 턔#Y1 mQ2Y'8Y` fw|X❛HMjT𴒿 ,٬b- 8t.8HUH.pg۳b>4zjXy7P` 3/9b7&2Ώ)[`f&PZ CRhrbcC1y< hQ)Ƈ},Y?^?}DMkUcI5 h¦4atE[ GOʏa_7|bqV.=3Rēc˃f1iMS-T=kvDH{zulm]B6Z_g}S/JVJNZv-`63.z-*&6sYX`Ɇw}c ̸3^Z:;$q36L=SFP]P`}d#hyH0ĕ^jinzF"XשUg:gӾ.qVjëAЏ# 79{WV.E!Y@9j.#AN>>9Q:c}wcu a&BZJ56q4 onwbYlc9BzB[E/XpԾʁ4AϜ]/Ǽ u[ZӨLEβSs}d K9|ŭkOu=g_gˋݢl2&kwP^!d1c>ehjv4Z6\ Gō#*[ƹ*-,"4IshbtXDKs) u.#J 061b6t#PFo!c*ՓH~Ii [fCXD bO^)eX3;2+Lj1Q򸢼h&U7!J}ꍶPZ7Zw|ns?X2z [nx[0ZaK`}Z#'I;9*5@+a Ru^ qXZB| [iq؟)kdS(Qi.JЌ5O[5 8s[=1R ֳ^sh_X[Ql6f@j]!&* a)*L&bФ5{R*^VKNqխ0`ќ$ RGwk!1HKlfxۼu8UjrzL98OpLhri>5BpZiv";mnM)HU{vkSwtQ L3XW9̗psDgP"fY2cc mҰerARVlWU-i%&8aozOn ,q<&:2N8*Z)nÈF-{ZعUf2Ր?=ݑ="*o8X6Mޅ-> 8qwsilx*хlHU76m9p7v@I[^N <>J%nX4kfTcuRIK}GD#`b2gMՉo0Ë7H]P._2U5]jedqd>yHOVoy%`fBzm\0*u'%2uch`Wn۹ɕ1Z] &P ĦYI .uMk.FZywm;)sSZly+4.w㞌i,"/c1H& v zAɅV]輆V=HƆxQiܛ5ǂ4UdCl3]Da[vEt q)0=+c#>ȆLNDԨޣ2 VҪ6qgDLҒ?n55RQsz%æŚ Ag= {])hCA&Kb%ZL ﺹү&W^ S-YЩWUhFa3P!0GTw wSƬ0y\$yd؅6 { &_=FTuit>3PYcQbpExl}۸BDq(Z> I}1+fQ7[ VU78N>D"^󦛼K!)"Jൎ=^]\A, Grw>qaeuetgwQ4Q>3qjR1Ƥ )Uk뎋~.8|Xe&Rg{)(9|c=ҋPiU<唏Ҝa >%ꐋ2ZTv"i5.\v|G18&eЯ ~]dNA9(kU .ljwq7"g(Y ]Ö˫8sH}v14}6bI^pޘsǻ;#5J}8J Y I=J%+_áp=yٜXƒ9 wn}84gXǓRSV`űCdϨŽv׽B+]03D^njw] =*^0$ V6R%$U> :I-lnwe=ɋnȅgm\A!!ވE?H(|v"4@`Z*K>Ȭ22ֺJ & Vɤ5eqY(3u#,Mke>1J:p -^V!{81Lx!$m ǻDNJe{Z Rԕ-cnMB2QZ*i5 !Xεxj@h&{sʂ8t$ }y4B={GxۢS;sKhR\l /g FąW.:l6)k#.5/]gP Dm&v4*YFq8m R,3*l\x*W=ADmhD%.,cH3e3.]\='gJy`]x3mC!>=_E!cYP"PDH1R65mQQᮝBǭZ:3gi"aMmg80ҩgyOC֑5BИ}<ioZet6E6C&i,$[XAg!Vu2 f{ˉ=4τ Z0Y +$bu-Fr@1Q Xƿf|H-%ԄI_\v_I+s8IF4:yDCїaIe)|PXIp:$իN5#;@^ ŗИ늕ZmNVJαYqx<3CܝV=xFl`])1&ӑ=K(fwYh80Z[V'AOFΫ&6bqAPkYb 0ռW;^RYQxFzk?49~҈+oJ0xbeWOȁ5cF,ZO8Wӿv͠$ylH~n]׭εj׃:E0>t3{㧴މù]jә7 cŗvZzMԹBC%2y*ldM8! =M<[B [ͤ}\v']dC95)MR3IEd՜L=XB5"!T *Ӊ1f6pXPi΀ld{tV8߻ԛhҵҁhAbN_޸uaL@ycGZ(3jM̸ K@0a43Xt扌 S֙T4"8AM$΍ buF&ΗZ{'n` pPHvu:G+wxHPkZnᄄXAXQ1ZU>?nG&ڳHN=gIkZֱ D51`6':hA$E`ƚѰ=aWB4Rmc_ Qߺ_&&dS״z,mn8'@˻YL$l]jPYY q &q4%&&#קWBB3۝ہxTv5B)NDR9!_ 8Ղ5YMW+QCaa@~qSQ)64<[!ƆEI(s_0Iʡ2-x2lS"{_Jv -A!D%CΤb엥9SΤ!.a>Y[yua (b3YWtO1mh$"XNU#= Өy'Y@Rea C+A$QDG/ViXt]hCihH t{>oVgdE#T2a]Ztv6&bMVA ͉>n%..T}5szN*a~5o$yvaLCؼ$p aDȉ2ފ*jg#FsK>t^Z0V sv\ s(̢j_9+~}GWa"1gNrՃZ|7,ĴpLP#ޤFGk,ghR"/m+F 1aPf\4e, bGa>2hGLZTOoހ]Sfrgswi:(M2f(s6%l#(bGc1Y1QM ^KiztPn,-6J+rVy.{4nN5q ex F)~HViE0X\$X_]ry D]Ze X}FoDFكiA`΍9FV5cG܂[Sb=Z 4rхIeMH(BBuL*a *YAU#X |t|ؕꢕST"6 8'em!RO9t*Vٹ+P`wxDN -ŵqj8Oy/)FRXW.> .V=$z25CG)a0$ud mZ_RE[/vQQ 0(Yq&B錹6EThY׈՝jL49^p6^5ѫ&nꄛDjB#T9=VlRFEyuĢMfwjujRlK&z+8 f̙VֱFWۀ\OͮKYB[LY$F4hjͬS%o'C>vԌ$ 5B#,+`tiqTւq]<2֍*Z`E^+!\FniDkK- b{x=^JZW[d02sYZ%\:61~cI`ܭɒt$Zօ[dL(I!\sv`ɦ d~oAc-{OJ#l1v^$S*k;t +H >ׅ}%8udu4Pmdi~.T`#)3;Դu؀i H׍`I>th͉ΌYI`O)A-] l3м, `pR($8KڛҌ%:!1ϵ:*Di̲׭KȌ7OgN ƢĢ溆@F3Fݢ1kIn(zU!HؗW6{diI=s,8) YPyV9 UTJ[*P#B.JDaC[E=Oj7Ա:lĎA΂AVB0EV_Zͅ8 UB"yiUN7Z|nFDm>,ٳ)[4t[D:u8xqO+X. 61Z Z5_]t Mb:X $#$ZD'Vcөꀖ-(X0sȖw;%hՌ&O ley 0wq`MNr+u;^,wVi¡ z1P:'>Tͪwկc evmA:Xclj *LӆFif1/3b!lUh'eI=] ZTɌf#-]rfԳ KtE DO UvT1A 6"SYueB5':AdKF'jTm y)vQ/A63ַ`+K, g"gY.V+t-gxi,o i<"^lgÖ WO;2f)n t,G(\KF Ʃt0JVX!/lIKP(TRQp0!3΋O@QX&+a~o oN-~hGYY^IRUzIS:h"$~/>HCs2j#n|*0- XHljY.Š0e}.nd#ŻlD82=Nfg^HZddžH l[2sdCS՞:y}QV*"{l>X!mv-gq1YVxӯv3Fs jKv,i2UNLv/.d\GMu҆vB*'˝0YQڲ4ϩ p10Mi$۠K8.ɬBLdF=rpO]/ # ]JQIWjE{m])a*E7TOhRt(#9 ({#3+!dR*L'/7"6P;H9pQ&ќ]bv5ze?eM_&G(U6ɨ#Rw*/fb5vrOf)0Wq7cG,.F\՜լ%8G5KdZ L+ͩM'$p+jژsR3 oH0G<ؚ'$Y6nfatw|O>qr&n[XF }j 3oXw".,=|֔bX-eCK'_X]V>% g+._WeaӒ3QуB2cnPvOuӐE-! |)Ɍݞd5,u7@a]1j- 4<+ AݼG_^wM0ưͩvl1rgn/X a'ShXޣ+CL}}dRNT4)޾ɑ-MeZI.ԥ7$\+o҆l#!FlY "4x/oVr)+&*ڌRԹy^{DVJEg:U3;B@@i<)յVN\nL͓/ ׀.SY[vᴀlp7N$D f{j'b琅քSt!bWcy=_ )9|jbz˝2FhiWM3,db hcR@ 0Y<  2>h1ؙqDVT>{q"-GG7/sgv5!ItQ'D x#Ryk1k(:>(XAlm`?O!6pfSεϑǑI.*˵BFcHNIc8KvnT[͘|IL@6 q?6ɢ1}wӍ٠BfF T=ʙg[/ L$iaΙhIvxƾ'$c;d`b`C2C}ɗxs (F'$89y$'M:JVϜLH̸^[y?axbb5ǭobU'XSvヒ`+=8:f֣=NjfV5HcKhsg.{e*G ').0u,"<{R{34x)xE$u ^pc)IɏC~'x2|֥X°E;:`6VzMM'_S%e0"J]$ŝ UCXp?UѤDC8 [!!gYJca`U8XLG9uN/ZJ|'G=G$uQSB.%&ilgVCκk)xA56,bGu3t3z*\2g2ƠA\#5\bEɒZ̞+Z ՖɌxI'I,TM=-eojEy<}JC )- ga!cG,Jo12 jX& v5 Ҧ{7;^fC3z>DΌhmZ2|\]y\yAZL%63fpN{1 J I*5M+zwa?Wo-YꎵWUui='c/-p_dR?''h$s0]iAd]VpΤDUyVUZsb6ZxY/爯婯$p"'ݸƫO44^L %Bր)Pܛy{4|@z"_q-y˫V{QF!zy^"~FKi곗aGC:0p!,Ul@X!b-lG] eMvCi 87NULe q^pyxPG4aHLTgI"з @tI^? TV$:ǹƄ4g.k*y2ˊIJ O.\RM^$̔ǞSubP*p`+sѴlbf$MRV>yꑋ~P(!mS1S"2ի8*%R(p 5'&ǹMJ`SD0c\iC!sjngnȏBdĬ;vuuy$DR UT;PCaڻ?hƆ-PYkhYToN Dĕ*ǽ8  -Z׈D!X^ s}Cg=\h &yROy_ȶ*SEJWSPTDG 3wE@Ĩe\k-:撖 .#Fk3$ ʡ%D)mo[ Bfvq]jFH_Re(4dlO=Lf]4.;25>QM*t2(EQ d± gETJsJy=B ^&,5m&91v7mʬ26u`g@N3O=Rfk(5 3ͧPӫ&i3xm[%' rX! !"!|ʮ9ד59k^4&ELc=\QhjI{EəMٳqjz|m'^JϞ5Ul2XG5;:w;E6Q V+l`8 &z ѰN|J1j>;s?XlKգ`ÇjzH~9hQó{ y. 'Rfhq|B܃6ۍW.C(KHi(Fi05̶m^EB>fnӃ !>8̅hF<kRzshm+TKaNuuEcVLg+3Β^Zr.!4,t q:15Gv2K;\YєQu!<by+2U|{A3{ u>('SY%a}KMwI0ͣqtE ],i&Y9XE"R#u&<*N1׺t<ƇG9(`@QlY4r{gú wGt2k` i;)X,,yad0Ͷ]waG V=_c0 -,SE3R"AD\cjHDelfʄ~Py-a![Rz/[˜4Sa)0gD[Ɉ8@@CFEgXA8 a_FB xh G#iySrW=}xU.p4/z :zFܖi"%[R@!j\fc&QDrn݃HFT%0Lmy.H#2lCы6d `ұ Ś C‹L;w{(R&X H~RiXAG쫴zL[ йv' r8PmE=-ӦȹFPj s>+ք{.v &I0Ϛe!0_iA(EݙL n3@SΑN?4&uWg|u咞5`Gf^ƶA/]i.)-b.s"u-ч82am[Qzvn_z4ִ1n $`pkѱP^O8OBe:>uqrM3OKaay-U7^a7͡18R夸N8{Bɛa:D0Dx N @N߹8ԌM7 (2xa݊ /޻,s VCUGVCWN߈s'פ +Zg `* 8Qx0y[+h7yՙu)0#3#Y!&K' *z9\y!XHwTڍ:w.hLF3 Ry:b0쩐b|3dLBCff {cݚ]d$OHdR1l5%BfM(!zInhw3UZv#G=ۦcQg㶌a[dƃ *"cC\b3^m-vL53jiB =hg*ʘ&irH n"jߍ+"dUj@L`ڒ0V&qh! :kh3o+{:'4_]y^T졃FE`hoړc}!j4 -$gn.:|vh]::39t#ZFBKi\^ b|,3SôF0gtɮ5)akћ g%ij:NWG|5F6W&UWO_eeE K UnIMm4 *. .lqU%VM8o?Dgc2%a[[2TXzk[/9|g@JR>|2}L qۓ:)"`:֢Q^Bm {L6'=m@kz6-PVNu yEtUMԩf!c^pJ"#1ؓ5Z!t5 K"X+AxĠޛT4iTky&]aLvBwۋi \ q5.sY=7xffhr8ֱ9d>0!ޔ| jA=Qo|D4慴Zbk*iSՍqH"H={H9lx==P"ɣf&zV=PZ.[j -x<]wD&>VM8e+V^ٔE 砱.VV*֧5^4BXS-(kmj(dd…58,׀)"˗U *䘕xa,Ǒ, ,bmۢf- n^?cӄgg?u!GCt:%xa0F7Q!re/R[>&С9)M5ϡ9nͣ5W,ŭ-/xaє/Z53t{ A[]*V]Ҿ& 1>-^-L|>se{)z'PfK{QBc"Tx=VcX%)c/Vfw>v0¼*q׺|aVp m'w,m>&~aoǛ!xMd_8ɇ=,KX6vU i~D`9$Lh"0zOGfHCZ,>B{ Ş,"Ԉu(hywH>heDe޲h2G֬0,iZsnܖO'7;#MY ` yŀHmej>%P1sJtv&F|FjJ:k!XGʖ;G5/G 9adH:gJqƅ-Wb}hKe4Z#+#CBg5BxBajj˜75WvcsRL) m2Cp)j_Ǹ2N 8msDiRil!a=!5T:p@@TNf O)& {%O1cLM2Rũqb5ktw&-j!05f`IV=6 RsʥP|Gdwit8ksTzaLu>oPm&`IKu=_Ə<4kN(yLB.'l_<_ɝNv|ns!hǩ=M{XX>+k׶2qyakA-)^_Flތ`#JgX I o'>si4ِ &j :H9Ō봯:E|c ȗV'JI1b+zXF̹ e4 ȁ3Kb1 JU)bia?ŀn/.sy&l^Qtz`|i30CD'Q.Ar0S#ַ=磋I[=ݮY6D(=3%sT/טsvT2 \*+{O=LbjW8xqvgkqyѴYH֖KDQU3 66d:'{$`5KFHĻ;ZJF4c3&ͻBSc1H򓌢h)\v= ӼX,0}аp 4ZCF58sgxw;*U@L;Q#2:ܚ0F&i4Ji ѧ#H&c0v l%+2s5m&Oj{F` Z{|WbrƂR~7]Zu7j[cw:갑I""l"靻a<$R#Fhwe0=BNWx TƋӨ gӁ,.ljI{U#ִ"K:J\ ք dh㰢i[#:LG-C$p:H0=qh,QgEV 0hc=fɝmni`˓OYŔ舃K5e78`X;t]0^F2|;BtT|E>F~8a}j%~`f%'BYμ}.sqx%uj: ҙv-c^wwIӵ%l'J@A;.I}-EAR.Yg $idI㱃+U Ddl~1,𑈖$O=vW48`2ʬ}7¢βʦ6^wNus0ڳgPwIʚ :Ѧl`N}X[íx]j14B0W:A ')s.X3&3ۉ(˘k :6im~֡zlK7M&դjDR46N^M(w)S;@m!$;t_~Wե}!rGX3׌ j|eN\rr3(a"n\ba]ڛ$vLnfdE!&`,k֘.RP1X Gn|'5fJ2cGִed\Sællޞ֨hXx55"^0Jyȴx-|>ǧ5HLd2@ϐDq͊c_՛F `>gc BOcUhU4 1>MdXߗc ف7vY|KD-EW`1ᐆ}oZ3X?++{ՆVZcm-[Wk,ETbDuu4eguſW'޷1k}N)wqӬcgCfO-Ec}~Owv4qvsRy%.4DOϜ6d4=4r=:@2@IgMmqŎoᘍ}%="Z[2*0$lIcYG Y[pn4"3(PKm8˭o5Dxu eu Qe:4Ybs *0գS|g]ɁH?wITd!hwRϭkB]dnjz N& r]m4W2vwj]ze K1pJ6@Rq$x9Q@-EQM>,~nգO.PFpNܘyY;D(l5͌)y_|~W}Md9I5-ݮ%)ʎNJ}Z2uAO2&m3O5$-{P@M6ipxW+*fϥ:43q=\tHNq2&Mi%VyI{!bj 3iۂQcߨѹmsIX:F=8tsԺ5x[oFY\66t8tt4AV/} apop1`'2=W#h]zjs g֛+a4fņGӍ`IgTrQ+J^ uVIƷ=&ů|Q~yqL6DD9)GPTc (rF.)b8ÄrJxgs՚R"' gǵP4:yoNrÞ}N̈Sz=4I0PX-I;/jX0q:nZu(Uj#1l\35XgR-=E <&sk1E=QkFp؁R5q5ތNUYL\_gX\yy9!]pFDyՎI&2[Q;e*N0⯮)jsФ~(Xmiwvx|U_w^71bۨG9K kM$jB{X?]z9'X(5/Hkke26^s5`aߞƬA)KkX2TYC~¹{ ˙ c YSʤ3\mFz3#M֖A4$ ݻN|kn0ľLgb 4B5Z%mI*6ZRр8bC !wd՟LͼQ H&GrmcDFdyT)&σƵdQ g9Fk^;0i&Hrg0hP>bYWVF$:ְ6!6-% 姻Cv=W'\Y}'u ycNqmlNH6]TC\%u_Q&Yĸ+gZ,& Z]2σ)ܜ[/uAؘ¤7(0s|d8+59c,[/LGDfwݻFp.;ӐP*ELf=֜M&:SUxCzX 1z>6f^}{Q[<^͉וZ3jńji)͏/^(OAڟa[Jb ֪ǫD"hY8n q(_&o1n:r.-!sjb&&1zӤ24b&#/J=ykBe@7IS洴WSWce~c[&&,hhsjM#UgdU믉pj)2yz&`K@I 6_sCBxB٣M>KcI w/ ?ZK)Wk).y#3;^h~-cz_[vz[U'oAfA(eg}ԧefe٫QWa*]b{9==<{c7+ytiI*jF=W@ c o0?@2ֵoO)"?2gi(Vx1bsS ӆu{+5m /SƎ -iD1qp- !Nݝ>1U*UJҤP79gTA,eOUsq8,F0]=y)c=u2vٍ/d#L|T x @Ywx%&PJRY(ClZ\hJDr0Pv\E6 pLسuz5 Z3"cIV24U2xZ+-k_|qrͲS)Rhq۳]Q$Q>\래^YqZ6f;Nlj,%$B`<#oPX~R{_fC[xe (BAu)[7Co(YP&6B׫`l`F*suzǪCqt FイR|*A5Z "|llFZj*d~e/%3/CNק5fx4kX>.ړ}teѢ6`J,Fhp kFs /sXߺ>iXI|#Bͭ7A aU /qPX_2U!Te)E_,jƌ(ǧˈ=&'sWF$Q`L-"̉QCLޮihH?7U$8͵uyTRX}vDRaϙbZЫ('8աbowzs5 #Re%&MOt,wΟ5B$Xx@-c (O%N4`鶤*Ij'X FLD>Ϗ]FޣaKYvHS_G6C/HnqϚbJKev j sV^r&˜YĖt"+"AN9g9/Zc̀`4;;u^[U/ Y#s5|r(/ᇇƵ fTCT0₫Z !yD,c>MV4I 3/Z;}jzpᅋ%2dW$%(T dϮӽʚrRŗPEEqv џ 4;<]$>J5X쫃6)X_]hgx A+׉F`X7L=VUX$ޟ{EH$|^IZid^'WX4b$O9o4;ڻke~P-fܫYY/1Q&K+,<ȇ޷A~v[@k!K|M,q vИ}L.sk ZqjŢTh3Gɍ& Zq[zJLa*э~g St ۣ.nXmZ]dt%urۓR'vO Xf"| 'i)׮aYQ`oAɎ#y$xVWKfιE1h $!6<LqSF?]X F.`HGY69ȪhK8ݙSm'x[#Lώ>-|*5piw4k"GK`puu/MFOExBq!ノzsx2чR{`+FQlJAi$6&^gh\iv䔻A'@$5Lf W$:ؗޏ HP@Lˣ_)v˅Ծ-#NMP!jV\&W asۃJ9} :jׁ{E}ՎSN,#9cbuū@ԯ@^X3B5U)\V./& gZsF'7z|: DžE յaҊSpY4KԏKՠ5m ˋ. X:u`1i$W%H7|;9TYt*}bU`MhfiI}fosf9F9<\y#}ѵƧ EB(ǁ40_݌'<tw*E)=^KٸP-6iMh5)(W=@d^Qg  l"ьlPxQ\+ MRCӖ:=viW82ؿnK 1]ުW^$POy<گ:ի-S]*0 $kάĘ]]Քk1bU,w/ 4x ^WHwмCJV8zn:ەT`e\yML̀A&j%h`] ^&oy(νT"^g GD`:K%'bׇɎ[QR%W8u`f&6Z7%.mհHVm>Me&lƚL^-B5uMuӦ4h,^'JlYN-zJi%4rL*`ټ9.VigTf׭nIYDhoۥp9W"ˑ̡au`hJ6ZPs,%U(“ScfK$&HkPO/j 6b:&I4',,eG>b4:13)wZK Y3ZbD|;g э!*Bk xї8P,*!V_O\MrʭGQB6ohRLU+#u~z8?;m?6lLb Z!,j PF4 2=[ǒDp8 L)AoXFr*[#Q)VJJ2;rحy1WƺX*KQZh £  ͘SLxy̷5яyp֗L93sKZ ͌sk*m&g?}iVI*p%')_n:*XP3C3[usYȫsc]ѱ-ϟWQaj4;?ݐr6AcP1^2LdL BJ F[yAg oYơ0ϱYX$NvI F}iz0NiŨ2zӨ VRö%rh4$؇OX.06c~X;X6֔FCtnKn#9x_īk NX)4e[ZAJ|~fd)N^qكdnf.JBSD<5 %l Y1c2J3EԶeuJxLj,JFwwPL)Y}GYSbVJ`,\lma4.ȣQg?>y2?:.Ρ١j+:s$D'~:`SڈJ̨PCp/(1)0v3&lKUDitm VlLBMo4%e8,#[J)"49[Q3fѾwhY65щϦZd_%DTp%I+؉GVUckLS'v4Q QrY6LfEg&?uwrH U,-F_ ~BJVkA>!GՖ$E=lùIGȊDzζ_?/TeR̼1DX&f0KݕbSψ44EgkK% -{~3xeɬߜėKKTBV̕g!|Z22^1a_b1 @\!s9l, N*_tS)5uĄt%D5+p4>Ţ֣.(@1djT1n 7uP F%Zڡh_,9^͍iV}ݠK2ÇH}O̸Ϳ^t֑3ʢ YImW6J@|9#,i,x{%CDUӋ[dg+*-dGg1tLw7QH09*Iz;U 듡8 ^Cd,T-DbFt-aƵ,vMYl? Z]ً jf/-; DiH){,TH>veL`ץ,3P@:4&"&M4W9aTէq}Κ:8k0Ov dŦkz\iRL8YL,E:˂=-xh ZImnsЌ ~P?&(֖Gz׬`k-@`Zc Z57[^1 |rr[ݣ(4 4B[Ulk5aFd17\#,m_&|`֝fp!+VKBh@"_\nxNY谢AHE1> _৾bį+[VWrbSڊg;406Ing3LL6LTNp!q'ZX&v04.LEi{ss)b1c!a8xTPxvQmZ+"Ml0 ݮ8 RX$&bZ2V™rgUaINJsT(dRɃZCC[^e#Ok.+P"xad[ryG*JޣL&Uc懱馤__:iHcdSs(DCYR޲?#5mr)4!rYm;#{g%}RZdUǣ>^M6IN;-6+:N]u2[" I*JD/_@!.UW !61ӣ6KN1uJX=9>ڨp)-(оm~hzu&U$0K\NeGa%a ZL!UV!QyNCY)^4ٳh3B`Ju+1g#W"Vfb4T옜 t20l$g>jܝt h%e*\XrJdr!3KCOF٤%ChFL bt` Lfod}>i*ץծ|ӏ KjŒkOd|\V X|zYThc.4%b'*I4 VvkIvO"Ya"4f|IY_,gIdM$y& cQsF-Z{%vЂ!`akլZ6^2+ X͸I Z!G_ID{aE6ƊnbD &(X6Ըkv\Q6E`)ϱA x:llcu^6r=g6h=1C`Z B7}wƹ^X k1g"cdŸ{oq fPvn "f%6 cF4gyzf7kDtY"l.g٥],[hXBS4j5*9L !Qd-V V,AfDBnP=Y%g sBʼn񆆱eVUp6 gINQWVg,D7zڈY|.֣?sl8qmvrV*26M$F6L2v/Vqy5q@qyϷvxDˉ U7YTItC#zKɚ#x>:h(9^4nV-'>tigfjj`d@ka9UJD>ѕ~RAd\&lEyIY>ZYtFJkjr1c@UPN=IxNneQgZ_dX (&UW+C]l[MLtH2)L>`w0Y?9+BTgX\`y}Pz\0!|LX|VռrpMob~d-XXs=y Z:baUwfc̎ޛCU?Zxr#9bŢ'ktFgeNk Ec.Xֳ2q2Y`݈ V®!<lmL .$oACt"ܕ1 t˜y}<^Yk!W1m/ڹ;pC[N)Y}T%`]a̸ӾܽI 灜񱀢ұq<#x(9 (um÷`LV|G⇛ܛ1֌e4 LkXtDo^2+^*0F2=62G7j_ajOi!Y ԼcVUE*pI˨a :ECF%<ϋ-i+QF\(?G״XāvJ@NN0&&&T+z,w4de,'ƚkjTcRŕ˜Ek=w:ƴQ'=zoꐚ#HD5շh V4a^ͤ*yJoVXW^Ķؓƿi%e􅤀Zs7wJVVy3gMY ZsbqK.Jd Ӭ![mc[,}S錐8 \ĖtRzqdיz ş] L98&N5y4^h6#h=GMYy &D1-;^< _rsPژ?\+) j4#IYs3fM).lMvֲyUWɌX!4`(@1xb\mY,Y`؇Xueς*q|wRIi-!Tl,X)gBxg3u9 &D(5^c􁋰%3?O֩Д,:me8'љ_e8,V0)?lKpG@I,ǗKׁAE o徨M-gOSvb6aF`f4l"7kٍ) ɥAL{_dmCi}+ ݸ400>1jӪ͋|؃&OQֱN85?4zp6[I3Zq[9CH.@&I\m"buL|H)R6mug=;(ћ<ZM, >Z8ӟZZ yP6<u L/4Cբ]5X<M !Lϫ.u'9APSAY I‹O Ѯ <,9 g^ R86^(c1~gat<>j(Q'Q eChurʮɻɳʔVQו2o0Ub4&߮kcYÌ0DcWDd s$x/^UA B~wb~mlj֊|q7dh!ʪ%9$שY |mn5MKbDkϸE3Vl#,h7XbEbRS6C\'3KЯgfV D{֔[e^î~+Kp81I4w-lJ.ZT++wşIrmHlfϮϸRy) Zϑ5QjGT~bǃIw@!Q[E۹,X}>QzֿZf={D }fP fYgt%o(ݑEx4/<&=4OwYq.t^2hx^l j Ѭޏ}dr=*=aeᥲo>5ޔ6qh_%s CG?&atK3IXy앿6|;YX6YjC&˓B'PN(R"jì0:xl}U!{7ׁҭ)&aFkbwcf,eH7wR`h|= ՝hJ`@a ;F bXAa>=RzdcDۼY6Qi`S/c[hWۭlG|mPjEFl9LLp9x:;D|KcUA ,Im高fG<&kōvXG*.7R%Zj˂&YN`WgME_(Y|-Һ1Pn,24HT. Y@vHTXܐ lHw*%yC#CjY=bVYGUxk$ m=#(1΋hH*aDl*MB^:&1cfhZE`Xѭ8XZ#oRi3Apcccg^[Wp>l@)UBd+3⁖B8x-&XXVM;0Lg^\cK6tyf^q=:F{%PU5TWX˼~q}/:@j1}4b_[&Lt~=" Q bרd5{pp - Ok7mQ^RܹP2aj&Rj3g +ѹ Dy!%+w.#ՔW߻;7Ϊ,aw4+E ؘMrUCT'\-?[';zPk8 kVF `/ Ǡ7%SM3Će5;z-9f4]z1ަZYm[]$sڶT-VyV#&ّ5=xǨG½m :^7=FL\&W+8|:tVJmEIO2T>;$:bh) k ߯EJX}߼Z$Vz,B=wx7\^ lJ0u}*0+I4%XKX1}c^ysGQlQsZ[>x`f_lq5љMĂX2'kw'}Ş>ƺ5&b;YŬ]92?wP+ЏflM2|ǽVf*1zukˋ^z,q0d:|R*/5mXQSn/)V{=h2rsg8YlY/`Ώ7A{E*&sM(ax -F-E\ z!<YCzNI_,e21 1l!9оYJљh/$B(a&}X P[Z`CFUE%dgY+a}hw==NIeړKDR,&15 TTۡyH c yf>fe!/d{^<^5I(#sv`}J?w04`xލ)a=tA=59Z}ոtluL&5+l 0 ku~τSF3Uk%xD4X뱎\FEߌ֪-8zЗᘭ}iHl`>fmːNr4čc#V4ibV<R & ؙ=$)Xo]vZ1>v7%BZhIM\294GDg¢;X\ 0 t2Xe~\hœ:h3P&*nަ>uW]sY+Ag:踉ܵ^`y<O=^?~lowEo(2bk0u;\=l z4Bj- ]|dʍ5k:s=Ntݰr[ /X1TD7}R).dE͇;ksOGw-א H^u cFu:cD#=Jv í S,=M,Xs _%# L͗[7v xs3#V?]"nW6CR%K$IC 9ls {^hP!0yx.V)XJEzZk[<9BH^eƗ^bւ"%nh>iS''=gz1F&zF=;Qmg>V ##;8BC6/] iYHsR {p؛=U9`jQm єM |}}S|:F0&Xo_=2GSbϧ\qsJxF:_.{EuX.xa2S1gu60>!3JC\I3`@I5'EMg4t&J,[=}jO0!,4e߬SQD^u-y"E땧9CCFi-.QR1ҐmmS^cvvX-=?~_dVї-\##s2#ߞ=FZ=Y|>DS̻N;53 V1{}|U<:; @䙪׸ݹJuc7/XJtN#ZSF3ǩ.z: Vr o?:g?ut]\\fq.&.Tp&ugYd}C/X`e~lՏ_iZ)X=?=#l-ͥz&<bhU3&:,D9kTj4dɺ_K[l DO)Ј8IqYsWTרUmZ)Bt2ʂY'~COX;b "ZɲbۯB~gy U65cb%ҞDtˢH5=qw )sXi3f@ްkZV|aGFDk(72S֪*JC$djkԆ"2.rU$p>% +^a,5עS;JÕ)<~O,bc?\]8X"W-D~K` OĻ[ڦ#LjC4X& і|@.6ko۫rȩy4Z:ִ6&ߟތg~JYCg2n:MM+F2ni͟:x>$X4 wNkGwCq 1 @/Dtkd5W/xAl e2Ra#Yo/g`z4XaC>Bpla̴x=i["ӨSV/pH%߮@01(# 1h- aAVxmbPŅM67f̅4A-!iu&'bùcNQ{盁2l^ RAef@2  ZGß8Wb64?kF ;xƨ!nBнB'Ҿ1t8$(.ФB)%ϛV5g T.5g3͇V|?SBT-єk8cWeWBdiG- fl'.1KBhA[(o9)"s9$ FQ?{ݪmł-BCSo˟mz9&0V/KQ{i$ëX?67,*OӸ0C^@ ~7UN+ a7sbɻC`lYo W]@<8(%05 f4 iX~{:] $ل}=K-l _huEn N C H㤿ⲹh*#(p"$ Y4B4![ +Qc"1͏{?}nkzDSThzF0|n&1:6k-"Z|뭖 tc;e}’{N_ b <:QN!GFց5K2h  `y֓GA+t5lX8sOˬ砄1"6Z;'2+Hx|sOSF鐰7Iv&m`[ Y5 S~WGQ5&=[>y@G 8LǁV{m,:ԧ?$?$ҚD4*U9תέ1%L)A\ JXsj ` eiuɑq-t(,'9FoXܹz:QymXS٤[3*ٗ"=+V^M^i:wL(qy:u{6/|(k2d:3U)Ch>wߞY*jWT:`a;$`ԄCr^Ɨ.VgqD..^ZzES$otjy=$ 藍L"(sˆRl]LW)rϳERAcU,h+_ Y4Kz=Akpy D,(2kIi?35H!D(J~&%a+yBFa芮pUcuIM5IRZ>i Keh Sack$:4Ռnk+{a7Z,W)d7Ljl^w-,w9sOǜMes hcGu#֫~{E1-:MW4#pxzyR W`O,0TmX$8֛ul';b"FcwPvǷTme+WJkYk1ZFld5 >(46ycgΥ;67ԺaX$-a)L t3BÅEΧ([τ $ VY/2xr_XNC ӈ݉_ &⼦۬bGܚ{&HK")0]*lL?1}-&׶-AZX 7e*0g9~;Y(z r_|\wA=/,t*eBѕᱎƙ 5ן$9uJh\vf,!iT!%Q`iXiqØ1ZK7W:,> U:ivwV*tB7;'ob]K"kX5Uõk263l&Ό;n&R0%匃>R.a^SomH׭]_OF߿3Eʤ2pwwӣa c*_9.t]uE8`EE#JfmJ͟g捭8rI.'IمbrWI:.QJذxi)\m8 ʋh8v7u8VID&JH]̦ voAh uw^-E(vn$JhԪ֔t2r{9* [R4^4xn@\*EtP,Zeh1)jwC=5[؜08$%X烥((fuM wd9A>xpwks dH! 4FjS"hZ(!c f TD#3dLEv  FFZy;h#ۻUn$/\qt7dޜ{l'/L^ĺrm Tv#džUUD7??v_/VMZ!WhZGHH~U|f2F aq'.b1:'oud3ǀ"4(4_՚!<_صI]-z q z^̛J5Hf2]VJ40ZrΪ֥7kPyl)"eưa$ig΀'>Ɔ]n#ry˟.qX,$ 3`{H7댓0e0^tq;:k~4xX h~[}yuZP` 9>jLOxU/ؕMrZ.굝vz!/p>TXK6PK@!ilġ>0(VNEy3Ν82m̥(-xѰoגUY??yKo[9_^c/U.M;Ж٢q。 ږA@ybbXwf4a+˓Y`2SWhjJ^(?kDH=ܞ 4qpvKjRE pZr:(joLT\ʾ4hJԺ|oMƣs} 9vC+ b1HNj2p48C(ӑ'V}OVʰhˋϊCO"*4 VaV,nR#\^d*$DڭǑgD#r'y`h*Q FthʨzW- g)ǣИAZ|kZt" Q&DEuν4XQi,|yjsIaҊ8dUJQbL?)d*ZeЮW8]4|7E49\b9Fdr5MXNT$ Tk9Iɚf'9p.{VkS rn9O3^Y'>0hq~ʼCG.u|!km^VJDǟn,/p.rh`broN :fp&=zF' ]k+fϡnSTwƊ)#B F )R6Z}W>̔CYO!$HUŬS]DÌ1:n Fd,hu@HG.J6ߏ'+PԥDrzc;kB/m%LlgfzѣCFӘΦC d+ =Qש, Zp%ܻ;6B4fm rğgLV *6<[wc(o${HCd-.yݦT"@0=F//>ID3D0+i&rI9j)~|.VaX31g>?qBzu%YD z#[ Dn8 c=< kB-."Cy6jB/QZ]9 V|%^Z׸͇ZǔjL(CCDG`.!r7iaDnڈSY3.\a+k5֟rgu/)*K(KBPD"SU:-Rq^>nV;Ѿ}y*D>i^lXeڝDdrDs-hBblba0{hN$]r B:uƽXR F ƕ,~ї_dMpKvzY#ۄmZ߹lLYئ} Oa]Y< Fvlƙk}t'ɟyǙařcY|12#d>t>qcBh.?B$f,iLƴ|E%XvˎKڳ8LJ0oBvmIQP'k:ǰ:R|xe™-f$OC-°~馈U{;QV!F(ezt;r4Bܷ΀/jrU%2Bf5|h̸"5Ʊ;aHܹShdT9clAֽo8יԦF3e/]{=aȓf7Qٰ"Lx#(leOffmZchu!OTû1p6 Zwqhv%̌3Adnщ6R!YO=%ki\ g+cK!:GI_UMɎFb~=Hc9wirmQܩn,~ibnX{\85Lr.fDO&a2#}|LЬbU!+BImI^ I,mLhEa-l͛8)AaaO'1wU|P߫ɂ,!"$+F"R[VHp* ]Ldy@82) ˛,%ZaܤO6[*}*M8.VFM^~ndVEEGv߱҉=06,Z|_,o<+B"E{xbS]U!*iE7#%TgǴysŷ -j 0c; JB.- d/w/74= l)gI.✔WaUX#M!ڬwuy +>0µh&{z&$'v <4U/חRFљXoχ*qE0c m_Uw(>lZq*.kD~)E"jǎ0Mؚ0lx U$NfصFά{xmgQs`$,CIh웴mSv1I),#ў֜xզ}wDSZ-T3QURe&XX m^)f6Qıo ^ԽcZU. 1?~"xC2`].b,C&'wcI3'O%m7ny&F; &¦պD/69L>uJ xԕFJ4rXn{ai>p0x{0HS04-Kn7x4#6!j=CQB]RۇjCKmN;emG<{DZVeGFXnbԩ)KjFW~U9sf|:ư_(S \ba*P`Ę b35sQ]Pyו΄ў,6N02?qZf1xOv^8Ǿn8 |ŭ <@Ksffa3R:C[63PY!=Sǃcc)/ǾޤfM[k1@IcClMia-2Ԏzå/H_ƾ5LF/¸`ff)ea=q:i0zPiByS9AHSD&V%j3^JC [ BYĖq~HNb1z#)b$cSĴR,-c62\~-8Ï!j3VuP gH-[]F&ƕ  խc4Hj(a^MjQy<ꂫȷcGv2 yvP+^0 S˒XucFf+j]`e amF!/yNVrHh! 23 ]uCFLZ` Y<jJ]8~nIF6 qpz-5M1con~cW$Hh޴i0x%k 'bH+@Xl yM+@`7k`4fO>y|#${~wV|}}RFM,ld]_D_r@$0xrc j Zs}XE:~WAGr{|=lIlƓ| WI7rרd+,t=?gmQ^Jzdb\.A%'0&5(S^SԀ0#dLs1z|D)k~*Vsܘsbu5 Ij~iਔ?R<β0b2H;S^ +}ٞ[ԧ3 ghFu2ؓY.Jb[l |u8osuqMC!=0 dqfMIh\Q_yGxIe)IJYHVb?:"ͦ5(QD$p(J8c?ʹ x CÌh/FS!VYkR+kyGa_?gڨc@Ǡ皶PVꙻ`K.mCbZN?7I&[S+|t2aXAznPÉ5&3^N@@f@'AEŮ g2>Zy H\vqN(B|sRP"lxGՍ=m.&;e-T۹SccZֳ j-HAhqѻ6P ߌ~Z|V5╆pxz}PʢZ[Z=umV1f4*uJg5y4igɊ]+OwI?md:XF^_qkDxVRE4!(*F4TC8YpKlÉ0"`# V 1[a4>q `En rFFAiwc3.q?N=TⱢ˲y7)dG=\1ViOPHohd7oX-3{I1.K%౔*;bm k\P=G| N]Lh,4 1IU1m}tuh3k+)\wby㗍Q!U ɩC9hAcg#\F'5CN)I >2k9Ϝi0ځ6}&;t ѳb Q Hz3)X&6iRmrܔV${YZ A_h2:[*mдͪ%3x0Za?NhbΏUz )qٱSBYeQ qSE} #NY2U1w HKϓ!Zf+ϟ1kAƚ=U/,M:Qrgg9VyeBH=b3sdH% ڿ<ڎ]״=20%ɉTx5g!ՃZd^bb&tߗuQ~^I\ 2W/]c8ƂhՕ8 6y g'1%0Y Y S$GEk.,%&){I0L M+ s8f)Y;ɡws0ۀq57jdѯswFӌfxɠs f# 㬎ff0q]}|SBZ^O-K-}wMwE-pŃ Tl?lPNH f1\0.-JKCVD0&74 ^=$3EUQEZ([ .!sw[X^( ~% IN` ͱÍ&cT/**_^F٪a϶$X+[mNQB #^`Z@IBQR^MU3s@ V7Y/Pŋ5f .'Xbk x⊡CgXC6XB\/"hPгն9'b)0:5$!XQ/<ҼY.]=ϸ)֖n%MԚF FCb@6%qP B*bT*Z6*?vmnz"(ꨒyec*Qa?Wؽa))֎o FRFsQԆCze}e/^Ow[S/=Zsjt']^qT0'nwi20 &:nJͩ(89Dkw'w!mtcjOZW)H4éY&h<&=Œf8wz{8tFtIRrU ,3mXe }BԬemIC V$[~4NWX{n=ٓ,&t p^{s֔,Zl:Gk.nFL":#Sm4!p`YE ]398/1ǤvID b0fEXcFEϾ}G) 1%ޮ9AS7rf&[MKfg͕ {YS=e "?t7aY12cW4)HHUB~=UdgXXq6-Vd֢asĬVD]eӥ2w7DD)~]yӌ4u;tscP0s?)[;ā`]dx񭢁7X/dkm~4;(cT4o'1jtLy(.[`>[}EK-%W>ݫ 1TXt wuzZ՜9$gcY*^Wh]N^qZ5+U EX34{ٻfº50ByXp@LzHk,RdH$$%SiNPՕZ}žQ:KfLDHqQ%Ή2y[.H-yL 80a+1\[hʌ)1:ͻ0 (.;I$ccUڣi2B]5)z%׵6MB(`J^.fcVtc3O.)5Ȅ R3=t̋퉙aљ=c>v{'ε?ݻ4efK&ɹy'('U9RyL5q;LJ/.֚ia`thx`Y5C[&8tu}KƓ%EV3Oa\2lnS<%YZ$pm <W\+0;$tB%`ڴMv_{Xɹ'U_|Bk'"#+cbX:`mz!e4GݨN1y<`+u;Ɉ7q1:v8lL,=0,:0".K&pMon !1Ht5H Baejȁ f-[bS34<l`IvnX;I8š'YD>(Ƣ1N%DȦL7X^ZO؜ؚaiTfk,M9 ;s|D5;+Q*c|:;F?jblL?f剗 g̵q\h |'['^ Pgѕk{cy8Z{pyӜjpE(&~;s$&3énGe"b9ZU`ʒS"IX|[}3z_@9WS%Cɱ-c<8[ ,[F Tcn40:bp2Y`SѢlgFMin5O&`[clL=?;jUL7QY_EǧdDP0VE,85Xn &ns{{>4g"!:3}V Vww'Rlh1ŗ٠vi*KդՅS⁴#Rymz4`*۵r"Bs.: McZ.sl d$u`W=LRhb'S aZd\upևezМ,m$4L"l-D ׼hZ[M.,KUે=00H@V،hݩtRYpHǞf]e0A>qzXqd)ONRsXե2ldƖIT2z,_;<`I/I%$rUgE 5,9bG$ XX9JB֒~`9Dڒ7r6aPa*  1lyT^h틘V,AzA2ؠsPcP Sս&aډ$ fɣTgP"&w8t8dǭ4ʒ먓$m20ׂ,%fb)|6L[chs\(~Id!iXmmI_uía8F X#0}?_DC$Ea 3lXVѪ%:L՜DZ61q=r9a[ x:P9lnHNqcE^4terjChk"RB<(@ RYxPIyw,] W|qB3-x#dfTh{(f 渺Ry>s&RFM>DE! %sv52iXOz<Q3JBd*}*+IH]10L#R,+ HWs Hz:M˩O%Jg+!o0MoX,p%%#-K]0Ե-H{m$<ȟTz6ay))($R*Q!(dJfVZiQT>1'ct)=^y0>E^H.SdܵrUP?u>eOz^۷!I|1!y_mO H~&TZxW aLymL ءʜ=*#Ӗ,|n{ @53 >T/1RUHea+ndI+$ZȫSWrHJ%Kp7GXZIKHզZE>9^WÒ4sk߽7L.*I'lg^7FRI$zJ18Ah>E$cBasКtZxk!<8IToQb{υ*0 ]nOM] Q=}xFE8"D恩 =ztIXn}RfnPϫ F#]{gρ{6֊L O/ ԙNc̉SB`}BL 4y=deܘeURB' 2ՋQE[.Ru&VFFmu7#ƋX _\` B,#o(&;ki݈2T.>'~щZ0 kַrveե'IL?ʔ:%|lL%,%a.Ll jP($!rhMؖ!5aZ93#F<9'%rId7z{Bt^kV(SMv˒.˄R ãXͬaό}8-݈ Ԕ)o>.Ba4T4e%喤M=Vs0TE (Ϩc*Gqrd̲7JGOBi-fYyTF9D>+ʪg-bpp`\5!~e!>q xFnUDA~Tpj,&ۗItx7#%&TuZXRxpFRVP5JER^tB.:"tCaHW<;_sŲ,8 8msQZ%{]$Hɟa=bN< |)MّMCK&.8>IV죍BY= שWwwdk Ox9K͵fy KSk(d(!ϬCN~ڏM"\4SU5}\0"n)i]Sh\#Me2LhYN1: wtÈ\1Ō+;+Xˡ7FA*Lzu:&kKΰUY(4`zpǏw=砝N9htxмtKd3i% shsDPN<}Jc7=tqFz2@jc6o"dn72a0Qg7dZwss.^9bL *_eNpQ;Y+,#-$jrD)k}q3 ͘e/8'khICOI&L0,7lϫ7o&0nK "3Gms!v& mYeeBH3 ,b.ݯc3Cg /ek,"p@!mksDOd' c"fHf~4x8L L\;I=>5hϻ߆W74QŬx"X[/s27MgJ3$pOB H.@u[ F‚~=VXYSѓyb4Xcƿ-yz["! 4^5Un;0\ Y9u%v(˧%mAɾ]z Ѐ"8nes\QX8Q1vNjW6hB,aΛ<'qMnuu r|]*|mxROڌ+h j Qe Vl]NBt)XGFf O"2 6.;ޮ*jWX/3!M٢f2Jzˆ#yƗ ˷'n_g>?a_[A?k }ɕ Zaag8Hqh?\v\6kY:6S̀4*>ݏeV=2| 0a]ASg@ ! SC2[:v`< y0TF6-.ʐA*etKbqO%iK8+@. 1e-,<9,2{vD b[ јE0Jz~{8^JV$Ucf1jsčzPH]p K^Cu 67*_|kaڜBH 3:z/q|Qnם^H%&$cS WBcrb'hqpb3iT5Dg'b0 VV1j}MΡl%i Ie=`=ƝUPQ<8Ǟ_Nk&;㵣ulg*a#z{nJt/Y-)FrWv6U{utNL~q6{}D: &RRgɆ<3,93Yt/Y|嵤r8A}qYcUcyl~D4fQB3, vmV[p"c{BRь-ܶyt4fуH$ kvFoY41>אFLI8cz+ilX)[ Q.cFUBzwf߶03]d mzJ;9!=Zgk5#:g̦bv}QKh7g:1Qt/IZYfeZp[<}F׆ :uJ5䥓 4X'd5 Dc"ӴԚ?ݨa}c\5ߚŚ7=LMjJ"hˇkрfS 4XMNU0[o&"Q&bk&/~_tDDg0ɳVkF2w`"2 hI46e+щ|ƾ;"BPc)8YֵPlTy%"~7Cf^t mgİlW9cj5ΆcYkEŻ~̠< X DB&uj\DBcj.\YXJRG͋1JoJ傺[6H[sc FXLXgO5jDYǮW"xX:{0C4S%R8bHWѸC].U Ys֏sňȢIKc7f=]gdւ?_ ;,qsyWb)2[*iljN" D pՄ/'0-^Cww  Jt~AzX`2XrZŊ.Q®c_mC"0bm޹񔚥DOCɩD0th{ņDMrIj2ZP~.?y$4nLhy6ܮ#<1? T-\Sf{4βy-c=bDRd[l"@`•|D?[ȊTv.tD{{Y;N YJoE1_L)7!KwĻ^>,BQb$m-6?h*r eP@ 'Zk6þ3B U!°,NYb5wwwgc#W A/w?_AS2~ [%h])to}_VB)D؈˚l~^C~S(/}|j*@hV7BvħV?1VRi:).$B-϶v`U.\k`r"%|WhK XĬ(rƉ4ᶉSKck[PSnxTx.Yp{'UW5kp`<2: tɬ#UZݑ>2Y|=IX3N:@iTB̈AfzCn7?wۦ!`62Rf/j sq1gY)iћdО5gFӇh(}SYs.5acBkEk't%0ļ@ NQDN: XFu#~>)l=s{ޚilcc*@[ZdM:"N#AE",)iZ]?\Cj^l/AyW"~_yvHQAy5rbMgZc"U kZK(UKr;7ʯYS!"h)he/ϏS6UXO1-/bRƗ-*X3hF'5h18H48I]`@KY-hX0r OYp'ﶞR  6Ɨ×qiTaY^GiLϣp&`ǫ`0DOGEj}OC?ӹ+Zzgb}E oJ=WumP!a2TjՏMcS=t*L'1ͤMGU.\N=<:̞(WN q&f[pO^äkIVs/;HTYZǸl_;fL)"LyGw"ڵuĥgјv3pBt$ V5UFdԹu}FE}Q#nG:]E_lBfYGˆz='Ns96q84Z.h2d!Yh >+B'Ŏ0tx>~g8f%=ZB ̎h9؈ 1[q Kߙ|>oCԚ\=@I8ܒ֖%mX +?>ϫs[)ᆌp<՞7?k3jf Flb?cwh,K+"n@22Gc<"S (mffPך/~ڻkq@9!e=HȲ$b[TYwawGjo^"44x4}]6ή4zt.s(ǧQ qEzw$BE=r.ϴfp{mpC26&,[&5HE 6 Gk  Q~WV WKPo4$!Kb\RmQsu{f=V~qs e2ǝ` k!i-$ jQO_/]5bän,jlm lmntC@m#)=cJ<{[pOZwJ1egț]VBCxE 72 %2a we~`"Ĺy"`zS/W+lBHiym}<[)YfK`@U5'Wf={z,4 msF(EWlGzqZq ԏۍc(=ubCDβ/~^,$Țz*64 t&wnˁ&A+E_sEcis؝k}׎k++ǙcaUƞ!0ޱ,uZP7N")2`kN|秵 FyTmfl`4>, @ŝӒ7LL6$,x}A^m:K݃mS^MeJk(k6 Jq}Ɍ0{vrFx;Ԇ (Ŋ!V12x[+pdH"þ:|O`}`JFM: $iʛwI' _$ў//I|Z}65HcN\29D W gYW2Rluq=kt{N=^s·pfCo&#+XQ)[ܘ2~kV6+c3"' hXzır2H4VW8v-Ziɹ$=~nB(l`WVXZ߿s||r9b;UfNǙWDNU9Hʛ;Nvu^ʆE ѵ@ V5rM%1t_jV HuI"!"=מNHjю}AeǴHvaL!,zYH Kfl-MwXRZ-k>"񜦚|8k S&0i\\HnĖ$;[cT3ZWI?;d-dH#٪77\dt`DhƽU~wBP~n*udZ5{}qέ*.{c%vz<>gӰ!SZOZGhJK Uh1fftm(;#.B*+t+֦0apvGIӚSU@`_B WcvkO˧Ϲy]<+RVD'L@¿[؊YY*Qڲ{VnϟTPHSPbĚBh+:NErc)h èчnIGupxT0zv7>r QFzzS>|O%̤66 zaJf̳$ɗբĤ(oŲSI^/ Gte6OEZ¯c\;KV;z=>Og!Jd /?~|{cVU, @sM.aɖǯOݸ#E% iVb6"&bl!M^Nd½H֩KҤYYf6XӺ7Nֱ*)ݽɆY}`Pb#w]\× -%-{'b̛b0J)fFF1qqxLUkʸGc(hm6 BܧuX܊cNAF|,tqlak;}7YK$$hDpz<xi\VD ')L`Z Uh m5D!k&mg= ZmHPZkȮJs$PrɪRi}F|8Y4rjb>eĎoq9H5:l&/5`t>bΪfӔkׇQ=Pa׼h+,s9ȺQi;/y !6oCm5l3a|~~O],Ɛ>&1 ŏDݮ"Յm"AV$)%bTͰ7G ZL%W18CfB8UJkqA"CudEjI@ vZ̽EB`-l ό$Y 2ơ>z4=Dn R Жsۤ)jC/Ya2CP(ps{fTP(J"\Z(DgװPeZ2M9wcӝag04sOjJ޸SSs@&qEE1`g|u-&&^˛'ЖRe-*fmת)IZB  0Z2~ź| Ьse= A! 1tӌ^uaZkP@z|0xk%uPUOO4Ĉr2=[EJ5>'VzM79B>K7_Ѣ#Z5:à\LXY]xYV|iu3oCyA쵓ъs֪}(.$U3CXFG QJ 0*xgK-V>vx6B%(B_Έ+$|GY{V|O%';vԋXuB~k|ΊBH6 sj4RM6M7&6J2)Ńٱ Y+U0#r6m222sk۳Īh0ZᱝY.c4rX4I(ml)%l:xJ*-Tj=k9}:w{#?Zs]cx&maXs01*4_Ż.#F۩D8CF"1c' b-BZM{y^ F, a 6 9c !^Y΂*ո|wg:k;5^h+Ie-]:pxy(&{M#5k t8׌5M =ߛ'E~l;)gttϨ@tY6*$K2vkkBe&81 ϥ}qhcӐ0&R >kr.A5}hU6~L|;+qKQ`Q<`ƛY`#gQ6,R>icZ˜DHǂW͔U6\bHElkkY}U-s![;]͡CNYcRIı8?^\y z(Obnt#zUT{.PzH&Nf-erwX|'QXgW=a0y5fb0wI#Zۉ\d;Ϥ~:z3<B`qCWlrxF" Sc/xUbL}՟_=>D̘ E[CM`Qם?o_}P#sLj1y"cվPhH.#QLn4kA5'p'EՍÏ9L.wXP:~{w`@$2:11+|jB٩'19uO46=vyLjWY#.Ֆu}$'N-t͒,38 -P+*mlHeMs6yfy5em 3Hj>P,+$yBն}P]bƨ?zCc..Bga(_]X2ySu5}<ŰV0CPmVύ NSV3UiҨEݺz'>ə$N$WYbR>ќd~\55 Ԕz1MCuL7kw.v)&'ìOV"Fu&m8#('tJ 064!5aRy>b^YՃh*bj_xAf4\kFϿ,ct]ALyLCaW=eť]laGTgkuClbHBזazvp}Ǒ_b@#'uocH7(blvtG[c֌ʠY.6S>۝z U޾>I/3b6,3#;V[HV$ vfwĚ78E alv2mPuWLB՝*DlmBy3IciҺoB{fxxV兄<|dM_rؐptYWlήBG!3@L1aRhɄՕjI ,`m 2bɣXI5}CsgVgXX cSmax9Uce:Kyٲb>Y$0Kv)&/aaeѢČ3ɒf#}A2,2ļ,zxéyb AJ4f$b<'|Q}}\ufHN[Ūàlhխ0.<笆h:֚DKԈTc]Ԗ}bng^y~~=|BT:•l7B"[SUþmYkJ|0m{ĩl k^}¾ $!Zg.{a2]qxયgFXH5(=8, n{on|fX- dz# k8V2sb:k$N,Hޱa5n% /=ǗBVJcDCJRP&4Hthok˨v[TbSFtzp,s$ӆgtڟYA}DJ!u GՋҞr7(ƨbςɠq 323RPiUeɍtԳ3l>k%U9L \ϑ֨ c#Z4M$DΝ.GXtOE}Z^t~##"3*fmTsgZws+Yǿ>wȟ)Z< k@ 6fY6jwֻr#806ɺ ،F4q3 Bf5\sV9a#^7/߭4[Zٝ>>^KZpb"mk'r{8{ H4!^R-?糣F[#F=EO^JDVY&WN4B1:%0&}`Nؒى ,X%_b+"o)JeV"=#|8=Uc|rz(Wt%9Hk?[_)RԬPZʖ{n c'j`7fmB[៽)1fRA)-#9E,鵂0B|lnwĕ 4XӦяOַ&1Ud׌c'9=I/wI 5:[[>0i 2,-hNQY)f[,Gir LWg ~:{b C+T21/&Ajl-+Რ,jqK˸}v7`dk ur.jaLꕚux̧h'N'&3YM|W0%a;3?LjΡ3Z=Cx|xIIl 3ӕGSOM ".iMA08NB^#xz̀u\{)b QpNpkC"ݹ%˜gzQ `f}m<>3ؘ]:4gP v%pLY%T MsR@~>)#-T.$H'fOōPeИw "%h/9OutcVio2p4eL7Ք_E @r/>=J[,0߬X3YhF|}UW,dV=IQkJCQ$6F3ဴwνf%4s>E-:ə)=Ģe*D~ 5Ia3c3Z1=8\u /)ÆˣNpgU%E'֌#H1dK6~ 0Ld,iӳg!F1kN9 M`JIb ]oy=3nW& RB` |ImbH'3 +eT`mOϞoNje/m]Kl7hkHbXcjV~@m>aqFO/΂W9qXbkSVĹ\yMH%Vq#^0ޔdi9}4욓 @uN&'AU =NKO~:onHƆ}ͺ?!#|viyp+>pzɚ 1B\>V"n蜭9%;%uFIua{]됝u~'138q6 Sv,:R Lңxq)K+cwϜ#"E=xµԚc#nFaȳ;>1r-vڝTbbQ]w{{fʫ1@ j(F,#Bg&5֛ =RbАwMXXy֗1 (CW2]1f"Ib/7.<}plwʶ'RL3L.>]XYlj%)ՊvCMVΆ-UFd~75+;*fJ*Am3ډ-A76"ѕ8#QȤ.yt}A\bsV;@=G`ז/ӜĶQϣ6M#D~g{dIEM֟|>11wc9H4ඉ?罻CFrUI"A .퓌vFN29ZIeCV{nrGFXҐ.jbL~7wP:|ԉӚK(N>cn'0rY,Q!i$=RdL(xEIX7!O]aT_kF.a1n{t8mhΝY+(C~Ϭ& uDAV|/9(x:$_vKB*(agi83'ay TdgigEsr'LWݖ`<% !֡^d B(KX-lL٩ϑzT~ZC3dq4IIkӓb]QEbY)](%5ӱ ucJ#`94ȋN >>%* csN[cSWŻ2П jFrQqcn0mi{')?8@ͤj%?{Uq Fw{q98JȦPI̸*|Rqn\5tZ \Wc%TF9P?>.* vrFazȩj\KILpF1Cv^븣竘NS6^9WDqNI4:&luǝS桃66^ZOrAnҞC9T7,9}κs V< Rb5y:q-Xmm}cw (Vj1H(i'.aR,Ng"+r{o*ح][Q==*li :~{Ӱ?Ȣn4:˶d$r=YxP 6LNn:)h vܲa=ϫ,`7f#QX@;P'^Ohvu?ݣl⿞/`4I$Ǩ ғVP/2148IYFVbbG.ct5H*eE]J+Į>83:6p f,mjiȁ(x\9\VKFV}NkM$ȩQZ(7nlPp׫ק)^!m)'fJ/cBdJcDS߬B@  ifyIa/],daԔz8w+!hƏFH[n'Rz*unfMW'͹ ԕWr%Jۦ"w[ Em%eܼlC:fQKXG-CdCsePK=R*zλ80L_qh4ڨpa{v\e10G盝ˣB 'n5iS.pgD}G8a/5Hӛ\n4dϒc&tcY|f_;:riˢ#k{ 'Hxf=V[fa Rfj!NpXtCЬ: >D?;N}^ӖqL]vj!ƪ3RߎL]Fou6ںa{4 ΁ra ^.ת0s4 ] Z_Մd~ǫTjdDA:,Jf~:wg>R7t;D]as(=[~Êq87I&&Wm._cbRkW;hԼ`0vъ _@6,.sC0nnW]LOGD/VREsQ+  g;yCa4a1XZ{McJD}kC3H)0"mЋ1T[k} <}zmȾ4nDW; դ> щiǰ*r1Өi|ۍțX[64.l~,6x JhOO*B Phc-Jl`ɠM BkOoXc'a,`ҺEtgKЂ,fưo2} Wԋ2 /ϴ'd:ϿN8ͭ+ ZuZsPd14`*Xj, }7zєb)4x춬_^HO9OyE+te,K6m m*hSWݖ{̃R%:ĴN~.HY~-Bz "ư٫2^IHҩ z5Bh[(7qtm܅%HoSN\TW; ^|4X:Vk~$vm(LMhF0Sj\Cib=|"'6OԓUa{Mu|(ڣmxWI-eاH` bG뱩-nBPi896b ZGLwB++F486qZTR=$O>yqgYZY^r;q짒k`%mXGO糥=7@C$>. T|K^qaѦ̈X0z쪨 @j34VZ,^`rIZQg=NS=|"&c^ _ BrXTE25g;L}D^A*%EMr-_!`Ibm. W0 T,R8=ldl``Ћ%C⌶Ҷ1,fiOQ}FA.qn^{PEknZ>-,#ޛ0/1%n2h!˷qS+JFY,iʢYQdMmœbcn5+1oݾc"`gDRV ם?y4:(|i)`uHڒчcV:3o@f+5t#> 8=c{Y>JZŔvٔĪ79 HNNw<@Gg!fA";>=o*c˂4b1F~ss0?ˊFG.gB iHzX7eı`HeFX5ǖ֨KNyIzcS(PHښ9^)7ve iT$R{]?uJ(0dNgYv:BXAr )Ŗ}pωITwEC-Vt!\ƣT3!uC:z#UWذ;Bk+RLFF+>)wQg"fjv1(j٭3 YPnƺ(CujdsEaV/u7'=՝&?}De 0d2+G aK|f+FiXܚQ2a61'߼W(HFZѯ{vY(ᅩ/"ՙT8fX5a;G~ʛK=L^&^0GnjӖ5LE(& ;\;Ύ󵜽#:ۥ㮛h8ˌtڟ1*KuCF<맭<A*%NGynz%T 6ҁzُ\#'ZХ]=gXFOkfJtBS5lhdaEeW͡ɈF_8M0O6I1d(Xj-.$sW:l6h l:+4-iR9t:[.Ƌ\W<#:JqzH-cXyD{¡gzڶ+pZ|5DV<*^R @ȭh7ܥށs:%) FQ9,iѯ4 8e̓UECLA.3]EH YN^koޞ ]dYÉY81{klw=ɓQD} lb 5 }eC ׵ó@!T鱧p⼑1"ӫ (Ɇ]Z[%VnMٍII$Izz"-ZDlӴk;S,R5@ `[|]F<슧ЕB /J^caJ`CMf.YI(îLE=U u_"D+wSYZw{r 'M kf<}$?4́85h3C٫D iaƭ*vKYZ}OuR2[0c89ےPT?o6. bE '#*;o>aP8gƇl*!'P!l.J bLFw`2ӝ9m%VW{KRy9|\TKO}oMP1NIQ9XI}aE5zbq3gClN )1K{~8㈌:ot&0H{B<k'&ʰ,&%aad5qjv.b8/ W([=TA)r8 \94& B-wX[_@aXnZwDE6l+uDP9ۗ 61n沓sbMtmi-N$iMx1&C߽_4 ~i,Pe[ ܯd"v4iES^-UKCl rKQ 41cg=g>zn6uk%nRM* b>I/8c׊ z(9$\c%2x_Qs,h*$d }!.<+(_\iW-*{bX&D#vW6&S60N4VE*Iֱ|x:ru9lZmɞb)*W2lõM n |qwڴBI;sX^}2bYW9\XR Z'&ll8l N(,$~P!}aalXs"0)MG_zL1䚀fIG N[RZ Bxc9L;9՝g=GHLB=$l_p p-ӱ>,Laς}Rͣ^Ωz]qx`j>s~4xKy45b7eEHc@7hL븧l@K+KYAիe`dž_>އŒZPmcvPKjJ (|(I BSX&iia32e -ͮH1F>.Lx%m{VPExIFIK/X+T-gtW3>I8dT4(VHEeooYe f}#ըTëwD'zT2cX)C}s˅*^\XB,` n Rj9X->!\OZ-GNH9Uq۷0͇+kJu ^4+h P>wo67+g @2qR?VHяÒ1QfPr#Pݞ( ZĔi"H>_wU7gGrz4d *ECIj #hВ?It Jqm'QY[\/CU c'!]g ӬHcft#p%SZ9-ynA]iv#WO9RZ4u{HL7sƴj}4%Ѭ@OB{ ߝ<ĞİR~b& qnLGhW) q[d3`,9x"uܹ3X"0lc*lc"F3ƣ#Tm I:-h8 s9[Ç cOFmաwqOІ%ݻ^C6Zf9 +;|^ zunsh4:7?_cЦV|JζFnqYs _hFuwT}[XN᱓i֖a ,]Xu U|펁D XA<5ّ"n#`@sviF(o7<ۨKPo٬_YWaf PFڟXF beWeU䏒 JFʢÍ,tMS}VqK<ג"P {8Nԟbl@qq:mVu040;ܦeAmxŜ̴$[,Ya]=<>V@ @AjgҊ0;MQflDBg-m <1NJiي'0<֦@[ɥ n;;"% ڑUj5Yإӿ6D%}R|nவfBaM 4ytj2Nn6q9<,SPY0[JKcГN=$(=Xؒ7X?:0p7O lI~x>GO!r#A"0Kc2kY5ۑ2ڳՙSV/6%$:oh|ÂyUz-[D 07;WTyYN. Η+ϪěFFS/ 1N͢goqA jqb`d(2ѢO1BFuR{} zrBd'QA·#900) |%@IiG0€ b*n99A9X$<\^|}%X Cfe"" 5l Dq۲_\mlm%W/8CfɡXŔ&r|t>=Y3`FtBאߗ[׮)+YdT6WPZ(pq{ \Ӧ,gNpu-wbj&X͚lcONnyJg)IޮϋXg+3ik,.Bbk43Ihm" 3|{,Fq@X)iW]rDž +Zڕb6q,2ڼ?QѓeVG+!ǧF=ݠ N0,4?|ÑOXL#RhUXuC!m\Vh,2h6T|G7ݲsZjock!w\/R]j:a)gy)nuc@N%[ xjiǁ E QKβc 7ֆtF83?r 5]:߯Sͧ9-΃,dfѪ [loq260i؍MnqÀR$YNձbQ3DKE-uv@*)涫Rua30]k(vuՖ -b!ka,^w5qgtH1@ LaJ~+/3Vh&vXuN!uؒBTg\-̶d C> wѽ+HƵ=Lc]*mU\ۍ1m<kW|N&tT!y3>cSO`ƴczYm®۷tX@mU{az@+cLn0L{M3ΰ\hˉ"E$d*S&gAOp wӋp$opV7Y"R?n#ͅ@5BT}Pp|{urN.w4g.nM0YjcTIE:iL>O=qIsV3} x܎kԄ`ŒWWΩ!|K8Vcmچb΀D̰pLM4tAǭ%=r.w:PXg.z4!Fڿgss)}{9g Ev4ͫ~m|ZZau_ ĺ`D˾}UWL(bKqVt `hJm_h>-l91Dҡj Zxfs)a*[eNQ:Zz|)jԙRqCмU&|S(>vanX1]X4yL0j %]ѝ\˒i\v|M7,z,6tKŃ= iu[2z,"0=v:^e>+X,"YE\P˦޾/5VUZ7nQ0(Fg66/5j3nqJ>#LS%'⊈~ɇmu8l<2QûWhQl`#/JYG_7_OJC4V"0yVɉEXQmPΛ@oe{JXUlq/$Zҡ"n|zSsQ$Ձuҟɑ[$"pG:ܖ;J=hiDS'<=[ueB!,T4 4l?IΎ{>>WO *1ȓW[kr3z;62ۍ+Ů4k9̃V5):4eDЉrOx!yLȺ\ =y}>RO5zDjƄf́hh8̱o'k)Hn-[l\CUK:Ux a}hUk0bI&7ͱgÿagTH Tg@-|e㎽lk΁MSCpCm|keF.XTΪYrhC'\؛ѧ+hτi= f;MĂ#mID2]46(bRk$R&omwHIH>rQVsbnS eiǙ5&!]뇱!w$a"uHŏ)}ec,UUErn/6R 볭x[L!x{@Еv݄mCg1'3Xj;q4jKY.Yf5a`H$6lg'0[9 x6CKEMrS a)`bvDhc4%`#dIt*Pڥpj_73fG 1FVyQ > $aRqHM5_i]BaI :E 1jiyh=܀ͽ+,d{Y!Er#PS>xyR/bfp|ɽSBlM4əӈL{KQdy>txT肠v=o8`^~~;bjrf>c{1XrG])yMaT="lj>xZXK#שT]Gܝ763?nELlV^Qj뿾upg[?q8QWv:AY7補\Vdz,eWp,$' 1Yi#=ZƓfˡ,92Т Z-Δ1}%^_:rѰa]׵Fu%I<ͤ Czz#0LZjLeʻ= ӸwXeOA H[e›^uq)iI_o05+*%HFbu՚ VmǼhX kK>rvַƎk2Sc55v) \u-`Z,V};!+Bjqhk1,daKfj<Һc*AE6|6vHoT4̱.fcLZ9mmXS|zJH~>k3ɠ DϢ~8!>HҤ8-a͝VXPLts{v?xxat&YPb6!4˻vJfk`'XI3*ēkLgD& u<Zq~ז]yDŊ??=3-M (Gyl&.Y:\Ow58JzBzїP8b5|˵=4YG8] lo8`ϋNO+E9rq{L(T΃A,F{@w[52Okx;"?>==̴_8!c&l,:Fݮ"-hO%M0-ѬOhGyxqZrx?' Tumi+#:qyg,X9u>:6&j5Yxߗ?:^SDz \ǺxUh-/E;'@FEf_rB? 8$/9$ ȅF E=vaPϬ&P~ңA3Aw[L:UR?G>`Lny,=`IŇ29U, e`0p,1eLh0UEqJi+N9q9Fr"hF!j-b*qY=fadx"V}m-E ą2Xmjfm9k6QOF, Z*BO>ҊldVbXH@@Y>vi@} X-Q\c~+6\CW9HgƎNe% q}k5uCnm~.E,E1z&PV[>eE ٴf̘7ػIfl0z`=:UP魉@h͑P2g(Ss#*Uz5l闍:Rra'9>!&v hy1ρH6dSh|KBMОH2(ϒuX$ȕ"d .GѢ{q5!K[2 DZ0>̯bDEΛKRut[h pCP$`ʂMf;gxryrBA[ x &Ex"(`a ,Z}͸!3kJf kX_5T 9jՆ<%tC~|Ԯ ?yq!HTb( R|,iwVi'ՏYU.cmS61AdJ(8zqǪm㙬 !rǃr:^bl^F' En->lgq!c m@j\N[6o rmS"R'l?YxG :j,"zǦ E񾾺zȁH[a51;`L#i,FL37icUФ1H&)w/H:[c,)6ad-_4g0"?AUHt]4+kaґzBe57)]5m6m g0UI^zоƎQR.{6E6p"`f' #ͫ`816Qb S{w,oD*OeR?6VJztܜ~~ݔ"JYq֟]8@6)5?&_`Ak.Qшs=f/r"y=RR!cz-Z| d!ƑK02a>l^q:k3ڠ!mJi& 'iLJ񩞧JY" ^ư&JlVшZK񳕕ek\C:>*oEapy1X1:c:s(Έ[8raY}3`A;~=Ym=.9MYY `8 -K.ÀC֛&bpeByFt-1րVӍfŚև"-ejv.CLJDms ͠]PsG77,6bXc+*VRC)6?q{XɬDr5 ˑ?x,{Z/#2Qsݮ^R/cIJ‰ҴT]}x ּYhɛoZV|0r65ݺ֬85RGe:!h'u^@U^Wcf́KQbRGwhdϫYדXW6ZX(|k o˻N88Бa0 ? }x >fj@L~nK$)ԋ9% 9M+cBec {BkG:7\_a6zw6"Kk}#j ⵍ\X=Kc)6X eƭiEsnk{NNC)\&:x(֛FE^!R f^61G*h J22.ѐ:fϯ_KUYy kjp Z=۫۠R!3*ًƑJ?t"^H|5Wj/Ku.+Gty^54 O.:g6`eie7h'>MsuYͅHFRwF/X{c kyZ\F΀ǒ*ײc5n#Nb"&5ɈbSzSMkrugҒA/ݠPCě#!/ݻYR/fEYSqJ>Ct{yFZ2I T$94۝n,`վnkr}[4.걞k8.eo8@2 x1cN(u`nE&+.\5DOZt\v0ew1(r<g7_MMKZ$ڇC&*QM(uaz6/6ޛHEfMӵ$1_Woᄒ~ήEX=;6֬y^X-8Q(#@h#2 H '~;er+r* .3jZ! ef_@FʣeK+̻-sZ?zdby JFSF~ XnS?žwc7OƊzm>%H -aci\-h > ?6dFF';C`S23N,\0ÀDt`%X}a +8܌E='"J/ Z-%c;"Ӏ&z>I3FkMc2 fT|ꝣ KB`)*o_3a)Cb1-Bk~yH2[:?esKɜA13Y[Gs-?c'(M) zQK;0QXߎ|R"tlLo@zk3xXe cʉD4v_K}X|e*==Y/$2ę)lGlAt[m+Q[tp#KblBXycѴkR)F{Ic7 -ߎVD 蒠 0{9S&ѬW}/:!ׯ5ìpF״ב`.NpUk>4bX!:;4hYn8f> v*$3>M9(茘1D%<T'{cѦ8p-g | c#WտY-#3$\ES9Zd!>5=Hjա`Cow4X#YV66>a1pFpx [qkY-]Q.@b󷌺6#{kPWDgq*Z U+<Д%1`j`GKLm$]X!sɕrg8TB@5Bc'Go H>|Z}cՑp3+D0ew\5h{TYdtNj΀\wXy1b.-vcM8B\`tb7c{lZ"S`Z`#_} O aad-b(1Elv\TeS.IvsrO3S%l{{B6$EtY}ÍL쎗[o$Yjf:{&ǃŸƁVg7=+F65-ݎŋT֚->eҼu'pV K͗SlLCDGt.0K&s0ˡc)emxxvjYdgNh2`р֟8rͦtKӵD>#W#=)F%UKS:'09хHjd0Ӳ[gE;7~?A{5=-nn賺ZXeJpJ}f61[D^md~9WX~ToTՃ\gV!ٙy\|J`YJ)`:Um)Ml:8HJ`Z  'K)˪c+ F{o!0Sp*B$>wc)6YJ5v|m܇" aH6E!B^Rk&1jg_yys'+s \jӋMgl`na!3GziƚұVÙI%dmۏ0IkF^ƀ: oN 8S#$ugZӛ ?j2iyk[^gKz^N"Yo˭yeɆ55Lp ddʚ,nTʎQpDv8-yP2lXvdS AК5<Ň'|q2Iub:$tz\$JKMGs+`SB65×$+.-qv6\ *F$RִW;ktFCZ}E 2'pʤ4;62ֺ&-[e.Hk̨^!zk ,V,=DWG؏ZT%a0K2iT_hdY9 +2EHJOt)lUVͶ`698Z-Eb#ͱjW4)(nظaR7+l`]V݄SIhɉJ=Zsl>I2gUє2[/n*gA1TzӒm}[n1fZ%XfpM0"hm.@B Ȧˣƌ \Woo;tzm .d" G]ܫq`¬MVչ1TgT4" ލ y[kFMcrjEn؋JAH*qhƌݹd־cC*d$6wc6BJƴExk)yђpj/'1XlmVԟ9qT5h.v:Oo-N5gi e3ڦ48Ʉ"VHg]&x%a@%bkY"О}6Bל/WEG}n! [(̰Z{;Im;=qruR2XGh=8r,ku>).γCdBc0.<2C.j̪ ƚ Z "]n.u–DŽOs6΍=۸5ɯATjN'*bo^z_ls,zۮ^zԕlʶ.Y"GiYL0Brw1>18MgEDїXš ,XDô+%y(G8\fYzcuw>dqe^'WPc#) 6-|CO-X m ! zP$qVJKuժfb묵YHRhχOmǁlq79'1+PαiZr`R mY`ZEØL+) BLT#zzɲ ))L=I=zywIh%1K  A#ĸ;T]*=cq!2°0fe9pqȩ*euR-~;ׯݿ_cČ1FG9m~wߺNlxOJ 9Dh; P}ەBbMJ<ئ3ЄDһmV=J%kҴlmfKXzڣ: >;&%PqN)р|^o40 SMX4UYvk@=lxĆFiGϽ,"Pe3֝_/?|˧! t-X` w(RN4F^Mr E""vZ0B KF> M#$Ò@:W zkӈ_Q'l-{:U|K#c2biAh4+ x%Aȶp ~kynUc_10OTd =%8Fӆ)%F"= z`4B|w# H'FYan44BfϋC' k2@!gAkV3J}17Y| cj],^m 0$(,F4}ϻG ɬֳUּJlT(M:Z+B.B"HȲ 69;a2N!a?(XEjZI&%!fejc҉v;UFPN#Hi\DCƋXIYC`ÉX3UX<ި<8=pZӄ'jddeץ2d+7Hx}'1fq5Gq*hW*AZ->~,u7Ǡo?-R+QǫP8Ћ Wr}DXI ϝV@݇S>lZ``'h?O;u߻W&uĘ}|~;ЯYJ`PMJq-,*6 |e?vYX=S (RK OՏ&SL#3AVL-%#ۚ!eBՙ68W"-3l =6jvX/.6;qvXZ0BŽJ!!`yi,^k) JBWe UQwvs~`fi"LÂkDjȤac=GK>rH{SaWLiQK/Z1?r)]SZn9^x tW1` iK!Ü#B!/M:CƥbʹqdU̫Sa k: &`!,54CJK,Zs>nܽQquS^sO,&iOoNRs;cHAEv낌MN^y`Z2`[(&gH} }rPhi2Us}FѧF В`qbQIC-gJv綌5N4%{x єdLeB0kdMgB 4 a>@ZXώѳ4M^TA" $7f.AdK`&/ޟssP\;FK d{"Yl<-;?;WWn͑-h3O$ 7:;ɸ37#"O8We1ŝs˔q}RW@xeLfi#]Hș6TΏ.*_F5SC,6X٦ljͦEP&# 1K77aI)s6߮^ԋ*ԏ9rn":-k3ѧjEQ`h}X'iNŢ-k4k" YQ:`sd.r>ҴBς5 j a`٠v*l }^;3k.Wrf Xv}'O @IB!ODp k%l~#wvŒ`I466 )-k}THL$%%WD<cƚ[ | (Zs%HHǬ6Ɔ,Ů^lVucR(3:yK-n,e]N2)ǖg9T# 8-(|잸0GѩѴ: ZrĘ4MD5)8{)bضk۳j΁mv wZaϞay|c.$dV .ӘjZ3D WiiW:] X*rKlD $k'~l44-0njAb3cY`Kro|KyKTaQL\aot%XOzs݅{>\h?9Ί],ft$T+(6؞M0@2)gG쾏S-x0O x,ƪwwn k-6V%Q"%B&XMXCM*TFJaXջI8LLɔb s a%3뉐=j-Scdk&Z 50>`6UWn/׽Vx+*pWMzŤ=7IbLoJwGy&fxoƛob{w 3N)c0R{.^ h:ڬ+R^UzMp[N`<":-/49*2. }7$k4F_n;QJ$..|R)@i ' '/wI)x{nm m:D ž)ͮIbpjWcML0!P5\K4ZRIu`8z o,,&,nuwzM`A[g*zU]!#F ,Μ` bW^h Қ\:L穝yvA*6t|z-[$'ʐk޳/\051:Ajd[Cq0^ `$6IǼ·[=m؋QI$`Q3u5YԽ洦^Uu֠*z, ]w-iR} H:pӒ'0 MFc̄YKj5ǨǨNh,k99<"尀 >DC:kYgHcY~zmh9LYW)ՅoVY;'%1gƤXJ/Wj{;B{mo2/“z׼NO H13ⲒVQCWlb!Yz%K|i(Lk-&37-.d4hػ糩,wX7u-˺J-DqkwdyZAǗ`}V&$tc}w82}Vi׫hRRÜȆr&jEPE)^mĵljQ2X{Ǐ=+l(m E<5*fAQ]c_v}JEPq#FVaHì<դnÌ]+a =dGgD*K8VfB{ki)B2Cx&>f'k dL[0G, du*ؕX4Qo$H`-8L0Mlp4ZWjIBmvxNj), c6Ĺ}1 ֏LSvZky?9uF?70[B1&!=&eWaBDn!(1U_ΧɏݩwR6C=jX р"RRӣu4~&7|$/Lj49{A3(5 \5iaO7c{kUJ Ù ,U34Ɇݞk[AXE"1xHK¦y?aFv"T1$طx(yl ғ_/{QTCݱQf7:TFX3ƭA`Z˭iM7֜aeȴ qGK+txkqQ"Kgt6Smow#KfZ0eA^YֱKcݺ'l6VYkWniqMSMԛɾob;spk$IΫC5 R%W a_Z4K+1VaTà",19<:&d6[VgL\#^|"^nf KeufX18H)Ռtbb?~k6&F!Bֵbhtڎ^\*9% …O{Ϡ15B FqTϘJ 73N$}k$o#k hxL )R$x c6)5,c6ԒP}naEpbGL<ŵ;*p{%arc< 6\5`ä@f C'j(8Yv;`l yt߯ F^ؽ9VX$9,6"#S1,6<:x8r9B,)ۑ#yJDӒ}x#SOPF(2k삜E$dTџ_ҙhMgqz]R9Έ" 涳? gͥZp!΋ngמfLzɡ:RJU+fӊ,&1L.}V%uR5tW$:q;+Icg&tqs)wKkC8]2puR;"7;>E YĹj<M,^Ό"}wiG 4cSmZ]MER|[9ۏ; Ƭ2( -9hBWj$Ca$Y5[l:S]>:)]֎Fn:eÆ#XKC+ F&;5Du)u'MHc>MpԱsEV8֍W_(oj=YW)пstԿ{yE fO 2^ r4ePIr~^k@-Bu>͌TZO߱k--tg( AFtq3qȚ5cS-bְ.Ʋr(IIIg bsɗ26"<{3ڱ?7=b٥qHo(v:LnKCk(jڀ'wkՀx-5YOK0ȱ<N,Tgx6b$Z ;'A1>tu[L drUGŒbSIrMkjkj#G-R)KgH3jrn7'tNMxc7seN"MT)C9>oi2yc9O9Έ>8<ǵ;3ޫ1v,B/)Mz `k܄=+FΧNdeN#\ci&0TH.ek} gE %kSE0ƂE)I-zfKo/"mZq[B$y@ghijwǘǩBL8bSMK Ιn/LC&#kcHV2.Rl{ib-Q>D`ό'9JZCl$vv9wBi`OEfWaGO4j0a`}DbʯYi%i߲ kG< vgα٢DQ+9TeOήLc % hc. Mߺ==!$VLdwN43):>]llGlj6zcnt FO6623>f{8`Nm^# .iL8zHjYsug,:Ydf248"XB8-UY40n\ylfge>PcLzZ>.CzqmˏXka*Zq4Ѭ&%V\-Wka&^Ewg\4a$8yENRWT\ 9 rZ]P[ |qs\`,Иb#+-S ,~7iItNgڟx1vg[y3&pr4aY$z FΒݧ ]+&mL6XVcu,%1aNe ukdV_-ՠgurTF ؍a+Ržw}Loh;Qe1MJD")|5`EbDW =Vfb[mWN4_}#S6EɄVjjsyalV2̲4 XRʵ̚9ݍk$4:RGkǶfXNE jH["+]֛?qaJ+^"k 3VᆴXCٔ^4zVRR2fy\ToG3fu)+'v1e)5cu7d[Z~wp{R9@0aj\Z JH~;A<7@!Z/Ze#H3! nFIM9[ #-:΋i ZMN[Dŏ:vG}ѵ%a ɹmZ1bD hkx7XjF?v@Gs]k 4IKӘRuH4~tvwZ$!Bey&^(63u A<tN.xzK4^48#V"'ƀ۾H+^oq#),?g >]QU^YsBaj}CXnpmf^FΓ-#IL=8r.:U*cz:3kYMkF1S|bǒ%=(ecA#dJ.^['`zz!JLʲĽ 7{Ml5U ZeeuWIe^_}||۸M_v#i^=eW%9NkT·\ :=Z.2W匛U֜I`0໴Y v'Q1JQ֊<&Z'ק5XAu=e?X7);A/}gv !vr+yW/i_[ f/[`2kX+cJɅ9Ղ? uv~E$$j,Hhh۔tg:>/9K Vv'-v{cEai4J[b0Y{EU&?],U@Xs8j=0a\uhuY65A[\s&ѲÀO$RL*ua=e"p*M,ʑMae}uь8~%׷1 aV\#,(ا$W?^nϻDLd-62 ~ g|tJ$ %K:rBMNq2oG$(|c9oĴiOvUa{/tWJĥLnwj K)bƳ%`]"o&#&3WS던ͳF$sE ;Eqf+ͨ#kh)D丮\4ѳL| gFpBuGL.iXy䏖B#>k;׻.([jXBx&W=-]rc=kWELKd`bGt!'۬ Pf\x"/f<^)VE0(2DRxpXf jJ6sjRLuHx|=eg[H6&:`sH925Hr+$Q a [܂aK#cԢ ^=+551+ )2ٕ C΄hMkZyѦudMGEZ05 |͏pm;1b'a aPW%Zg?=7'VN@p?a%gm1ǭC)і,%f@cB (97TN+\}J]ڐ]6d]cmH2X'%kFieQ.:q=dS6hU(eˆ9O>U5 j|l@/H bym[i%^n\i06|VV"ze[:\ܚ[Ƕ1T{J-/\a,( fvMg0oX#)1 ۾4,,I#XŜ.Zo8Ν*| z,nrF>{|mVhmҨ`gϪdDl׳鳛a4<ĘpAVѮ/%"O˸4Ӛ"YQY %TR2YͱDy2]9sOVܩ4#0ZgYK;. SIP}}ۧu?}CFgtJit @x +$l>Z'Qw6>&kn`\.(hm͋ır# 6)WcmFr#RHd({m.&lRl4kn-N`jӌO `Y06sm'b՝#匭9Cيry<ޗ8t#_vꈁґ_.Jўx-e&`d=m3N4R>JVf7ku6BL4Yh!bv+ A-ׯ k\#܀y$ ]Fs.؍ ϒM^>GL`Z0X H K=ðFO Df\4lŏrb}9X`mgfU3a>Ԣv^e @DjdžpV:00No HL1vۇ5<&Wڹ9k]uE3 / Ң[Y6QLO*z ƱqǕ RGS[Ll[&+Zf(]b "zi-[`Y 7gTe1, V[!aix6@+:z t-h=AVϤ3U Lfu:dD19, 5u|.#ycb43duuɹ繌(,!icݩV(WbUҐ& v8@uZc'y.vwed bd+"R)=lV48!hG7 QUD1zY#91`-xj O UT|e1)Rh1O,qD@ŜZ'v\X2bv]P"50Okʜ XFgTc5y90kPC`S{8K\~S>Wb1M|tqMghZ eLB$V5cկ*x̪eS3#+ɾ8Nf}bmCG\ HhEV[bx"plT6+;F׌3k gJDf9;5lJ?oS Rhڰ̺L~3v=pDͬ?vtSSj2T%`8X\XjsjF܏y@mKKbOѓCO_y'4z[s I}okQk Ή^'}vFJL5!'};]݌"jTI6cQ¨f5$=25F?Oh5<B.t{b&Yvo+3MX |+nĭy!=XX5VNu zS8'|PƦ!ŕ3L_ѡ{}N1(G iaufqz6-f%j_qA6*}|-sVGX:avO"Usj"n9؆ۓLjYх,>-zWwvp$D{Y?0Gg:m^6|4QbtbӒdF۷D&{ v$[[Me9j>:>}fN Y. C.e!|G&cy&Уm6ݪQKnǺ¢-%LnQ@l@1ˠRN g=R*t^U fAqxyial0HkY2s_~sgd5qj߆$#:&4^oXscI{W:$Y4ݦ0,%OK"7A r k^O : #R6|)Zт.^1&_28xeH1˜hn-V5&D(6R<ٯTǏfW(#Fv[%L{.m&/z]!'*"Y@GF8Zh {k PIKltX&ύ$ŀ.Egc8H0CaYhU9YQt fך⼏.8HD F-`GN2dE];qnDt^ƣTݤ@qbi)=ۡdmܐQl cڰ.L/Ae&ޛJu,!,x?T7}Ǽ"݀3.e+(Arv%G"5FQJջSVf̠#C>tGNOyǵȘC{=ӶgZolHe=F6| 9Cˌ~c>)/;R -ثFǃ-_~~4wZH~RǾM, ie0yԹtsw1-Vs%pΩU}g. 20ֱ~bX:!z}+f_۵ L-![>ooA9BA x󠐢P4Ίw9lgm`UyybN}g#ŜzR\;l$Rzlz-wn-ːS9X |CXVRKTZLĘnj ;oQ,a**󫕍# "YX ek`$/Pz܇Vy*<'k4 I65U RxXE';y("ZG3<^,}Xx"KR͑ũȳvup}HQ("heLz<#@:SXՠsBϾZtcr2^WE[?M_02.E9qi7d'ZbdW_f2t a֐3Kh({ ԅ |Yh(vgw7vG:2`U8!EbW4~?R$.qvD/i'SjC5nZЍᗩBVzyЊ4Զ?'; bḙIHZC5=u q7&ZBګ>6~iGhP. - |uo>4JCǕtKuѣ6^iq '&cA/gd=A#XUi?;i,OVP7ʼM^.-L{m<9͢2R8ħػ8( ՚?8Z){*Tv$7|3f2DZZ\еG>qdN0]FKGq8F5$CmzҲYEhFV%UK1 Vu,ϙ{4,qpFqAzguV5'I5F"ϓaEg.Ȯ".GAbe_?lhi΢Q,{6'4PQç p3"]td;=dt,f: iU0DaTt[ǣkVUj'v2CG2%+?r7'qy݃BmDyuLq J*tjؒE3γӪILxwIrȺػhxuŔc0iF1Ƌ)N -k4蚼akKGˀ9 ¡mG^ aU >ύ[v&iP``) kܹS9 kx0Gtipla˟܊(~^p1ےr"'n<\ߺ'9'4ύR&KY[֯YKiJ;lEe-XҷkǺSg;2:-ThމQZ/FL/Ms|W ^X՜FB2zˌ- ZuJV!w^z,!HaT[R_ xm>*4۞ ~9'Քaˌ `ZJo^B; IsN }_|' 'iRo!P"O[a Y4]i.;4KhtshN7B;FiY(J(kד(e| buh9c9_e6 +4=8Ʌ4U )ABfQx6'A̱Xao\\qҔ7}?o߼2J-E @ni4k'&%ؽ[!\'sGZSvF@HqD>~[8:10<"ȍ`dÅ3-њ0u77y3ȒϨ3c1UF^qv#ih;j ߿3hMRR6êa2} npq`חX2<1WQw38Ɍ:뻏vγ`d#cʶ|Hj(r'o/`ћKVriK_HbrX֬fJ 3B#^N s Ycty%uXHK-fX$JxoN/ o|Y>cË&\5g 9hOy¸3Objc#TzBolHE]%{Ysek4ğƴ1ͨa=k;la٠Dx꒳"1kI8< 9TR(UZrιq(tfs.z_csdz7Zs`J[G}@J ۠Lk Y&QqY97 mRP%H0Igh Ehv{Şמ̤Ke!)Dj0[*:taUSan+Cj`9wr:xn@jrì׌ST`|w  B?)eٗ'[(w>&- 2rDثf%׬)hį64ɺY"{TZτ?s{++V1̧?u8Sb՝/\$G2Ijא }v<><fARh΍r4A&jlvnddž~r_z@p@ Ś(e-qǓvJ(c la#1Rc:e'[=1SʎݹW 8_+O`ŭ()(3|a) &ؘJ6 Qd7;Rxaⵜ_@dfԵŨ1qی"dg.jZj4)V)Q4Q֡krxaJ"y ѷLN\}߾R%#{Sk|P n(Ӛ\@a#)[*^^$+d.L݇saӠ}gXQ$#5aւk5(hׇLT6O*YG>Iޅ^IWʮo"XeZ,x#4_E#*!o{63蘮ƽ[ѝe<60NhɬE¥"bC8t3aZ*o{)BxT@,"Y .o@ӍVcIfu{vZ͕51#kd)0УrI:n8(ܶC^s "1VIQ98ۗ'n6 &+OnM'ˆZX@L4DͰ[c tN @e YV\xHq-V~xFlk%X ^l3byH}b}_G2KhW@ju^`&0%߻ ƙSjs I+"f^E0x8 l:N}YYJKyD!Yt6v' xWulZ],bȔ`SXtiֲ1=z")&I5vG,M4L+7Xv8Gv`FFï@bK9jϡѿ=Bsb {',V?vBA:Gf95Ѥd3™ ¶U,jxfW=|g# g\8J¨OVgrJD1ZPu:ZE08$:iʚqQ[I4 MB{7:7mDfi9 IxzAjEj06Ґ|~$Xg NJVIxҨu%VS6vqNX`滶`~uce[\ lUHPr}0rcoEr*?N:|kzFJ>/K,EZb =ԆDEuSHK}ZZ7,jen8k8Ά+pzX]k6z| e9͐^6Nv-Tʗ86J6;MU,D'%1J_ၩ%ϥLYDqBSXHoHjp곬cM XMJ<DVظEȶJ`bǏq`aՙi=mEBۣ8kISv}"+Z1+#K!Y@bpVx?퍑`,uۨ 8qqPMPS$(5Ax=aίw.3/1K948uحL'˛ƨlߺϔY48-Z:*2%ltךRAiX3EZ@RTGuqbl+im[%R<@ YɈՅ56lhiMbC CݺfV߶3T-Sn-,!Ⱥ03af5\C:L aΞ[J?twNmV.`Է{8aFtZi5f1pMbUy+Ҳ֟ 'fo>Hy)&v akN*E{ iTر & VlhmnR,zO"3UCjCm6$n!Ę@cA1\{j~ջV;8fZO)<\xgޘ7lcad'2Zݻo(%Z&kCf=pxjQvCf14$:PsWƥyXI{0b<CXpu^qO/9ϭݮ8˩ *,L](B=h@g4ĉ!C%I;[N% m?-pO$#+FhXvfӏջ]n'c֐5I_ 5jUH6g07U?wJ`G$+26ñ~s}7H ʧ=׀[J hqaS3¯3ʬ3)^wn>.sM7_Ōnj T\k 󑡕ijXcBK>igLH[7rQ + V1*Ud_4k9d8aO+^ḮVD5]-5X))H\0l~w֏cF.Z-sIqqC]FL-DpDnX'w:kXZcGM[q=mQpN2XLz<G;k6?q%vZV܌ ޻R*Da56kg/nU|5ZXǫ9G3lT':<ף."ͭRkjF'Ǹ9 a!k˂ IӍQ5/6!h&$S@9-d_zLL5؍iqGkeVAX7ݮy XQ|kTn9@`6^k,8+QZQ%yY`F*C,Nf&6(cp┰fwtmiק.-&h fsY*k o0 N:zFן3,4`Ĉ;۳g6fo LӯZhTe*ڠ)YΒǖ*Dude 6sHs&S"X*K:jwYEBi[(ҩ^c+,[B~xok#9<7hH cS"Xږ=ⱏ˅X*Nq0u܍s$ި^‚=lCbOͬIV 00J{"Ǒ.!7wGV Y֜(auy]L'Xh֫ihٝ9E)"{b ;Ik틬8t.qE5aTc~h˦ 5':y>b8&"OiEm>(8$0UYE}V`N11`#☋ʂ[I>YI~߯L#>jxdjbZz̙bnڹP4RMe%&в%JcjJ{dS>5*`-5fGX ]YHr2ڳ:(QWD튥!Ll:e)&̬e*1렫8ro_3j+5Nx8jokRb+2[oR/|lѢ[Aa7Yє+PD/WGn>gʊYB}fi]9`/n3kńF"629Z c[sMkYWh׻Zѵ h,-mU 6\Db@e`d{n2Y~wdȺ-hTjŶ2CUT˙%k,ljt;]28 Y!͒f@jVꍩ^:sy`֕Iye+/fUZ2L$իj ȭaM.p⢝֧`lKx޷sQ l p jMIGb0(A5/9Bu0jIٕ!vraQM+k5:NnQwhՕjJIk1M:ZъsϺ<sIɌhIgZ.7,%xfekko3J-,՞h|~~9YÌkCؕ<'&uoܼI |羵Pٖ .!5vm%zЬ$!ĶjG 8Ym[x7u6M[2I#yUL34ĭ*nl?b"%%Ai.wb:i è'/EOϺglUN-"Dǐw:TױR˥<< 'ykTSʄ*ֶQi[5+X^Iϖ)EsܽLGsx?u8#/1_g;O/BDzγ U .V+rq`@NjUƳ"C"= >T(q%Yנ‘41 ||i{xmQ1S4JPR2bu0! Sj53읈'^;t4 ԍ878e6uꠃpiIDсdɫE`pleDŽ]Ez@2Ž.M!Kؙ,n_Gٌ5b`qge\jwei"+w;ᡲFhqmÌ>q ӓ$_O{ #-.An8kPMA$BukgZ#6Rt,4ΌPSGS]PC794LP^1Y2rFǬkiW")o1,C?u:bKMDZ**hx\Y#;(,ű ͏/>kG[޷9r k uCe)vqe&oxCPxS9ɡЋgaޏv) gThY"VSAQa+ 'jkӌ"$., ,eOPkXE#>{$٘qHbP B'IRjm9rZIyKsENu0ئ7Mbdq7nY/+{uǃœ'tT*% HI :,谮W=q^{|R-&tzeBtlTgJxa*^ICJKj;$ddnveB!7.-XakPdiʝ7ER/ԓa^=+ƦJQ,|4<|K5Ͳe6XKl3c D86{m .3J4KFi{Qӎγ_kA#&3Y#c `Eu;J `C۴`qa w ,sK i X,op4B@.5hi*uN˜u6y2gEPg'弛#YcˢՔ0YR+Pg2ͬ/ql9>{cKԔLwc}ځZ*}7/}ڭkT v13P R.0JSoX=S15ON1X /9bQ*5ZW $a6D#NZ wTijc4vjNx/tk t:5gi:(b!_0urj<>sfiO2\ZX/=S)7]k-Wjƀ'qњ9yIR\l;n؍Sդ}|vmS@;їI8FHv$qjY,vp^ގi+l,,qa>=Q9?z*jA+86<|fI&[nldH8Fɇ|5)3aEJ \YԱJZpjθO) $"4X VŤ4fǤ,ǍNb(֭kyw7Cz<io0,wfK6XAex9RT#=%ݰ֧Ct} 'VPEt+"aZumX8 {<kJ1@>ώ;kI3N_NGFՔfže iб/ 8ÝQ't~~pkmhi!_ňnS6|JJQK)+p'0\9. A zG9a?$&SeefŤ]ө35 zT测:6DY`XZ ,Q Kơc P_JMyj "s6LzaB-~- ['Ž4é]ne/ǒxˬj%o(ْ9~c61xV~KɜӖH2xd,ސVQ-"d̶DJ}0976~qu`Σ;V&2 ;uݏw(LcӉJ#W77؋Jj+5[TN&ɍ ń-M}'vGN}dG.b'АhְK\@8,`J)G#0ZJ NQJ>&SZX}JkWGً0+5%[BYR=+/3# GMjqYu4ȒNukjW{o>wM/q{}>X/-U. aՋ> L6T0Fl;#5Nj߻\xJYriS+|,́[\v٥ gP"D1 5+>۽nu%mI]?_$8@`h84TccK3nrY,7Gg[*2,X 74Z'#DܩLwQ#~Na}p`}e aF5*%  &YP('Ƴ_;"FPm7]6o%BbФC;;oV\ b`o3<`g ܹ+fR4- W=D&W|OSV2T@ă(dLep|krd&Mb^e'kkP$ň)cw]-++/&=$ AA) :dVb:|>V7&2~{FmiIəS0vf(5X%XҺ\kHEY=ԱD,ƦmK˥oޱap7Jq h}鉝'-IBX+B G&-~5t2Ŋ esM0[6R8Ͱ z1c>%ߣx&fhHE}L9Q-6zUƠ%Q졅xj>vB|W 3Miu<)OT/:PСM aXӎx-BL/H" Y~_=2ZlO3E{X˥YuL+dUky[-ʆf,_&]_ T[dԡ/HS{:4J]O FRGe|ЕF=) +lQ˦SIX`XN!q5kHkXnny#NY*X,1%iYϼV֒C: YD),n$)|SŢ!zF[l5@M`ZKIZ?hie^,7u\U`skT$-E`^sŌ*HN:#} lx[-(]1W-ff4qzˌY^Kv~ucydh15XɃ4)xAh13~5ŚZ' #Y09zN5H&>@wkg 2BAgi&> ?Ḇظ|JV>ώ#[84*I]Mh2-^MwE4{d^0C8Rb͏rIҢۑpבwn1A %Ki ͥ  z:&["aQӧŜ}cgN#a'ͮbpL'gIZE"$xrq&i&3vB2Sb@q:OUs[c{$AƁ+lV+E@'k SF& b=:Ʋuf@33Μ.ϼܘxA&AɋBfpVdf1hcutVlƔ=eúBx3j=quȏ갞6rՖq30K*ai?@\Ez0M9Ɩ1.l ?6oQx7L࿟mggLC6vzQ2)M؉m=b.&yea04z}YCybR\AQ6.XbtCɏѭZ@h8"R[^'g8u7GTs2c/<)4Xf ;Vog}/P9W{vv pnF®)5Lf_IzO>|6V|I=y'3ZIMEq*pŅ? `یN#継rFrG;G3u1t&>s fm|ۇkr]ן8468cgB{iA9QXe`6n1/ s^@Xi iz^ Rم6%rbG2䜅ZǃЙ}+-XC.Pqt+ΐ&w 3Uee #1tڦ!ve= YOcc]㥰4d`\D&S}K6L&ξnǎ3EL> H!r8w!؁+yX\0"= /yw76 B^D'Mzy먗I ņdi}}=M5JٝƔ>X<Ը[Q~)2"jY6qإ-BBX}1#2g)i=z{>Ï?6" ~i:uk"p"Zs<}ρ0b\EH[&l.Ċ )àj=%'lcmn.y+akuWP֨?x9*6\ǑŒWSSM$6ׁ`=x{y\Aa,'D?g\G![d[ g0&2>?Mae$A"LfP洺[UP_zͬR5du"򈚆D"$:l3oyO10e+4j+ǩӏ ^F]7:G MX!iPs 1v 5WKtu2nT5Iw;&Xl,xs&\ / ڡ (uB o!Fā L_#uyx`|<_~o!;-ˢ'`Ju4 i(IV,mM}/f7٫Eܨ5^Bj~/_U|CW igYOǬ0ZԜCaj=,D*۱|qX4ι8Lm,#,KWmcZL0?V͵ŽeI!e 2'gx?I#|Y:$R~e SɊ;TJP:feZ-P&룀qJNaa޽5؈\[ 3y\h&ßRbiBos'sSz"ZA#Xbr˻7WJa#Y4gށS])&1)ѯ :Ւ;cJ?n]X"^!{6]l':Wm`2-rDa0a8]3KmE,G-MJl/txӊ3y\Ϭ,'4ID5=p}v֒,;|j4= W?rbO`dus5rǻn!G'lkP4qH]̧4$-xLZkb 26L~z&Pѝ 㣲ɱ[I~u2t~ia1M1]΀Z~=Iyà#3-zEgbAk~w|ބiB{Cg d.cxqrL$lE-< 0+:qHc mÓZus)~;3 )fevWjƝqHd|yjRBPM|t(.R2e'n݂SP8kxmQQٲu`\T]g+Qy嵬EYLÂL0eáaV*XHkŕDzx^=؜ݞkkv1ECe̘XVg$hH 1eڌ#!6%g e\j? yƗuQEfT˨FѴbhn @SA(D~4ouG HJHW "y|#¨㜧T#8'WVeW9Sf${`D̹a/[Rs]Ǻ&h`ҙrgdbfP%V vcǼ~ӹ|(3 3BN%sEIMkvvhl*$Ȗעv֢fXaA,͓&Mr$z2R{QkzEOSW(l 2KXů5T~Ղ[)flZ@MbJC 0RBPn4:ט؍&U dN1Q+ljq4z0!S9Ta|< +jkej&^MK0Qoc*ݞx1*jx\֔NCK,ef9 ĉW^IZ0eeȴe\5% fѧ NE\'f"v*ٜf׼uU(6H)^vw^Sl|qr@PyR#ojz9rXWRֻ8s 5,BQ䕅NWsCQs|pcJ|tԒ+8λS$ XW@60o=kҟG9ߪ#mODydz#$B_>tYYJQ%^!L:Mb߶ gJʶʂGS5 }vꙵ-+-5Q{D&Gu u.(N8` iorTIi*3*xh8k_fh0H` N`m8ݜZvdĮ!.H/`KMS6IHVE_q nCc4[ H* SS2ʀ IXϬ1j<jP/Ź$ 1:.!3y7Cؓ<9bT I|=3Vohi=l T,^Rr~O˧J3N[ fr \mi!I4Nf mE d20HN|c@\+ *H.W ίQ4#웵&Tk5:*TܫtFRN}:u{HCl,ެE p p荢`S?ziR\ Fm޳ ˬ^ӻR?yhF"C<} J< s u"UCRjQ2/mu K~ďD* -U 2ĦSEy^Tn1^Tܬ=Dg#$jl9dh̸+l2 *5҈{(nkTLOWQDP#V^z8LxȌ Dx6OlnF&Tds &#JJ L9 ,O@EeǺfa &b^!.팎km-7$ާ"< %B3ٕS̨*nxO8*ñ?^Cr(J8Kx"͝ieG1xsfkșe$jU"FZF=$tʲ+9t%Ȑ;dL\= >sbijbeF`:IS!WDH#3&F=T2 /Kr<\Fz9Fy9%r\uJKJJ#EE/(Y%$")*(gRaGFu)C5f60HReeTQ>w(U(ys&&&'X`U* jZgaGdiUh|{;eJ $̤JJ!4WP0ܷ,Rī;n\Jݓ3)+r"LD,?,TOߖE"40tH҂2 TAs-K Q]B$V#XеȔ Ĕ)5#M()Bx ָ(ԺEAYeL>ZaXIF.o]*UaqI05*])P}w*#!WhI*yU(hdP(y:g)!)bf0B,G(ABKxa&.E{ϳ vVK̦d"o3QjK7e] Qb)d[3 ,ʪ0$9b+"Wl~O. '~UnpMDi bz my̥ͦW3yّn^beU2+(RDZ|Ⱥf?b?xFOv Yn!/5#TBED%DJW5_hwY-P0E_oI,h,u`Tʌ^PxdXH`C_Ιr 78/ˌŰUb^ 㹺M"  (U"Xc*QD(ԋI^ѻɞG,Q51^ B{FHy؟=0KvbQ:NnBOeom)a!ZPYFxȿ2nFl Q*~vJ ^yXXBwCCA5)C\*0}u)D]_[0WL,sB( -+\vmY(IQfL+ҫ(ʊ$*ee^ ueȊCEǠ&d|&ad˾M XEf^j^oYMD_ytU̬HA$s#1)4 pAX rJȒR̈=t =h(c-S!|zشӤ՝`e:`phricŞ7hעyqDD%YFR+.'VϱZ!3茘 dGgI^+uy6C1Deu2ŲHLc%ڴC>OX0.BdҥSP]><ΨZĥU,(@- HuKFyH,# kPXHRbZ}4"DjW4Rͅl(-U"[39##W&j"Uʸ`˚):0Zk: ΂"ŽH E7ݩf<4f5Ƅ hFϜ FΖ yɨҨs#6u'[tҪ-8 CP̅yea|\I K B ~ *ƙ<v4j 3o.덺2:Wu>,k/b4CP;ZҶ~Z^Z K'^0^qT\Wι %gYL!Fgm/ﻟ? {4lY,%/hgG:r0E & ӋK`,$֯Ş5 mr~zkWnMﵣua?tym%eW;_89r Q)jԳp]k:?IV\ђw0iZϘƔ V}_1xRfDiVvqdӗSξ z^CT0Ŷv8BӏfP@f6߻= 4ơ۰KƲK8|0!ŏ5!@&P̷g:ݮF,&ߟ}s.kTΟDS5l%^N<6K MhDŰ~B)rc ¶b=Z=x%խ;,`Xu^=b)1=sCǾsrHFG ]{a]FL/kǞȭBf0+YZ+҇{@_66B0zv1ƪ 4IhZb b NCτEN_!:o8Z{FE μݫ8T*wZGoDE *x_,{cr֋#0%ZFZ%e1{n I8їL)%>b6|4UlB&"^B^ݪ71_{LprJpQ{#z6m h^44.e VVoSh㍂ M8%wQ{?_Gtgŷdu\PB@"PG1$ي_׶-LaI6bDlȀK.HUlgG*B2zJ ?g7V@&Hz0a'd.`w7 يQlݧ P,m-?If%u(Prj\vVka`-F:UEz0X ~7{Bn08D(gY݋NӮ2 BxI]ۏvѪ0X(ĤPg˕)tJ&l*TSKZ/itIAuF3-HLCb![+ wy )/4/H 8Ѷ푋j)DsIK_w`M-Kҵ& X@="ę#|$X5ACtα1wO$K86.Y4z؜wLT 4Q-Z8u;Qդғ$F/۬b r.Z&fkb9뻞|$z*I2FV9ԣ.)zFvx%`! Z9W"dNg=0J*aB*+"6xzgvykWie#hqMs kV,Vj&nc5X"tj۸=&0gU\p_Mc'M6=ljM=כPC,`"l$./ktX1hky^%m~Q' t9oC|[/aKM, "%rMze=&kKV ͹ <#BU,whlj~[wDobHBz3<4BN51adusFJnr~[O?-e4tiݹ,EI\ w{Uwdj_uJ;ļp d@_ow2s2Vy|jgX8mi_TD j 0%x#b<_qi?iM,xqO Ѭb5D=Z$<ֺ.a(_ge+HZ>\F&΢)Ӱu{3IQitLB]yl̍ 6a,AC&<. P uN/v`I1/l5<O4`C,Y?WHcă JՌ{gƬ%4Րs:>wC3LiHkKjl {G@UHu3׊\BV.&# T1C.eF]]x% e䋖U RzGJE&e\I}q@"OfO MQۃlkΩ-ɥ"mu+~ϋU)xm$Z_Mp-ת2ű͡F@BP#ql84Szg)ѶfL̶piΰ]w-Ɋub>oz > U1m^?ǵ "6lQD쟊)ɯ@Wzy|ҟmڣa>fIiŕc։QI ք/N089,IU8)xEh6>۸ֱ4e|yuf WQ!e6Cc 1# (.*L2y]3όTAp*cWl0Ij͊eWJbB*nOcߓݣ7-2,;dXv6mRSK1t rX&דv>HV Fbփ6\ =g*"TsQ5feAo1 =^as$t^t=' ~%%%CXü9sXp֙Q]*fRl)D4 lNu{&zHֱ^-NE2hs&uČ@ ע:)֌-ҋ?഻KM#ǘѷO|[}ԼrMW9z@MiW,To%HӔ{[|V#F ad0Xλ!8(mU6o_/ܦ!AWͼ[SX'JiMW*Q䌴ͫzy0OJk%V@[*CPl4y0",d0,D;&e.܃iͭ^b8s9].dbT3hZۭ{H^k,&6vFWE46{ ͫӡΏ<ƭfqߍd6R̓>zՃQsKi0m &Sr}NI[n aj\e+Q&M3%,] 3Q/fqil>r>BH@} WzxNquҎr|s\? hY RM?H6ty ZZAM~]xER)[}yBx~{lsͲYߍۂ|[)EuRifxH:CR(*hXQiك.a$f_׍8ȧɆGۗGRNB.*Cճ;炙m*5HB͐efBw4bq$-$]I(|Èņwī. RPU YeݜÑИ6 YRV,ŢsրM<៱gڹmH{A8,4הETV3ΜgZ>}SȚX~shL=1(R2D%UCy!Ӌ= yYdm%RS7eczRVS]!E¼cdO6ycvS%ʋk5&5盎]"82S3kμHJ U;)d(k(Jv iS~IX1#B_}n$C%ffL#]J{2bRC>rو)d u: [t-6.sB,K*X&&MF|}N:$kXQ%baQ,%ΕTHGlB[&ҏDc 瞼6=X,DPnV5m#ZԁfҐ:(C6Fy&&ŀQW׼yLqƓUd=&q0XcwD3柺{"G8E@Ke ‰c h-̈C;( vY;bR3`6q" Wƹ5^yj!``a`fu~ -n`DeJ4Ibx02rBgƔV[[ ʦɱ숃|2iBQFJ+ɞ&D^X(irͣShQ^'|Ϛ,@:FrhaZp Wm eC-Jq#XrdmY#xLM1 +,q %)DN?50Юok9$"͆,ﻤ<9ɺ6Z{1u-lW(=,x]œg0u.5^0y>AJ3M 2T3)T*譍V X]?ΙcXQe aW,4g*&H& EU>O0-=IŔ/# z4D&G~9p3L:i`1ZV*:RE3'y`0U-Ƴ Eb\y!ud }>?ǜ~RQ~$5 XoѴ{O[I4D+HȨzpk N*myAbXl :mjLcV p-_f*- l<0\sŸ7])Ow9ZZU)yyMvm׆)%*C,3G)X=h:|Ra<{_7P˩o%.IA@\ eaLZţEeMj&oVΐ%>2-'ژZg꘬:nՆ֬S[HM]/:VnWlWc+tm4-rcƵF,,nj \;akY6gZTle.pqۖc6/5h]=&\J:ͪcY!7xӯ%ϩ t2-&`?/~{GzŎR>{B4B aləi,T$G}[6Il&u=H"S'Lhs2D)YEV=}: K-f6wOjh|/=l1׼hX֧YZiƕк)ĵL!1~RIM1!iК`'cX|!Wb!4Ҏf6!Y6XekYC ɋs;"ℼUۻ;XD>\1wTg>Ҡ+u(DuZ"UED&`{Pwmfc2 Ic^ͮ#^xNXMw^t:>"A3ν!uـٝw6*Q<ԕeb/;*5 a`A*wcHLFR%r9PPaTeS6'cL91ӆ$֌7ZYsh'r_*3c JjjC%N Aɦ.\XCswF{K*$D`޻[4 VAo<>u烮r2y9-t?c 7撏B/'꿛r_v+˥sa?:7sh0RUSh:ҷuauy՞M}u* T=F[$Y=N[H!cBݬѰz3;GGaa$^O)xN1b&k)6 1ͩj0l,i]"S5-b ]h2۱;sݔ{ڦ+Ò O\R5Z^? H`'PNqmj!U}t!hh(,H)lkhדWѣqϳR'W9iVĀ4+g*%D#bzkc6W Ek9uY=?d'mmh[-zLpf[=DƇǘAX :ږ(C2H _vNΰCUZTH,! bKV BDo&` ީ!{L5h۵Fy|J!VvŬ%笹VE -ui%Q`/}Y"ul 3Vǰe%\b1C=?v*gJ&uruLI&)̸1y#ooG_ *j?}8'hcv)F#O8T[8`lP7gԘF&QiR' pc"+++QC2K̨Zk.2h짪5UYρˆ$hUk[2Y1٥5=-;HV'H~;30LZ }:gb,@4)}F mFMte+:dу`kAE9q'{G3x 9.0lE3vLez& ρe{X-k =bՠ2KGgRFLSU`Ʀ[:mʩE͊Mؙ㴯υw qQfW_1>|Y_VPa,&@C"O1| pIYFׄŨrF(k`-̔xÜ_EX=:Z :,z}} f0z$IShݜ\YӤPOnͤz^ U(=<{Pƈ@y_r{|Y~?ňLH嵲0͏ǜû=`եD^Uj]03Zo]E&I2:MS}= %-?4|(Z_Np o>]x+XZ8wqY@oBY7Ƌw˜}TiMB9Xyx4lucnPtQB_Yɿrk+PtO/'oIfb՚W6?}n!_q)o{uӠRInNqKѐj@H2*Qqf}eⳅ81d5Wx;:_8+e 8Y1@BKPUn&VDF24S H!i(L^_#-SSRjiE;g. c%CW$=t5B2hmwVja 4@sƳ5C˷< ƒF7CbՅ `KhwLl," :Rl:m=2#D[ ޣ9~받 쳂̬*ǶlZp?=np_W;fȆVܚMlzxŊBzWךL;xJ|ƴKM ixw/)˚LH=$U"0..5)Ź2hZhriόW29ErX^FT$@AZ1B}|dTWG7Tǯ#KՖF1.5˂`47nݩP0+Xu 'yӃA&u i}#z=Q"j{e Y}[q5BiӔx hЛv_rM)˅/v&u@5+c;43 wfNg6>r*x8ԥ|];tMleQ/@xqLaudx =[T\k-XͰLsK~)>Nj^uiC9{uiӬ^ +Qf]aR&>iq38f0b++ :[gß:4ݎZjX5I7x<L4e { 43a݃j8hh%j5VjqwZzM%axdXI!Z0᤺L[[e-z*]# wimU訃X9Wc%oGdjINtlk%cHOZ)bnqB8{fG j%\BgOuTd2dKS)dCX4$QO˧s-uNjq-ɂ(cՇ(fدƏhnybrL툲[ Pg@myU ll QDJ1N#C,vHPbueuԬfW}.TwVf1k*}=xӬ̫cf:2zgR䵧#5Y&*9Wv60FPɐF.#8%9P4ڵV59Ɨp?&'Zs`J]g^'^ 3ƙ[XJE\{H׭-IF3 1Ln-l0aWODJYKarzcwy@LclJ׫LsEhDYO=}mNij^4Ǜ>$mNΛXJr!& Y*#sՓ9X=$ rTn랂Wy=\+ƒ4&vW۹ lT5^0S^Ef~ڣ j5PL9AuQQuJjé&ɇ}jzzx9kJ[W߫[sju6E՘u5 ).¾qmѱI>  >L*.c[-I#906Nɚ錪F5yH4Tc/wt+1SʆhɚATcCLH~:NP KcYqM7o$'LH'ΉQXɮyc:j(oi<5G͑5{8zD9G8&N,K9h1H#6b4 aW4: 84@La;o IO1'tlyrrV9b,v-0|VsOZasgY5,ϫ^ &rkSfToON~ww:TC"u:6^f,Livǹryγ2T6L1m:n(V0Zrhymh<FuA!#?R3]`Ăm=zݕAڼ; 4W!0!5ATdH)v!c5#+py\ƣKtJ`basb !~{peq $5VBBI*=Ygb0[Z<8 gYɩ'-$ e\OɨMaI9E{V1yD&2k@iI &S9P}vW`t_v3IJV3C])CP{{[P+xFh,6D3NGR ݤ2k^8`GNb?^9> qz=y-R4eT㭑"$tłZZzȈVǨZب~.)ܮ-fqlbqitN´k,(O mgȈ" 10*^Q "3L3Y|>EiJizlT'DwVwk*c&Yf]Uf'Rq. X/]{qkIFѵ7yJ>LJ"kӻ{gz]\5Kb2 #YZ$a3,~\wCve (fɌLE+c#ЯyeB o2/ƓA*-!aszg~_K**XMV,ҟPq4_/aq;uNZ]b%RQy3g | NtL /#Z/2ғ/^Җ0bKĭ|MUTcv0hݙ(!yg?&Eq{N+Zoݓ<ڃh_.$z5+XBt(X5&e4X-ѬL_wvhR4|ep<0REևcm5pP4cjiԚ7Yjr(YiQ#TKX:)ʸDΰU^[G7gFl6QK+FZ=8ZsC/UV&cP=Y{rq4H2uu/˗0.e 9Ky2КBhf hm! ,@ֱZ>`9QOd+2 BBm=0*>Ǣer2Q:MJz#ч}.`I( I&v{Y1xRrDeF0bi3.r4kFg>H_-3a7Ro(˪c;R)&5\yII2%5S爪8,Z+(v4;XFU{Bh ➺9a/c i{ƖiwZFp@9#+٠tQ(bG ?''7HMr&'xpg3Vb5Ck!z(nIUU&W.ujE6!&zt7_j#&JH"Ll ՍKE¾r$ۓ mn<%V^١<¤m?^Ӟ4niJӗ9+ `J3.p>}~!pヿ󝠨Ŀ2 煂iuz5T*6չYܩO˜|摲d<ک]zCFBQ&f[U#KdF:ڵ,ۑ暑Z0r6 (X'dXM]j{vݴP\3RBqti P'Uh'٥0hOg$',9-' [0Œ> i-Xӣ(jvLXeAIABJK:ԊacUEl%S*fXV B4K˧%Y ,s9lR5ΙYJKjnr>283M7O30V4hjiCؼ^<9@] NI\6c) ً)/a3P`5A}NtL&9㶘/{хz*kb52٪k9FrZ=S05U*j,엓)6hRLg0- 8MYufSEaά3=m[2KeHčl}kIyFF}e ک6@>/k>ՈgDb2hp1h74bQ4 2Hͨ59ݢbLfug2m'A:XX X6 &eWÕ<:`T KNDИpZdP]Փ&M&`^`6e!-c1s]ynҠJ~/qŃ шEɔ]kW_~7Ȧ=e5y܏z34ZqO8՜)Fp=uyªeAc; }Z#a͢+COtewpON,h͂, I)̼8Y&%6t:XE^wiFbƢhUD-EΆsN>:9@WD7O?>|TI:xYR J,ZzY"IHslIdMGUy\XD V5RAi߻Ewp0j=[ ~Dg}xɏb}]^ilF p)-|ׄw Pi`YSϐSlΘTz]nb[hG"|o$P%QHa*?ݲjL,xɀQ5slGVNK&Ϩ>]&Do&ьJ$ʲ.W1wkOs׀6cqb3_0e` 6MA s3&l||6*)ţjwg("ݢ] g ce&9Y}`^6 SR%~NF%n$X8U5J𻌴U*4_;J 0EAEI;gv58Baǣ^(c;cPf2SVnW=hL+ZvB[X~cuyW.^J[(e=G䐼u@ 3CHz6bhgJ=y\1aLb([aہ^1Um+1<a1ԄzD#G^HsR qW<1:rov(aX,㞯>5i:W90̱BS "Ls4"~#vncmXEJP"Cd ][|0 uÞ,Y\W鞊lZMIM>2`:yRq'hLFLP<i7gCsk/=i,!l%7ۄɗTR3}̧. Bex `C f,TEHN<]#,ŀ_iHҹQǵ, 7G$pc4 ݈WUvУ1:'בq0^ƪpd0`>dC1$ >u]Ea}B鼑_3Fb*a&Pp1s(_8E^Q*h[0C۔oMeq9X A3<2}K|.@mbuђϐܢE˪r;SsaAA(UTc+ήeO b*G'=ҞPbpW/&,@ V!1Y+/i|<'^^K&]^tWY[w7).VdƓ ~o"1ItKq0XD#։QCù:b5ES3t8<-gRcSC(D;IX ƭ7LaiL/_>md!F/0a !U֏8TCR{20Aj"af4t++Aї_ZeM헾F)S& VJY*^]G)` rH Uk&#va0M\ u0A&8PYYi^o}"S 96F%iTe˛T^Da$3L/ˮg9mxQ v~XqIۤQWlҩM=Fn- "dt/Q F#ؑ%R2q3Lҫ7`UtZT ͬ9b*翵$#ʋ }e|G=UĆ2` 2`;v'QX*=e/Jb4VZ-x /\CEcbu&MCwW.1.5ir F^m( usԞ۰WӖyX7"ŖL. Jb51ՇNJ&mGB=[)CDF_;T10fdd05ibsظC"tBv4>.*񨽈kVfFmYd1mɉ ^a&ȗCΎh6EpƱ6U X=,ǮRmz<ǟ0tp%a; g6=IMa CddG=^Dy.[.M,bH'%4`050i)I_~/A9ao|rXkarJ>W& uTe9%~E.c$#eɤrlm{Lg,zQ"C:+_d6l#Fm F<2V)GU7KӳFK+?qf9'=FZy<眄xЙ4b,2iгgYYkE{BQRfK^-DLl2 2?8gZb²Յ=Q*sFϛTA3 Rk#eIUanܷg(O{q1^gw9@K W]s%jwk6$"DGY+.԰P`Q&_1igqGƬ[5/< bAw×wjPYL&U K*L% 3J"͙uKmB1N/r`YF'+`cwdc͗Y0MH1 ɍgQO:ik5=xXihr 9% XzQ1WN45hY :FsIjXr(Y["ǡV),r6i(]6&b -@AΈM)XA 8iO>۬ik9X̝Vw8"!Ɲ+3Ć-ٍ %#+^/׹;hQ_I, Jenm)e)\d" 6_ k=yT8hӈLl(&Qs=:jfY,ŜtHoS3$L4RݐE&s5C+  dk)FA XRYUqvJ`m l( Sa Ɲkt"SByJ8Jy[X2FpBLR]8؛kX4}j)6L"{#Z/4[JcW c[NvUx Ռ!,bU1,r5)]i,gGvRԣa;ng/˝IFtGh0X|hSV[ d܊A6\3"b}<>QJl$8| kfg>LgVlIanЌOd޲Is9fD٭R@暕%4(%Wly _l_6̵5v^؜hLl"G-T=ъ<%K OF,2P^L%aƶƣax'6;yTVH\Oi#c4GTj[ & q6#>{p1@*1 0duLdMdvz$=7t͌!Z<ãLNU1ڼlb|Bg=$0aS`1Rq)zRDLlF9އn]LE1d$ndv4DZMkkIѯg5x~%0=+/0 yx@4g@=μhZt*Kًrhr׭zOmRI$H+MF]l \pgT@&M#kKG)G1{ɓ9}>]uhwNw2٨)@bZ~|g 6sQVgXfv srcCtpCvt_ީ}{]*з4ĪRbN/r>QŧتL*J3\$"Ϊ钩ʱX7e%Th3s68hŏ:bG[8|@#H- L67}C*r~vNT5w}/!Tn0+aKH# 1YfQ?o+$!U eƘ .Gr?D 2D%P\w4@Cz{8Z>[|kZtkxa1Pa^-K>ݸԛbXϸK⎢ Ւ[tٔ*1 Ĵ1$x!X[%1=Qk/“9 J6Y/AzH.Z%F|fŜs&)^z!uC۶%ѩ3!Iٻ.Y(5F|B?1)F !i}Ee"f'!deĊ& U0CSOMGzD7J^;OgZ;HG1,46ҤWipuud59#U,;KQ J.eڍBu>= o{hcp}vGKEI~BJ28lpC/ 3NU[& mD{d2 %}UzYd@9IA㈊%f4\s6HEW5UBm=DE"A)>ZD2 Շd(ST)Ϻ-Gk+$ad[BHJ^lFSrŠ$SVێ=яbu;YTּ>}5 iF&U j,gtC=?SG8@{Rl8Ί䅺bs{3)8WP>5"dj՜0!`+ZXwfn}@ֱnmD1Pռ58KYkFg˦qؤs&fJe|_rEruxqE3[ bDaiӈ_$!j0 OV}5|{虌1KLBbB^k`n`0/DJ' ~7ܝmy^,(J"u?6T]Ckա[9!"}g[(7DGΣ;3D<ӢKyD7_>/OܦLXRLL{&ObHfzs)cE_$f$:l^)ؚ՚XƄ&}=Ziug~4+-!0ڕ:rk:)4HZPVgb'-;]`$j1ݝ510J`v5RV![,IfX7<*h>3|xA؏vAKyXڬ1.gM86%~k#|*RQ=FhMcXV $<</à Ж)*ֶ=y mc yΒj=0ӕIDgwkN^Xi@a<2e.I]jz5:WOFSbyIgג0-KtMd-܃nǜYD{[c nW< Y|cCWB6eQ,iYBuA0fh'7qZ2EJ屒iP _gnW%Mc쪎X,>w|Byr@dÄ .BIQ NM?¢BnhN3W6]jM4t\feH)xnl*pAjGx̴aEBv߯Y1]Ap"dkvq.ۋaH"#,_ Awu̖+-#25a΋7xwx68{ D.%iV!;eu[9|S`#ի6̷ţ&p_=yFÝ۴X'}S+ݜ#+ֈ7[S])Ἁaׯ^ؚh=("WHWxg*ybBɆ{LjE-loՖ֭58pAX .6,awlv,_w]n͗."l}!80owH'ٴ,"`S\^і/ *=MA)ydUGs^2ֳ8:^ɥғ9c-Li߹1ݢXc9YƘP8[FW!@5؎ P3%t[Hv#rA9%(׼ K-Xuy0NdE7.] &IU^6wvbglJ(6#m`+aplĞ0i*kJV*Ջ:&EэŅ'ݖ-ozrSX aG R cv /`١Մy\iѢiq+Vs5[NQD9) B%Yϟ^ [T_ƬMʍd6(ͮH&尰&EiGoVG#tYilPQj"2rC_x@&aln T'/}[QkkNqt6gKUd="DkN2'\qu߮1eoĺc;ETkh}dHF s.* .3 k#& ç]ٺVUXq ercVʬEvWL# O$uڼ*)SF;M]Ii+:k3ן `6[apVe =YiZGCIWsfBCi!Ħy!o\FԸ-z<ǽ8ET(D!ɔ+KkҾpBjCŌZ* mw+NeZu%# 1%ˎrbQd0ΈAe_tɂܟ kdÔ!jr✑N$Z!/8?2 g$.f*x%1 ePk~ >s:4WT`3ϥ3N.+jk"pz$LzFkH!âOfmJ=Z%dƶEŠvㇲg&5XS:d儕OB[ƕHb6uz5=cX<)c%݋Y34(7O*KN$ֵk;XӯP2aX43"y:hdD.9ɒM%P$/rhDOvUՙJ?)4,f|=L!h[v9s\Hb&j v*zLcJDw𤼈kQ?ǻܦcBDԊYQR1`VyN+>O ̩ a-k1S'gb΋cE"!]9S0ⶒ&ɉQ?{os.;dme"mXu-jcfS#b3vG 0LIK?tbӮ5Dwk XRcX_cth[^#D)01;2iX+3GQS{'DBqCC0vpyYN|5 (zzj6]9=k Ǭ8;JF 5jTVqWƮ2Yehc3g}D |Emf+Mȅq5>kZXbdɯ0mX(O ]A'PO|mz}kG&<[i㚅)&f?k}86)ZIXƬ?GO0^Ec0-0ySz# H#V lF}>IFJ\GbygFɒ: 3XOF>c׈F'nG71t 9'e|yVQduęs^C`c ֖%imLO 4g:::)c7AVd2$j|ƛ- >!ˬzrw45QRdYa /=nE>ECOqWiP)Okf[IH[x-I%y) irZGn7$^eXɊl ן$ڑ%IƝR挚,M b=,hαN#mL{p0i[Wr&*2.zs)EeЬqv^ܘSe/{;iVmȴdrVtgB18х+qh|< qa@ LP2aR JCgB1H ,I9ЅOl-Cpn[HdƳ5R3a!-ڞgJ-匾k^jɥѪZ6\Q;=g(  Z)ґ5~rцj&chä#"QKF ~o26TfSq dbV*~ɸ9(% fR@ xȀfA &ցgG/ȸ.sF;iWt 5fF#+ X d"ׇBEEȉN i%' hqk,bwQ[<@ғsF`Dz[Fb X @/ 7+$Ij5ήhlQLY(luCn3ACN0i 1! LCa ׌LDjtNR+fB` ;.pxf0Jı8c]gl0!ͤs4 e4BYC=8uO}=:WHgw!I!QBJtnc:aq#3zM`L% .%zI?}n%k$t8 )UD^"F+E+ɜ݅=OK*u12 +E'AJ90p#`\)%wy- / 66eU5R\C=e,kYUrNAg,&V3ٲN&͕ya}"1 LSq7ް5A pӽhEmЁ15]]jJC[dM?R uſQ.[:ք}F+;1Ty qsL/ťxYB߹9V|VXUa57pqӱdoE&ܜ9 V)/:xr",lNYCH_-Gم1rz.yO(Bmt)h^G0˜ʎ>+bÀd4B 0 )T2s7qF"E~:Oqcx+^ Xm$e虭x^FLMTIQW;ŧoQX+b>.4sdʦ4Ȧ$=8}3hC d#=lK8:5m7;zYp'5`0LiX66X1)ԤWơ"(ґehw][ c0À${ JoxN~bMҥ"RZ$rԁsPB& vѥ#*ZFzKr,cGL5 aP,AN:b:k$k6s6]CF l#t=P,$C8b!2 N_7lID)XHٹ6tdV~u=+!q>q@kMN9. if@&m8eeAm^"fuum cf[6|@)6d15JG>~wA-l d%RbK =FH#ND (j}&ՉLMd3EΔCMT 6 3bFFC:[&1&viB3$K;#Ez<ȴm WݝϜT; /:Zv+)8Ḡ\-@0MtcrB-ta굊Ӡ\dAI<5՝Um#*eȸ0`Ҋy3$>@Ue8uŰz8sK%+ P8x-ź?=3d%QO]E C65:/ I$&iI"ǹu3w>_!U47Cv2/Ϯ jKi.3?\6R1'^ ѿZXЗw9ơ>)j=gJb8ּծ]6ζ_{>rxEbpg93Ѩ A7Ka0P'>'R#1T{l>\2i,&eRM7dx a/0 I"YIe5ҚӦ_`X6w!L״4}n ZOL [u+ Se`"QO6<&V"kJ u-Έ5TuR:vj`<Qe;nvXᑊ]Д6Wƺ*E>|S:.ac鈀ZHŋFG};%UE1VjIIyElhj@̸;'\W m0C=[m4{0$g[OzD2mPO J1(!+  Fu`&l,^YTXlp|n$5Ɠ25ָzåרfO)iK~0bkی1 zᄊ֌TazWs {j˴EM˅&NGkɷR3I7} CæezZD[ѷZyyļP;"&2f0%Z2:cD|ą_81 UmFGcYvJI3Mj "#W\Hv+Cec\͏ZՕʭ:cO-M$i899K1z&ThR4c3CbHggL=0KD )~h=t8υ5+*ϻZdogYU ΥJ >lfVr37cZ,Ťw;t/Ycc<݊6y&hSثHy+cNfFg{3 *qDLHx Aa(2k@ #>w j*qZͬ3yoZ1qpn0=PΊۤ|gKiD 8Ȧ'0HoU8+I@NjN8;)VKkhDJtM4"xMKjSYgX rB%Mλ *!3f|1Xc"ҌY=D㒤i-QCLjT ,٥}@ӔSd՚>yI5 5sI:hj+X0RXO@Y5xۋ .賬`S(0dI%t4`܇^ hfSb1hf]i]+L#dƬ脝.&δ5D'ևЖntHCjCṼ"E&|Q ΄¢LdHdhgSčz8cI \z<$KdPDH)cAh,U#:q9e%S8ڢzabSa;O ^T{}ʣi0I3cgEپr>ah(iiQ13wòmsQ׌#8klYּ2&cH >9o J qAd3[YJWNի|ݞsꩭM& K(f%`qdqzBʼnٗ'Yħ{ѓTR#ĵvu-p˄F%VVM+yFkAEl%,ȽVˉʲW%ULkERpJt#CPϭz B^"Npl9ЄƤc3K0(Ze=?lDHXɓXq@yȫ 3SlyD`èj"0k,*jJy^-d!c@+/B t2OrlԤͧaSQkumcw49 St*2%fe=+3 <%ëv^[ Z ͙Ӌ0j ob>q%g{R[b8hvkcX k>YL4SpR,3 U|kzbCg6{h87b^L#o\>7`DQnb }j6X2å ap9uDܲ{F69XHlmb wI{Ӏbw1@7?zzL-I=:nJiy1m m!/ '|-ל V@EgqtPJȾ%gjQ i,v\>k'`sHկ}w&tV|1+1R3ab,.5vݖ)XsvmbLŲ9lQe_z5M+Sd#92XA3UFnԨZ4NvLz:V$+x0Hi)u kQgL\DuɃ}#jqb ͳ QI1dU"k#%:0摖MM ד''`3 X_d]u56*rE0\!Z QDMa 8kmBV1 KX c2gQ#Gi\"=NOْRh O,%Zn\۱CRe7ѻf,XNJ|JaX8F(fx#* }.͊pz>Lt<^ֽxJ+؉AV**46j.-k5ًqBRmȉ-&xseG / ު+X>>TٯkrhcϺ?zSdGo`ڙl=qE٭å˅z 1+J/۫@Pi95urHGX%(8Qy_MPjlb6-_;&|Fʶ19l&ci23? 9r<iĉae@)`YR{:?s}eyނ-̈єdKP_1.nhH@1 &Y8D&Ba4z+tN"R:Kcޛ)t½#g d!L Of+>Tߺ/3 iXqYR6cGD ̮wj,qV /KV1/f|hBGP9ЮC*`k^Xj}f,@+Qlh !au8 D'b~ѳƖD겕?3w5Y #ǜ95ebb&'E;bʍF6 2r)ELڈe u:Lf8 P6J:FfC%,Kz-SKTI7LkmO7pGrbO4,Bı&ΊWEmk,*u L` ivZ Yˆ !I`G]]\5V k|RZ9&͈Ay^ 9uh0eq!1 *VX]FV:نY[&}םYhm.\.Kx*֕mNp!J;ב00#W;SW1cFh ~q{`p!Ľ*s LƈUWǺlѨֽ",/ i8ַ>I1|>^4ΖF**@}f}mM<2hMOm0PliĖkgd=Efd[Y[t#3 lWHSȥ%AXH !*zb8n}60Ao' Қ1+ka3cø νN*&DPy>yˣ^K[!`yI|Y @CT.*ZR7;tN~XА55βӣY!/VM8[1+/eX40H@`E++0V,%zWp,r@kJ BbXL"k-81Ϲ }+N+e!0y<j 8L$F$`%Q0j["kԍlz%҈_wJ*pFH }\O:$\EX%ƥǙD uxc#N30Qk&!ͣxMG^gL#-Fr@4a8wILlɕ>XCL [;XCVc8g[ 7+Ia|·LcY >tC T&uV:uJA9TWU<[%9N@<3v8(D>*`ՅAMm#6|F23= ȴP 4m H}[,0+=}ˈL˹@(V'{K y`BꉌMύ XW˗TFi~wޏ!-|j󬰰Z|jEޯAZ d,\4Vv]$/1vVCYk z D<C*xzT]Ŭo,0)j I6fET1Tș ƣV$,a2>odNeX[Ƒ͆/ם}D>_IӒKv t l/6]r8֔JjF D- +9PN ZƝێ'64)Sd~x RL0^BLwnwZ.Mì6FbׁRbneb\Y9i,[Bo ΆƂĀ/z;".s]y21^*fJf<6Nss )x zk X9L%ݸH1gDĆֆ)"m鲕$wlQjQc؋Dq Սe '΅Y׊g8蓧eHh8 ɨLj_Yz'[bu( &$fcIh{OgZqiZk5c (ƖLB+M\c)Vrq`.{ $TX$.l3 S\ѶжҚjdON×!K51+:!k`W,I=L1Dr0~mZRdZPV81ˊ14@\Vo'LZ 3KhPZʕ{ϗy3> rzS0b#&"cM8 $@\AVքtÈJ&=1aPí%9̞mkZ1=8;ԈZ~:j C 8-R>IIEZ.glѪFR| jݐ,M+#"  Pyΰ!MׅhQlRScb5J 2M b]vrqXRhg>3S| lD]tۦ J(uD×ve|^-%EL0r,ˆζ|85VPTe@4SÆPYEVZ ͒gɐ -ܽ+YÈ3dˍyW*zZ-kig!:h8GM|:&/ٓb- =5JpCS^\^:qgafΰp=mqw2XISkhQXBet!y)k/,8wK*!00R}>sPZ6yD0X x j*q +ZѐSz›NCU7$P I}(Ļm6Ӌ5+-Q؆,,FTƫidոzЬ3Q*ܶ ^I>{ƋcĊ,yyѧp瞇!8峣;1-U=vk9܈Gzlj@Ť shm nj2E2T`oziƇ Ƴh`BEc[M5F5NuteC@KUmXcbk"fGa$^ao_<0PI=t⬙k&#'W(69_X v\"dݵ:4=}p", c.PL#k.p֡]s g*rp_6)Ȇk(*6bř2! ն )a׫hEVя 实IΉ{_mgT%bjB.Aj^=#QhV hrvvXh.`œ 2Fqki8F"Bu;6,¦3ziv₃y'O3OXqj{AKEQ!βu܎Lq3i275t]emP6#4ZP|Zd`Yi,Y5cEʣ Ic( _UjpOÆiB(mm],bfAe36'@M&s@ky\"< n75h0f01<$.g&*?xgK5LՌ2ELؒhWjͤSU%VezUmG> O:+IMj-^4ͭ&>P{}&m^qHpxjXBh|εӫrOL"`#tn.(K3$zKp#"ȝ~]鸄3EFU(Z3ѶՈ"0 R3z *s㗷5^F2N C]mcTDצ>{+zέĚΟdä V6v^CKX4= cdZc|WMasVţ^m{r' 0G=9`BdhEq@{7ZXIebɅб>l5UZڷpU%f$l'{OOa:7k>KhxU&[~#՟6G'IfBU$۴ܓD6Z@r0{(Vdk[-6 p2""hg"EϺgM>}œ&tӣ9s\ܞy'݁:$uQRIIFj_wgAPLC̎uɬ38jKaؗD;OgZ1` Nz<:~~骳3 B%Yr>uIfͨF :qht+T !+ hrz⍞kYzQukլ#$F!GngO Df=V.¦"uxBTfblz` 3I8R,P;wP/ءae5&a+ D{cvn zʪqS!Dm.K&ʌL97j7B5U/#,A*߈ (HFբ[Cu`3啜~5zS39Ơ,cnsr^fh|y؂-AHdś_=u"9ׯ4*:Z$e!¢ JdՃZޡ9TN$4:7=q>(o܁{X I+%fRkeCMIx16HO&/sϢRfdH9φ͓>4 f8#X~|lPH\(rV4cs`}K,kUT*4=FS ɐ"khhz#<*)y'Z ֓- rzÞTPI[DMΫ:zBcv1d=u='_=r"1wgqpgE\ApbJ94߯P3B#rd l5R-SyY b5aBвCdl9w؝"T4UK5PX 0d 0U)" Iيςn|_~8!X>Mz1`\`,ټAB6ckXXCg2r֢ߝ:|nB*g̓rC7=V d 8L9ՓӔN^4yt΂YiLxqu-T)R\F M'of2* Cu /]Ȧu2R9Ͱgrb4 B& 9|'Ϣ wrgHpކ(0mFW[ T<.aDވ/^TS L~5׺VKݘt&R3&=uf㥵Qleďv1KgP K1xA d\wބϜ 5ҘkOx=fa L,||WFv&hqaJ[NM9c H<)&;՞l2ث&j[cXW"ٲ[6X3d`"5 NIqd¥TPZSS!a5ZPSs3lDL'R;&6=_=qkӈ0Hl7}[AˢK6riЩx㲩S aZڏ9Auf"zJ^ř7t֏>@_9 ŮP[UXnXitnV!1BBfapUj3n?sse3k1iƆC,x|QٓHy=LP4KcƁ6)&҉#ė 82 {Jnr{g-VT];+uo&#֚?pG@.k6փ*&p$nK ] AU)dq١(,f&*͋*s>Vdܛ#K2+%Rlq$ḥȎ\0=m7D8Ɂ*,494b0 RxxbA'$v M7xZDC1[7ðvKR(P:Wh0N,kVG뻻5VҬlsc̟Ÿ7~c~eL$VuK՛:ӓ܎͑'ъ>.ki@"3c$̵9'-6`$elj5*nv2k s{E:\jXCJi9ſpcj5"}cOJK׌(dc c kB0rS݅ ,4]Ϩ|ؙV8kQ3Kf'[9c j[9^̀pzۚ~1zG Ugo+Ee_"ڜ/_'V1*ot-e CF6ȧ)U3+ 4co0Eox< ({:ӆYg`eh i@46UPrZT3 jtKVl`c)?u=~|y9M(KsIGJ5Q؟w>+KP؝优4ܫZNQl6bYf ^]k0Ig &.u7W֥݇eszV/'tM{Cu!{āmZwB#ՅڃLNG[* ِ ] b+uC>t<@I<G+D.YE$Y ;3(R#봾ocwz[y<֠Y] IBlMdQE(T6pWvJYoHEs6 }锫2`iR&V jf:/ջ|fA3"ÔHWC:Q[/Q(j65#mR !!k,O-f" E-ZA hSX' ]ƼhC6%7ݻP>*MF*3 ƣHzi0&l+rGq]Hjv0oܹL es<בKJ1C)S8s11Zbl8,1 0:ֈv P`BH+!&r[+Ǧ=tċD¬5b$텠V:d20?PM]jkTk xB Qz+vCOEV ZE"Bud`‹7ĎEulHJ .sœ#C͊Gjm[v1 0´f3 F;YGP2ÎG[=Lޣ6Z u | $˩Qo㻧 qU\C"`F5O۵W#kͅh`rhx 9U1shQKEDԹQUWMXu6[Q@d%WoF:H-kRUzKz3<XJ BZi$2z>8/y:=8swkUP X3DgDK1.V¸MU؟sr|q@+^%ₑc\ ïrʸ:a:R_>T" ZE,VYpFn&Cf.2k/fPHoݻ-kXr!d,G@KщΙyJcqsiʘtlYԈfwqZ L-Q\@"og/!:(˔ɜGdյҡq+:rt0XWs.5 Kc5Oy2ujVibz@X4&yG=N< _Y7>VĮ.]Z%/0ͨT֣(;ɇH-P8\! C*옴FM)~7kn BmOk"1,KK}8/A~^=q([vp0Xb-9tbhݛc'`I0.7|ZP֡AmZd34xUiETN'-?v;kHjCJ]=FjjIւ_- `=]׈V=u׽SHLխmAVb0A1/Cܾ#bqȐ0A Ԝ!ۤ@} UlX:<Tnw&w$O/a C%IkYaUe?1g3\:@MMQUܹđuWDIrm4ii2e\"!ŋ7WP 'dgR~5(YbAx2Id,mV Xl#Ud<Ͳa~#CՃJd.8M7L,8;dDt #N#κ{.x bGM!μc6Tai܄XD䭍meS xу^o1n.5QdY;6,Key +EYv4A:,V5POHEÄue@I *e#[HWhXX҅dCke|wK1s f , r|QєLb3xфtS-gS՗]w_/)S^n͂g@!HE=em2&\:dϱzڐa\,N1L 'CW]ĴVK#%Me`-5i!u^uMVS5E.R+'߯aĉ,Ia0Bp49XΜSoo* %&J&U)zf%+ɹoݓ"[N3%[1KJ׃ִӭRi؆) @5c^C6xfti  QڬtJ簽! ݬ>޲z{;Pud[k$*m)BMbaq_. 8LbzR&`|C~.p/vy8: 00r0!x*y֯7vbqj_3a%QqNPŌٚ6 Ys΂#H[cvf1&ʦV[i(%ahc ^ܼ7N()\+^EFR>@B߯2=:#9 diraZaM͸h|ܙFxx<;K#|My!L+WiTXun}uΝ_bdv0]%TE }g8hl[vgHx渹 q{%I){%odUμŮA|Kd)㖈QiI@n+Bgux ? aTNp,[B0Y,Pp61`zRzb";0gQ'LzPT-͐ˆNb8Ӌ.UA/2_%C;3Zc 1:l]gwmiV|3lv&Of'B9pvEIy8 2OSi$}4iq1ִ,Cf/ݶ4rg_;hG@,Q jZj=qq=nb>2,DFRM[0 ].IQPOф@銗Dದfˡ1#xBI( c5mJq&`M0 ҅@{F # %37̊M>U3˗?Q{<>q I+Z3aq3nXz[e-EkB||TW.VТk1u5@2lZrV2o`< ajXx׫O.tjXAiFoXFVQ5jO [Xz QW<9gP*e7wrsգ3ra1$41>Kc)H֝wjfyjLG;݀ jHǦ g v;`veG]]`T1)H]T`Uz, @72%cn-{[,`0&5ww9MОtH\cE>i9 D}'˫Z[,"k`*4<,'7G<c*&F va4XSL˒asb^hP&ø4Z4^"zD$rkV6 Ѩ9YV"9z"X#vxQqhލTlA%oNěXd뷌l~||s etnX:;($ Ș11E"ggwDh 4a lBU1)ʑYld l8.YRMHCڂlnŜԛ%W*χkp= ($lpuIs5ϷY=JBRZl٪1d@XWb T2 LjZEg8OY3`4,B;eIX3Z*WW^ec!AaeHkuM/:rjǒ&sM5UI&M IDJkT VQaٰ7fͣ $47||*Ͷpm NN(laMh1Mj/y*l hC5|e)#&01cR}nRלEE@d:@< a$a'ii. ,e"  ߎeu 0C(Y룡\f&h˯Bj&ي$'iuW.,5yssh:|3̒6\x]Lpp>M!C:\,!&VT5G/agL]8@ Z3IkA5G`ZD+}Y׃iֱ>_?"a ;Vd\|m{=drj\f1](eL&LL^c@3^z cB hҹǘS9@Q<-ú5jd׊qy08jBh+I.iY4Ԥ(X)DQf6qS%!ӻӉZي\y' Keb9l&qb9FnO{ۺu n'; 0λ;mآݰv(Ax,!UYq~ÿ ``' hh}2Wǎs;-^pQ0_Ε#틬$ѭ$-^ij3}*&[zrej%6A)RkS,3"8dBxbCDo;%z9v] a(ͫNaG F4k8lqYG-,iZ|FÆ#*%nٶfUPė.gRq{at1a6j Fǘx*vѭF8Tҋ8'3hj jH1f!յEh pmKB~\oyf1ZK?RKr>Dyo hŒas8qMTykCµdѥph f֨)G6Qbx"T:<HLYrhɪ- 9 NwRj)iLDg,2k$#a-냘MdmHI}ua);hhc4I鸶LۮmݮPC/Vۘ5_0ؗ QP E6U;fkC @mް |1'92a]>`HTeoS΢H0g\&\dJ:##/Y'>7rK Ķ|Qc#Lbmsc+l~ذa8aM=ѥˌ%GTb`$g) R({JcGJ\&Zc5bgX48`#q7bj7l SY҇Ii'4g2ӃAi_ts٪C J`s;.T6-~u /&![#(]wδ&!\'tQEUEBc}gwzta=dɊ,wh{rgMSl@x&^u`̄@#^9qd[VjPg0\ͨm>' "g9ld85=:hBP y Ze0.~{"Aեtcyy%w|^!`4a&kpe.^ *z*6*$anaz8g7Wr,VUd\vf7:;; Z<zhJ<9;fÌ՘38 BTA {qŗ@>KV_t^'Jƴ0biEI)As1$XA&C- =X=/jg|LJŌe/ժ6/fM$ҩ~^^M3~{tnƴ0hG**>k ke[ +rHEY[\՜il6/9,91 qo_w[ݙ촹6ue'g[ Wi|gzhє$k]Q){}}v5e@\JM( EVtzodL7Rjws'L0[XΕ%ɉFQҼf[9RocI^! W*^N֭})Uf6lgY\z˜HUb 2K[[XzﻸGDm {#e d&>a%bw2AT@3&G,8{|gvH"L5:sJK8C&Vm* t/4\hwXC [=%l[Z X3S:|g;A(i:ˏdC8 #Ύ˸ע璼TY14Z=`9`)ow8Q2q?\ Z!Ê])وi?Fl=6ds 4|UcU}=e |' '[1T2) c;<$V,>-ik$ߘh胋FWs:+1ϼ'ri5"ŝ&+{Cx\JX"*%m&Vjѕ1 ж8m'ӣ[^nX!Ӑ~aaV_QhKADef0PP{ !`  F69;N)CZ|-#SclJUԩľ\ ORdeq28BBd5":k_vZp:N0zXq;A[-ntGMCKqؗR(Ytŀ;Hg˪ &wqh)E:l\qFD .L-9~Ȓ5`9/ݤ!aͥ&ΆEgXlhiX|65gڨbTfj͙yYV !k9L@_m&j0@ڬ.2@עh<3WF+b5X2-v'FӠqM믝z&(QB8z3qAX儖6Ul8v[C ! rauG[QEFo;'fe6%jBGL\^W$kQGD|\FJa^1Pg5z(:pf[F ԢZǴ@<7<|e*ĖRM=<" l n^CׯI Sg.h.V̈́lo-udZۈ _KV\pCQѦ_4sǭb1yqK{F uK ҐO9.\޶1N4+aܬ50 j+픣3)@jԀgO!̻in U9>UՏ,(tHLj:L@,ьRiHϗ\7u |=MK\F?f`s)̥ŭiϢtoZ`XnԺZdk(T9+nR*/m%esYQ5'Ãf!,|8"BIhYXγ8cY"αH[sܘƌ ͭ> f}EUtQcٻ&։Bt-bgjT.sx!˂MFհ)2F#VB:p(H͕ fUQO2CVs UsXc5ji+OcW)KT8WV:ɌasA7{_EXm +`V<,L!(qE&T յ=V |eywq YMiGayEs*R'"M+0ABw@0]D k8HF͜@Q- iljŚǘ$fVUiއ. 2Z L*@9ībX%S2NI"AT~7M~Q˶zQmoLu1'KAR5fŴfմBB R2LbViS8e͘32]I`Ԁߪt}™$:yEvcZ%ʋ%G67]<1AIcubr#(@tybĔr1TjbWw!8|b( ДV G k}ܷ*z5"Qj SI)!ݫ:/8H0l[&oKc,q)"m#dbkqlb+dGB5$h^"S5Ł}6V͏N dkM!VPhb>eJT԰{m)t:/x6eS~nrg%6sbYK 912Xjw`Z"DmzΖ`A#٠,>*K=4+Zy=@i (t#\o"a6VIE|xt^8*6 AHZiTǬ&uqeH4oؚV$$IKTXA>(l-b1,DNJH#dz`Y Ȣg;h"d2тE4#+6V8٬H+ wubylI(BnNzgΪ^9fS׈'VSj`)/QˋŢzV-ǞFN+Et:MkAcc ɼr9Ŕ5QZu5K3bjFW2ֽ?Ǐ1|G,ͨ9v:,ntidVZS+XLx =ujG19QLfk }R8zJZ'Jm?.0e㪄KH1Rhxx^F}cR$gpQCaCk ՋCRE>|>Oů4 DcӏrlY}}̏4>і44OS1T#{BxᙫUfQ"q`C f$RQ+Qi,b͘/e J!hBy-ɍbWLMYk|[8H+ 1H6}q42Be=l!D[eB|lfdF  D-0N!5zV}n@zqbFγR`s snk9Fiϭ&`(RڰIfh{X:5:]Cn;\Y<ěHֲ޶"1ti߯yRTdDzXΝ &WFC,\{z O@XuQ:cn4f5<[(sQ/Mt9 z"/hw PfyEtHcJ*Jqb: &tUSNcfL0$1^*j]^-srq #`x"B)"`,Ri>p/ <%1\>N0sֵk.l2F:ɟ Zi*l#37x;M>}_K.RIW2Raޠh9QTcD62̖IԍXaMSÅ#8(WFug%6eRgNr΢׉" &.vVfqdQLlLe~]Z1k8Ħ^G$7q YGt8d?)CX5FYa}=4^`(<&RyWwA)djٺ{d|B&^uUmw\WR 2,"iPph[(e҈rkKcq6N a)!A4cX;qOڤmM=&"=Aq.*Z,Τ}g,R|TJeoAwXyՊ y5aÚƲGU2߮;t|b#Jv`GR6#z6(CaT. =u!Rv350t,=mxDѷ.UZhϥ)a)wĘ=9#UpJ$bI2|ȡx> 77[ĆhEфiiR'ˆMy.s,ibzXK K*SV) K1qE*dbnxi4] IjwƆt 8ё/:TZ=j 20^Ϭ9>8;DnkM c^!h!}w<][~`{[]īy_^j5pPĠt3#yb[hf.΍5a=)#R#[|J慏9ȶ>t6scv+SYlatl!&gq 3vwvaVW6ΰS&#UFm7i:K)am,xezɳ*6,kwZ۳s E+Y^nr U:HniM# j*TX0ˮ(݇T]KwwzŠ1h&QȦS糶{㻀Tԓtw3T\FrEOiH@n;G̃rQr4Rc >n혵Ɇ@O֖+M<Ύx5 Am1X`&,Ό` 8$8B.4UYr9|;L/xh\1^?X02/:,\=0i8k$ Bm~nzCd#!5CRe @e<LC< vm7N%$kDGS,сKb4~;KvCKj[lyacYﻮsG J(ԙmxYZ.-\Vp]{Vj ˀ[HʄC9[e^b@] jKYH2)֘[^c}Xb]G*׬zzr :,d^.͵vxƖSJtrgHdtzJLgV3 S(4OܲUO;""yaw=eYhvxpuXt% /-a<٭TjJӐNzc| hﻛw ݘޣ}Վ J0CB -TZ64D2LA͌`EC8T.Z9gJT9<ظmu<ƻ:ëgjRӂ; \|ݓ^+ӋGݛ*@*O o&Q˜9Tzy7m+f~o03s q1O:,2SzP+[7=lE2a}'A`Ju JsK ѰUkQ5*\x9+C5wgo]e8#TD{8JYLCBTٔ0S5/ixp9dkmCmp1q悅x6*Js,Khs ~uD+U8XלX#cE=ԱaY/KyX@W֤6+#<˹m6"+׀MN_0`]XgI,:14(V˭zQMgF3MW2I( cjcbiSFyIq_^tmN)_֎NKؑ6MNH2e S0֣"Z'`=#`&1-8O\`s2>f}5}_=ѬYÍWcݤg8%xSӚՈ=^!DVV1V/ŀ?Z߼4LK}S-.u*hGub4<ٽ/"s81Gq^zqЎ$<&MV'RI }kGRir/|iijJ%m#=_h(YR Y`3Ugg/Y23ZlHc2jo5Ԕ+^A>.;H¸r 0RπIM&ϵ{]ŁSKKV xC|lEW-PbuK0'SV$&r wv֌X 0i=Nz^>u`xJ+36q*4%i%(ڗy׵:&˖+ RRE2O7]gBF7c/mɅ`J6|v \0ŀ}8G kr׽ưGC`00 O;OՑqBVF%#ǫd#YFEQq>nqZ$y&͑|sE,_a*Ff-,-`Ŝs ]xrfף̕,,Yؚ#…:xݘ fw0|0ӊSeTKwn:b8PhYS#a6-KY'Ćƭ󯏲#\&l.:: 4: xWC-93Qc kZ򙼽Pb5"L[] 1!U& vSSpriK=\z]FXC-+ jdfŌQ\n5J"{SI x9*t0`elWv V* _V/fem\ehΡ·ф06Djl4NlHi"%N6=L pljsfhgUk9_]x{g&MeXyA:3‹M, d5rYW&bOdcRal Dv,D-,:2f  UDS ZcI8)zW>X/VAs]ur!^/;P22QάTGAr \q@D>ם4NJSU.ٕamY@i)q-z3LG#X=۵;0aԉ:.?wn6V77&7l{NqK6ȇKFh9-~һ֘]CSS@.ן\BzphMqkceyT=׷(j1%u2߽+_xI&Q\ho%a8۴4%a3C@7)6̓\<0Tb[:W-92zju`β8csje]DAĘƤN _H=˫aE!FPXGnτZBO4k)+^8!x 4K`B0)<ݏcS^p5~<1`@2LTuJ¡c~°,uB6@`HJ4uLRJIikg"6ERdaRx[9LCTf0Ymtr6XC %(6$*hYWLu7iXQuUb֡TYZ-緼<d Q`ԈZ/d & ,9,E xEWjj]͋}HĐHcw\520`$ȽbcXLٶ"Ƶ܌r[mWa-U?`dg\엧Y=u QURZ5/IM 왟W%Z2l/ճ}!A5:MYuYEIwNu!l93IO4Xĉ70՝˘2Z6lT4hl{6Jn:19#X?z(eX b|L|o ĀlV{;cX5fYn`M΢([lYjKgLɔJ0sau#9:SŁnKy]ey˹(TحFXoXtY2hs98_}kjHz~YOM %(Vȍ<Y'Q)r7WЦ]NTtR)lWhӂ?Ǟi[8{=Lh qو^"*:1ZԓA5^Q# KͶ^FmSK >2tÌDIaGWR*Tֲɔ/›d?7\^sH+]ٰSGJ&wb vV+B֜ϊւ 5Ҏb^[cS!%f6CPw}Y׏NeU wtxjǗYFi(ƕ)4mj9'҈UwlI5bX\S5bw|Vqk}ּDLZ9ϲ3"џY)0l֦g OEb4#A  J=]z'+`PB} l ie|ˊZSX gZ=ǩYp0K#K8[7U'93J$q$s3ȹ\19x9! _ ;VJ%c$7s7%hDLs yW 1YZ9tx  /Cte(X%ֈ3Kk,lƒx B !iWK HT8ehC^yHLVM#1!#͵ހ}ez289:z=5i ,7"c+j1S)rCRgIb3Y y~p-.4[!I:p#'NJcR;x=l/c\.s1-U$1Fv!S;g'pu΃j34!XW{X,$p}}nmSe3"rpށO)5z_MYów863ڻf}A- r[Ouw΋v,Re2K *Rh$hY֜$'wjk4i>G y %Hsi3BD+h[Akk ,9 Hzg"a*uT/0cT.ş[3CYe\̘ C*1YK8f*ۚKZXP 5R9r:sM|bX[3/Y|C}e, :wh|&b積=DT7bGY&tbT0V,7N6ɈLl\݌m|Ȑ4@BZF2n>7|a(MBH9Ѫ =1_ɳh r$|ū%yf/wHz0PP=> Q #Yaǥ$#Lcqa|zUN BYF,>'wH`K QFWVf~azǠ0VԌF?׻ !vZ忈rЕ( ׺#Ւ֖\Й'-Üʖy![}\Y \>SQ9LK ׾Fmp Ϳkwv-" -TtUx#,ad/,c(­JwBZ߆cɒRSxһI1I 0)r6'γ^I{.5#l,-|j=^X6)M5EFŋj!6V- 5}|k2Rί#a`uH8:X.aaR؁=&D"|uڮ A3R8̤?M$a`C JNnT35|>Fp)*8À e h2VǓnicrH/s>L Vuħf4F}uj ۠ѧ9Dd,~ݹ6ј2%=Џ#c5hY^MrsLVcB)6R*L;P5xkH kfU AxdsM$=~ϯ E%oww8hkOr̓,ln3SI,D3h~# !ȐkjՇz7o%ìx\m,JqҜoc?ԒAk-% ~vlBkLN$ um}<&Њ2ϖ9Ό!^F 5hջ89Ț1"1yG73k+##YpO*RR6yiv\;P<zͅ1ϵ$:ՙ u8t`2nLZJ1tOaLZĺJ< L~.];&4rHq,:h†v0#PTP]{]m :F?q.Diy&# uJf+ݤQ:9:N9 GJ:VbbV"33V+8 yAc.#W=yAa HU$."hIйf>LW ubo8q bk33p۶*1 4Uؗ>6 HP1xؗ^[rdiC#unbWΕMj]FI_smӾ3z1!JZMI`zP)YJEںSe+hL,m#au tlxEu9bsĽ|7y+3-k֬d Ǎ,5(0:rgTfM-gJU,^׀ڡT#jظ뙄) >|x9ϙ={Z*g)[#=Yo*|\QmkIΞi_L۵N[/wξ1h[eOaޅT9UQ1 %qJvkFk}۬2f`fFAtM+F,Û&H1y[l*Lkim9X!(mtݰ^2lƏWx4F!,pT[=-K5Kf(VJhb^$%YxHa] 1dZUT_nʉ|{%2=\r _͹Dja+F#*IA(LT2B2 3C RSU/%2#r(LHԾ"Qr6\3]H$WJ <ЊB$@cAc 8mku|\<&IUJ( bW[%\ZmIr-*7%up,mnDQTH}n2($OSIIda+*ɟyDtH &KH4T0T[3 S6|IBF}>$"|LMi4\uDHDW,}uؕ&b$.Q0Dn)RdZ2:(cb)JSjgzQk2_zECIyyF8 柺׫&P$M4aL-77Q NjbRiEehPU&eΉ&UU(Lgc9rm )UPв.*(cJBE"ŢٜMBsK檨V5%1 T_I]/؞~gŶW$̊HDK2Ԓ ("\O4^WXFGiRVbNiHFjTRgUQg\8AAUxzl>0y˅x1ViJYVXeTM%D*%/lcutԫC綊DPE$e>v.z$"6 B@I 0BJIU؞$YZ"ev1!ZAyV/* d\ (PIi!*!"=r 55J )H$:QhkB"M&FVRnan鈹r%EkՅ"%H#/74ҢE%R-dhZg[m*^[ʭ2H"]<;.RaJI) uғB73BC0EC7T<4śAdM[Rg)RJZnJ&jJ骛'UIV^^zWUئ3#OP*6dZQINeȵL۝1H!UBkiQR(*%)+hU\\4IM+I*1*]x^8)d h[yifX"JeIOZ)嫶k뤡 xvQ b^-%@ z.{R`h%Z(VIADIJ^;BSq9B,/5$T= U2Բ2 HGTJ+7$(Қ QTkW̮A:REbYᵄHm$ұ0ȲTlK7=aoL7Es,'a4s E_ğ$IUŰm)F|'bN\3\D)‹ٸ9.͈ E8/I%-i۬PJ<#BЪ1D ȥRBkiSqP@I9( W}p#Dt-ЉS #5r)hx)U&dk B)G) *T4#LB-V)=9nƑM4DIQ tRR4҅-" ˵"F%S,("ejHI9/pҴ\($(t,5BȆEVR'i>M!ы:YYYM)KtAjfDa6in%fx$^f Ԇ<ê*$]J{ZHCL\ʉE ,bs3*5 LA-U Ru+34ʈPʎ+`babGPy@$=u4 tJ=2tHBT2DJ%g,"\ұKuJ5$UJ6$zYD$-,%)EJ5s[aLrSBLED}kf!%'HEDf^O=Aefkf"bdxH TdGYf"𒩥@%XURyh$J%B&B>PBPʢ)73K8O盽Rn.{?>Y.{A $ª֔Eda%BUE)D7 3K-Q c['-%JPRM%Pʴ s-yș)IhkꙶZJ}bRX#~&%y!d)zebahɍ)aF'Or/L+q02J9fOز1L^© (1HI(RH^TE^zaIaZizHb(UdIhR#{|QLLHT6fe!.Yi VIIdJR3܉+eUyPdL]12X `ցu#ƚ"*B02-#JM$SD\#%В]$n$ȫE1E-҂4-!. r#1V6|Ƌ%.Xa8y7Bʏ* /$tđ%Q%ͶsbdzVXfyЭvE/ii=aLHz24<%m&MlgqWUr̔ϛE(̱PB- ]I*ưIV'RfIFfya PI%Ji"z&VRnfhEM0Q8B\vE`r6KD0A2R+.F678bbб,MDL+P=D,S5 Ctڅa{] R2jvq^#jJ'hQе7!B]mai"PP&Z%j$dnQՉF'MBԗ*C*G#A.Ȃd+u]$}3ҫDKOs24OI;v_3X?DyiZAPg6ɹk^U)^dA2H"'DTaK'egR[$QQI&Q- zU阒$:aTRfnHfi&UF i~כs`BI֛95e|졍 wsݨ@dlrYp5+գ -c2JvGnrBBoiyEN=g#i1iK~+˦|ޑ8NL܋h <1ZʎW%?3ri gAi8X8Ʈێ-4cЅ&1p%kRLK:\"Hkwn\Qj\2+i(pw]ؓX*laAY"$ŝC(H3)o/cU#[zg#r&[C[5$gFe'օ&&G;߽|~hr=]uD 8AF~:C%gL7N0 J wqnx׿-z;$+Xg3k O:N; {g_/œzǩ}۾/ϟːWyT*WMyӽ3]J7p &F}֓}jgh2870F #)'\9O_q]yVD5emdvɂWwky|QW ˰扽^˜QUhlBsȹrbㇳE(9\+K7&pI9EQOK|9)v;2c1#p9%^+عt:GνqC2l5J \c qk-l/rBlb%Nk6,iGKrRF{aQ"q|$E{ Bfb)j*΋w껣ߎʫPyc `{8\JD7*KI>ckEB^/LM&yE$ ]v&4s;5K|`ESkƚ2 N*fE4lyTb.g)t2=UK(%RKVsw6-XJ-c,ڍJ "K7YΦëjKIgT}1X̼HI 0PL$ԣ4rS ,|Y#1~]t.Ґk;P 5ZU.3WB-jqgc,4.-qޱ :S1e :U]7vMfu=.-S Hs|b>~=󧥞!MY !ΒHSD9^t'7JOˆx Eri Je-gM/߿=|9vYZv-0З$6>:.|*X-I]*&\d85 ЌM d~5CaZ(^IX>־" EܑN$۔