changeset 0:2595c27071c2 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/kma commit 43bbde4f8f8671284b2acb21dfd2657de4ba967f"
author iuc
date Sat, 15 Feb 2020 15:32:58 -0500
parents
children
files kma_index.loc.sample kma_map.xml macros.xml test-data/ERR884056.aln test-data/ERR884056.frag test-data/ERR884056.fsa test-data/ERR884056.mat test-data/ERR884056.res test-data/ERR884056_ecoli_b0842.mapped_R1.fastq test-data/ecoli_cgMLST/ecoli_b0842_1to5.comp.b test-data/ecoli_cgMLST/ecoli_b0842_1to5.fasta test-data/ecoli_cgMLST/ecoli_b0842_1to5.index.b test-data/ecoli_cgMLST/ecoli_b0842_1to5.length.b test-data/ecoli_cgMLST/ecoli_b0842_1to5.name test-data/ecoli_cgMLST/ecoli_b0842_1to5.seq.b test-data/generate_test_data.sh test-data/test_database.loc tool_data_table_conf.xml.sample tool_data_table_conf.xml.test
diffstat 19 files changed, 5697 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/kma_index.loc.sample	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,7 @@
+# Expect three columns, tab separated, as follows:
+# - value (Galaxy records this in the Galaxy DB)
+# - name (Galaxy shows this in the UI)
+# - path (folder name containing the KMA index)
+#
+# e.g.
+# senterica_cgmlst<tab>Salmonella cgMLST<tab>/path/to/kma_index/senterica
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/kma_map.xml	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,179 @@
+<tool id="kma_map" name="Map with KMA" version="@TOOL_VERSION@+galaxy0">
+    <description></description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <requirements>
+        <requirement type="package" version="@TOOL_VERSION@">kma</requirement>
+    </requirements>
+    <version_command>kma -v</version_command>
+    <command detect_errors="exit_code">
+        <![CDATA[
+        kma
+            -t \${GALAXY_SLOTS:-1}
+	    -t_db '${kma_index.fields.path}'
+            #if $single_paired.single_paired_selector == 'paired'
+                -ipe '${single_paired.forward_input}' '${single_paired.reverse_input}'
+            #elif $single_paired.single_paired_selector == "paired_collection":
+                -ipe '${single_paired.input_pair.forward}' '${single_paired.input_pair.reverse}'
+            #else:
+                -i '${single_paired.input_sequences}'
+            #end if
+            #if str($settings.advanced) == "advanced"
+              #if str($settings.kmer_size)
+                -k '${settings.kmer_size}'
+              #end if
+              #if str($settings.p_value)
+                -p '${settings.p_value}'
+              #end if
+              ${settings.decontaminate}
+              ${settings.dense}
+              ${settings.ref_fsa}
+              ${settings.matrix}
+              ${settings.all_best_mappings}
+              #if str($settings.minimum_phred_score)
+                -mp '${settings.minimum_phred_score}'
+              #end if
+              #if str($settings.cut_5_prime)
+                -5p '${settings.cut_5_prime}'
+              #end if
+              ${settings.only_count_kmers}
+              #if str($settings.min_id)
+                -ID '${settings.min_id}'
+              #end if
+              #if str($settings.base_call_depth)
+                -bcd '${settings.base_call_depth}'
+              #end if
+              #if str($settings.minimum_mapping_quality)
+                -mq '${settings.minimum_mapping_quality}'
+              #end if
+              #if str($settings.reward)
+                -reward '${settings.reward}'
+              #end if
+              #if str($settings.penalty)
+                -penalty '${settings.penalty}'
+              #end if
+              #if str($settings.gapopen)
+                -gapopen '${settings.gapopen}'
+              #end if
+              #if str($settings.gapextend)
+                -gapextend '${settings.gapextend}'
+              #end if
+              ${settings.force_end_to_end}
+              ${settings.set_cge_penalties_and_rewards}
+            #end if
+            -o output
+	 
+        #if str($settings.advanced) == "advanced" and $settings.matrix
+            && gunzip output.mat.gz
+        #end if
+        && gunzip output.frag.gz
+	]]>
+    </command>
+    <inputs>
+        <conditional name="single_paired">
+            <param name="single_paired_selector" type="select" label="Single or paired reads" help="--paired">
+                <option value="paired_collection">Paired collection</option>
+                <option value="paired">Paired-end data</option>
+                <option selected="True" value="single">Single-end data</option>
+            </param>
+            <when value="paired_collection">
+                <param format="@INTYPES@" name="input_pair" type="data_collection" collection_type="paired" label="Collection of paired reads" help="FASTQ datasets" />
+            </when>
+            <when value="paired">
+                <param format="@INTYPES@" name="forward_input" type="data" label="Forward strand" help="FASTQ dataset"/>
+                <param format="@INTYPES@" name="reverse_input" type="data" label="Reverse strand" help="FASTQ dataset"/>
+            </when>
+            <when value="single">
+                <param format="@INTYPES@" label="Input sequences" name="input_sequences" type="data" help="FASTQ datasets"/>
+            </when>
+        </conditional>
+        <param name="kma_index" type="select">
+            <options from_data_table="kma_index">
+                <validator type="no_options" message="No KMA index available" />
+            </options>
+        </param>
+        <conditional name="settings">
+            <param name="advanced" type="select" label="Specify advanced parameters">
+                <option value="simple" selected="true">No, use program defaults</option>
+                <option value="advanced">Yes, see full parameter list.</option>
+            </param>
+            <when value="simple">
+            </when>
+            <when value="advanced">
+                <param name="kmer_size" type="integer" min="4" value="16" max="32" label="Kmer Size" />
+                <param name="p_value" type="float" min="0.0" value="0.05" max="1.0" label="p-value"/>
+                <param name="exhaustive_mode" type="boolean" truevalue="-ex_mode" falsevalue="" label="Exhaustive Mode" />
+                <param name="decontaminate" type="boolean" truevalue="-deCon" falsevalue="" label="Decontaminate" />
+                <param name="dense" type="boolean" truevalue="-dense" falsevalue="" label="Do not allow insertions in assembly" />
+                <param name="ref_fsa" type="boolean" truevalue="-ref_fsa" falsevalue="" label="Consensus sequence has 'n' instead of gaps" />
+                <param name="matrix" type="boolean" truevalue="-matrix" falsevalue="" label="Output assembly matrix" />
+                <param name="all_best_mappings" type="boolean" truevalue="-a" falsevalue="" label="Print all best mappings" />
+                <param name="minimum_phred_score" type="integer" min="0" value="20" max="60" label="Minimum phred score" />
+                <param name="cut_5_prime" type="integer" min="0" value="0" max="64" label="Cut a constant number of nucleotides from the 5 prime" />
+                <param name="only_count_kmers" type="boolean" truevalue="-Sparse" falsevalue="" label="Only count kmers" />
+                <param name="min_id" type="float" min="0.0" value="1.0" max="100.0" label="Minimum percent identity"/>
+                <param name="force_end_to_end" type="boolean" truevalue="-1t1" falsevalue="" label="Force end to end mapping" />
+                <param name="base_call_depth" type="integer" min="1" value="1" max="1000" label="Minimum depth at base" />
+                <param name="minimum_mapping_quality" type="integer" min="0" value="0" max="100" label="Minimum mapping quality" />
+                <param name="reward" type="integer" min="1" value="1" max="100" label="Score for match" />
+                <param name="penalty" type="integer" min="-100" value="-2" max="0" label="Penalty for mismatch" />
+                <param name="gapopen" type="integer" min="-100" value="-3" max="0" label="Penalty for gap opening" />
+                <param name="gapextend" type="integer" min="-100" value="-1" max="0" label="Penalty for gap extension" />
+                <param name="pairing_reward" type="integer" min="1" value="7" max="100" label="Reward for pairing reads" />
+                <param name="set_cge_penalties_and_rewards" type="boolean" truevalue="-cge" falsevalue="" label="Set CGE penalties and rewards" />
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data name="result_overview" label="Result overview" format="tabular" from_work_dir="output.res" />
+        <data name="consensus_alignment" label="Consensus alignment" format="fasta" from_work_dir="output.aln" />
+        <data name="consensus_sequences" label="Consensus sequences" format="fasta" from_work_dir="output.fsa" />
+        <data name="read_mapping" label="Read mapping info" format="tabular" from_work_dir="output.frag" />
+        <data name="assembly_matrix" label="Assembly matrix" format="txt" from_work_dir="output.mat">
+            <filter>settings['matrix']</filter>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="single_paired_selector" value="single"/>
+            <param name="input_sequences" value="ERR884056_ecoli_b0842.mapped_R1.fastq" ftype="fastq"/>
+            <param name="advanced" value="advanced"/>
+            <param name="kmer_size" value="8"/>
+            <param name="kma_index" value="test_index"/>
+            <output name="result_overview" file="ERR884056.res" ftype="tabular"/>
+            <output name="consensus_alignment" file="ERR884056.aln" ftype="fasta"/>
+            <output name="consensus_sequences" file="ERR884056.fsa" ftype="fasta"/>
+            <output name="read_mapping" file="ERR884056.frag" ftype="tabular"/>
+        </test>
+        <test>
+            <param name="single_paired_selector" value="single"/>
+            <param name="input_sequences" value="ERR884056_ecoli_b0842.mapped_R1.fastq" ftype="fastq"/>
+            <param name="advanced" value="advanced"/>
+            <param name="kmer_size" value="8"/>
+            <param name="matrix" value="true"/>
+            <param name="kma_index" value="test_index"/>
+            <output name="assembly_matrix" file="ERR884056.mat" ftype="txt"/>
+        </test>
+    </tests>
+    <help>
+      <![CDATA[
+
+When the mapping is done KMA will produce the following files:
+
+    *.res A result overview giving the most common statistics for each mapped template.
+    *.fsa The consensus sequences drawn from the alignments.
+    *.aln The consensus alignment of the reads against their template.
+    *.frag Mapping information on each mapped read, columns are: 
+        1. read
+        2. number of equally well mapping templates
+        3. mapping score
+        4. start position
+        5. end position (w.r.t. template)
+        6. the choosen template.
+    *.mat Base counts on each position in each template, (only if “-matrix” is enabled)
+
+      ]]>
+    </help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,18 @@
+<macros>
+    <token name="@TOOL_VERSION@">1.2.21</token>
+    <token name="@INTYPES@">
+        fastq,fastq.gz,fastqsanger,fastqsanger.gz
+    </token>
+    <xml name="kma_index">
+        <param label="Select a KMA index" name="kma_index" type="select">
+            <options from_data_table="kma_index">
+                <validator message="No KMA index available" type="no_options" />
+            </options>
+        </param>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1186/s12859-018-2336-6</citation>
+        </citations>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ERR884056.aln	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,170 @@
+# b0842_1
+template: 	ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTC
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	TGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATG
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	TTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCGATGACCGCG
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	TATCTGGCGGGCGGGATGTTTTTACAATGGCTGCTGGGGCCGCTGTCGGATCGTATTGGT
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	CGCCGTCCGGTGATGCTGGCGGGAGTGGTGTGGTTTATCGTCACCTGTCTGGCAATATTG
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	CTGGCGCAAAACATTGAACAATTCACCCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGT
+          	______________________________________________||||||||||||||
+query:    	----------------------------------------------gcataagcctctgt
+
+template: 	TTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATC
+          	||||||||||||||||||||||||||||||||||||||||||||_|||||||||||||||
+query:    	ttcattggcgctgtgggatacgccgcaattcaggaatccttcgatgaggcggtttgtatc
+
+template: 	AAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTG
+          	||||||||____________________________________________________
+query:    	aagatcac----------------------------------------------------
+
+template: 	GGCGCGGCGTGGATCCATGTGCTGCCCTGGGAGGGGATGTTTGTTTTGTTTGCCGCATTG
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	GCAGCGATCTCCTTTTTCGGTCTGCAACGAGCCATGCCTGAAACCGCCACGCGTATAGGC
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	GAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGC
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	TTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGTCTGCCGTTGCTGGCGTGGATCGCC
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	CAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTG
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	CAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCG
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	CGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATGATTGGTCTATTG
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	GTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACTGCCGGGTTA
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	AGTATTTATGCTTTCGGTATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTT
+          	____________________________________________________________
+query:    	------------------------------------------------------------
+
+template: 	GCCAGCGATATGAGTAAAGGTACGGTTTCTGCCGCGATGGGAATGCTGCAAATGCTGATC
+          	__________________________||||||_|||||||||||||||||||||||||||
+query:    	--------------------------ttctgCgGcGATGGGAATGCTGCAAATGCTGATC
+
+template: 	TTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACTGTTT
+          	|||||||||||||||||||||||||||||||||||||||||||||||||||||||_||||
+query:    	TTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTT
+
+template: 	AATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAA
+          	||||||||||||||||||||||||||||||||||||_______|||||||||||||||||
+query:    	AATCTCTTCAACCTTGTCAACGGAaTTTTGTGGCTg-------tggttatctttttaaaa
+
+template: 	GATAAACAGATGGGAAATTCTCACGAAGGGTAA
+          	|||||||||||||||||||||||||||||||||
+query:    	gataaacagatgggaaattctcacgaagggtaa
+
+# b0842_3
+template: 	ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTC
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTC
+
+template: 	TGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATG
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	TGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATG
+
+template: 	TTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCA
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	TTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCA
+
+template: 	TATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGT
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	TATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGT
+
+template: 	CGCCGTCCGGTGATGCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTA
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	CGCCGTCCGGTGATGCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTA
+
+template: 	CTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGT
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	CTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGT
+
+template: 	TTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATC
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	TTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATC
+
+template: 	AAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTG
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	AAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTG
+
+template: 	GGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTG
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	GGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTG
+
+template: 	GCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGC
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	GCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGC
+
+template: 	GAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGC
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	GAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGC
+
+template: 	TTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGCCTGCCATTGCTGGCGTGGATCGCC
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	TTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGCCTGCCATTGCTGGCGTGGATCGCC
+
+template: 	CAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTG
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	CAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTG
+
+template: 	CAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCG
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	CAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCG
+
+template: 	CGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTG
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	CGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTG
+
+template: 	GTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTA
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	GTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTA
+
+template: 	AGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTT
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	AGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTT
+
+template: 	GCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATC
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	GCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATC
+
+template: 	TTTACCGTCGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACTGTTT
+          	||||||||_||||||||||||||||||||||||||||||||||||||||||||||_||||
+query:    	TTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTT
+
+template: 	AATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAA
+          	||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+query:    	AATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAA
+
+template: 	GATAAACAGATGGGAAATTCTCACGAAGGGTAA
+          	|||||||||||||||||||||||||||||||||
+query:    	GATAAACAGATGGGAAATTCTCACGAAGGGTAA
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ERR884056.frag	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,506 @@
+TGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTT	1	94	1072	1169	b0842_1	ERR884056.2834864	0	97
+GATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAATGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTG	1	94	1076	1176	b0842_1	ERR884056.2647297	0	100
+AAGAGACAGGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCT	1	77	1050	1145	b0842_1	ERR884056.2441237	0	99
+TGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGGCTGT	1	50	1183	1233	b0842_1	ERR884056.2335253	0	101
+GGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCA	1	89	1058	1150	b0842_1	ERR884056.2321059	0	92
+GCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAAC	1	96	1053	1152	b0842_1	ERR884056.2143874	0	99
+GATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCT	1	96	1076	1175	b0842_1	ERR884056.2103308	0	99
+GCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCT	1	98	1053	1154	b0842_1	ERR884056.1887994	0	101
+CGGCGATTGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATC	1	84	1051	1144	b0842_1	ERR884056.1872018	0	93
+TCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTG	1	95	1078	1176	b0842_1	ERR884056.1857520	0	98
+CTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGC	1	77	1048	1128	b0842_1	ERR884056.1732986	0	80
+GCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCT	1	98	1053	1154	b0842_1	ERR884056.1622292	0	101
+GAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAAC	1	89	1060	1152	b0842_1	ERR884056.1533035	0	92
+TGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCA	1	84	1072	1159	b0842_1	ERR884056.1246840	0	87
+TGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGGCTGT	1	50	1183	1233	b0842_1	ERR884056.1091687	0	101
+TTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCT	1	85	1087	1175	b0842_1	ERR884056.960542	0	88
+GATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGC	1	41	1076	1117	b0842_1	ERR884056.917207	0	41
+GGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACTGGGGCAA	1	69	1058	1130	b0842_1	ERR884056.791515	0	72
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGATGAGGCGGTTTGTATCAAGATCAC	1	79	346	428	b0842_1	ERR884056.731782	0	82
+TTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTT	1	88	1046	1140	b0842_1	ERR884056.552530	0	94
+TCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAGTTTTGTG	1	88	1078	1172	b0842_1	ERR884056.307281	0	94
+CCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAAT	1	74	695	769	b0842_3	ERR884056.2922822	0	74
+GAAGAGCGGCCGCTTTGTGGCGGGGGCGCTGCCGCTGGGATTCGTTAGCCTGCCATTGCTGGCGTGGAT	1	63	647	716	b0842_3	ERR884056.2921952	0	69
+TTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAAT	1	78	691	769	b0842_3	ERR884056.2909363	0	78
+TTACCGGCGAGCAGTTGAGCAGCTCTGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATT	2	65	739	807	b0842_3	ERR884056.2901629	0	68
+GCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAG	1	101	933	1034	b0842_3	ERR884056.2898975	0	101
+GATCACCGCGCTGATGGCGAACGTGGCGCTG	3	31	422	453	b0842_3	ERR884056.2895985	0	31
+GATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCT	1	101	228	329	b0842_3	ERR884056.2892663	0	101
+CAAAATAAATTAGCTTCCGGTGCCAGTCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACC	4	81	3	87	b0842_3	ERR884056.2892595	0	84
+GGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCG	1	99	271	370	b0842_3	ERR884056.2892198	0	99
+CTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAACAGGCGGTTTG	2	86	327	416	b0842_3	ERR884056.2890162	0	89
+AATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGG	1	101	293	394	b0842_3	ERR884056.2889097	0	101
+AATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAA	2	93	1140	1233	b0842_3	ERR884056.2878314	0	98
+TTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAA	2	42	739	784	b0842_3	ERR884056.2875483	0	45
+GTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCG	2	72	358	430	b0842_3	ERR884056.2868977	0	72
+GGCATACGAGATGATTCAACCCGGTATGTTGGCCTTGGTGGAACAATATCAGGCGGTCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCG	1	84	93	189	b0842_3	ERR884056.2867288	0	97
+CGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCA	1	50	974	1024	b0842_3	ERR884056.2859125	0	50
+GGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCC	1	95	260	355	b0842_3	ERR884056.2858390	0	95
+GCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTCTGTCTCTTATACACATCTCC	1	62	563	658	b0842_3	ERR884056.2852677	0	99
+TCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTT	2	43	733	776	b0842_3	ERR884056.2852599	0	43
+GATGCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTC	1	73	251	324	b0842_3	ERR884056.2840702	0	73
+CTATAAGCTGGTGCTGAAGAACGGCCGCTTTGT	2	33	632	665	b0842_3	ERR884056.2824864	0	33
+TGTTGCTCGCTGCTGCCGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCG	1	89	895	990	b0842_3	ERR884056.2808940	0	95
+CTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGG	2	39	632	671	b0842_3	ERR884056.2808507	0	39
+GTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGAT	1	72	159	231	b0842_3	ERR884056.2800871	0	72
+AGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTT	3	76	748	824	b0842_3	ERR884056.2797781	0	76
+TGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAG	1	69	445	514	b0842_3	ERR884056.2797463	0	69
+CTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAAT	1	73	696	769	b0842_3	ERR884056.2797331	0	73
+GTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTC	1	92	811	903	b0842_3	ERR884056.2794338	0	92
+AGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAA	2	59	1037	1099	b0842_3	ERR884056.2789404	0	62
+GATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTG	2	41	491	532	b0842_3	ERR884056.2780542	0	41
+ATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGC	1	101	921	1022	b0842_3	ERR884056.2770314	0	101
+GGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGC	2	74	468	542	b0842_3	ERR884056.2755181	0	74
+GTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGT	1	69	197	266	b0842_3	ERR884056.2751601	0	69
+GTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGG	1	101	896	997	b0842_3	ERR884056.2751170	0	101
+CGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCG	1	92	838	930	b0842_3	ERR884056.2750406	0	92
+AATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGC	1	73	170	243	b0842_3	ERR884056.2749313	0	73
+CGTGGGCGCGGAGATGTGTATAAGAGACAGATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGC	3	51	401	485	b0842_3	ERR884056.2739815	0	98
+CCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCCGGG	1	40	175	218	b0842_3	ERR884056.2728974	0	43
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAAT	3	51	346	397	b0842_3	ERR884056.2723354	0	51
+GGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGC	4	71	981	1052	b0842_3	ERR884056.2722198	0	71
+GTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAAC	1	62	522	584	b0842_3	ERR884056.2719283	0	62
+GCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGG	1	74	909	983	b0842_3	ERR884056.2712338	0	74
+TTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTA	1	80	862	942	b0842_3	ERR884056.2697910	0	80
+TTCTCGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGG	1	43	0	43	b0842_3	ERR884056.2695888	0	101
+GGCTCGGAGATGTGTATAAGAGACAGCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATC	1	58	91	184	b0842_3	ERR884056.2694342	0	98
+TTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGC	2	98	360	458	b0842_3	ERR884056.2694148	0	98
+GGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTT	1	101	981	1082	b0842_3	ERR884056.2660902	0	101
+GGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAAC	1	70	514	584	b0842_3	ERR884056.2660618	0	70
+GTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCG	1	72	918	990	b0842_3	ERR884056.2655488	0	72
+GGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGG	1	48	217	265	b0842_3	ERR884056.2646708	0	48
+AAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTC	1	43	568	611	b0842_3	ERR884056.2643014	0	43
+CTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTT	1	84	815	899	b0842_3	ERR884056.2637351	0	84
+AAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCTCTCTCTGACTGGTGCTTTACGAATTTTCAACCTATA	4	80	5	91	b0842_3	ERR884056.2622950	0	86
+ACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGC	1	73	310	383	b0842_3	ERR884056.2616973	0	73
+GATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGC	1	93	860	953	b0842_3	ERR884056.2607345	0	93
+AAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGAC	1	65	568	633	b0842_3	ERR884056.2605978	0	65
+TGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTC	2	62	1113	1178	b0842_3	ERR884056.2598748	0	65
+TATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGA	1	101	416	517	b0842_3	ERR884056.2589555	0	101
+TTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGC	3	89	413	502	b0842_3	ERR884056.2587906	0	89
+GGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAGGCCTCTGTTTCTTTG	1	95	266	367	b0842_3	ERR884056.2586239	0	101
+GCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTAT	1	69	874	943	b0842_3	ERR884056.2585006	0	69
+GCGCCGCACCGTTCGTTGGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGC	1	60	839	905	b0842_3	ERR884056.2580363	0	66
+ACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCT	1	75	110	185	b0842_3	ERR884056.2574628	0	75
+CGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGC	2	91	591	682	b0842_3	ERR884056.2573662	0	91
+GCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATT	1	101	909	1010	b0842_3	ERR884056.2568832	0	101
+TTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGTGGTGTGGTTTATCATCACC	1	87	198	285	b0842_3	ERR884056.2561466	0	87
+TTCTTGCAGGGCATAAGCCTGTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTG	2	96	336	435	b0842_3	ERR884056.2557328	0	99
+GTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGC	2	53	918	971	b0842_3	ERR884056.2539491	0	53
+GTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAG	2	75	469	544	b0842_3	ERR884056.2533585	0	75
+ATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCG	2	101	729	830	b0842_3	ERR884056.2533545	0	101
+TCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCC	1	95	493	588	b0842_3	ERR884056.2525965	0	95
+GGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTTCTACTTCAATGACCGCATATTCTGTCTCTTA	1	58	114	189	b0842_3	ERR884056.2518242	0	80
+TGTGCTGACCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGG	2	60	497	560	b0842_3	ERR884056.2518086	0	63
+AATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTAT	1	100	319	419	b0842_3	ERR884056.2517781	0	100
+ATAAGAGACAGTCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATC	1	81	88	184	b0842_3	ERR884056.2515778	0	101
+TAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCTATTATTATTGGTCTGTTGGTCGCTGCTG	1	95	812	910	b0842_3	ERR884056.2513155	0	98
+GCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATTTTTTTAAAAGA	2	94	1102	1202	b0842_3	ERR884056.2501314	0	100
+GGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGG	3	101	771	872	b0842_3	ERR884056.2491700	0	101
+GCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAG	1	101	305	406	b0842_3	ERR884056.2482988	0	101
+TTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTAC	3	100	753	853	b0842_3	ERR884056.2480276	0	100
+CGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGC	1	57	848	905	b0842_3	ERR884056.2473957	0	57
+GGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGAT	2	62	375	437	b0842_3	ERR884056.2465843	0	62
+GTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGTTTGCTTT	2	78	1155	1233	b0842_3	ERR884056.2465496	0	97
+AGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGGTGATG	2	26	1207	1233	b0842_3	ERR884056.2458707	0	78
+CTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAAT	1	73	696	769	b0842_3	ERR884056.2452526	0	73
+TGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGGTGA	2	50	1183	1233	b0842_3	ERR884056.2441819	0	100
+CTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGA	2	43	1190	1233	b0842_3	ERR884056.2435667	0	82
+CTCTGGTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATC	1	98	325	426	b0842_3	ERR884056.2432703	0	101
+GACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTC	4	75	34	109	b0842_3	ERR884056.2429225	0	75
+GCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTC	1	101	825	926	b0842_3	ERR884056.2414650	0	101
+GGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGTGGTGTAGTTT	1	81	192	276	b0842_3	ERR884056.2401930	0	84
+TTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGATTCTGCGACGATGGGAATG	1	95	964	1065	b0842_3	ERR884056.2372228	0	101
+GGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAA	1	97	485	582	b0842_3	ERR884056.2366863	0	97
+CCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCCCCCCTACTTG	3	66	397	469	b0842_3	ERR884056.2366292	0	72
+GGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGCC	1	73	624	697	b0842_3	ERR884056.2365186	0	73
+TTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGG	2	43	730	773	b0842_3	ERR884056.2364113	0	43
+GATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGC	1	72	881	953	b0842_3	ERR884056.2358743	0	72
+CGCTGGGATTCGTTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGC	1	95	679	774	b0842_3	ERR884056.2357350	0	95
+GTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGG	2	83	329	412	b0842_3	ERR884056.2350645	0	83
+ACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGAT	1	97	134	231	b0842_3	ERR884056.2349709	0	97
+TGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCT	2	67	574	641	b0842_3	ERR884056.2343529	0	67
+GGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTT	1	101	981	1082	b0842_3	ERR884056.2339078	0	101
+TATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCC	3	91	416	507	b0842_3	ERR884056.2338086	0	91
+CCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCG	2	58	571	629	b0842_3	ERR884056.2336693	0	58
+ATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTT	2	95	729	824	b0842_3	ERR884056.2327679	0	95
+GATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGA	1	90	491	581	b0842_3	ERR884056.2318308	0	90
+GTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATC	1	100	829	929	b0842_3	ERR884056.2299455	0	100
+TTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCCTATTTATGG	1	56	886	945	b0842_3	ERR884056.2288894	0	59
+CTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGC	2	95	338	433	b0842_3	ERR884056.2276054	0	95
+ATAAGCTGGTGCTGAAGACCGGCCGCTTTGTGGCGGGGGC	2	37	634	674	b0842_3	ERR884056.2275730	0	40
+CTCGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCG	1	45	0	45	b0842_3	ERR884056.2242826	0	101
+CGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGA	1	74	304	378	b0842_3	ERR884056.2227703	0	74
+GCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCT	1	75	254	329	b0842_3	ERR884056.2223777	0	75
+GGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAA	1	93	114	207	b0842_3	ERR884056.2218876	0	93
+TTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGT	1	99	167	266	b0842_3	ERR884056.2218472	0	99
+CATCATTACCGGCGAGTAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGG	2	75	734	812	b0842_3	ERR884056.2214745	0	78
+CGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCG	2	101	727	828	b0842_3	ERR884056.2211785	0	101
+GTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGC	2	63	197	260	b0842_3	ERR884056.2211588	0	63
+GGTCGCCGTCCGGTGATGCT	4	20	237	257	b0842_3	ERR884056.2207456	0	20
+GGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGC	1	73	514	587	b0842_3	ERR884056.2205764	0	73
+GGAGATGTGTATAAGAGACAGGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGC	3	51	392	475	b0842_3	ERR884056.2205724	0	81
+CTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATT	2	76	1143	1219	b0842_3	ERR884056.2203624	0	76
+GGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGT	3	54	446	500	b0842_3	ERR884056.2196555	0	54
+GGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACG	2	101	344	445	b0842_3	ERR884056.2177089	0	101
+ATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGG	1	100	294	394	b0842_3	ERR884056.2176769	0	100
+CTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGT	2	36	210	246	b0842_3	ERR884056.2173347	0	36
+TGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCG	4	71	23	94	b0842_3	ERR884056.2172322	0	71
+AAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGC	1	72	568	640	b0842_3	ERR884056.2172067	0	72
+CTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGG	2	41	632	673	b0842_3	ERR884056.2163307	0	41
+GGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGGTGTTTT	1	85	114	202	b0842_3	ERR884056.2153651	0	88
+CGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGC	1	44	0	44	b0842_3	ERR884056.2147023	0	98
+GCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCC	1	101	254	355	b0842_3	ERR884056.2138937	0	101
+ATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGG	1	81	137	218	b0842_3	ERR884056.2130157	0	81
+GAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTC	4	60	0	60	b0842_3	ERR884056.2103500	0	68
+AGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAAT	1	76	693	769	b0842_3	ERR884056.2101027	0	76
+GGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCAAACGT	2	98	345	446	b0842_3	ERR884056.2100024	0	101
+TTTGTGGCGGGGGCGCTGGCGCTGGGATTCTTTAGCCTGCCATTGCTGGCGTGGATCGCCC	1	58	660	721	b0842_3	ERR884056.2094836	0	61
+GAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCC	3	67	440	507	b0842_3	ERR884056.2091648	0	67
+GTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCC	3	92	415	507	b0842_3	ERR884056.2080224	0	92
+GTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTG	4	101	22	123	b0842_3	ERR884056.2079310	0	101
+TCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTT	2	61	715	776	b0842_3	ERR884056.2075724	0	61
+GTGATGCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGC	1	87	249	336	b0842_3	ERR884056.2070433	0	87
+AGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTAT	1	94	142	236	b0842_3	ERR884056.2066001	0	94
+GCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGC	1	97	563	660	b0842_3	ERR884056.2065465	0	97
+ACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCT	1	101	84	185	b0842_3	ERR884056.2051948	0	101
+GCCTGCCATTGCTGGCGTGGAT	1	22	694	716	b0842_3	ERR884056.2042309	0	22
+TGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTAT	4	59	60	119	b0842_3	ERR884056.2027917	0	59
+TTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGAC	1	98	78	176	b0842_3	ERR884056.2014142	0	98
+ATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTC	2	85	387	472	b0842_3	ERR884056.2009372	0	85
+GTTGAGCAGCTATGAATATAGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTAC	3	98	752	853	b0842_3	ERR884056.1982067	0	101
+TAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGG	2	75	595	670	b0842_3	ERR884056.1981194	0	75
+GACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTC	2	85	1132	1220	b0842_3	ERR884056.1973933	0	88
+CGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCC	2	101	743	844	b0842_3	ERR884056.1972738	0	101
+GCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTG	1	76	906	982	b0842_3	ERR884056.1969034	0	76
+TATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCG	1	89	887	976	b0842_3	ERR884056.1962262	0	89
+GCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCC	1	92	486	578	b0842_3	ERR884056.1938032	0	92
+TGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGA	2	93	331	424	b0842_3	ERR884056.1937462	0	93
+CGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTG	1	62	1025	1090	b0842_3	ERR884056.1930586	0	65
+GTGATGCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTG	1	54	249	303	b0842_3	ERR884056.1921183	0	54
+AAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAAT	2	36	1197	1233	b0842_3	ERR884056.1918182	0	77
+GCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGG	2	101	369	470	b0842_3	ERR884056.1915153	0	101
+CGTTAATTGCGGGTAACTTACTATTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGC	4	71	799	876	b0842_3	ERR884056.1912061	0	77
+ATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTT	1	59	882	941	b0842_3	ERR884056.1909999	0	59
+CTGCTGCGGCAACGGTTATCTCATCGCACGCGTCTTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATT	1	74	904	981	b0842_3	ERR884056.1903717	0	77
+GTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCT	1	89	961	1050	b0842_3	ERR884056.1903553	0	89
+TGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGGTATCTTTTT	2	81	1109	1196	b0842_3	ERR884056.1898375	0	87
+GTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCG	1	81	849	930	b0842_3	ERR884056.1886263	0	81
+CCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGG	1	58	835	893	b0842_3	ERR884056.1883857	0	58
+TTTTTCAAACAAAAGACGGCATACGAGATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGAC	1	75	77	176	b0842_3	ERR884056.1882876	0	101
+AATATTACTGGCGCAAAACAGTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATAC	1	85	293	381	b0842_3	ERR884056.1864997	0	88
+TCGTTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGGTGAGCAGC	1	71	688	762	b0842_3	ERR884056.1856689	0	74
+TTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCG	2	93	339	432	b0842_3	ERR884056.1853993	0	93
+GATTCAACCCGGTATGTTGGCCGTGGTGGGACACTATCAGGCGGGCATTGATTGGGTTCCTA	4	56	104	166	b0842_3	ERR884056.1841589	0	62
+GCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGA	3	63	449	512	b0842_3	ERR884056.1833811	0	63
+ACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATAT	4	44	97	141	b0842_3	ERR884056.1828648	0	44
+AGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGCC	1	101	596	697	b0842_3	ERR884056.1827187	0	101
+TTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGG	1	101	939	1040	b0842_3	ERR884056.1822809	0	101
+TTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGG	1	43	0	43	b0842_3	ERR884056.1822265	0	84
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGA	2	96	346	442	b0842_3	ERR884056.1818685	0	96
+CCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCG	1	89	504	593	b0842_3	ERR884056.1816332	0	89
+TTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGT	3	101	399	500	b0842_3	ERR884056.1800274	0	101
+GTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTC	1	46	849	895	b0842_3	ERR884056.1797391	0	46
+GCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAAC	4	68	68	136	b0842_3	ERR884056.1795666	0	68
+CGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGG	1	92	98	190	b0842_3	ERR884056.1794348	0	92
+CTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGCTGTCTCTTATACACATCTCC	3	70	327	429	b0842_3	ERR884056.1792383	0	100
+TCGGCATTGGTCTGGCGGATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGG	1	64	973	1040	b0842_3	ERR884056.1790519	0	67
+GGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCAT	1	94	271	365	b0842_3	ERR884056.1785764	0	94
+TTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTT	3	82	774	856	b0842_3	ERR884056.1784946	0	82
+CTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTC	1	80	815	895	b0842_3	ERR884056.1777973	0	80
+GTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATA	1	94	286	380	b0842_3	ERR884056.1774118	0	94
+TCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAA	1	77	493	570	b0842_3	ERR884056.1766400	0	77
+AAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGC	1	78	568	646	b0842_3	ERR884056.1761856	0	78
+GCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGC	2	78	590	668	b0842_3	ERR884056.1758666	0	78
+GTGCAAAACATTGAACAATTCACTCTGTT	1	26	303	332	b0842_3	ERR884056.1756976	0	29
+AGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGTC	1	78	693	774	b0842_3	ERR884056.1752766	0	81
+CCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTG	2	88	576	664	b0842_3	ERR884056.1751543	0	88
+GCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCT	1	77	698	775	b0842_3	ERR884056.1741640	0	77
+GGACAGTTTAATCTGTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGG	2	92	1131	1229	b0842_3	ERR884056.1739204	0	98
+GTTGAGCAGCTATGAATATGGCTT	4	24	752	776	b0842_3	ERR884056.1736774	0	24
+GATCGTATTGGTCGCCGTCCGGTGATGCTGGTGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGG	1	73	228	304	b0842_3	ERR884056.1730754	0	76
+GTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTT	2	75	1090	1168	b0842_3	ERR884056.1730603	0	78
+CGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTT	1	47	852	899	b0842_3	ERR884056.1728787	0	47
+CTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTAT	2	63	356	419	b0842_3	ERR884056.1726331	0	63
+GCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGCGCTGAAGAACGGCCGCTTT	2	85	575	663	b0842_3	ERR884056.1721121	0	88
+TTGGTCTGTTGGTCGCTGCTGCCGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCG	1	98	889	990	b0842_3	ERR884056.1716206	0	101
+GGCGCTGGGATTCGTTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTAC	1	66	677	743	b0842_3	ERR884056.1714945	0	66
+GGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTAAGTCTTTAAAA	2	63	1125	1200	b0842_3	ERR884056.1681951	0	75
+GGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACA	2	63	1043	1109	b0842_3	ERR884056.1679176	0	66
+AAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAA	1	85	568	653	b0842_3	ERR884056.1675603	0	85
+TCGCTTTCTCGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGAC	1	37	0	37	b0842_3	ERR884056.1675490	0	100
+GCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCA	2	80	486	566	b0842_3	ERR884056.1667539	0	80
+GTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGT	1	72	1016	1088	b0842_3	ERR884056.1658880	0	72
+CAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAA	2	63	1134	1200	b0842_3	ERR884056.1658355	0	66
+GATCTCCTTTTTCGGTCTGCAAAAAGCCATGCCTGAAACCGCCACGCGTATAGG	1	51	545	599	b0842_3	ERR884056.1654192	0	54
+GCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACG	1	92	563	655	b0842_3	ERR884056.1646141	0	92
+GGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATG	1	64	1001	1065	b0842_3	ERR884056.1643573	0	64
+GTGCTGAAGAACGGCCGCTTTGT	3	23	642	665	b0842_3	ERR884056.1637785	0	23
+TATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTGATCGCACGCGTATTT	1	54	884	941	b0842_3	ERR884056.1630893	0	57
+CCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATC	3	98	397	495	b0842_3	ERR884056.1627923	0	98
+GGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACC	1	100	986	1086	b0842_3	ERR884056.1624738	0	100
+CGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGC	1	90	98	188	b0842_3	ERR884056.1609281	0	90
+GCGGGGGCGCTGGCGCTGGGATTCGTTAGCCTGCCATTGCTGGCGTGGAT	1	50	666	716	b0842_3	ERR884056.1609073	0	50
+CGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATC	2	56	1177	1233	b0842_3	ERR884056.1608906	0	83
+TTATGGATGACCGCCGGGTTAAGTATTTATGCTTGCGGCATTGGTCTGGCGAATGCGGGACTGGTG	1	63	939	1005	b0842_3	ERR884056.1595077	0	66
+TTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCG	1	90	886	976	b0842_3	ERR884056.1583891	0	90
+GTGGCGGGGGCGGTGGCCCTGGGATTCGTTAGCCTGCCATTGCTGGCGTGGAT	1	47	663	716	b0842_3	ERR884056.1582361	0	53
+TAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAAT	1	77	692	769	b0842_3	ERR884056.1577636	0	77
+TGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAA	2	75	578	653	b0842_3	ERR884056.1576701	0	75
+ATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTA	1	98	320	418	b0842_3	ERR884056.1564935	0	98
+GTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATG	2	66	372	438	b0842_3	ERR884056.1563582	0	66
+GCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTC	3	90	749	839	b0842_3	ERR884056.1552045	0	90
+GAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCAC	3	101	747	848	b0842_3	ERR884056.1546375	0	101
+TTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGT	1	63	691	754	b0842_3	ERR884056.1545724	0	63
+ATTGGGTTCCTACTTTAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGC	1	63	154	220	b0842_3	ERR884056.1540709	0	66
+CGTATGGGTCGCCGTCCGGTGATGCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGT	1	97	231	331	b0842_3	ERR884056.1534978	0	100
+GTTGAGCAGCTATGAATATGGCTTTCTGCAAGTGCCTATTTTCGGGG	3	44	752	799	b0842_3	ERR884056.1524408	0	47
+CTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGC	1	31	0	31	b0842_3	ERR884056.1523716	0	63
+CTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGTGGTGT	1	49	222	271	b0842_3	ERR884056.1519482	0	49
+CCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGC	1	101	471	572	b0842_3	ERR884056.1516945	0	101
+CGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTG	4	79	799	878	b0842_3	ERR884056.1508304	0	79
+CATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGT	1	75	535	610	b0842_3	ERR884056.1504718	0	75
+CTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGACTGTCTCTTAT	1	80	288	389	b0842_3	ERR884056.1503335	0	101
+CTTCAACCTTGTCAACGGAATGTTGTGGC	2	26	1145	1174	b0842_3	ERR884056.1503123	0	29
+GATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTG	4	45	1006	1051	b0842_3	ERR884056.1499945	0	45
+AATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACT	4	40	10	50	b0842_3	ERR884056.1490832	0	40
+TCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGG	2	44	1189	1233	b0842_3	ERR884056.1488198	0	91
+GTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTT	2	54	722	776	b0842_3	ERR884056.1483684	0	54
+GGCGGGGGTGGTGTGGTTTATCATCCCCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTC	1	68	257	328	b0842_3	ERR884056.1483059	0	71
+GGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTT	2	64	712	776	b0842_3	ERR884056.1480300	0	64
+GCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTT	1	51	0	51	b0842_3	ERR884056.1477458	0	100
+ATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCG	3	62	991	1053	b0842_3	ERR884056.1461496	0	62
+GGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTT	1	92	955	1047	b0842_3	ERR884056.1450187	0	92
+GCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCT	2	93	745	838	b0842_3	ERR884056.1449623	0	93
+CTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCT	2	47	210	257	b0842_3	ERR884056.1443357	0	47
+AAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGC	2	60	580	640	b0842_3	ERR884056.1430661	0	60
+AGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGG	2	101	569	670	b0842_3	ERR884056.1428431	0	101
+GTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGC	1	99	896	995	b0842_3	ERR884056.1427854	0	99
+GCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTT	2	70	486	556	b0842_3	ERR884056.1422703	0	70
+AATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCC	1	62	293	355	b0842_3	ERR884056.1413487	0	62
+GTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGA	1	101	956	1057	b0842_3	ERR884056.1406178	0	101
+GTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTT	1	86	115	201	b0842_3	ERR884056.1398665	0	86
+TTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACC	3	84	753	837	b0842_3	ERR884056.1388318	0	84
+CTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGG	1	67	0	67	b0842_3	ERR884056.1387895	0	97
+ACGAGATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGAT	4	56	97	156	b0842_3	ERR884056.1385126	0	59
+CTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCTCTACTTG	2	96	370	469	b0842_3	ERR884056.1369900	0	99
+TATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGA	1	101	416	517	b0842_3	ERR884056.1365050	0	101
+GATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGGTGATGGTCGTCAATCTGGTG	2	33	1200	1233	b0842_3	ERR884056.1363636	0	100
+GGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTT	4	42	899	941	b0842_3	ERR884056.1347621	0	42
+AAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAA	2	36	1197	1233	b0842_3	ERR884056.1345433	0	41
+GGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGGGG	1	57	208	268	b0842_3	ERR884056.1334838	0	60
+CTCGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGAC	1	37	0	37	b0842_3	ERR884056.1332784	0	93
+CCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCA	3	100	397	497	b0842_3	ERR884056.1330530	0	100
+ATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGGTTGGGTTCCTA	1	46	117	166	b0842_3	ERR884056.1329269	0	49
+GTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTT	2	54	722	776	b0842_3	ERR884056.1324910	0	54
+GCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAG	1	97	447	544	b0842_3	ERR884056.1324474	0	97
+TATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTA	1	101	863	964	b0842_3	ERR884056.1308086	0	101
+GGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCT	3	62	446	508	b0842_3	ERR884056.1307458	0	62
+GTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCT	1	100	272	372	b0842_3	ERR884056.1306815	0	100
+AGACAGGTCGTGACTATAAGCTGGTGCTGAAGAACGGACGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTT	3	62	617	693	b0842_3	ERR884056.1305951	0	74
+TTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCG	1	101	889	990	b0842_3	ERR884056.1301560	0	101
+TATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGG	1	71	275	346	b0842_3	ERR884056.1298180	0	71
+GGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTT	2	69	707	776	b0842_3	ERR884056.1273831	0	69
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTT	2	68	346	414	b0842_3	ERR884056.1272125	0	68
+ACTATAAGCTGGTGCTGAAGAACGGCAGCTTTGTG	2	32	631	666	b0842_3	ERR884056.1258361	0	35
+GTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTG	4	101	22	123	b0842_3	ERR884056.1256943	0	101
+TGATGCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGG	1	97	250	347	b0842_3	ERR884056.1256714	0	97
+AAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGG	2	87	1036	1126	b0842_3	ERR884056.1254124	0	90
+TCGGAGATGTGTATAAGAGACAGAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTAT	1	66	793	890	b0842_3	ERR884056.1250427	0	100
+GTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATC	3	80	415	495	b0842_3	ERR884056.1248377	0	80
+ATTGGCGAAGAAATGGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGGCGTCAGG	4	40	0	43	b0842_3	ERR884056.1247185	0	60
+CCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATC	1	82	847	929	b0842_3	ERR884056.1243527	0	82
+CGCGGCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCT	1	96	826	925	b0842_3	ERR884056.1230429	0	99
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTG	2	89	346	435	b0842_3	ERR884056.1229094	0	89
+CGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTG	1	101	916	1017	b0842_3	ERR884056.1224451	0	101
+AATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTC	4	99	10	109	b0842_3	ERR884056.1218607	0	99
+ATCGCTTTCTCGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGAC	1	37	0	37	b0842_3	ERR884056.1214769	0	101
+CGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCT	1	82	843	925	b0842_3	ERR884056.1209816	0	82
+CCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGAT	1	36	695	731	b0842_3	ERR884056.1206654	0	36
+GGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATT	1	90	147	237	b0842_3	ERR884056.1187274	0	90
+ATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTAT	1	101	789	890	b0842_3	ERR884056.1177620	0	101
+GCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGG	1	84	976	1060	b0842_3	ERR884056.1173946	0	84
+GCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATCTGTCTCT	1	69	698	776	b0842_3	ERR884056.1160367	0	79
+CCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCG	1	83	847	930	b0842_3	ERR884056.1135197	0	83
+GGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGA	3	76	981	1057	b0842_3	ERR884056.1132704	0	76
+CGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGC	1	100	808	908	b0842_3	ERR884056.1121258	0	100
+GAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGCATAGGCGAGAAA	1	93	510	606	b0842_3	ERR884056.1114707	0	96
+CTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTG	2	98	1014	1115	b0842_3	ERR884056.1111193	0	101
+GGGATTCGTTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAG	1	78	683	761	b0842_3	ERR884056.1110926	0	78
+TCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGT	1	101	493	594	b0842_3	ERR884056.1110557	0	101
+CGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGG	1	94	125	219	b0842_3	ERR884056.1104695	0	94
+CCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTT	1	72	459	531	b0842_3	ERR884056.1098192	0	72
+GCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGG	2	85	585	670	b0842_3	ERR884056.1090194	0	85
+CATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTG	1	80	535	615	b0842_3	ERR884056.1087956	0	80
+GTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCT	2	95	1044	1145	b0842_3	ERR884056.1084963	0	101
+GTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGG	3	95	415	510	b0842_3	ERR884056.1082860	0	95
+ATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGC	1	83	105	188	b0842_3	ERR884056.1082604	0	83
+AGAGACAGGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTAC	3	90	754	853	b0842_3	ERR884056.1076153	0	101
+TGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTG	1	92	436	528	b0842_3	ERR884056.1059483	0	92
+GCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGC	2	69	1102	1174	b0842_3	ERR884056.1049088	0	72
+GCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATG	1	85	909	994	b0842_3	ERR884056.1048588	0	85
+AGGCGAGAAGCTGTCACTGAAAGAGCTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGCC	1	95	596	697	b0842_3	ERR884056.1047435	0	101
+TCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGA	1	91	287	378	b0842_3	ERR884056.1031891	0	91
+CTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGG	2	54	1179	1233	b0842_3	ERR884056.1023875	0	101
+GGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGT	2	101	712	813	b0842_3	ERR884056.1001428	0	101
+TGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAAT	2	100	706	806	b0842_3	ERR884056.993832	0	100
+TGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAA	1	101	517	618	b0842_3	ERR884056.986985	0	101
+CTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGC	1	91	904	995	b0842_3	ERR884056.986421	0	91
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGC	2	87	346	433	b0842_3	ERR884056.984906	0	87
+TTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGC	1	83	160	243	b0842_3	ERR884056.977897	0	83
+TCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCC	1	88	927	1015	b0842_3	ERR884056.959504	0	88
+CCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCG	1	83	847	930	b0842_3	ERR884056.945032	0	83
+TGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAAT	1	72	697	769	b0842_3	ERR884056.944629	0	72
+GGGGGCGCTGGCGCTGGGATTCGTTAGCCTGCCATTGCTGGCGTGGAT	1	48	668	716	b0842_3	ERR884056.941817	0	48
+GCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAAAAGATGGGAAAT	2	86	1126	1218	b0842_3	ERR884056.935629	0	92
+TGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATC	1	98	451	549	b0842_3	ERR884056.934412	0	98
+CTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATT	2	76	1143	1219	b0842_3	ERR884056.933549	0	76
+TGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGT	1	88	436	524	b0842_3	ERR884056.929684	0	88
+GAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACC	1	55	1031	1086	b0842_3	ERR884056.913294	0	55
+GAGATGTGTATAAGAGACAGATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGC	1	31	0	31	b0842_3	ERR884056.910352	0	89
+CCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTC	3	49	353	402	b0842_3	ERR884056.905506	0	49
+TTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAG	2	78	466	544	b0842_3	ERR884056.904100	0	78
+ATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCC	4	37	978	1015	b0842_3	ERR884056.900492	0	37
+GGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGC	1	72	271	343	b0842_3	ERR884056.898290	0	72
+ACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGGTGTTTTTACAATG	1	96	110	209	b0842_3	ERR884056.854899	0	99
+CGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAA	2	73	1160	1233	b0842_3	ERR884056.853243	0	76
+TGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCA	3	46	451	497	b0842_3	ERR884056.851964	0	46
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATGCAGGAATCCTTCGAAGAGGCGGTTTGTATCA	2	72	346	421	b0842_3	ERR884056.846553	0	75
+CGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTG	1	43	974	1017	b0842_3	ERR884056.844992	0	43
+GTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAAT	2	82	1136	1218	b0842_3	ERR884056.842430	0	82
+CGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGG	2	83	584	667	b0842_3	ERR884056.841801	0	83
+GCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGAC	1	37	0	37	b0842_3	ERR884056.840652	0	86
+TGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTAC	1	82	1003	1085	b0842_3	ERR884056.835880	0	82
+CTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTTTCTTTTTTAAAGATAAACA	2	53	1145	1208	b0842_3	ERR884056.830001	0	63
+GGCTCGGAGATGTGTATAAGAGACAGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTAT	2	54	323	419	b0842_3	ERR884056.819730	0	99
+CGCTGGTGGGCGCGGCGTGCATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTG	2	53	472	528	b0842_3	ERR884056.817808	0	56
+ATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTAT	1	100	496	596	b0842_3	ERR884056.814969	0	100
+TTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGAT	2	67	1166	1233	b0842_3	ERR884056.803607	0	93
+CTCTCTGTCTGGTTCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGAT	4	98	55	156	b0842_3	ERR884056.801847	0	101
+GTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCT	2	95	1044	1145	b0842_3	ERR884056.784159	0	101
+TGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCC	1	56	0	56	b0842_3	ERR884056.777342	0	101
+CATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCG	4	94	0	94	b0842_3	ERR884056.774319	0	95
+GCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCA	2	80	486	566	b0842_3	ERR884056.769877	0	80
+AAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATAAATGGTG	2	35	1198	1233	b0842_3	ERR884056.764837	0	84
+GGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGAGAGAAACTGTCA	1	96	513	612	b0842_3	ERR884056.761704	0	99
+CGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATA	1	76	304	380	b0842_3	ERR884056.751024	0	76
+GTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTGCTTGGTCCGCTGGT	3	65	411	479	b0842_3	ERR884056.749917	0	68
+TTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATT	1	93	297	390	b0842_3	ERR884056.743252	0	93
+TGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGG	3	101	770	871	b0842_3	ERR884056.738574	0	101
+TCGCTTTCTCGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGC	1	31	0	31	b0842_3	ERR884056.726431	0	94
+ACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCG	1	68	165	233	b0842_3	ERR884056.714227	0	68
+GGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTT	1	101	261	362	b0842_3	ERR884056.703797	0	101
+TCGTTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATT	1	53	688	741	b0842_3	ERR884056.700716	0	53
+GATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAA	2	70	1026	1099	b0842_3	ERR884056.689769	0	73
+GACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCA	1	82	833	915	b0842_3	ERR884056.677990	0	82
+CCATTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAG	2	39	719	761	b0842_3	ERR884056.667985	0	42
+TCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCG	2	65	626	691	b0842_3	ERR884056.657358	0	65
+CTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCAC	2	81	1143	1224	b0842_3	ERR884056.656772	0	81
+CCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGTTTTGGCAGCGATCTCCTTTTT	1	92	459	557	b0842_3	ERR884056.656250	0	98
+CGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGG	1	93	852	945	b0842_3	ERR884056.656164	0	93
+GTTGAGCAGCTATGAATATGGCTT	4	24	752	776	b0842_3	ERR884056.650623	0	24
+GTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTG	1	82	498	580	b0842_3	ERR884056.646967	0	82
+GTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAA	1	94	559	653	b0842_3	ERR884056.646404	0	94
+GCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATT	1	49	839	888	b0842_3	ERR884056.644643	0	49
+AAGCCATGCCTGAAACCGCCACGCGTATAGG	1	31	568	599	b0842_3	ERR884056.634181	0	31
+GAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCT	1	83	132	215	b0842_3	ERR884056.633068	0	83
+GAGCAGCTATGAATATGGCTT	4	21	755	776	b0842_3	ERR884056.623465	0	21
+TATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGAC	1	80	920	1000	b0842_3	ERR884056.602258	0	80
+GTGCTGAAGAACGGCCGCTTTGT	3	23	642	665	b0842_3	ERR884056.598757	0	23
+TCGCTGAGTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCA	1	69	855	927	b0842_3	ERR884056.595821	0	72
+ACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGT	2	34	631	665	b0842_3	ERR884056.577180	0	34
+GGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGG	2	92	1038	1133	b0842_3	ERR884056.564439	0	95
+GCGCGTCTGCCCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTC	1	98	825	926	b0842_3	ERR884056.562507	0	101
+CTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAAT	2	88	1145	1233	b0842_3	ERR884056.550969	0	94
+TATCTGGCGGGCGGGATGTTTTTACAATGG	4	30	180	210	b0842_3	ERR884056.549497	0	30
+TAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGG	1	82	958	1040	b0842_3	ERR884056.543935	0	82
+GATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTA	1	78	1006	1084	b0842_3	ERR884056.541158	0	78
+TGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCC	1	73	942	1015	b0842_3	ERR884056.536318	0	73
+CTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATAT	4	84	57	141	b0842_3	ERR884056.527528	0	84
+AATTAGCTTCCGGTTCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGC	4	57	10	70	b0842_3	ERR884056.506046	0	60
+TGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATT	3	101	784	885	b0842_3	ERR884056.490309	0	101
+CCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATG	2	43	212	255	b0842_3	ERR884056.480992	0	43
+GATGAGCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGG	1	98	944	1045	b0842_3	ERR884056.473750	0	101
+CCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCT	1	40	175	215	b0842_3	ERR884056.463263	0	40
+TGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCAC	2	100	328	428	b0842_3	ERR884056.459364	0	100
+GCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTG	1	63	844	907	b0842_3	ERR884056.458931	0	63
+TGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGC	4	82	64	146	b0842_3	ERR884056.455901	0	82
+TATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACA	2	78	1028	1109	b0842_3	ERR884056.446973	0	81
+ATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAA	1	71	546	617	b0842_3	ERR884056.443295	0	71
+CGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCT	1	99	826	925	b0842_3	ERR884056.442163	0	99
+GTTTGTATCAAGATCTCGGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGC	3	88	411	505	b0842_3	ERR884056.429602	0	94
+TCCTTCGAAGAGGCGGTTTGTATCAAGATCAC	3	32	396	428	b0842_3	ERR884056.423060	0	32
+GGGATTCGTTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAG	1	78	683	761	b0842_3	ERR884056.415729	0	78
+TCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCAGTGGCAGCGATCTCCTTTTTCGGTCTGCAAGAAGCCATGCCTGAAACCG	1	87	493	586	b0842_3	ERR884056.391698	0	93
+GTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCT	2	57	469	526	b0842_3	ERR884056.388812	0	57
+GCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGCATAGGCGAGA	1	98	503	604	b0842_3	ERR884056.382290	0	101
+ATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGC	2	79	1092	1174	b0842_3	ERR884056.374774	0	82
+GTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGGCTTGATTGGGT	4	94	61	161	b0842_3	ERR884056.374282	0	100
+AACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGC	2	75	1158	1233	b0842_3	ERR884056.370452	0	98
+CTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTG	1	100	548	648	b0842_3	ERR884056.359883	0	100
+GCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGC	2	82	575	657	b0842_3	ERR884056.352982	0	82
+TGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAA	2	63	1170	1233	b0842_3	ERR884056.345201	0	67
+GTTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGC	1	84	690	774	b0842_3	ERR884056.339085	0	84
+GTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAAC	2	72	372	444	b0842_3	ERR884056.330664	0	72
+CGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACG	2	78	1042	1123	b0842_3	ERR884056.321176	0	81
+GTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGC	2	65	592	657	b0842_3	ERR884056.320385	0	65
+GCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTT	2	90	704	794	b0842_3	ERR884056.319248	0	90
+TCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCT	2	46	211	257	b0842_3	ERR884056.315446	0	46
+GGGTTCGTTAGCCTGCCATTGCTGGCGTGGAT	1	29	683	716	b0842_3	ERR884056.313568	0	32
+GCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAAT	1	75	694	769	b0842_3	ERR884056.311849	0	75
+GCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGC	2	94	369	463	b0842_3	ERR884056.305434	0	94
+AAGCGATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAG	1	80	568	651	b0842_3	ERR884056.304199	0	83
+GGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGC	1	100	271	371	b0842_3	ERR884056.300554	0	100
+CTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGCCGGGCATTGAT	4	98	55	156	b0842_3	ERR884056.298911	0	101
+TATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAA	1	78	0	78	b0842_3	ERR884056.295385	0	99
+GATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTAC	1	59	1026	1085	b0842_3	ERR884056.269420	0	59
+GTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCCTGTCTCT	2	83	372	468	b0842_3	ERR884056.249008	0	97
+GTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGG	2	45	625	670	b0842_3	ERR884056.239337	0	45
+TCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCA	3	101	396	497	b0842_3	ERR884056.234054	0	101
+CTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTT	2	98	370	468	b0842_3	ERR884056.233084	0	98
+GGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTG	1	86	1001	1090	b0842_3	ERR884056.229003	0	89
+TGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGAC	1	91	859	950	b0842_3	ERR884056.224770	0	91
+GTGTTGTTTATTATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTG	1	94	267	367	b0842_3	ERR884056.218543	0	100
+TCCGCTACTTGGTCCGCTGGTGTGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTT	1	70	458	531	b0842_3	ERR884056.217433	0	73
+TATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGC	1	70	0	70	b0842_3	ERR884056.216260	0	91
+ACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGATCTGGCGAATGCGGGACTGGAGCGATTAA	1	91	915	1012	b0842_3	ERR884056.214669	0	97
+CTTCAACCTTGTCAACGGAATTTTGTGGCTGTCG	2	34	1145	1179	b0842_3	ERR884056.201723	0	34
+GGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCCTG	2	43	712	761	b0842_3	ERR884056.201474	0	50
+CGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTT	1	71	828	899	b0842_3	ERR884056.196606	0	71
+AGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGC	1	101	142	243	b0842_3	ERR884056.195008	0	101
+GCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGG	1	100	698	798	b0842_3	ERR884056.193977	0	100
+GTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCCTGTCTCTTATACACATCTC	1	66	559	654	b0842_3	ERR884056.191399	0	101
+GTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAA	2	97	1136	1233	b0842_3	ERR884056.171393	0	101
+CGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGG	4	52	988	1040	b0842_3	ERR884056.160015	0	52
+AAGACCTCGGTCGTGACTATAAGCTGGTGCTGAAG	3	32	616	651	b0842_3	ERR884056.154502	0	35
+AGAGACAGCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAA	2	83	1140	1233	b0842_3	ERR884056.149198	0	101
+TGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGG	1	98	942	1040	b0842_3	ERR884056.148041	0	98
+CTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGG	1	98	815	913	b0842_3	ERR884056.146603	0	98
+CGCAAAACATTGAACACTTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAA	1	98	304	405	b0842_3	ERR884056.141798	0	101
+GGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATA	1	83	514	597	b0842_3	ERR884056.132716	0	83
+GCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGA	1	101	303	404	b0842_3	ERR884056.130233	0	101
+ATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTACGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGG	4	64	0	67	b0842_3	ERR884056.128819	0	84
+ATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGGTGATGGTCGTCAATCTGGTGT	2	32	1201	1233	b0842_3	ERR884056.125093	0	100
+TGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGTGGTGTGGTTTATCATCACC	1	89	196	285	b0842_3	ERR884056.124429	0	89
+GTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTG	2	97	372	469	b0842_3	ERR884056.111065	0	97
+ATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAA	2	45	1188	1233	b0842_3	ERR884056.108798	0	85
+GGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCC	2	72	1161	1233	b0842_3	ERR884056.98521	0	81
+ATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGC	1	46	885	931	b0842_3	ERR884056.96205	0	46
+CTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGG	4	100	48	148	b0842_3	ERR884056.90492	0	100
+TAGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTT	1	82	436	521	b0842_3	ERR884056.87557	0	85
+CAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAA	2	63	1134	1200	b0842_3	ERR884056.87421	0	66
+GGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAAT	1	61	147	208	b0842_3	ERR884056.82382	0	61
+AGAGACAGGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGT	4	88	21	121	b0842_3	ERR884056.68978	0	101
+CGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCT	2	52	589	641	b0842_3	ERR884056.57400	0	52
+CATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGC	1	74	700	774	b0842_3	ERR884056.51896	0	74
+TATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGC	1	90	936	1026	b0842_3	ERR884056.49971	0	90
+GTTTGTATCAAGATCGCCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGA	3	98	411	512	b0842_3	ERR884056.45596	0	101
+CGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCG	2	101	727	828	b0842_3	ERR884056.44406	0	101
+GTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCA	1	101	286	387	b0842_3	ERR884056.35909	0	101
+TCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTAT	1	60	830	890	b0842_3	ERR884056.28618	0	60
+CCGCTGGTGGGCGCGGCG	4	18	471	489	b0842_3	ERR884056.25879	0	18
+CAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGT	1	97	169	266	b0842_3	ERR884056.18517	0	97
+GGAGATGTGTATAAGAGACAGCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTT	1	73	263	361	b0842_3	ERR884056.13376	0	101
+AGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGC	2	71	569	640	b0842_3	ERR884056.12478	0	71
+CCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACT	2	51	583	634	b0842_3	ERR884056.2831	0	51
+CCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGC	2	96	353	449	b0842_3	ERR884056.1120	0	96
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ERR884056.fsa	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,28 @@
+>b0842_1
+gcataagcctctgtttcattggcgctgtgggatacgccgcaattcaggaatccttcgatg
+aggcggtttgtatcaagatcacttctgCgGcGATGGGAATGCTGCAAATGCTGATCTTTA
+CCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATC
+TCTTCAACCTTGTCAACGGAaTTTTGTGGCTgtggttatctttttaaaagataaacagat
+gggaaattctcacgaagggtaa
+>b0842_3
+ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTC
+TGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATG
+TTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCA
+TATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGT
+CGCCGTCCGGTGATGCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTA
+CTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGT
+TTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATC
+AAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTG
+GGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTG
+GCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGC
+GAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGC
+TTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGCCTGCCATTGCTGGCGTGGATCGCC
+CAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTG
+CAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCG
+CGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTG
+GTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTA
+AGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTT
+GCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATC
+TTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTT
+AATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAA
+GATAAACAGATGGGAAATTCTCACGAAGGGTAA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ERR884056.mat	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,2542 @@
+#b0842_1
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	1	0	0	0
+C	0	1	0	0	0	0
+A	1	0	0	0	0	0
+T	0	0	0	1	0	0
+A	1	0	0	0	0	0
+A	1	0	0	0	0	0
+G	0	0	1	0	0	0
+C	0	1	0	0	0	0
+C	0	1	0	0	0	0
+T	0	0	0	1	0	0
+C	0	1	0	0	0	0
+T	0	0	0	1	0	0
+G	0	0	1	0	0	0
+T	0	0	0	1	0	0
+T	0	0	0	1	0	0
+T	0	0	0	1	0	0
+C	0	1	0	0	0	0
+A	1	0	0	0	0	0
+T	0	0	0	1	0	0
+T	0	0	0	1	0	0
+G	0	0	1	0	0	0
+G	0	0	1	0	0	0
+C	0	1	0	0	0	0
+G	0	0	1	0	0	0
+C	0	1	0	0	0	0
+T	0	0	0	1	0	0
+G	0	0	1	0	0	0
+T	0	0	0	1	0	0
+G	0	0	1	0	0	0
+G	0	0	1	0	0	0
+G	0	0	1	0	0	0
+A	1	0	0	0	0	0
+T	0	0	0	1	0	0
+A	1	0	0	0	0	0
+C	0	1	0	0	0	0
+G	0	0	1	0	0	0
+C	0	1	0	0	0	0
+C	0	1	0	0	0	0
+G	0	0	1	0	0	0
+C	0	1	0	0	0	0
+A	1	0	0	0	0	0
+A	1	0	0	0	0	0
+T	0	0	0	1	0	0
+T	0	0	0	1	0	0
+C	0	1	0	0	0	0
+A	1	0	0	0	0	0
+G	0	0	1	0	0	0
+G	0	0	1	0	0	0
+A	1	0	0	0	0	0
+A	1	0	0	0	0	0
+T	0	0	0	1	0	0
+C	0	1	0	0	0	0
+C	0	1	0	0	0	0
+T	0	0	0	1	0	0
+T	0	0	0	1	0	0
+C	0	1	0	0	0	0
+G	0	0	1	0	0	0
+A	1	0	0	0	0	0
+A	0	0	0	1	0	0
+G	0	0	1	0	0	0
+A	1	0	0	0	0	0
+G	0	0	1	0	0	0
+G	0	0	1	0	0	0
+C	0	1	0	0	0	0
+G	0	0	1	0	0	0
+G	0	0	1	0	0	0
+T	0	0	0	1	0	0
+T	0	0	0	1	0	0
+T	0	0	0	1	0	0
+G	0	0	1	0	0	0
+T	0	0	0	1	0	0
+A	1	0	0	0	0	0
+T	0	0	0	1	0	0
+C	0	1	0	0	0	0
+A	1	0	0	0	0	0
+A	1	0	0	0	0	0
+G	0	0	1	0	0	0
+A	1	0	0	0	0	0
+T	0	0	0	1	0	0
+C	0	1	0	0	0	0
+A	1	0	0	0	0	0
+C	0	1	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+C	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+A	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+A	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+G	0	0	0	0	0	0
+T	0	0	0	0	0	0
+T	0	0	0	1	0	0
+T	0	0	0	1	0	0
+C	0	2	0	0	0	0
+T	0	0	0	2	0	0
+-	1	0	0	0	0	2
+-	1	0	0	0	0	2
+G	0	0	3	0	0	0
+-	1	0	0	0	0	2
+-	0	0	1	0	0	2
+-	1	0	0	0	0	2
+C	0	4	0	0	0	0
+C	1	0	3	0	0	0
+G	0	0	7	0	0	0
+C	0	6	0	0	0	1
+G	0	0	7	0	0	0
+A	7	0	0	0	0	0
+T	0	0	0	7	0	0
+G	0	0	8	1	0	0
+G	0	0	9	0	0	0
+G	0	0	10	0	0	0
+A	10	0	0	0	0	0
+A	10	0	0	0	0	0
+T	0	0	0	10	0	0
+G	0	0	10	0	0	0
+C	0	10	0	0	0	0
+T	0	0	0	10	0	0
+G	0	0	10	0	0	0
+C	0	10	0	0	0	0
+A	10	0	0	0	0	0
+A	10	0	0	0	0	0
+A	10	0	0	0	0	0
+T	0	0	0	12	0	0
+G	0	0	12	0	0	0
+C	0	12	0	0	0	0
+T	0	0	0	12	0	0
+G	0	0	15	0	0	0
+A	15	0	0	0	0	0
+T	0	0	0	17	0	0
+C	0	17	0	0	0	0
+T	0	0	0	17	0	0
+T	0	0	0	17	0	0
+T	0	0	0	17	0	0
+A	17	0	0	0	0	0
+C	0	17	0	0	0	0
+C	0	17	0	0	0	0
+G	0	0	17	0	0	0
+T	0	0	0	18	0	0
+T	0	0	0	18	0	0
+G	0	0	18	0	0	0
+G	0	0	18	0	0	0
+T	0	0	0	18	0	0
+A	18	0	0	0	0	0
+T	0	0	0	18	0	0
+T	0	0	0	18	0	0
+G	0	0	18	0	0	0
+A	18	0	0	0	0	0
+A	18	0	0	0	0	0
+A	18	0	0	0	0	0
+T	0	0	0	18	0	0
+C	0	18	0	0	0	0
+A	18	0	0	0	0	0
+G	0	0	18	0	0	0
+C	0	18	0	0	0	0
+A	18	0	0	0	0	0
+A	18	0	0	0	0	0
+A	18	0	0	0	0	0
+C	0	18	0	0	0	0
+A	18	0	0	0	0	0
+T	0	0	0	18	0	0
+G	0	0	18	0	0	0
+C	0	18	0	0	0	0
+C	0	18	0	0	0	0
+T	0	0	0	18	0	0
+G	0	0	18	0	0	0
+G	0	0	18	0	0	0
+C	0	18	0	0	0	0
+T	0	0	0	17	0	0
+G	0	0	17	0	0	0
+A	17	0	0	0	0	0
+A	17	0	0	0	0	0
+C	0	16	0	1	0	0
+G	0	0	16	1	0	0
+G	0	0	17	0	0	0
+G	0	0	17	0	0	0
+G	0	0	17	0	0	0
+G	0	0	17	0	0	0
+C	0	17	0	0	0	0
+A	16	0	0	0	0	0
+A	16	0	0	0	0	0
+C	0	15	0	0	0	0
+G	0	0	15	0	0	0
+G	0	0	15	0	0	0
+A	15	0	0	0	0	0
+C	0	15	0	0	0	0
+T	15	0	0	0	0	0
+G	0	0	15	0	0	0
+T	0	0	0	15	0	0
+T	0	0	0	15	0	0
+T	0	0	0	15	0	0
+A	14	0	0	0	0	0
+A	14	0	0	0	0	0
+T	0	0	0	14	0	0
+C	0	14	0	0	0	0
+T	0	0	0	13	0	0
+C	0	12	0	0	0	0
+T	0	0	0	12	0	0
+T	0	0	0	12	0	0
+C	0	12	0	0	0	0
+A	12	0	0	0	0	0
+A	11	0	0	0	0	0
+C	0	11	0	0	0	0
+C	0	9	0	0	0	0
+T	0	0	0	9	0	0
+T	0	0	0	7	0	0
+G	0	0	7	0	0	0
+T	0	0	0	7	0	0
+C	0	7	0	0	0	0
+A	7	0	0	0	0	0
+A	6	0	0	0	0	0
+C	0	6	0	0	0	0
+G	0	0	6	0	0	0
+G	0	0	6	0	0	0
+A	6	0	0	0	0	0
+A	5	0	1	0	0	0
+T	0	0	0	6	0	0
+T	0	0	0	6	0	0
+T	0	0	0	6	0	0
+T	0	0	0	6	0	0
+G	0	0	5	0	0	0
+T	0	0	0	5	0	0
+G	0	0	5	0	0	0
+G	0	0	4	0	0	0
+C	0	4	0	0	0	0
+T	0	0	0	4	0	0
+G	0	0	2	0	0	0
+T	0	0	0	0	0	0
+C	0	0	0	0	0	0
+G	0	0	0	0	0	0
+C	0	0	0	0	0	0
+T	0	0	0	0	0	0
+G	0	0	0	0	0	0
+A	0	0	0	0	0	0
+T	0	0	0	2	0	0
+G	0	0	2	0	0	0
+G	0	0	2	0	0	0
+T	0	0	0	2	0	0
+T	0	0	0	2	0	0
+A	2	0	0	0	0	0
+T	0	0	0	2	0	0
+C	0	2	0	0	0	0
+T	0	0	0	2	0	0
+T	0	0	0	2	0	0
+T	0	0	0	2	0	0
+T	0	0	0	2	0	0
+T	0	0	0	2	0	0
+A	2	0	0	0	0	0
+A	2	0	0	0	0	0
+A	2	0	0	0	0	0
+A	2	0	0	0	0	0
+G	0	0	2	0	0	0
+A	2	0	0	0	0	0
+T	0	0	0	2	0	0
+A	2	0	0	0	0	0
+A	2	0	0	0	0	0
+A	2	0	0	0	0	0
+C	0	2	0	0	0	0
+A	2	0	0	0	0	0
+G	0	0	2	0	0	0
+A	2	0	0	0	0	0
+T	0	0	0	2	0	0
+G	0	0	2	0	0	0
+G	0	0	2	0	0	0
+G	0	0	2	0	0	0
+A	2	0	0	0	0	0
+A	2	0	0	0	0	0
+A	2	0	0	0	0	0
+T	0	0	0	2	0	0
+T	0	0	0	2	0	0
+C	0	2	0	0	0	0
+T	0	0	0	2	0	0
+C	0	2	0	0	0	0
+A	2	0	0	0	0	0
+C	0	2	0	0	0	0
+G	0	0	2	0	0	0
+A	2	0	0	0	0	0
+A	2	0	0	0	0	0
+G	0	0	2	0	0	0
+G	0	0	2	0	0	0
+G	0	0	2	0	0	0
+T	0	0	0	2	0	0
+A	2	0	0	0	0	0
+A	2	0	0	0	0	0
+
+#b0842_3
+A	20	0	0	0	0	0
+T	0	0	0	20	0	0
+G	0	0	20	0	0	0
+C	0	21	0	0	0	0
+A	21	0	0	0	0	0
+A	22	0	0	0	0	0
+A	22	0	0	0	0	0
+A	22	0	0	0	0	0
+T	0	0	0	22	0	0
+A	22	0	0	0	0	0
+A	25	0	0	0	0	0
+A	25	0	0	0	0	0
+T	0	0	0	25	0	0
+T	0	0	0	25	0	0
+A	25	0	0	0	0	0
+G	0	0	25	0	0	0
+C	0	25	0	0	0	0
+T	0	0	0	25	0	0
+T	0	0	0	25	0	0
+C	1	24	0	0	0	0
+C	0	25	0	0	0	0
+G	1	0	25	0	0	0
+G	0	0	28	0	0	0
+T	1	0	0	28	0	0
+G	0	0	28	1	0	0
+C	1	28	0	0	0	0
+C	0	29	0	0	0	0
+A	29	0	0	0	0	0
+-	0	0	1	0	0	27
+G	0	0	29	0	0	0
+G	0	0	28	1	0	0
+C	0	29	0	0	0	0
+T	0	0	0	26	0	0
+T	0	0	0	26	0	0
+G	0	0	26	0	0	0
+G	0	0	27	0	0	0
+A	26	0	1	0	0	0
+C	0	27	0	0	0	0
+G	0	0	23	0	0	0
+T	0	0	0	23	0	0
+C	0	23	0	0	0	0
+A	23	0	0	0	0	0
+G	0	0	23	0	0	0
+G	0	0	23	0	0	0
+C	0	20	0	0	0	0
+G	0	0	19	0	0	0
+T	0	0	0	18	0	0
+T	0	0	0	18	0	0
+A	18	0	0	0	0	0
+C	0	19	0	0	0	0
+T	0	0	0	19	0	0
+T	0	0	0	18	0	0
+T	0	0	0	17	0	0
+T	0	0	0	17	0	0
+C	0	17	0	0	0	0
+C	0	16	0	1	0	0
+C	0	19	0	0	0	0
+T	0	0	0	18	0	0
+C	0	19	0	0	0	0
+T	0	0	0	19	0	0
+C	0	19	0	0	0	0
+T	0	0	0	19	0	0
+G	0	0	20	0	0	0
+T	1	0	0	19	0	0
+C	0	20	0	0	0	0
+T	0	0	0	21	0	0
+G	0	0	21	0	0	0
+G	0	0	21	0	0	0
+T	0	0	0	19	0	0
+G	0	0	19	1	0	0
+C	0	20	0	0	0	0
+T	0	0	0	18	0	0
+T	0	0	0	18	0	0
+T	0	0	0	18	0	0
+A	18	0	0	0	0	0
+C	0	18	0	0	0	0
+G	0	0	18	0	0	0
+A	18	0	0	0	0	0
+A	18	0	0	1	0	0
+T	0	0	0	19	0	0
+T	0	0	0	19	0	0
+T	0	0	0	19	0	0
+T	0	0	0	19	0	0
+C	0	19	0	0	0	0
+A	19	0	0	0	0	0
+A	20	0	0	0	0	0
+C	1	19	0	0	0	0
+C	0	20	0	0	0	0
+T	1	0	0	18	0	0
+A	20	0	0	0	0	0
+T	1	0	0	19	0	0
+A	20	0	0	0	0	0
+-	1	0	2	0	0	17
+-	0	0	2	0	0	18
+-	1	1	0	0	0	18
+-	0	0	1	0	0	18
+T	2	0	0	18	0	0
+C	0	20	0	0	0	0
+-	1	0	0	0	0	19
+G	0	0	21	0	0	0
+G	0	0	18	1	0	0
+C	1	18	0	0	0	0
+A	18	0	1	0	0	0
+-	0	0	0	2	0	17
+A	21	0	0	0	0	0
+C	0	22	0	1	0	0
+G	0	0	23	0	0	0
+-	0	0	0	1	0	21
+-	0	0	1	0	0	21
+-	0	0	0	1	0	21
+A	23	0	0	0	0	0
+T	0	0	3	20	0	0
+A	23	0	0	0	0	0
+T	1	0	0	22	0	0
+G	0	0	24	0	0	0
+A	25	0	0	0	0	0
+T	0	0	1	24	0	0
+T	1	0	0	24	0	0
+C	0	25	0	0	0	0
+A	22	0	0	0	0	1
+A	25	0	0	0	0	0
+C	0	24	1	0	0	0
+C	0	25	0	0	0	0
+C	0	25	0	0	0	0
+G	0	0	28	0	0	0
+G	0	0	29	0	0	0
+T	0	0	0	29	0	0
+A	30	0	0	0	0	0
+T	0	0	0	30	0	0
+G	0	0	29	0	0	0
+T	0	0	0	29	0	0
+T	0	0	0	28	0	0
+G	0	0	28	0	0	0
+G	0	0	26	0	0	0
+C	0	26	0	0	0	0
+C	0	27	0	0	0	0
+G	0	0	26	1	0	0
+T	0	0	0	27	0	0
+G	0	0	27	0	0	0
+G	0	0	27	0	0	0
+T	0	0	0	27	0	0
+G	0	0	27	0	0	0
+G	0	0	28	0	0	0
+A	27	0	1	0	0	0
+A	29	0	0	0	0	0
+C	0	29	0	0	0	0
+A	28	0	0	0	0	0
+A	28	1	0	0	0	0
+T	0	0	0	29	0	0
+A	29	0	0	0	0	0
+T	0	0	0	29	0	0
+C	0	27	0	0	0	0
+A	29	0	0	0	0	0
+G	0	0	29	0	0	0
+G	0	1	28	0	0	0
+C	0	29	0	0	0	0
+G	0	0	28	0	0	0
+G	0	0	30	0	0	0
+G	0	0	28	1	0	0
+C	0	28	1	0	0	0
+A	28	1	0	0	0	0
+T	0	0	0	29	0	0
+T	0	0	0	29	0	0
+G	0	0	29	0	0	0
+A	29	0	1	0	0	0
+T	0	0	0	30	0	0
+T	0	0	0	27	0	0
+G	0	0	27	0	0	0
+G	0	0	27	0	0	0
+G	0	0	28	0	0	0
+T	0	0	0	29	0	0
+T	0	0	0	28	0	0
+C	0	27	0	1	0	0
+C	0	28	0	0	0	0
+T	0	0	0	28	0	0
+A	29	0	0	0	0	0
+C	0	27	0	0	0	0
+T	0	0	0	28	0	0
+T	0	0	0	28	0	0
+C	0	28	0	1	0	0
+A	30	0	0	0	0	0
+A	30	0	0	0	0	0
+T	0	0	0	30	0	0
+G	0	0	30	0	0	0
+A	30	0	0	0	0	0
+C	0	32	0	0	0	0
+C	0	30	0	0	0	0
+G	0	0	30	0	0	0
+C	0	30	0	0	0	0
+A	30	0	0	0	0	0
+T	0	0	0	31	0	0
+A	31	0	0	0	0	0
+T	0	0	0	31	0	0
+-	0	0	0	1	0	29
+C	0	31	0	0	0	0
+T	0	0	0	29	0	0
+G	0	0	27	0	0	0
+G	0	0	26	1	0	0
+C	0	27	0	0	0	0
+-	0	0	0	1	0	23
+-	0	1	0	0	0	23
+-	0	0	0	1	0	23
+-	0	0	0	1	0	23
+G	1	0	24	0	0	0
+G	0	0	23	0	0	0
+G	0	0	22	0	0	0
+C	0	22	0	0	0	0
+G	0	0	23	0	0	0
+G	0	0	23	0	0	0
+G	0	0	23	0	0	0
+A	21	0	2	0	0	0
+T	0	0	0	24	0	0
+G	0	0	26	0	0	0
+T	0	0	0	27	0	0
+T	0	0	0	27	0	0
+T	0	0	0	27	0	0
+T	0	0	0	26	0	0
+T	0	0	0	25	0	0
+A	25	0	0	0	0	0
+C	0	25	0	0	0	0
+A	25	0	0	0	0	0
+A	25	0	0	0	0	0
+T	0	0	0	24	0	0
+G	0	0	24	0	0	0
+G	0	0	23	0	0	0
+C	0	24	0	0	0	0
+T	0	0	0	25	0	0
+C	0	26	0	0	0	0
+C	0	26	0	0	0	0
+T	0	1	0	25	0	0
+G	0	0	24	0	0	0
+G	0	0	24	0	0	0
+G	0	0	25	0	0	0
+G	0	0	23	0	0	0
+C	0	22	0	0	0	0
+C	0	21	0	0	0	0
+G	0	0	21	0	0	0
+C	0	22	0	0	0	0
+T	0	0	0	22	0	0
+G	0	0	22	0	0	0
+T	0	0	0	22	0	0
+C	0	22	0	0	0	0
+G	0	0	22	0	0	0
+G	0	0	24	0	0	0
+A	24	0	0	0	0	0
+T	0	0	0	24	0	0
+C	0	23	0	0	0	0
+G	0	0	23	0	0	0
+T	0	0	0	22	0	0
+A	22	0	0	0	0	0
+T	0	0	0	22	0	0
+T	0	0	1	20	0	0
+G	0	0	21	0	0	0
+G	0	0	21	0	0	0
+T	0	0	0	21	0	0
+C	0	21	0	0	0	0
+G	0	0	21	0	0	0
+C	0	21	0	0	0	0
+C	0	18	0	0	0	0
+G	0	0	18	0	0	0
+T	0	0	0	18	0	0
+C	0	17	0	0	0	0
+C	0	17	0	0	0	0
+G	0	0	17	0	0	0
+G	0	0	19	0	0	0
+T	0	0	0	20	0	0
+G	0	0	21	0	0	0
+A	21	0	0	0	0	0
+T	0	0	0	21	0	0
+G	0	0	23	0	0	0
+C	0	22	0	0	0	0
+T	0	0	0	22	0	0
+G	0	0	20	0	0	0
+G	0	0	20	0	0	0
+C	0	19	0	1	0	0
+G	0	0	20	0	0	0
+G	0	0	21	0	0	0
+G	0	0	21	0	0	0
+G	0	0	22	0	0	0
+G	0	0	22	0	0	0
+T	1	0	1	19	0	0
+G	0	0	19	0	0	0
+G	1	0	19	0	0	0
+T	0	0	0	19	0	0
+G	0	0	19	0	0	0
+T	0	0	0	19	0	0
+G	1	0	19	1	0	1
+G	0	0	23	0	0	0
+T	0	0	0	23	0	0
+T	1	0	0	22	0	0
+T	0	0	0	24	0	0
+A	23	0	0	0	0	0
+-	1	0	0	0	0	21
+-	0	0	1	0	0	21
+-	1	0	0	0	0	21
+-	0	0	1	0	0	21
+T	1	0	0	22	0	0
+C	0	22	0	1	0	0
+A	23	0	0	0	0	0
+T	0	0	1	22	0	0
+C	0	23	0	0	0	0
+A	22	1	0	0	0	0
+C	0	23	0	0	0	0
+C	0	23	0	0	0	0
+T	0	0	0	21	0	0
+G	0	0	23	0	0	0
+T	0	0	0	24	0	0
+C	0	25	0	0	0	0
+T	0	0	0	25	0	0
+G	0	0	25	0	0	0
+G	0	0	25	0	0	0
+C	0	25	0	0	0	0
+A	28	0	0	0	0	0
+A	29	0	0	0	0	0
+T	0	0	0	29	0	0
+A	29	0	0	0	0	0
+T	0	0	0	30	0	0
+T	0	0	0	30	0	0
+A	30	0	0	0	0	0
+C	0	30	0	0	0	0
+T	0	0	0	30	0	0
+G	0	0	30	0	0	0
+G	0	0	31	0	0	0
+C	0	32	0	1	0	0
+G	0	0	34	0	0	0
+C	0	34	0	0	0	0
+A	34	0	0	0	0	0
+A	34	0	0	0	0	0
+A	34	0	0	0	0	0
+A	35	0	0	0	0	0
+C	0	35	0	0	0	0
+A	35	0	0	0	0	0
+T	0	0	1	34	0	0
+T	0	0	0	35	0	0
+G	0	0	35	0	0	0
+A	35	0	0	0	0	0
+A	35	0	0	0	0	0
+C	0	35	0	0	0	0
+A	36	0	0	0	0	0
+A	36	1	0	0	0	0
+T	0	0	0	37	0	0
+T	0	0	0	37	0	0
+C	0	37	1	0	0	0
+A	36	0	1	0	0	0
+C	0	38	0	0	0	0
+T	0	0	0	38	0	0
+C	0	40	0	0	0	0
+-	0	0	1	0	0	37
+-	0	0	1	0	0	37
+T	1	0	0	39	0	0
+G	0	0	39	0	0	0
+T	1	0	1	37	0	0
+T	0	0	0	39	0	0
+G	0	0	38	0	0	0
+C	0	37	0	1	0	0
+G	0	0	38	0	0	0
+C	0	37	0	0	0	1
+T	0	0	0	37	0	1
+T	0	0	0	38	0	0
+C	1	38	0	0	0	0
+T	0	0	0	40	0	0
+T	1	0	0	39	0	0
+G	1	0	39	0	0	0
+C	0	39	1	0	0	0
+A	39	0	0	0	0	0
+G	0	0	40	0	0	0
+-	1	0	0	0	0	39
+-	0	1	0	0	0	39
+-	1	0	0	0	0	39
+G	0	0	41	0	0	0
+G	0	0	46	0	0	0
+C	0	45	0	0	0	0
+A	45	0	0	0	0	0
+T	0	0	0	45	0	0
+A	45	0	0	0	0	0
+A	44	0	1	0	0	0
+G	0	0	45	0	0	0
+C	0	47	0	0	0	0
+C	0	47	0	0	0	0
+T	0	0	0	44	0	0
+C	0	44	1	0	0	0
+T	0	0	0	45	0	0
+G	0	0	46	0	0	0
+T	0	0	0	46	0	0
+T	0	0	0	47	0	0
+T	0	0	0	46	0	0
+C	0	45	0	0	0	0
+A	44	0	0	1	0	0
+T	0	0	0	45	0	0
+T	0	0	0	44	0	0
+G	0	0	44	0	0	0
+G	0	0	42	0	0	0
+C	0	42	0	0	0	0
+G	0	0	44	0	0	0
+C	0	45	0	0	0	0
+T	0	0	0	44	0	0
+G	0	0	47	0	0	0
+T	0	0	0	47	0	0
+G	0	0	47	0	0	0
+G	0	0	48	0	0	0
+G	0	0	48	0	0	0
+A	48	0	0	0	0	0
+-	0	1	0	0	0	44
+T	0	0	0	46	0	0
+A	45	0	0	0	0	1
+C	0	43	0	0	0	1
+G	0	0	43	0	0	0
+C	0	42	0	1	0	0
+C	0	42	0	0	0	0
+G	0	0	41	1	0	0
+C	0	42	0	0	0	0
+-	0	0	0	1	0	40
+A	41	0	0	1	0	0
+A	42	0	0	0	0	0
+T	0	0	0	42	0	0
+T	0	0	1	40	0	0
+C	0	40	0	0	0	0
+A	40	0	0	0	0	0
+G	0	0	41	0	0	0
+G	0	0	41	0	0	0
+A	39	0	0	0	0	0
+-	0	0	1	0	0	37
+A	39	0	0	0	0	0
+T	0	0	0	41	0	0
+C	0	42	1	0	0	0
+C	0	42	0	1	0	0
+T	0	0	1	43	0	0
+T	0	0	0	44	0	0
+C	1	44	0	0	0	0
+G	0	0	43	1	0	0
+A	43	0	0	1	0	0
+A	42	0	1	0	0	0
+G	0	1	41	0	0	0
+A	39	0	1	0	0	1
+G	0	1	39	0	0	1
+G	1	0	39	0	0	1
+C	0	41	0	0	0	0
+G	1	0	39	1	0	0
+G	0	0	44	0	0	0
+-	1	0	0	0	0	41
+-	0	0	1	0	0	41
+-	1	0	0	0	0	41
+T	0	0	0	42	0	1
+-	0	1	0	0	0	42
+T	0	0	1	42	0	1
+T	0	1	0	41	0	1
+G	0	0	45	1	0	0
+T	0	0	0	48	0	0
+-	1	0	0	0	0	46
+-	0	0	0	1	0	46
+-	1	0	0	0	0	46
+-	1	0	0	0	0	46
+-	0	0	1	0	0	46
+-	1	0	0	0	0	46
+-	0	0	1	0	0	46
+-	1	0	0	0	0	46
+-	0	1	0	0	0	46
+-	1	0	0	0	0	46
+-	0	0	1	0	0	46
+A	48	0	0	0	0	0
+T	0	0	0	47	0	0
+C	1	43	0	0	0	0
+A	43	1	0	0	0	0
+A	43	0	0	0	0	0
+G	0	1	43	0	0	0
+A	44	0	0	0	0	0
+T	0	0	0	43	0	0
+C	0	43	0	0	0	0
+A	39	0	1	2	0	0
+C	0	42	0	0	0	0
+C	0	39	1	0	0	0
+G	0	0	39	0	0	0
+C	0	38	0	0	0	0
+G	0	0	38	0	0	0
+C	0	37	0	0	0	0
+T	0	0	0	35	0	0
+G	0	0	35	0	0	0
+A	33	0	0	0	0	0
+T	0	0	0	36	0	0
+G	1	0	34	0	0	0
+G	0	0	34	0	0	0
+C	0	34	0	0	0	0
+G	1	0	34	0	0	0
+A	35	0	0	0	0	0
+A	34	0	0	0	0	0
+C	0	34	0	0	0	0
+G	0	0	33	0	0	0
+T	0	0	0	33	0	0
+G	0	0	34	0	0	0
+G	0	0	35	0	0	0
+C	0	35	0	0	0	0
+G	0	0	35	0	0	0
+C	0	35	0	0	0	0
+T	0	0	0	37	0	0
+G	0	0	37	0	0	0
+A	36	0	0	0	0	0
+T	0	0	0	36	0	0
+T	0	0	0	36	0	0
+G	0	0	36	0	0	0
+C	0	36	0	0	0	0
+T	0	1	0	35	0	0
+C	0	38	0	0	0	0
+C	0	38	0	0	0	0
+G	0	1	35	1	0	1
+C	0	38	0	0	0	0
+T	0	0	0	37	0	0
+-	0	0	1	0	0	35
+A	35	0	1	1	0	0
+C	0	37	0	0	0	0
+T	0	0	0	38	0	0
+-	0	1	0	0	0	36
+T	0	0	0	38	0	0
+G	0	0	37	0	0	0
+G	0	0	36	0	0	0
+T	0	0	0	35	0	0
+C	0	37	0	0	0	0
+C	0	37	0	0	0	0
+G	0	0	37	0	0	0
+C	0	37	0	0	0	0
+T	0	0	0	36	0	0
+G	0	0	36	0	0	0
+G	0	0	36	0	0	0
+T	0	0	0	36	0	0
+G	0	0	35	0	0	0
+G	0	0	34	1	0	0
+G	0	0	35	0	0	0
+C	0	35	0	0	0	0
+G	0	0	35	0	0	0
+C	0	35	0	0	0	0
+G	0	0	35	0	0	0
+G	0	0	39	0	0	0
+C	0	39	0	0	0	0
+G	0	0	39	0	0	0
+T	0	0	0	38	0	0
+G	0	0	38	0	0	0
+G	0	1	39	0	0	0
+A	40	0	0	0	0	0
+T	0	0	0	44	0	0
+C	0	44	0	0	0	0
+C	0	42	0	0	0	0
+A	43	0	0	0	0	0
+T	0	0	0	41	0	0
+G	0	0	42	0	0	0
+T	0	0	0	42	0	0
+G	0	0	40	0	0	0
+C	0	40	0	0	0	0
+T	0	0	0	39	0	0
+G	0	0	40	0	0	0
+C	1	40	0	0	0	0
+C	0	40	0	0	0	0
+C	0	40	0	0	0	0
+T	0	0	0	37	0	0
+G	0	0	36	0	0	0
+G	0	0	36	0	0	0
+G	0	0	36	0	0	0
+A	36	0	0	0	0	0
+A	34	0	0	0	0	0
+G	0	0	35	0	0	0
+G	0	0	37	0	0	0
+G	0	0	37	0	0	0
+A	37	0	0	0	0	0
+T	0	0	0	36	0	0
+G	0	0	36	0	0	0
+T	0	0	0	36	0	0
+T	0	0	0	36	0	0
+T	0	0	0	35	0	0
+G	0	0	36	0	0	0
+T	0	0	0	36	0	0
+C	0	35	0	0	0	0
+T	0	0	0	35	0	0
+T	0	0	0	34	0	0
+G	0	0	34	0	0	0
+T	0	0	0	32	0	0
+T	0	0	0	32	0	0
+T	0	0	0	32	0	0
+G	0	0	30	0	0	0
+C	0	29	0	0	0	0
+C	0	29	0	0	0	0
+G	0	0	29	0	0	0
+C	0	30	0	1	0	0
+A	30	0	0	1	0	0
+T	0	0	1	30	0	0
+T	0	0	0	31	0	0
+G	0	0	31	0	0	0
+G	0	0	31	0	0	0
+C	0	31	0	0	0	0
+A	30	0	0	0	0	0
+G	0	0	30	0	0	0
+C	0	27	0	0	0	0
+G	0	0	28	0	0	0
+A	29	0	0	0	0	0
+T	0	0	0	29	0	0
+C	0	30	0	0	0	0
+T	0	0	0	29	0	0
+C	0	29	0	0	0	0
+C	0	29	0	0	0	0
+T	0	0	0	29	0	0
+T	0	0	0	29	0	0
+T	0	0	0	29	0	0
+T	0	0	0	29	0	0
+T	0	0	0	28	0	0
+C	0	27	0	0	0	0
+G	0	0	27	0	0	0
+G	0	0	29	0	0	0
+T	0	0	0	28	0	0
+C	0	28	0	0	0	0
+T	0	0	0	28	0	0
+G	0	0	31	0	0	0
+C	0	31	0	0	0	0
+A	31	0	0	0	0	0
+A	29	0	0	0	0	0
+C	1	27	1	0	0	0
+A	36	0	0	0	0	0
+A	38	0	0	0	0	0
+G	0	0	37	0	0	0
+C	0	38	0	0	0	0
+C	0	36	1	0	0	0
+A	37	0	0	0	0	0
+T	0	0	0	38	0	0
+G	0	0	40	0	0	0
+C	0	41	0	0	0	0
+C	0	41	0	0	0	0
+T	0	0	0	41	0	0
+G	0	0	41	0	0	0
+A	41	0	0	0	0	0
+A	40	0	0	0	0	0
+A	39	0	0	0	0	0
+C	0	40	0	0	0	0
+C	0	39	0	0	0	0
+G	0	0	40	0	0	0
+C	0	39	0	0	0	0
+C	0	38	0	0	0	0
+A	37	0	0	0	0	0
+C	0	38	0	0	0	0
+G	0	0	39	0	0	0
+C	0	40	0	0	0	0
+G	0	0	41	0	0	0
+T	0	2	0	38	0	0
+A	39	0	0	0	0	0
+T	0	0	0	40	0	0
+A	41	0	0	0	0	0
+G	0	0	40	0	0	0
+G	0	0	40	0	0	0
+C	1	37	0	0	0	0
+G	0	0	38	0	0	0
+A	38	0	0	0	0	0
+G	0	0	38	0	0	0
+A	38	0	0	0	0	0
+A	37	0	0	0	0	0
+A	36	0	1	0	0	0
+C	0	36	0	0	0	0
+T	0	0	0	36	0	0
+G	0	0	36	0	0	0
+T	0	0	0	36	0	0
+C	0	35	0	0	0	0
+A	34	0	0	0	0	0
+C	0	33	0	0	0	0
+T	0	0	0	33	0	0
+G	0	0	33	0	0	0
+A	32	0	0	0	0	0
+A	33	0	0	0	0	0
+A	33	0	0	0	0	0
+G	0	0	32	0	0	0
+A	31	0	0	0	0	1
+A	30	1	1	0	0	0
+C	0	32	0	0	0	0
+T	0	0	0	31	0	1
+C	1	31	0	0	0	0
+G	0	0	33	0	0	0
+G	0	0	34	0	0	0
+T	0	0	0	35	0	0
+C	0	35	0	0	0	0
+G	0	0	35	0	0	0
+T	0	0	0	34	0	0
+G	0	0	34	0	0	0
+A	36	0	0	0	0	0
+C	0	39	0	0	0	0
+T	0	0	0	38	0	0
+A	38	0	0	0	0	0
+T	0	0	0	38	0	0
+A	38	0	0	0	0	0
+A	38	0	0	0	0	0
+G	0	0	38	0	0	0
+C	0	38	0	0	0	0
+-	0	1	0	0	0	33
+T	0	0	0	35	0	0
+-	0	1	0	0	0	32
+G	0	0	32	1	0	0
+G	0	0	34	1	0	0
+T	0	2	0	33	0	0
+-	0	1	0	0	0	34
+G	0	0	33	2	0	0
+C	0	35	0	0	0	0
+T	0	0	0	34	0	0
+G	0	0	33	2	0	0
+A	34	0	0	0	0	0
+-	0	0	0	2	0	31
+A	34	0	0	0	0	0
+G	0	2	32	0	0	0
+A	32	0	0	0	0	0
+-	0	2	0	0	0	29
+A	30	1	1	0	0	0
+-	0	0	0	1	0	27
+-	0	1	0	0	0	27
+-	0	0	0	1	0	27
+C	0	28	0	1	0	0
+G	0	1	27	0	0	0
+G	0	0	26	1	0	0
+C	1	26	0	0	0	0
+C	1	24	0	0	0	0
+G	0	0	24	0	0	0
+C	0	24	0	0	0	0
+T	0	0	0	24	0	0
+T	0	0	0	24	0	0
+T	0	0	0	24	0	0
+G	0	0	24	0	0	0
+T	0	0	0	23	0	0
+G	0	0	19	0	0	0
+G	0	0	19	0	0	0
+C	0	18	0	0	0	0
+G	0	0	18	0	0	0
+G	0	0	18	0	0	0
+G	0	0	14	0	0	0
+G	0	0	13	0	0	0
+G	0	0	13	0	0	0
+C	0	12	0	0	0	0
+G	0	0	11	0	0	0
+C	0	10	1	0	0	0
+T	0	0	0	11	0	0
+G	0	0	12	0	0	0
+G	0	1	11	0	0	0
+C	0	13	0	0	0	0
+G	0	1	12	0	0	0
+C	0	13	0	0	0	0
+T	0	0	0	12	0	0
+G	0	0	15	0	0	0
+G	0	0	15	0	0	0
+G	0	0	15	0	0	0
+A	14	0	0	0	0	1
+T	0	0	0	15	0	0
+T	0	0	0	17	0	0
+C	0	17	0	0	0	0
+G	0	0	17	1	0	0
+T	0	0	0	19	0	0
+T	0	0	0	20	0	0
+A	21	0	0	0	0	0
+G	0	0	23	0	0	0
+C	0	25	0	0	0	0
+C	0	27	0	0	0	0
+T	0	0	0	25	0	0
+G	0	0	28	0	0	0
+C	0	28	0	0	0	0
+C	0	29	0	0	0	0
+A	29	0	0	0	0	0
+T	0	0	0	29	0	0
+T	0	0	0	29	0	0
+G	0	0	30	0	0	0
+C	0	30	0	0	0	0
+T	0	0	0	31	0	0
+G	0	0	32	0	0	0
+G	0	0	32	0	0	0
+C	0	32	0	0	0	0
+G	0	0	32	0	0	0
+T	0	0	0	32	0	0
+G	0	0	35	0	0	0
+G	0	0	35	0	0	0
+A	35	0	0	0	0	0
+T	0	0	0	36	0	0
+C	0	30	0	0	0	0
+G	0	0	30	0	0	0
+C	0	30	0	0	0	0
+C	0	31	0	0	0	0
+C	0	31	0	0	0	0
+A	30	0	0	0	0	0
+G	0	0	31	1	0	0
+T	0	0	0	32	0	0
+C	0	32	0	0	0	0
+G	0	0	32	0	0	0
+C	0	32	0	0	0	0
+C	0	34	0	0	0	0
+G	0	0	34	0	0	0
+A	36	0	0	0	0	0
+T	0	0	0	37	0	0
+T	0	0	0	36	0	0
+A	36	0	0	0	0	0
+T	0	0	0	37	0	0
+C	0	38	0	0	0	0
+A	38	0	0	0	0	0
+T	0	0	0	38	0	0
+C	0	38	0	0	0	0
+A	38	0	0	0	0	0
+T	0	0	0	40	0	0
+T	0	0	0	40	0	0
+A	39	0	0	0	0	0
+C	0	39	0	0	0	0
+C	0	39	0	0	0	0
+G	0	0	39	0	0	0
+G	0	0	40	0	0	0
+C	0	40	0	0	0	0
+G	0	0	41	0	0	0
+A	42	0	0	0	0	0
+G	0	0	43	0	0	0
+C	0	42	0	1	0	0
+A	43	0	0	0	0	0
+G	0	0	47	0	0	0
+T	0	0	1	48	0	0
+T	1	0	0	48	0	0
+G	0	0	50	0	0	0
+A	50	0	0	0	0	0
+G	0	0	50	0	0	0
+-	1	0	0	0	0	48
+C	0	50	0	0	0	0
+-	0	1	0	0	0	48
+A	49	0	0	1	0	0
+-	0	0	1	0	0	48
+G	0	0	50	0	0	0
+C	0	46	0	0	0	0
+T	0	0	0	45	0	0
+A	44	1	0	0	0	0
+T	0	0	0	45	0	0
+G	0	0	45	0	0	0
+A	45	0	0	0	0	0
+A	45	0	0	0	0	0
+T	0	0	0	45	0	0
+A	36	1	0	0	0	0
+T	0	0	0	38	0	0
+G	1	0	38	0	0	0
+G	0	0	37	2	0	0
+C	0	38	0	0	0	0
+T	0	0	0	35	0	0
+-	0	1	0	0	0	32
+T	0	0	0	34	0	0
+G	0	0	23	1	0	0
+C	0	24	0	0	0	0
+T	0	0	0	24	0	0
+G	0	0	24	0	0	0
+C	0	24	0	0	0	0
+A	24	0	0	0	0	0
+A	24	0	0	0	0	0
+G	1	0	23	0	0	0
+T	0	0	0	24	0	0
+G	0	0	24	0	0	0
+C	0	24	0	0	0	0
+C	0	24	0	0	0	0
+T	0	0	0	24	0	0
+A	25	0	0	0	0	0
+T	0	0	0	25	0	0
+T	0	0	0	25	0	0
+T	0	0	0	25	0	0
+T	0	0	0	26	0	0
+C	0	25	0	0	0	0
+G	0	0	25	0	0	0
+G	0	0	25	0	0	0
+-	1	0	0	0	0	23
+G	0	0	25	0	0	0
+-	1	0	0	0	0	22
+-	0	0	0	1	0	22
+G	0	0	24	0	0	0
+C	0	24	0	1	0	0
+G	0	0	25	0	0	0
+T	0	0	0	25	0	0
+-	1	0	0	0	0	23
+T	0	0	0	25	0	0
+A	25	0	0	0	0	0
+A	25	0	0	0	0	0
+T	0	0	1	24	0	0
+T	1	0	0	23	0	0
+G	0	0	23	0	0	0
+-	1	0	0	0	0	21
+C	0	24	0	0	0	0
+G	1	0	23	0	0	0
+G	0	0	24	0	0	0
+G	0	0	24	0	0	1
+T	0	0	0	24	0	1
+A	24	0	0	0	0	0
+A	24	0	0	0	0	0
+C	0	27	0	0	0	0
+T	0	0	0	27	0	0
+T	0	0	0	27	0	0
+G	1	0	26	0	0	0
+C	0	27	0	0	0	0
+T	0	0	0	27	0	0
+G	1	0	26	0	0	0
+T	0	0	0	27	0	0
+T	0	0	0	27	0	0
+A	25	0	0	0	0	0
+G	0	0	27	0	0	0
+C	0	29	0	0	0	0
+G	0	0	29	0	0	0
+C	0	28	0	0	0	0
+G	0	0	29	0	0	0
+T	0	0	1	28	0	0
+C	0	29	0	0	0	0
+T	0	0	0	29	0	0
+G	0	0	30	0	0	0
+A	29	1	0	0	0	0
+C	0	31	0	0	0	0
+C	0	31	0	0	0	0
+T	0	0	0	30	0	0
+C	0	30	0	0	0	0
+G	0	0	31	0	0	0
+C	0	31	0	0	0	0
+G	0	0	31	0	0	0
+C	0	31	0	0	0	0
+C	0	32	0	0	0	0
+G	0	0	32	0	0	0
+C	0	32	0	0	0	0
+A	32	0	0	0	0	0
+C	0	35	0	0	0	0
+C	0	35	0	0	0	0
+G	0	0	37	0	0	0
+T	0	0	0	37	0	0
+A	36	0	0	1	0	0
+C	0	39	0	0	0	0
+G	0	0	36	0	0	0
+T	0	0	0	36	0	0
+T	0	0	0	37	0	0
+C	0	35	1	0	0	0
+G	0	0	36	0	0	0
+C	0	36	0	0	0	0
+T	0	0	0	37	0	0
+G	0	0	38	0	0	0
+A	38	0	0	0	0	0
+T	0	0	1	38	0	0
+T	0	0	0	40	0	0
+A	40	0	0	0	0	0
+T	0	0	0	40	0	0
+T	0	0	0	40	0	0
+A	40	0	0	0	0	0
+T	0	0	0	40	0	0
+G	0	0	40	0	0	0
+G	0	0	40	0	0	0
+G	0	0	39	0	0	0
+C	0	38	0	0	0	0
+G	0	0	38	0	0	0
+G	0	0	39	0	0	0
+C	0	39	0	0	0	0
+T	0	0	0	38	0	0
+G	0	0	38	0	0	0
+G	0	0	37	0	0	0
+C	0	37	0	0	0	0
+C	0	37	0	0	0	0
+G	0	0	37	1	0	0
+A	39	0	0	0	0	0
+T	0	0	0	39	0	0
+T	0	0	0	40	0	0
+A	40	0	0	0	0	0
+T	0	0	0	42	0	0
+T	0	0	0	43	0	0
+A	42	0	0	0	0	0
+T	0	0	0	44	0	0
+T	0	0	0	41	0	0
+G	0	0	41	0	0	0
+G	0	0	41	0	0	0
+T	0	0	0	40	0	0
+C	0	40	0	0	0	0
+T	0	0	0	39	0	0
+G	0	0	41	0	0	0
+T	0	0	0	41	0	0
+T	0	0	0	41	0	0
+G	0	0	39	0	0	0
+G	0	1	38	0	0	0
+T	0	0	0	39	0	0
+C	0	39	0	0	0	0
+G	0	0	38	0	0	0
+C	0	40	0	0	0	0
+T	0	0	0	38	0	0
+G	0	0	39	0	0	0
+C	0	38	0	0	0	0
+T	0	0	0	37	0	0
+G	0	0	40	0	0	0
+C	0	39	0	0	0	0
+G	0	2	37	0	0	0
+G	0	0	39	0	0	0
+C	0	38	0	0	0	0
+A	38	0	0	0	0	0
+A	38	0	0	0	0	0
+C	0	39	0	0	0	0
+G	0	0	39	0	0	0
+G	0	0	41	0	0	0
+T	0	0	0	41	0	0
+T	0	0	0	42	0	0
+A	43	0	0	0	0	0
+T	0	0	0	43	0	0
+C	0	43	0	0	0	0
+T	0	0	0	43	0	0
+C	0	39	1	0	0	0
+A	38	0	0	0	0	0
+T	0	0	0	38	0	0
+C	0	38	0	0	0	0
+G	0	0	36	0	0	0
+C	0	32	0	0	0	0
+A	31	0	0	0	0	0
+C	0	31	0	0	0	0
+G	0	0	32	0	0	0
+C	0	32	0	0	0	0
+G	0	1	31	0	0	0
+T	0	0	0	33	0	0
+A	32	1	0	0	0	0
+T	0	0	0	33	0	0
+T	0	0	0	35	0	0
+T	0	0	0	35	0	0
+A	32	0	0	0	0	0
+T	0	0	0	33	0	0
+G	0	0	32	0	0	0
+G	0	0	33	0	0	0
+A	31	0	0	0	0	0
+T	0	0	0	31	0	0
+G	0	0	31	0	0	0
+A	31	0	0	0	0	0
+C	0	30	1	0	0	0
+C	0	30	0	0	0	0
+G	0	0	30	0	0	0
+C	0	30	0	0	0	0
+C	0	28	0	0	0	0
+G	0	0	28	0	0	0
+G	0	0	29	0	0	0
+G	0	0	30	0	0	0
+T	0	0	0	30	0	0
+T	0	0	0	31	0	0
+A	31	0	0	0	0	0
+A	31	0	0	0	0	0
+G	0	0	32	0	0	0
+T	0	0	0	32	0	0
+A	32	0	0	0	0	0
+T	0	0	0	32	0	0
+T	0	0	0	32	0	0
+T	0	0	0	32	0	0
+A	32	0	0	0	0	0
+T	0	0	0	32	0	0
+G	0	0	32	0	0	0
+C	0	32	0	0	0	0
+T	0	0	0	31	0	0
+T	0	0	0	31	0	0
+T	0	0	1	31	0	0
+C	0	34	0	0	0	0
+G	0	0	34	0	0	0
+G	0	0	33	0	0	0
+C	0	33	0	0	0	0
+A	34	0	0	0	0	0
+T	0	0	0	34	0	0
+T	0	0	0	34	0	0
+G	0	0	37	0	0	0
+G	1	0	35	0	0	0
+T	0	0	0	35	0	0
+C	0	35	0	0	0	0
+T	0	0	0	35	0	0
+G	0	0	36	0	0	0
+G	0	0	36	0	0	0
+C	0	37	0	0	0	0
+G	0	0	37	0	0	0
+A	32	0	1	0	0	0
+A	34	0	0	0	0	0
+T	0	0	0	34	0	0
+G	0	0	34	0	0	0
+C	0	33	0	0	0	0
+G	0	0	31	0	0	0
+G	0	0	31	0	0	0
+G	0	0	30	0	0	0
+A	30	0	0	0	0	0
+C	0	30	0	0	0	0
+T	0	0	0	29	0	0
+G	0	0	31	0	0	0
+G	0	0	31	0	0	0
+T	1	0	0	31	0	0
+G	0	0	32	0	0	0
+C	0	31	0	0	0	0
+G	0	0	33	0	0	0
+A	33	0	0	0	0	0
+T	0	0	0	33	0	0
+T	0	0	0	33	0	0
+A	32	0	0	0	0	0
+A	32	0	0	0	0	0
+C	0	31	0	0	0	0
+C	0	31	0	0	0	0
+C	0	32	0	0	0	0
+T	0	0	0	29	0	0
+G	0	0	30	0	0	0
+T	0	0	0	28	0	0
+T	0	0	0	28	0	0
+T	0	0	0	28	0	0
+G	0	0	28	0	0	0
+C	0	28	0	0	0	0
+C	0	27	0	0	0	0
+A	27	0	0	0	0	0
+G	0	0	26	0	0	0
+C	0	27	0	0	0	0
+G	0	0	28	0	0	0
+A	28	0	0	0	0	0
+T	0	0	0	29	0	0
+A	29	0	0	0	0	0
+T	0	0	0	29	0	0
+G	0	0	30	0	0	0
+A	30	0	0	0	0	0
+G	0	0	30	0	0	0
+T	0	0	0	29	0	0
+A	29	0	0	0	0	0
+A	30	0	0	0	0	0
+A	31	0	0	0	0	0
+G	0	0	32	0	0	0
+G	0	0	32	0	0	0
+T	0	0	0	27	0	0
+A	27	0	0	0	0	0
+C	0	28	0	0	0	0
+G	0	0	29	0	0	0
+G	0	0	31	0	0	0
+T	1	0	0	29	0	0
+T	0	0	0	30	0	0
+T	0	0	0	29	0	0
+C	0	29	0	0	0	0
+T	0	0	0	29	0	0
+G	0	0	28	0	0	0
+C	0	27	0	0	0	0
+G	0	0	26	0	0	0
+G	1	0	24	0	0	0
+C	0	25	0	0	0	0
+G	0	0	25	0	0	0
+A	25	0	0	0	0	0
+T	0	0	0	23	0	0
+G	0	0	23	0	0	0
+G	0	0	23	0	0	0
+G	0	0	22	0	0	0
+A	22	0	0	0	0	0
+A	22	0	0	0	0	0
+T	0	0	0	22	0	0
+G	0	0	22	0	0	0
+C	0	20	0	0	0	0
+T	0	0	0	20	0	0
+G	0	0	20	0	0	0
+C	0	20	0	0	0	0
+A	20	0	0	0	0	0
+A	20	0	0	0	0	0
+A	20	0	0	0	0	0
+T	0	0	0	20	0	0
+G	0	0	20	0	0	0
+C	0	20	0	0	0	0
+T	0	0	0	20	0	0
+G	0	0	20	0	0	0
+A	20	0	0	0	0	0
+T	0	0	0	20	0	0
+C	0	20	0	0	0	0
+T	0	0	0	20	0	0
+T	0	0	0	20	0	0
+T	0	0	0	18	0	0
+A	18	0	0	0	0	0
+C	0	17	0	0	0	0
+C	0	15	0	0	0	0
+G	0	0	13	0	0	0
+T	0	0	0	13	0	0
+C	0	0	0	12	0	0
+G	0	0	12	0	0	0
+G	0	0	11	0	0	0
+T	0	0	0	11	0	0
+A	12	0	0	0	0	0
+T	0	0	0	12	0	0
+T	0	0	0	12	0	0
+G	0	0	12	0	0	0
+A	12	0	0	0	0	0
+A	12	0	0	0	0	0
+A	12	0	0	0	0	0
+T	0	0	0	10	0	0
+C	0	10	0	0	0	0
+A	10	0	0	0	0	0
+G	0	0	12	0	0	0
+C	0	12	0	0	0	0
+A	12	0	0	0	0	0
+A	12	0	0	0	0	0
+A	12	0	0	0	0	0
+C	0	12	0	0	0	0
+A	12	0	0	0	0	0
+T	0	0	0	11	0	0
+G	0	0	11	0	0	0
+C	0	11	0	0	0	0
+C	0	11	0	0	0	0
+T	0	0	0	12	0	0
+G	0	0	12	0	0	0
+G	0	0	11	0	0	0
+C	0	11	0	0	0	0
+T	0	0	0	11	0	0
+G	0	0	11	0	0	0
+A	11	0	0	0	0	0
+A	11	0	0	0	0	0
+C	0	11	0	0	0	0
+G	0	0	11	0	0	0
+G	0	0	10	0	0	0
+G	0	0	10	0	0	0
+G	0	0	11	0	0	0
+G	0	0	11	0	0	0
+C	0	11	0	0	0	0
+A	11	0	0	0	0	0
+A	11	0	0	0	0	0
+C	0	11	0	0	0	0
+G	0	0	12	0	0	0
+G	0	0	13	0	0	0
+A	12	0	0	0	0	0
+C	0	14	0	0	0	0
+T	14	0	0	0	0	0
+G	0	0	16	0	0	0
+T	0	0	0	16	0	0
+T	0	0	0	16	0	0
+T	0	0	0	16	0	0
+A	18	0	0	0	0	0
+-	0	0	1	0	0	16
+-	1	0	0	0	0	16
+-	0	0	1	0	0	16
+-	1	0	0	0	0	16
+-	0	1	0	0	0	16
+A	18	0	0	0	0	0
+T	0	0	1	17	0	0
+C	0	21	0	0	0	0
+T	0	0	0	21	0	0
+C	0	22	1	0	0	0
+T	0	0	0	23	0	0
+T	0	0	0	23	0	0
+C	0	23	0	0	0	0
+A	23	0	0	0	0	0
+A	23	0	0	0	0	0
+C	0	23	0	0	0	0
+C	0	23	0	0	0	0
+T	0	0	0	23	0	0
+T	0	0	0	23	0	0
+G	0	0	24	0	0	0
+T	0	0	0	24	0	0
+C	0	24	0	0	0	0
+A	25	0	0	0	0	0
+A	25	0	0	0	0	0
+C	0	26	0	0	0	0
+G	0	0	27	0	0	0
+G	0	0	27	0	0	0
+A	27	0	0	0	0	0
+A	27	0	0	0	0	0
+T	0	0	0	27	0	0
+T	0	0	1	27	0	0
+T	0	0	0	28	0	0
+T	0	0	0	27	0	0
+G	0	0	27	0	0	0
+T	0	0	0	28	0	0
+G	0	0	28	0	0	0
+G	0	0	28	0	0	0
+C	0	28	0	0	0	0
+T	0	0	0	25	0	0
+G	0	0	25	0	0	0
+T	0	0	0	25	0	0
+C	0	26	0	0	0	0
+G	0	0	25	0	0	0
+C	0	25	0	0	0	0
+T	0	0	0	25	0	0
+G	0	0	25	0	0	0
+A	25	0	0	0	0	0
+T	0	0	0	26	0	0
+G	0	0	26	0	0	0
+G	0	0	26	0	0	0
+T	0	0	1	25	0	0
+T	0	0	0	26	0	0
+A	26	0	0	1	0	0
+T	1	0	0	27	0	0
+C	0	27	1	1	0	0
+-	0	0	0	1	0	27
+T	0	0	0	29	0	0
+T	0	1	0	28	0	0
+T	0	0	0	29	0	0
+T	0	0	0	29	0	0
+T	0	0	0	29	0	0
+A	28	0	0	0	0	0
+A	30	0	0	0	0	0
+A	31	0	0	0	0	0
+A	30	0	0	0	0	1
+G	0	0	29	0	0	0
+A	30	0	0	0	0	0
+T	0	0	0	29	0	0
+A	29	0	0	0	0	0
+A	29	0	0	0	0	0
+A	29	0	0	0	0	0
+C	1	28	0	0	0	0
+A	30	0	0	0	0	0
+G	0	0	29	0	0	0
+A	29	0	0	0	0	0
+T	0	0	0	29	0	0
+G	0	0	29	0	0	0
+G	0	0	29	0	0	0
+G	0	0	29	0	0	0
+A	29	0	0	0	0	0
+A	29	0	0	0	0	0
+A	29	0	0	0	0	0
+T	0	0	0	29	0	0
+T	0	0	0	27	0	0
+C	0	25	0	0	0	0
+T	0	0	0	24	0	0
+C	0	24	0	0	0	0
+A	24	0	0	0	0	0
+C	0	24	0	0	0	0
+G	0	0	23	0	0	0
+A	23	0	0	0	0	0
+A	23	0	0	0	0	0
+G	0	0	23	0	0	0
+G	0	0	23	0	0	0
+G	0	0	22	0	0	0
+T	0	0	0	22	0	0
+A	22	0	0	0	0	0
+A	22	0	0	0	0	0
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ERR884056.res	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,3 @@
+#Template	Score	Expected	Template_length	Template_Identity	Template_Coverage	Query_Identity	Query_Coverage	Depth	q_value	p_value
+b0842_1     	    1721	    9112	    1233	   21.01	   21.25	   98.85	  470.61	    1.46	 5042.64	1.0e-26
+b0842_3     	   36074	     523	    1233	   99.84	  100.00	   99.84	  100.00	   29.95	34532.73	1.0e-26
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ERR884056_ecoli_b0842.mapped_R1.fastq	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,2176 @@
+@ERR884056.1120
+CCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGA
++
+BCCFFFDDHHHHHIIJJIIJGHGHIIIJIIJJIGHIJGIJJJIJJG@G>EDA=EEDDDBDBDDACDDDC@CC>CC?@BD@@BBDD+(0999@88?B#####
+@ERR884056.2831
+AGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTTAGGCATGGCTTGTTGCAGACCCGAAAAAGAGATCTCTGCCACTGCG
++
+@@@DFAA?FHF:?FGEFGHAGI??<9CH<D@B@<D@0D6CFGGAHGF>DFA##################################################
+@ERR884056.12478
+GCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTTTTTCAAACCGAAAAAGAGGATCGCTGGC
++
+@BBFFFFDHHHHHJJIHGHEGHHIJJJJJJJJIEDDHIHFAFFABC@CFHHHHDBCD,8?>CC:<B><?<A##############################
+@ERR884056.13376
+AACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGCTGTCTCTTATACACATCTCC
++
+@@@FFDD?DHHADCFHIIIIIII<D?EE8CFH@GGGFDDFFDF8BFGGGEBBFC@@8BHBHE;CCCA@3?;>36;?CB-(;@>AA>>@::>@C>ACC:>@>
+@ERR884056.18517
+ACCCCCGCCAGCATCACCGGACGGCGACCAATACGATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGGTCATTGAAGT
++
+CCCFFFFFHFHHHJJJJJJJHGIHIJJGHFFFFEDDDDBA?BBDD@BD7B78?BDDA?ACDDDDC>C@;<@CC?2<BB@BD59AC>@AC35)9>>>@####
+@ERR884056.25879
+CCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCCTGGAAGGGATGTTTATCTTGTTTGACGCAGTGGAAGCCGTCCTGTCTCTTATTCACATCCACCA
++
+???DDDD+ADDBD8DE0@###################################################################################
+@ERR884056.27378
+GTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTTGGGGCGTTTATTGCGGGGGAATTTCTGTTTGCGCGTCTGACCTCGCGCCGCACCGCAC
++
+@@@FDFFDHFHHHJJJIIIIJEGI)+++22:1111:4*:CDG<0)?@######################################################
+@ERR884056.28618
+TCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTCGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATTCC
++
+???DDBDDDB1CDEE8CDDADD@?0?BDIIIAC@ADE@EI36?<9=?8;<=78<=<>BAB#########################################
+@ERR884056.35909
+GTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCA
++
+CCCFFFFFHHGHHFGHEHGHHJJJJJJIJGIIJJHGIJJJHI*?BBBFGIAAHIFCCEEH=EFDFFF7>A@CCCCDDDDDC@:;?@;&999?@CCB9B@B<
+@ERR884056.37433
+CTGCAAATGCTGATCTTTACCGGTGGGATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGGTTAATCTCTTAAACCTAGTCAACGGAAT
++
+???A:=BD?4A22<CDB:<?F8)31@)11?D3?@B><**090)00?B**988BCCAC@@##########################################
+@ERR884056.44406
+CGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCG
++
+@@@DDDDDHFHHHJJFHIJIIEIIJHJGJIFHFGD@EIFFGIIGGCCH)==EBFDDDCCCEEEDECCDDDDDCC3?CCDDDDD9<05<<>@>@C:@:>@:<
+@ERR884056.45596
+TCCCAGGGCAGCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGCGATCTTGATACAAAC
++
+;?@FFFFDHFHHHJJJJHIGGIIIIIIJJGBFGHGJIIGIHHFCCDD;>@>BB=?BBCDDCDABDD;5;<?<;>DD@A:>+)5<9&5<B?BACC@:@CCDA
+@ERR884056.49971
+TATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAA
++
+@@@FFFFFHHHHHJJFHGHJH?GHIHEHIIIJJFHHIIGIJJJJJJI=CGDEHHFBC>CC8?8?BBDCC@@52<?C>ABBDC>CCDAA:?###########
+@ERR884056.51896
+GCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGAAGGGTAAAGAACACCAGCGCCGTGG
++
+@CCFFDFDHHHHGJJIGBCHHHGIJ<DHGI8F@GGGIDDDGGHCHIJGGB<BDF;;69>;88@:@@BBBBC9>A###########################
+@ERR884056.57400
+AGCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGCGGCGGTTTCACGCATGGCTTGTTGCAGATCGACAAAGGAAGGAGCCTC
++
+@78BDDDDFFDFD?EF<FFF)?DFFF*CGF99D<FB?9BBF(7@'@F4)=5@#################################################
+@ERR884056.68978
+ACATACCGGGTTGAATCATATCGTTGCCGATATAGGTTGAAAATTCGTAAAGCACCAGACAGAGAGGGAAAAGTAACGCCTGACGTCCAAGCCCTGTCTCT
++
+@CCFFFFFHHHHHJJJJJJIJGFHIGIJJIGIIJIHFGHIJJIJIGGHIIEHIJIHFGHFFDDF>?CDDBBDD,5>C<?8?<9>3<><8::??B<84::>C
+@ERR884056.82382
+GGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTAGGATCGGTTTGGTCCGCCGCG
++
+BB@DDFF?FFHHHJGJIJGIJJIJGIICHDFEHGGFHCGGFGHB<A@@5509CDCB03>CC########################################
+@ERR884056.87421
+CAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGGTAAACAGATGGGAAATTCTCCCGAAGGGAAAAA
++
+@?@DDDDDFF?FHHGHID;ACF<CDHIGHH)?:9CD):CFHCF>1B)?DD*8BH<B4)8CDCEE>@###################################
+@ERR884056.87557
+TAGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTTTTGTTTGCCGCT
++
+?+?D?DDDFADB1CGFIIIIFEEFGFIIII@FFFFIAFIDFB=EED<?B@?BB@588::?AB3:>AABBBBB@@8838?@??BAB################
+@ERR884056.90492
+CTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGG
++
+CCCFFFFFHHHHHIHGGHHEGEHHHFJIJJJJIIIJJIGHJJJJIJHIIJJJGJJJJJJJEGIGEEHF?A?@DDDDCD?;=BABB?+38<@A@BD:@C950
+@ERR884056.96205
+ATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGGGTATTTATGGATGACCGCCGGGTTAAGGATTTATGCTTTCGGCATTGGGCG
++
+??1:A2BD<+AD?EE=2:C1CEFEEED?)0?0@D?(7=B>C>==@D#######################################################
+@ERR884056.98521
+GGCATTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTAAAAAGATAACCATCAGCGACAGCCACAAAATTCCGTTGACAAGGTTGAAGAGAT
++
+@@<DDFFDHFCFHGGIIIEH8CFHC?CFFGHI>?BF@FFBBGF<BGGGC))--=CFH@FHGIHG8:B<<;?@=A5=B:C>C####################
+@ERR884056.108798
+TTCGAGAATGCCTGATCGCACAAAGCAATCAGGCATTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTAAAAAGATAACCACTAGCACCAGC
++
+@@CFDFFFFHHHFIIIGFHIGEHIJJIGHIJJGIJJJIGGIIGFFGEGEDCCE@CACAE?EFDFDF>>A;;@66>AC@>ADCB@A################
+@ERR884056.110453
+TTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTCTGTCTCTTATACACATCTCCGACCCCACTAG
++
+@@@DFFFFFHHAD@EEH7FHHGI??EC:FH<9?@D<FH@>@GDHHCG9@>@FC==@7=5'59A@>@?=BB;@5;:CC3:5,5(5(55@>A###########
+@ERR884056.111065
+GTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGCCC
++
+@@@FFDDDFDHHGIJIFEFHDGGIGIJGIIGIJIIJJ?BG5=BB;CECECAC>C;?C;=BBBB73:>C79@@5+285059<@::>:(4:)5)59@CA####
+@ERR884056.124429
+GGTGATGATAAACCACACCACCCCCGCCAGCATCACCGGACGGCGACCAATACGATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCA
++
+@@?DDDDADFBHHI3CFHBGG;C@E?CGGIC@GGHGG;FAHHHB?>=@8<@C@BB@BBB?BBBBB;5;55??288??C(4@:@ACC@5?############
+@ERR884056.125093
+ACACCAGATTGACGACCATCACCATTAATTCGAGAATGCCTGATCGCACAAAGCAATCAGGCATTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATC
++
+BCCFFFFFHHGFHIIJJIJIIJJJJJJJJJJIIIJJIJFFGIIIJIJJJJJIIIHHHJJJHHFH7?DD=>BD:?CACDDDC<C:A:CCAA@CCCDD>@>C3
+@ERR884056.128819
+CCAGACAGAGAGGGAAAAGTAACGCCTGACGTCCAAGCCTGGCACCGTAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCTGCGCT
++
+@@@FFFBDCFAFFGAHHIACFHIFEGHFHEHFFCGIGFB<F;C=BBF(=@==@@)7??AAECCBD;7;AC>@>65>35=;B8;A#################
+@ERR884056.130233
+GCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGA
++
+BC@FFFFDHHHHFGHIJIJIIEHJJJJJJJJHIHHIJJJJJJIEIGGHJGHHIJIIIJJJHGIJ=AHFFDCCDB=CCCDDDB@@DDDC<>:CBC:>@CCA8
+@ERR884056.132716
+GGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCAAGAAACTGTCAATG
++
+@@@DDDDDHHDH<GEHI<D<?D?<FFHI@GAF))?;0?FCGEGCF<FFEF@@@DE;7=-=>B3??@A>>AB@>'38;:><9<C##################
+@ERR884056.141798
+TTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAAGTGTTCAATGTTTTGCG
++
+@@@FDFDF?DDHHIIDHIJJIIIGEFGIJGCIJGHGIFHBEHHEEFHFDE>;AB>;C@ACCABDDC@C3:A;;>59?A?C:>>C(4((++4::4::AA?<9
+@ERR884056.146603
+CTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAA
++
+CCCFFFFFHHHHHJIHGHIHIEIJJIJJGIIIEGIIHHFFFFDDDB?DDECDEDDDB?BDDDB<BDDBBBDDDACDDC:>:344>8<><BB59A@A@@###
+@ERR884056.148041
+CCTTTACTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAA
++
+@@@DDDDDHDDFFH;F<C<FFGHGHICH?G?GI4?G?@@BD?D<F7A;FH=C@BEAH=;@?C>;A/398/5?@CCC@CCCCDACA(&0955&0>CCCC###
+@ERR884056.149198
+TTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTAAAAAGATAACCATCAGCGACAGCCACAAAATTCCGTTGACAAGGTTGAAGAGCTGTCTCT
++
+CCCFFFFFHHHHHGHHHIJJJJIFHIJJJJJJIHIHHIIJFGGHIHGHGEBFFGGDCGHIIBGHGHFH?@EFC;CCEEC?CDDDBCCCCDDDACCCDDDA>
+@ERR884056.154502
+CTTCAGCACCAGCTTATAGTCACGACCGAGGTCTTTCAGTGACAGTGTCTCTGCTATGAGCGAGGCGGTTTCTGGCAAGGCCTGCTGTACACTGGAGAAAG
++
+@@@DDDBDF?F+2A:??<FIH?CC21@):)8@9?D##################################################################
+@ERR884056.160015
+CCTTTACTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCCAGACCATTGCCGAAAGCTTAAATACTTAACCCGGCAGTCATCCTTAA
++
+@@@DBD:4AFDFF<A<:CDEDF3<+2?;:E?FCFCD;D6DFFF/BFFFFE>@#################################################
+@ERR884056.171393
+GTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAA
++
+BBBFDDEEHHHHGIJJJIJGIHHIHIHGHHHIEGIIGHHJBG6208FGBC=C<=.=>FHIGGDG7;@?HEEE@CEF@B;ABECC:5>@=???B8(5:>ACB
+@ERR884056.191399
+GTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCCTGTCTCTTATACACATCTC
++
+@@@FFFFFHHHHHGJIJJJIJIJJHCGGIGFHGIJJIIGIHIIIHFHFFFCDFEEEC;@;?AC@A@DDDDB>C<@AC::449CB@@ACDDCDCC@CCC>C@
+@ERR884056.193977
+CCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCA
++
+@@@FADDDFHHCFHEEHEHHGGHJIJGHGEHCGHIJJJIDIHIBGFEEHI?7;AF;=EDDEEFBDCED:6='9;@DDBBA?9<5<?3?@BDB9<CD>>CD3
+@ERR884056.195008
+GCGACCAATACGATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGGTCATTGAAGTAGGAACCCAATCAATGCCCGCCT
++
+CCCFFDFFHHHFFIGIIHFBGGHIHG@D;CGHIIHEIFBHGCEHHHEBDB=ABDDB?=?B8@>CCCD>;@DCDDD:CCCC::+2(0<1<>A4>CCC99B>5
+@ERR884056.196606
+CGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCACTTC
++
+@CCFFFFDHHHFHIJJJJJJIIDGIJGIJGIGEGHGIIHGHICEA='3885?AD5@<<@>:>C@:@>@?C@##############################
+@ERR884056.199275
+ATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCCTGTCTCTTATACACATCTCCGAGTCCACGAGACTAAGG
++
+B@CFDEFDHHHHHGGIIHHJJIIIJIJFGHHGFHHGIHFFDHIIIHH=<B;?A@BDD:??;?BDDDCACCD>CCCDCC@CDD@9>5++(4:<009@CC###
+@ERR884056.201474
+GGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCCTGTCTCTTATACACATCTCCGAGCCCACGAGACGAAGGCGAATCTCGTATGCC
++
+;;?DDDBDF@FD>G8F@:CFFC*?DG?DF<GFG@?@;;B'.;?)).;AA@###################################################
+@ERR884056.201723
+CTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCCGATGGTTATTTTTTTAAAAGATAAACAGTTGGGGAATCGTCACGAAGGGGAGAACAATGGCTGAT
++
+=??D+=+=DC<2<:A:CD:FF@F+AFE1:C8?3?###################################################################
+@ERR884056.214669
+ACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGATCTGGCGAATGCGGGACTGGAGCGATTAACCGT
++
+@@@DBAD?DFFFF?+CFFFDFF<?F?:DFGBDF3BGFF0@EEF5(;?...(;(;(.;(;;;8=@B::(;ADB:49@09AA@53558(((++)5@B?@####
+@ERR884056.216260
+GCACCAGACAGAGAGGGAAAAGTAACGCCTGACGTCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGA
++
+@@CFFEFFHHHFFBAGHIGIGEHHHIEH@GGH@GHHBBDDHBFGHIIEIIA'5??DD>CE>>@>CCC:AC>>>@C@C>ACA98=@>C@4:A##########
+@ERR884056.217433
+AAACAAGACAAACATCCCTTCCCAGGGCAGCACATGGATCCACGCCGCGCACACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCAAGTTCGAAATCAGCG
++
+<@@D;D;BF;FA<E?E:CFH@:ADFG1EGFI>?DFIE?:B@@?B0?A/@:'',;56??>BBB5<?<:A:>>@@############################
+@ERR884056.218543
+CAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATAATAAACAACACA
++
+?@CADDDFHDFFHJEHGBHGHIIJGIEHI;?F>GHBEHIFIIAFHGH88BD8@E)//=CHG):-:BB?3;666>(.5;(,(,55:A@@(5;@>C@48<??1
+@ERR884056.224770
+GTCATCCATAAATACGCGTGCGATGAGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTAC
++
+@@@DFFFFFDFHHGIGBHGIGHIGGHH@HGE>FE???F?;:FGBHIIH8?9>;@@25<ACBAC>A>:>>?@9058<B@>09BA9>@3::>@##########
+@ERR884056.229003
+GGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCA
++
+@@=DDDDDHHHHHJGIGIIECEDFIJIIIIJII@FHHHIFHIJI??<CCCCHHIFDBDDBCCBCCCACDA@>CCCD3>CDDCCCC>B?B############
+@ERR884056.233084
+CTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGT
++
+@@@FBEFFGHHHHGHJIJJJIGIJGGIGIJFHIIJIJJEFHHA9BAA>CEEEACCDDDDDDDCDDDC::9;;>5<8A?>>BB99@4:@CCC<B<BB@A###
+@ERR884056.234054
+TGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACCGCCTCTTCGAAGGA
++
+@CCFDEFFHDHHFIIIJJFIIJGIJJGJHJIH=CHHHFBDDDDCCDDCBBB=BBBA<9BDD?CC:@7B;@5;2@CD>::ADDDDDD8&0959@3:?<?@08
+@ERR884056.235526
+CCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACCGCCTCTTCGAAGGACTCCTGAATTGCGGG
++
+@@@FFFFFGHHGHJJJGCFHIGIIIGIIJIEIJIJJJJJAEHFFFCDE>C;@BD@75?CDDCCCD@C@::<@9BBB9:@CA??@91(33:44>@CDDD>@0
+@ERR884056.239337
+GTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGGGGGGCGGCGGGGGTGGGTTTCGCTCCCCTTGCTGTGCGGGTGTGCCCGCGC
++
+BBBFFFDFHHHHHIJJIIFHIJJHG>CGGHGGGIIJIIGFHIBHH########################################################
+@ERR884056.249008
+GTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCCTGTCTCTTTTA
++
+B@CFFDDBHHHHFGGIIIGIJIHIIDGGGIJIFIJHIGIB=EDDB?DE>C>CE>C;=?BBD=;;AAA<75@D;28?<5935<AA(4:>(23:@CDCC####
+@ERR884056.269420
+GTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTACCTTTACTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCCAG
++
+@?@BDBD;?DDCFDBF@CEFI:FEE<?A<CEAFF>E:)*9?D<;F6B=@4C==7@=@@C##########################################
+@ERR884056.286499
+AGATTAAACTGTCCGTTGCCCCCGTTCAGCCAGGCATGTTTGCTGATTTCAATACCAACGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCG
++
+@@@DDEADHHBDHIEFHGIIIIJGD?GGIJJJFGI9BDBFGAGHHGGDEGFFC@F=@@DD@EE:@EFFD@CEECCCCCDD:;2';=?9<05&0>C######
+@ERR884056.295385
+TTCGTAAAGCACCAGACAGAGAGGGAAAAGTAACGCCTGACGTCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAAT
++
+CCCFFFFFHHFHHIIJJJIHIIGIJIIJGJFGGIIAHECGHHGHIGG@;CGEHHIAAEFDDCA>>@55@>>A@>@CDECDDA:@AA>@3+5&259:>AC##
+@ERR884056.298911
+CTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGCCGGGCATTGAT
++
+@CCFFFFDDDHHFHEIJJIJJJGIIIJIIEHHHIJJJIGIGIHHGEHGIGIFIGHIHGHIG=BBEFFF;@>;@>;5<<B@>B<A>>>>@(+9@DDBCCC@>
+@ERR884056.300554
+GGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCT
++
+@@:BDDFBFHHFHIJCG>HECHIIIIJIJIJFFHIDHHHGGGIHDGHII?DCFBHIIIEHIIIIEEEB@;@:>;(,;=AC@C@:@CCC5>:@DACC:9<@#
+@ERR884056.304199
+CTTCAGCACCAGCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATCGCTTTTTGCTGATCGAAAAAAG
++
+@CCFFFFFHHDHHJJJGGCFHIIJIGGIGHBDHIIIFHFGHFDGIGHIGECGIIEGHECEFFD@@>BB009@(:CCBC(0?<A##################
+@ERR884056.305434
+GCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGG
++
+@CCFDDFFDFHFDIHGHB>HGHIJFHIHIIIJJIIJIFGIIHH9?BA6;AA;@CCC;;;CB6;BB73>@>CDB;>0+<<>3&0<5AC:A+4>9@#######
+@ERR884056.307281
+TCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAGTTTTGTGGCTGTCC
++
+@@@DD?DDAFDFH:<CECCFHBBHGHGHEHDGFGIIEGIIIDGGHH?D==B?CCBBB@B@C>@>@A@:>>CC@>@CCC4>CACBBB023,:<<C#######
+@ERR884056.311849
+ATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAACGAATCCCCGTCTCTTTTACACA
++
+CCCFFFFFHHHHHJJJIIGGIJJIJIIHJGJJJJJJIJJGJIIIIGHHFFDFDB>BD>?@DDDDBDCCDC?>@DB##########################
+@ERR884056.313568
+ATCCACGCCAGCAATGGCAGGCTAACGAACCCCAGAGCCAGCGCCCCCGCCCCAAAGCGGCCGTTCTTCAGCCCCAGCTTATAATCACTACCCAGGTCTTT
++
+8?;?D3=AFA<1ABC@CB?F6))1?911:0?D#####################################################################
+@ERR884056.315446
+TCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGGGGTGGGGGTTATTATTACCTGTCTGGCAATATATATGGGGACAAAA
++
+BCCFFFFFGHHHHIGHHHEHGH?FDHGIBFHGIHHIJHG=B;@CCC#######################################################
+@ERR884056.319248
+AAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCA
++
+@BCFFDBDHHHHHJADFGIHIFGHIGIJJGEDGHHGIJHGGI@B>BBGHD<;5@DGD@AAAEEEECEF:>:=B=AA(550<?>?@B89>?###########
+@ERR884056.320385
+GTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCATTGTGGGGGAGGGGGGTGCGGGGGGGGTTTGT
++
+@@@DDDDDFDF@DE+<EF>H?CFBFIIIEIF4:?DGF:@?BFC=8)BF@A@;7C7.7??>=CDBB####################################
+@ERR884056.321176
+CGTTCAGCCAGGCATGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTACCTTTATTCCTGTCTCTT
++
+@CCFFAD?FHGDHHGGFGIIFGIG<CFHD@HGIIEEHHI?FB*0DGIGFF@?FDBFFFCH7=@78@CEDGHHDCC85>A=@####################
+@ERR884056.324912
+ACCCCCGCCAGCATCACCGGACGGCGACCAATACGATCCGACAGCGGCCCCAGGAGCCCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAA
++
+@BCFFDDDHDHHHGJJIJEHFGFGHHGEHDFFFEC?AB?B?;=@BDBDDD08?8?BDDDCBCCCCCCDDCCACCDD@4>9050)228<&59>CC(:9>@##
+@ERR884056.330664
+GTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGTCTCGCTACTTGGTCC
++
+@@CFFDFDFHHHFHIIIJJEDGBBBFIIJIJI<BFFFGGH5=BBDDD@>>(.655>CDDDBB;@DDC?BDB@#############################
+@ERR884056.339085
+GCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAACAAAACCCCGCGCCAGGC
++
+@??DFDEFFHBFHBBF+AFHHIICAHHGIJIH?FBGI9FG@HI?F?CGE<=BD?A(;@6>??C>BBB>>?(+>>>(3?@383:?#################
+@ERR884056.345201
+TTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTAAAAAGATAACCATCAGCGACAGCCACAAAATTCCGTTGCGAAGGTTGAAGAGATAAACT
++
+@@<DDD?ADHFFFGIBFAFHCHG@GGG<EFDDGGGCFH?FHHFH@FGDF<98B<=)8=7;@AEE2;@##################################
+@ERR884056.352982
+GCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGGC
++
+@@CFDFFFHHAFHBHIIHDHEHIJJJFHHGGIHICHGGGHHHHHCAEEHE?BCDDDDDDDDDDCDDCC9<CA>>@C4>A>BD###################
+@ERR884056.359883
+CTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGA
++
+@CCFDFEDHHHAFF@EBFHIIIIBHIEGGHFHIIIIDGEHHGGHIIHFHEC@BCCBDDDA@@@CDDDDCCCCBDCCBB@@>)0984:(:@CCAA3+9AC>4
+@ERR884056.370452
+GCACAAAGCAATCAGGCATTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTAAAAAGATAACCATCAGCGACAGCCACAAAATTCCGTTGCA
++
+CCCFFFFFHHHGBIJJJIIIJJIJIIIJHHIGHHIJIB?FGIHIHIIGIJ>FHE;CGGHIJF4CCH?HFCEFFFCACC@BDBB@<?A9(2(44>CACC###
+@ERR884056.374282
+GTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGGCTTGATTGGGTT
++
+B@@FFFDFHHFHFGHIGGHJJEFHHIHJIGIIJGGEHEIIIIIIGIIGIIGHIJH@AEHHFDF<@BDDB5?BBCA?A@:>CDAA999&&&)+51>CDBB@0
+@ERR884056.374774
+ATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTGCTTGATGGTTATCTT
++
+=?@FDFABAAFHHIIIBFHIIFHGDHHCEHEEGFG;ADEHGEDD?@@D(.6;>ADD55@>=ACDD:;>3;;<(<@CC@?A7?###################
+@ERR884056.378475
+GCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGAGGCCCAAACAGCAAGTTAACCGCAAT
++
+@@CFFFFFHGGFHIJGGHIGGHHHJGHGHC?BFFDBFEGFGGFBCG@GHHGFBABAB3(;3=@@#####################################
+@ERR884056.382290
+GCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGCATAGGCGAGA
++
+B@CFFFFFFFHHHHIJJJJIGHIJIIIJJJJJJJJJJIJJJGGHAB6@HIHFGHIGHFFED?;6.;AA?BC@CDCD><CDDD8)505>B>&09@44>9509
+@ERR884056.388812
+GTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGCTCTCCTTTTCTCGTCTGCCACAC
++
+@@@D1@@?FAD1?E88?CE6666;@EF@CEA;A3=CDD?>?=@35;??;8(,>39AB############################################
+@ERR884056.391698
+TCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCAGTGGCAGCGATCTCCTTTTTCGGTCTGCAAGAAGCCATGCCTGAAACCGCGACACCA
++
+@?@DD?DDFHGAFFGHGBFEHCEEGFC?>GHGEGHFF;?FH@G?.BCHH9@FB'6@A)=?)).)79A(9/(5;3,,(:><C>ACAC49434?@########
+@ERR884056.415729
+CTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAACGAATCCCAGCCCCAGCGCCCCCCCCACAAA
++
+@C@FFFFDHHHDDIIJHHIEGDHIHIJJIFFHHJJJHIJIIHHFEB@CACC?8;?BDCCC>CAC?@5?4@C(28??CC#######################
+@ERR884056.423060
+TCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGCTTGCTCCCCTACTTGGTCCGCTGGTGGGCTCGGCGGGGTTCCA
++
+=?7D=A3B?+<+A@EEDAC=8*09?*??39DD#####################################################################
+@ERR884056.429602
+GCAGCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCCGAGATCTTGATACAAACAGCCTAT
++
+?@@D?BDDF<FD?EH@GGHG>1::@?6?FGEGII5'-(6?;?CDC=/3,(,5:@:537055<?<<>70((3:+:9<&)&00(+4:(4>ACCCCB#######
+@ERR884056.442163
+AGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGACGCGCT
++
+CCCFFFFFHHHHHIJGJJJIIJJGGHHIJJJEGIJJHHIIIFGDGGEHFFDFDDDDDCCDCDCECDDDDBDDDBABDD<A3<>BBBD<B@5?@<CCDD<30
+@ERR884056.443295
+ATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAGGAACTCGGTGGTGCCTATAAGCTGTGCTG
++
+@@@DDDDDHHFAHIHHEHD9CFH;GHI@BH9DDGHHHIIGHI>HIFG55??>);5=BB>>:@>:>>5@@>@##############################
+@ERR884056.446973
+TGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTACCTTTACTCATATCGCTGACAAACAGGGTTAA
++
+BBBFFFFFHHHFHEHIGGFHIIJIICFEEDHGFFGGIIIIJBCGBAHIIJBFHF?D;AEEEHFEDDF?;=1>C@@5>@ACC####################
+@ERR884056.455901
+GCCTGATATTGTTCCACCACGGCCAACATACCGGGTTGAATCATATCGTTGCCGATATAGGTTGAAAATTCGTAAAGCACCAGACAGAGGGGGAAAAGTAA
++
+@@CFFDD>FH?AFGIGGGHGIJIJHEHIGFGHGGH?DDBFHGGHGHIGDEFA74:AB?C@@;A>5;>CDDC(:<9?(,(9?A###################
+@ERR884056.458931
+GCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCTACGGTTATCTCATCGCACGCGGATTTATCG
++
+?:?BADDBDF?FDHIIIBHGBEIIIGIIEHIAGGGIIH:=?AE@BAB@>--;?>@C?5,8?@B######################################
+@ERR884056.459364
+GTGATCTTGATACAAACCGCCTCTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAG
++
+@CCFFFFFHHFFHJJJGIIJJIJJJGIJGGHIJJGGGJIJIJIGHEBHHHBEFFFCDACDDBD=AAC>ACCCAC@BA?DD>ACCC88<44<A?()05<@A#
+@ERR884056.463263
+CCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCCTATTTGTCGCCCTGCGTTGATGCTGGGCGTGGGGGGGGGGGTT
++
+???DDDDDDEE4<CED??A@,,,,5;<?<AAAA:><?A=A#############################################################
+@ERR884056.471806
+GTAATATTGCCAGACAGGTGATGATAAACCACACCACCCCCGCCAGCATCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATG
++
+?@@DF?BDFFHDFGBGFH<CHHGFHIHGFHGIJIIHBCDDFH@AGFC;@E=CEHIHHEAEH>>CCCDC@AA@BBDDBDDDDDBDD4(9>BB@5(4:288CA
+@ERR884056.473750
+CCGTACCTTTACTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGCTCATC
++
+@@@BBDDDGFHBF>EEFEGEHHIJCGGI;??FH?DHHGGIJI@F@BGG=B@@@AB?;AB?4(5?@?CCAC:;=,,(++4>@CDCC:>:@(2005<&&0<CC
+@ERR884056.480992
+CCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGGGGGGGGGTTTTTCATCACCTCTCTGGCAATATTTCTCTCGCACAACA
++
+@@@D@DDDFFFFFCGGFEED6?3?G<B9D@@CA5@EAE59;;@##########################################################
+@ERR884056.490309
+TGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATT
++
+BB@FDFFFHHHHHIJJJJIJJJJHIJJJAEHJHHHHHHHFFCDCBB@BDDACDDDDBDDDBBDDDDDB?BCCB@BBBDCACCC:BC4<<@<@-9>?8.&5?
+@ERR884056.506046
+GCACCAGACAGAGAGGGAAAAGTAACGCCTGACGTCCAAGCCTGGAACCGGAAGCTAATTTATTTTGCATACAATTTCTTCGCCAATAATAATCACGCAGA
++
+???DBD;DDBDAC;EEEE9?CF+2AECE8?DDEAB@)?DDD(8BB().;;ADDD>@;@?A#########################################
+@ERR884056.527528
+CTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCACGCGGGCATTGATTG
++
+BB@DDDEDFHCFCGGHFGHHHIHIIEECHHGGHGIHFFGGIGDBBGHF=BFCFGIHABE=B?D;77;@>AB>>;?<9:5<CA@A#################
+@ERR884056.536318
+GGGTTAATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATAAGATAACCGTT
++
+B@BDDDFDHFHHHJIIGHIJGIJJJHJHIIIJIJJIIIGJJJJIIIGIIAEHHGHFFFFBDCD>=;08>ACCD############################
+@ERR884056.541158
+GATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAA
++
+@@@FFBEFGFDFFEGGGFGGDA@GEEEEEGIG@DHIIFDGD@BFFFIB0'99<A=C@AACCCCDDD3::@::AC>>>A#######################
+@ERR884056.543935
+CCTTTACTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATCA
++
+BCCFFFFFHHHHHIJJGHIJJGIJJEGHHGHIIGIIJJHGIIHBB@GIJGCEHH?E<B?C2;@CCD@>8;CCACCACDDC:A###################
+@ERR884056.549497
+TATCTGGCGGGCGGGATGTTTTTACAATGGGTCCCGGGGCCGGTGTCGGGTCCGATTGGTCGACCTGCGGCGATGCCGGGGGGGGGCGCGGGGCGATGCGT
++
+@@@DD8A;?DHDAGEB3;;;;;?<>A:ACC#######################################################################
+@ERR884056.550969
+CTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGGT
++
+@C@DDADFHHG?FGAEHI@BB:FHHAEHGG?:*1:?@?3BFF9*9/?BD8==F@C>;3@AC@@;))7AC?E;37?B>@A2;'59?(,5:ACBB?#######
+@ERR884056.552530
+AAACTGTCCGTTGCCCCCGTTCAGCCAGGCATGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTAC
++
+@BCDDDFFFFFFFIIJHFHGGHIJJEGIJJGGIIGCHICGEGGGFGJDHGBC=@CB5@CC?CH>?DD@D>3;A@A>A@>A;>A@?BB@=90)5?#######
+@ERR884056.562507
+GAGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGGCAGACGCGC
++
+B@CBFFFDHHHGHHIEGHIIIBHHIJJJFGIIIIIJJIHIIIIJJHIGBDEB5=BDBBCCCCDDDCCCC@BBB>?AB@<38<>@9BBBD<5&0<3??909>
+@ERR884056.564439
+GGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTT
++
+@@?DFFFDHHFHGGJJGI<FHIJ?DBBHIGGIGGIIIIIJFIDEHIHIHHHFFFFEC@ACACCC@;CCC<55(,5>CBD9@ACD?9>B<B><ABB######
+@ERR884056.577180
+ACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGGGGGGGGCGGGGGGTTGTTTTGTTCGCCTTGCTGGCGGGGGTGCGCCCCACGCCCCGT
++
+CCBFFFFFHHHHHIIIIJJJJIJHIIJJJGIIII###################################################################
+@ERR884056.585093
+ATCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATG
++
+CCCFFFFFFHHAFIIJGGDHGIIIJJFFHGIICGHEEDHGIIHIJJDI<B>EHE7?BDD@B@?@>CCCCECA?;>BDDDDC5>B@@@C:A@ABB3?#####
+@ERR884056.595821
+TGAGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATACTCAGCGAACGTACGGTGCGGCGTGATGTCTGACGTG
++
+??@D???:?<CF1?)C@@EFE>EFGFFAD;?F;=CFIFIIF@7CEF7B4'5??;3;>@BBAAAA(:AB@B@B#############################
+@ERR884056.598757
+GTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGGGGGGCGGGGGGCAGGGGTTGGAGGCCAGTTGGTGCGGGGTGCGGCCGGGCCGCCGGCGAACTGATATT
++
+B@BFFEDDFFHHHIBGGGIHHCF##############################################################################
+@ERR884056.602258
+GTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACCGTTGCCGCAGCAGCGACA
++
+?+:ADD?DAC?CDEDADDFDE<EEEDDDDDECD?DDDC<=CA<B<(-@89>???AAAA5:>>3>>?>08>?>?8;AAAAA#####################
+@ERR884056.623465
+GAGCAGCTATGAATATGGCTTTCTGCAAGCGGCTCTTTTTTGGGCGTTAATTTCGGGGAAATTTCTGTTAGCGCGTCTGACCCGCGCCCGCACCGGAATCT
++
+@@@DDDDDFFFDFBBFIIIFB################################################################################
+@ERR884056.633068
+GAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGGTTG
++
+CCCFFFFFHDHFHGIJJIHHGCBFHGGIIJJJJIEEHCEEEEEEHFFDDBACDEDDDDD7;B@&0?:C:<?8@CC@CCACA@A##################
+@ERR884056.634181
+CCTATACGCGTGGCGGTTTCAGGCATGGCTTGTTGCAGACCGAAAAAAGAGATCCCTCCCAATGCGGCAAACAAAACAAACATCCCTTCCCAGGGCAGCCA
++
+BBCFDFFDHHFHHIJIDGHDGEGAGEEHFHI######################################################################
+@ERR884056.644643
+GCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGTTGCGGCACAGGTTATCTCTACGCACGCGTATT
++
+CCCFFFFFHGHHHJGHGHDGHGEHG>HGDFFBD2@G>BA>5;>'385>B####################################################
+@ERR884056.646404
+GTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGT
++
+@@CDDFFFHGHHHIIGIIJIJIIJJJGHIIIJJJFIIIIHEIEHHEFFFFEFEEEEEECCCDDDCBB58?99??CCCC>CDCC?9?CA@A@:>?#######
+@ERR884056.646967
+GTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCCCCCCGCGTATAGG
++
+CCCFFFFFHGHHHGBEHIAB@CHIGEHFGGHHJGHGIIGGGIEHGG=F@6(()7=DEEH7:??=<>AA55?BCBB<ACCCC@###################
+@ERR884056.650623
+GTTGAGCAGCTATGAATATGGCTTGGTGCAAGTGCCTATTTTCGGGGCGTTAATTGCTGTCTCTTTTACAAATCTCCGAGCCCACGAGAGAAAAGGCACAC
++
+??@DDD>DFDF?FGCF9ACBFG@F#############################################################################
+@ERR884056.656164
+CCATAAATACGCGTGCGATGAGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGC
++
+@C@FFFFDDHFHH1CFIGHJIIIHG>F*?DBFGH<FHGGGA;BAEBC2?C(-=AC@@A3;@;>>?35>B88<595))3>:4@4(4@:CBBDD@########
+@ERR884056.656250
+CCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGTTTTGGCAGCGATCTCCTTTTTCGG
++
+CCCFFFFFGHHDFGIJIJIHIJJHDFHFFGBHFFFFCAECDCEDD(,;>A?B9??<?8ABACCC?CDC:>:CC::@)&328-::?8&08<A>@::4:@###
+@ERR884056.656772
+CTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACAAAAGGAAAAAAAATGACTG
++
+CCCFFFFFHHFHBHHIIIHIGIIJJJJIJ=FGFFD@FGIFHGG?D*0*8D8BABDEG@CCGHGE>=A>=3=C);?CA;:AC####################
+@ERR884056.657269
+ATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGGGAATCTCGGTCTTCCT
++
+B@CFFFFEHGFHHJJJIHICFGEHGGGGG@FHHIIGIBBFIGH@CFH;DHDH=77A=;.))7?DC@=8;>@@2<'8<9<>4A###################
+@ERR884056.657358
+CGAATCCCAGCGCCAGCGCCCCCGCCACAAAGCGGCCGTTCTTCAGCACCAGCTTATAGTCACGACCGAGTTCTTTCAGTGACCGTATCTCGCCTATACGG
++
+:+=???:BCF+@?GFABDG:?DGEFIB6@@@FA@BABCC8;?;@@BBB<(,<?A(333>(::@;?####################################
+@ERR884056.667985
+CTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGAATGGGCGATCCACGCCAGCAATGGCAGGCTTACGAAACCCACCGCCAGCGCCCCCGCCACATA
++
+?@@D?A?DH?B<D??:FC@EDGHIC?B9F@FGIFG6@A';@@###########################################################
+@ERR884056.677163
+GTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGACGA
++
+B?BDFFBDFFHDDGGIIIGEGGGGIGIFHGHCHIJJGIGIJBHIFG@77=:E=D=CE;?B@B>@@@CCCACD:@:AC>ACB<@B@BBBB999@########
+@ERR884056.677990
+GACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGTTTATCTCATCGCACG
++
+@;@DDDDAAFHFFIIIDHBG?FGGEHIIEGGGHDHIIFIIHC@BB@BBB058?A3>@::A:@>A>CC2<C-099<@CC>B>@###################
+@ERR884056.689769
+TTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTACCTTTACTCATATCGCTGGCAAACAGGCTTAATCCCACCAGT
++
+@CCFFFFDFHBBHIGCDHHIIHIGIIJIGIIGGGHCC?FHHGIHIJGDF:;ACEH==EEDBDCC>ACC36(;@############################
+@ERR884056.700716
+TCGTTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTTTTGCAAGCACCT
++
+B@BFFFDFHHHHHHHJJFHGHGGCFGC9DCDHH<?9DBDF@AB@;@G7)77??################################################
+@ERR884056.703797
+GGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTT
++
+@@CF;DADBHHHHIGHIEHGGIHIIIGIIEGIG?FEHIIHIGCF:FHGGEDAEHFEC>CHEDFDBBFEE@C;>;>=88>:>@C@?>B7<@4>>CDC@>@4:
+@ERR884056.714227
+ACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTTGCCGTCCGGTGATTCTGGCGGGGGG
++
+BBCFDDFEHHHADHIIGHFHHJEHIFAEDD?BD3>CCBBDDCCCC8ACB33+8<&58607;CB;0(5@#################################
+@ERR884056.726431
+GCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGAGTTTAATAAAAGCACAGCTAACGAGAAAGCGAATTTTGA
++
+@@@DDD?BHHHHHGHFHGHDHHGEGEEFFHGIIEEG@B:BHIHH@BFHHIGFCFC=FGHHDFAC:AC>>:5>(-5;?35,:>:>((095?:ABB#######
+@ERR884056.731782
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGATGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTG
++
+?=?BDD;+AC?CD:EEEDA:<<;E@FE??EAD9DBBDDDDDDAEEICA@A=CA;C?AD))7;(;>??608<>ABAA4::>>A###################
+@ERR884056.738574
+CCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGACGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCA
++
+@@@FFEFDFFHBFIGIFIGEGGIJEGGIIIGDG<BD3@CCECB>?@BBBCCCBCCCCCDCACDB>@@CDA><05>>BDBD@A3:4438<:>C@A>8<<A??
+@ERR884056.743252
+TTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATC
++
+B@@FFFFDHAHHHJBEGIFHHFHCGIIIIHIIIJJIFGIIGIEGHJ<FHJHCHGGJCEEHEHFBD>ADCC;69;;?BCCDB>?AB@<BBD<B@########
+@ERR884056.749917
+GTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTGCTTGGTCCGCTGGTGGGTGCGGTGTGGTTCTATCTGCTGTTCTTGGA
++
+@@@DD:?B:BF<+A:CFGE6GFE?)?FF9@F<:7BFFEEFEBEFEC;@@@<>C'3;@;8,:A=@@B;?#################################
+@ERR884056.751024
+CGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAA
++
+?=?ADDFFGDFHBHHAEAHGHIGJGIIJJFIJGIBDBFF<0?FA;?DGCC@CGDHHCGF@ECE=@BEBDDCD>=;A#########################
+@ERR884056.761704
+GGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGAGAGAAACTGTCACT
++
+=?@DDDDDHBCFFHGFDHIEIEAE@DE>FBGFHEC;DHGIIIIDB<@(5;CC4@CD;)=;@>@CC)(.(.>5'9=82355<52>C4(3<2<>?A>3@@A##
+@ERR884056.764837
+AAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATAAATGGTGATGGTCGTCAATCTGCT
++
+B@@FDFFDHHHFHJIJJJJJIJJIIIJIIJHI:?GGHFG:F>DFHIJICGC@G8@@E:AE;;?C;?B@ACCE?>5@(5-;C35@#################
+@ERR884056.769877
+GCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGC
++
+@CCFDFDDFHFFHFFHEEIJJJIGIFGHJICGGHIII89DHIJHIDH?DEAABFCHGGDHBFF67?CE>;>CD?B@=9@C#####################
+@ERR884056.774319
+CGATATAGGTTGAAAATTCGTAAAGCACCAGACAGAGAGGGAAAAGTAACGCCTGACGTCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTT
++
+CCCFFFFFFHHHHJGIIJJJJIJJJHII=DHGIIIIGIHGGHGGCGBBFHEGHGHIG@CH;??BBDFE=ACD=;2'38<C>:>@ACB(:+:A:AA######
+@ERR884056.777342
+GGGAAAAGTAACGCCTGACGTCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGAGTTTAATAAAAGCA
++
+B@CFFFFFHHHHDHIFIJJJGHIIIIIIHGIGGFHHBHGFGCH8=B@FFECGHIJIGFHHFACCEFDBC<ABDCCDCC3:???BB352A:@C@C@@34>?9
+@ERR884056.784159
+AGATTAAACTGTCCGTTGCCCCCGTTCAGCCAGGCATGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAAC
++
+@@CFFFFFHHHHHJIHGGIJGIJJFHGGGGIJIJIJIIJ@HHIJIDHGHG==FGIFHCG?EHFHCHFCB?CCCEECDC@>A?;5>-5((58?B59>9<CCC
+@ERR884056.791515
+GGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACTGGGGCAACGGACAGTTTACTCTCTTCAACATGGCAA
++
+@@CAAAD?FHDFH@BCGGGEHCGID>FGI;8?F@EHI?@FH><BDE@G;;BD*8DFG9@;;6=@)8=DBEBH#############################
+@ERR884056.801847
+ATCAATGCCCGCCTGATATTGTTCCACCACGGCCAACATACCGGGTTGAATCATATCGTTGCCGATATAGGTTGAAAATTCGTAAAGAACCAGACAGAGAG
++
+?@@DDDDBDHDFFBHBG>EHI<<C2AFFHGIIIFHIBIGDDGIIGFCBGCC3==AEH;)6.9CA??B?(,55:(3>C,44>03<88+(8988?@?(((3??
+@ERR884056.803607
+TTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCCTT
++
+@@@DDDDDFFBBFEFG@3AC<A9ACHGIII9CDDEFGIFGECFDFBBB8B8BFFDFFIIFECB@==>C)=?>;-;@AA<BBB>BBB:;5:9>B########
+@ERR884056.814969
+ATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATA
++
+CCCFFFFFHHHHHIJJGGIJIGHIJJJIGGGIHGIIHHIJIHEFGGBH1BGIJCEDHHFEEED85=AA@>A;=5(585>CD@CCCCC+8)55<0&)09@@4
+@ERR884056.817808
+CAAGACAAACATCCCTTCCCAGGGCAGCACATGGATGCACGCCGCGCCCACCAGCGTACCAAGTAGCGGAGCATTCAGCGCCACGTTGGCCATGAGCGCGG
++
+;?=DDDDDCA:ACFE>@A<<AFGIII@CGF>*:)0:*0:?8@)?-@8='5;<BACB#############################################
+@ERR884056.819730
+ATACAAACCGCCTCTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCTGTCTCTTATACACATCTCCGAGCCGA
++
+@CCFFFFFHHHHGHIJHGFHIJEGGGHGI@GHHIIIJGIIIGHHHHEFFFACDD@CDDC>@CC>C@BBDA::@ACDDDCCCCCC>A@A>:ACC:559@B##
+@ERR884056.830001
+CTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTTTCTTTTTTAAAGATAAACATATGGGAAACTCTCACGAAGGGTATAAACTCTCTCGTA
++
+@@@DDDDAF:CFDF4E<8A:AAA<AA+1?;E1*)))0?F9B*9(7DFFFI3'6=@=73)=?;A######################################
+@ERR884056.835880
+GTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTACCTTTACTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCCAA
++
+@BBFFDFFGHHHFHIIGIGHGHIJJIJHHIJJHEIIGHGHIHJHHGDC@FC@>G@@EDHEC9<>DAC..6=BBDDD>:@<??###################
+@ERR884056.840652
+GCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACATGTCTCTTATACAC
++
+??@DDAD?FFDFHEGIIJGIHGEEFGEGIBDFGHFCAHEHI<AF=BB>FHCGFA@ADDEHHHHHFFFFFD'',9?A55,9A98<:A###############
+@ERR884056.841801
+CCACAAAGCGGCCGTTCTTCAGCACCAGCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTTT
++
+CC@FFFFFHHHGHJJJGIJEHGHIHIIIHGHFHIIJGIHIIIGGHFFFFC?CEECFEA>CCCDCDDC?88;?@@CDDB@BDB@##################
+@ERR884056.842430
+GTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAA
++
+B@@FFFFEHFHHHJJHHIJHHIJIJGGFHGHGEFEFFEFHGGF=GGA??38==F)==FHGIEHD=7C>=CEECCCD@D;C?@###################
+@ERR884056.844992
+CGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATTTAAGTAAAGGTACGGTTTCTGCGGCGATGGAAATGCTGCAAATGT
++
+?;;DD?===<ABB2<:GAD>9@A?D092B*/?608CFFEA@DF##########################################################
+@ERR884056.846553
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATGCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCAACGCGCTGATGGCGTACATG
++
+@@@D?ADDDBFFFIGI4AAHE<CGIG6?@CF31)::FFFF<FF)=FE2CD7)=AC?2?BBBC(,;/)&0?@34>A##########################
+@ERR884056.851964
+TGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACGGCGTCTTCGTAGAT
++
+?@@DDD>;FDDHHB>6C8CFG9?BDHF:@@;@7@C=<</9A=;@C@#######################################################
+@ERR884056.853243
+TTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTAAAAAGATAACCATCAGCGACAGCCACAAAATTCCGTTGACAAGGTTGAAGAGCTTAAACT
++
+@@CFDDFFHFHGHJBGAEGIIHIHEGIIGJFFGHGHIIEHICHGDH?GHB@BAFIIIII:@B;CGCEACB;>BCC@#########################
+@ERR884056.854899
+ACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGGTGTTTTTACAATGGG
++
+@@@DDD:8BFFFHIEHI<FH;EHBG>FC@9B9BBD?DGE/<9>C33;C@B<<@CA>55>@@:ACC:+585;@C(4@CC99@&))555))2<9??@3:>@##
+@ERR884056.869575
+ATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCCTGTCTCTTATACACATCTCCGAGCCCACGAGACTA
++
+@@@DDDDBFFFHHG@FEF:?<AAFH<GFDDFEGHCBD<DF?BD64'5/92;6,9>?=CC12?88?@((+:CCCCCCCCD@4@CC@>5&)0<2<?>5&59@:
+@ERR884056.898290
+GCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATGATAAACCACCCCCACCCCCCCACCATCACCGGCCGC
++
+8?@DBD?BFHHFHIGFH92AFEII31CFHEB<CADG3?@FG6?BD4BDHG<CFCACC6=D=?>)7A=;;7BB#############################
+@ERR884056.900492
+GGGTTAATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGATCATCCATAAATACGCTAGCGATGAGATAACTGTT
++
+::?:DDD4DDDDDEE@EE+A?EEE6C18:)?DDDBBD################################################################
+@ERR884056.904100
+TTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTCTTTCGGGCTGCAA
++
+@C@FADBDHHHCFG=EEGGGIG@@@EHHHFCA?=?CCCDECA;=((-;('5,8>:;A<CC:>:3(3:(5>;&5:ACC@#######################
+@ERR884056.905506
+CCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGAACACCGCGCTGATGCGCAACGTGGCGCTGT
++
+??@DBDBDFHHBHG<;C@@@C?BGEEGHBGHII6DEH=8=C)@;3=;@C####################################################
+@ERR884056.910352
+GCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGAGTTTAATCTGTCTCTTATACACATCTCCGAGCCCACGCG
++
+B@@FFDDDHDHFFEHGIIJJJJGIIIIC@<DGGD:BFHHGIFEGIGFHIC=CDHEHA;4595=>;C3;@CA(5>ACC;,;,:>(:>AAC############
+@ERR884056.913294
+GAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACG
++
+=?@=ADD:=+2AC<F=?CHBH1@E?F?D<FEDFFFF>DF@=@;EE97;)=)==AB##############################################
+@ERR884056.917207
+GATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAAGGGACAGTTTAATATCTCCAACTTTGCAAACGGATTTTTGTGGTTGT
++
+@?@DFFFFHDFDDGHFEHIIIIEHAFEEHHIIIIIII*?B@############################################################
+@ERR884056.929684
+TGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCA
++
+@<@FFFFFHDFHHHIIIIGHFDHIHIIGIGGGHGGDHGIIAGCHHFBCBD3;B58BBCCDDCDCCCC:>+8:??@+9<B>8A?@@A?A#############
+@ERR884056.933549
+CTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTTTCACGAAGGGCAAAAAAATACATG
++
+BCBDFFFFGHHHHJJJIJJJIGIIJGIJIIJG?@@F;<0@D>?9?889BF8BFEC@F45==;=7)77??;2@?DD@#########################
+@ERR884056.934412
+TGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCT
++
+BC@FFFFFHHHHHIGJJJJCHIGHFHHCDDGFGGHEHFAA@?CC;5@CD@AC:>9ADDDB89<@DB9?>:>C24:@@@>CC>()999-443:<<>0?@###
+@ERR884056.935629
+GCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAAAAGATGGGAAATTTCTACGAA
++
+BCCFFFFDHHHFFHHHIDHGDFGEHIJJIJJIJJJJIIJJHIIFGFFHIICFHGE8B@=E?CEH777@DC?A>C@7>3;@(5,(,(:?9ABC#########
+@ERR884056.941817
+ATCCACGCCAGCAATGGCAGGCTAACGAATCCCAGCGCCAGCGCCCCCGCCACAAAACGGCCGTTCTTCAGCACCAGCTTTTATCACCGCCCCGATTCTTT
++
+@@?DDDDDHHHHHGIIIIIII?3:E3?CGFCHGEH9@:@;'(5;;>?D#####################################################
+@ERR884056.944629
+ATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGGTAACCAATCCCAGCGCCAACGCCCCC
++
+@@CFFFFFFHHHFHJJJGGIJJIIGEGFHGHIGHIGCIHIFHG05;BEB;.;ABB;?CCB@?=?B<<CCCAC#############################
+@ERR884056.945032
+CCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTTTGGAGG
++
+@CCDFFFFHHFFHJGHIDHI@HGIJGIJHIIICHI/=E?DECCDEC..>;ACDBDDD?B@?CDCDB8@8AB9+<@@CCDC@>A##################
+@ERR884056.959504
+GGGTTAATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACGGTT
++
+B@C=DDEFHHHGHJJJJJJIIGIIJJGIGIGIIGHGIJHIFHIJJIIHIFEE?AE>DFFD?CDBDB575@C@CDCCCDDA893505<B#############
+@ERR884056.960542
+TTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTT
++
+@@CFDFDEHHFHHJJJJFGEEGHGGIIIIIII?FHGGGHB<@DHHBBDDAEDDC@@CCDDCDCDCDDDC>ACDC9-??@4>AC?<<??#############
+@ERR884056.977897
+GCGACCAATACGATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGGTCATTGAAGTAGGAACCCAATCAATGCCCGCCT
++
+@@CDFFF?FDD=BEHFHBFGGIGAEH@?FGG?=@FAGE@@=DEH;'.7@C(,3>:@B8@?ACCD>45&&09@>3:4:>(4:@@##################
+@ERR884056.984906
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTG
++
+@@CFFFFDFFHHHGIJIJCIGIJIIHHGHGGHGGIGGIIIJGHHGGH@7=@>AHHEEBD?9ABAB?8>BB?CCC@@ACC:4>C?>B@##############
+@ERR884056.986421
+CTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTG
++
+@CCFFFFFGHHHHJJGHGGIJIIIJJJIIIJJIIJIJEHHGIEFHHEFFD?BB=?A@C@CDEEEEDCCCC>?095@CACCCDDDDBDDBC@##########
+@ERR884056.986985
+TGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAA
++
+@@@DFFDDFHDFF:CAFGIGGGIIGHI<H:?BF9FFFFHGFHGBFHA>@FCC@AE;AAC7;CC>CEACDD?DDB@B50?CA>C<<<5&33>>+4>C@::@:
+@ERR884056.993832
+ATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAG
++
+@BCFFFFFHHHHFHHHHIFHIJJJJIJIJJJIIIJJJJJIJJJJJIJIHHIGEHHCEEEHBDDBDDDDDDDD@DDDDDBDD@DDB@8?89><?DCCB5?B0
+@ERR884056.1001428
+ACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCC
++
+BC@DDFFFGHHHHIJJJJADHIJIJFIJIJJHGEHGIIJHGHCHIHDHHECCCHHCDEF?@CCCCEDBBDD;B?@@CCCDDDC@>?9@3<9@@<<B<<<@<
+@ERR884056.1011404
+GTTGAGCAGCTATGAATATGGCTTGTTGCAAGTGCCTATTTTTGGGGGGTTTATTGTGGGTGAATTGCTGTTAGCGCGTCTGGCCTCCCGGCGGGCCGTCC
++
+@@@DFFFFFHHFFGGIJGIDHFHF)+2++29**1*1:*?DCB*):@G######################################################
+@ERR884056.1023875
+CCATTAATTCGAGAATGCCTGATCGCACAAAGCAATCAGGCATTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTAAAAAGATAACCATCAG
++
+BCBFFFFFHHHHHJJJGHHIIJIJJIIJJJIIJJEGIIIHFHHIFFDAEFGGDCGEHHHHEBCDCDE6>>>CEDEDCDCCCCAAC>>>AB1:CCAC@>>:>
+@ERR884056.1031891
+TCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATGA
++
+BC@FFFFEHHHGHJHHJJJJIJJJJJIJIIIIIIFGHGHCHIFGHIIBHDCEC=E?>@?CD>BCEEACCCC?@;=;2,(55;>3:ACDCC?##########
+@ERR884056.1047435
+GGCTAACGAATCCCAGCGCCAGCGCCCCCGCCACAAAGCGGCCGTTCTTCAGCACCAGCTTATAGTCACGACCGAGCTCTTTCAGTGACAGCTTCTCGCCT
++
+=?@DDDD?DFFDHIIAEHIIIIIGGHFFGIIIFIIGHHFEDCCB@=CB@:5::ABB?8<@>AA:::@:A98;@595&0@CC>AC@::>>@(+:+(:><?B5
+@ERR884056.1048588
+GCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGCTCGGGGCGATA
++
+@CCFDDDFFGFFCFFBGHHIIG8CGDDGADDGB>BGG@HGIIGB:<AD3=;>>>;C;@CC:5>CC@?77@;>4>:>>9A:<<&5?################
+@ERR884056.1049088
+GCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATTTTTTTAAAAGTA
++
+BCCFFFBFHHHDHIFGGBEHGHIJJJGGHHGFEGEAHHGFHEFBED7;>;;AEDCCDDA@;(<?CC@CBCDD#############################
+@ERR884056.1059483
+CAAGACAAACATCCCTTCCCAGGGCAGCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCACCAGCGCGG
++
+@@BFFFFFHHGHHJJJGIIJIIIIHIIJJJJJJJJJIIIIHIFGHIIHHBBBEDBC>BBBDBDAC@C@>;B@BDCDDCDDB5>9<+8ABBB?#########
+@ERR884056.1074224
+TGCGATGAGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGCACGGTGCGGCGCGAGGGCAG
++
+@CCFDFFFHGGHDHGGIFGHHGGHHGH>FFHGIIJGJFDCGGGEGIECEEA;BE>B;5?@=8=?CDDDEAACCAC9-<B@&5>@>+859-5>BDBB#####
+@ERR884056.1076153
+GTACGGTGCGGCGCGAGGTCAGACGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCCTGTCTCT
++
+@@CFFFDDDHHHHJJAGI.?CGIHGGHFDBCEECEDDD@CDDDDBDBDDDC>9?B7:BD@;B<A>CC@>?C:::4>@ACCBBDDDCCDDCDA:::<@C34>
+@ERR884056.1082604
+ATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACA
++
+@@CDBDDEHHGFFHEHHGDEHIFD<FG?:<DCHAFEDG*097/?;?3;:>5;32(??BCC3@C@@CCCC:>A&&&02::@4:@##################
+@ERR884056.1082860
+GTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGG
++
+C@CFFFFFHHHHHJJJJIJIIJJJJIHJJIGHHHGIGEBGEHHHHHFFDD=ACCCCCC@;?@@?CD>BDDDDBB&5<<@:3>CDCCDDDCDB><?######
+@ERR884056.1084963
+AGATTAAACTGTCCGTTGCCCCCGTTCAGCCAGGCATGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAAC
++
+CCCFFFFFHHHHHJJJJJJJJJJJIIJIJJIJJGIHHIHIJJHII@FHIGHGIJIIJJJJIHCCHHDCCCFCEEEEDEEAC@C:;>@C@?BB;9@<><CC?
+@ERR884056.1087956
+CATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAACACTCGGTCGTGACTAT
++
+?;?DBDDDAB@<C+<???C?HH;CA:CH9:?*9DDDH;9BFHBG@GH8B(-'5=':<AA/?>;AA@'3&039>@>>>@>A#####################
+@ERR884056.1090194
+GCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGGGGGGGGGGGGG
++
+@CCFFFFFDHFFFIGIFGAEHIIJGIJJJJJJJJ>GHGII;F@EA:?EHCBD@CCEEE>AEC@>>C@;?@6;@B9>@?:+388<B################
+@ERR884056.1091687
+TGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGGCTGT
++
+@@BDDFFFHHHHHJJIJGIJJJJIJIFHIIIJJJJJIJJIJJIIIJHDFEDGFHEHGIIIEFHHHGFFEFFDECDDDBDDDBCDDDDDACCDC3:>((9?<
+@ERR884056.1098192
+CCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCGGCATTGGCGGCGATCTTCTTTTTTGG
++
+@@@DDDDBFHH?FHI:FFIAGEH1DFFH@EAHED<C3;AC(;.(>;5?@A55(:<@@BCB3:@C?3>@A:>?#############################
+@ERR884056.1104695
+CCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGGTCATTGAAGTAGGAACCCAATCAATGCCCGCCTGATATTGTTCCACCACGGCCAACA
++
+BCCFFFFFHHHHHIIHGIHHIIJIJJJJJIJJJJJJGJIIBFHIAAGGGIICEEEHHFD?DDD=@CC;;;;5?B@BB<3+:@CDC>AC::<?A?#######
+@ERR884056.1110557
+TCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGT
++
+@CCFDFFFHHHHHJJJJJEGIIJJJJJJIIIJHFHDGHIJJJJIJFGIJIGGEIIIIGGHHHHFFFB=A@CCDC>AAAA59@CA5:@ACA:<B>5<BBBB<
+@ERR884056.1110926
+CTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAACGAATCCCAGCGCCAGCGCCCCCCCCACAAA
++
+@CBDFFFFHHHHHIIJJIJHIIIJJIIJJJJJIJJJIIHJAEHGFFDDDCC?DDBBBDCDDDDCD@>2>@3+2<8<AC#######################
+@ERR884056.1111193
+CAGGCATGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTACCTTTACTCATATCGCTGGCAAACAG
++
+CCCFFFFFHHHHHJIHHIGHIJIFHHIGJJJHHJJGHHIJJJGIJIJJCDDGHHHFHIGCGCFGHHDDD@CE>;A?;;>CAA:A::3;58<899?9@+8<A
+@ERR884056.1114707
+GAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGCATAGGCGAGAAACTGTC
++
+BBBFFFFFGHHHFHGHIICHFBFHHHGHGDHIIEGGEGEDBFDDFHIB;@GEAADEHHFH;;BB>@;@A@=AC@='8=@BB95&00<A:(5<9@3A#####
+@ERR884056.1121258
+CGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCT
++
+CCCFDDFFHHHHHIEHHIJIJJHIGIIJJJJJJJJJJJJHHFEFFDDEDD@DDBCDEDEEFDDDDDDDBDBDB@5>B?CD>CDCC>@CA:A@B@>9@B@<3
+@ERR884056.1132704
+GGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGTAATGCTGCAAATACCGATCTG
++
+@@=BDFFBFFFFHFFHIIGHGH:BFHEFHFGD=BG;.8/=@F4=CA469/7?A>A(6>C-;;9;558((,:;BBBB#########################
+@ERR884056.1135197
+CCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACCCGGATTATTGGGTG
++
+=?@D=:DAFHDFFGAABFHFA@ABH8E67@;@F=A'5A1;;?;B@;.66;@;;?,>?6;83:3:8B70&2;-22<::>>3AAC##################
+@ERR884056.1160367
+GCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATCTGTCTCTTATACACATCTCCGCGCCCACG
++
+@@CFFFFFHHHHHIIIFGIECHIGGC@AFGF@@C;BBB8=CGHH=@EBEB;>88?>C33:C><83:>:@@>A::>CDDC######################
+@ERR884056.1173946
+GCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTG
++
+@@@DBDEDDDHHHIBB<FEIIJGEGIIFHFF@=FEHBEGFGIIGHGGGEH>BBACEED@@CCDD;@A@@<<B@>CCBB9B<>BB#################
+@ERR884056.1177620
+ATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTAT
++
+BCCFFFFFHHHHHJJJJJJIJJJBFGIJIJJJGHHHHHFFC@DDDDDDDDDDDDDDDBDDDABDDDDDBBDD@CDDDEEEDDBDBBDBBD@B>992(:CC:
+@ERR884056.1187274
+AATACGATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGGTCATTGAAGTAGGAACCCAATCAATGCCCGCCTGATATT
++
+@@@FFFBDHHHDDHIEHIJGIID6BGHFGHIHHHIIIIIEIJGDGAED'3=9;>BDDEDC@BB7>CAAAAC:>CA@AB(0<8<?>::>>@###########
+@ERR884056.1206654
+ATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAAAGAATCCCCGCGCCAGCGCCCCCGCCCCAAAACGGCCGGTCTTCAGCACCCGCTTATAGCT
++
+@@CDFFDFHHGHHGIGGGICGDFHEHGIIIIIHEGG#################################################################
+@ERR884056.1209816
+AGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGCCAGACGCGCA
++
+CCCFFFFEHHHHHIHGGHIJEHIHGGIHJFF>HHGFHIIAHIIE;;8==;??>CDBDDDDCEDD@C@CBB@BB8ABDD?AB@###################
+@ERR884056.1214769
+GTCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGAGTTTAATAAAAGCACAGCTAACGAGAAAGCGAT
++
+BC@FFFFDHHHHHIIJJJGIIIIJGHGIHIHHHGGHIIIJDGHIHFGGGHBGGFG@EGHIJJGF<AA8?>CCDDDE5>5@ACD9<ACCCC@D9>@?C<@B8
+@ERR884056.1218607
+GAATCATATCGTTGCCGATATAGGTTGAAAATTCGTAAAGCACCAGACAGAGAGGGAAAAGTAACGCCTGACGTCCAAGCCTGGCACCGGAAGCTAATTTT
++
+CCCFFFFFHHHHGHHGICGGIHHIHIG?FCGHHIJJBGBD@DG?DGGGF;BFFGGFAGFEE=A@CBDDB=?C@;=,85:5,:<(8A@@@&95&2:A<@C##
+@ERR884056.1224451
+CGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTG
++
+@C@FFFFFGHGHHJJGIIJJHBGIJIIJIFFGIHFFFHFA::ADBDBCFF?DEEDDEEDD;>=BCC@>ACCDDDBDD>:<<&00<A84?>>-(+83>AB?9
+@ERR884056.1229094
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGCCCACCGGG
++
+@CCFFFFDHDH:CFHHIGIJGGFGHCGHCGIIGGIJJGGHEHGGHIIAHGGCAHHEABDD'>(5?;>@@8(4>::>C:4@ACA?<&0<@############
+@ERR884056.1230429
+AGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGCCGCGCT
++
+BC@FFFFFHHHHHJJJJIIGIIIIGIIIJHIIHJF=FHHGH@FCCHHHFFD;AC?BBCC@CDADCCAA;9)9@8??<>9?@B90&)09990<A<:(5<B##
+@ERR884056.1243527
+CCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATA
++
+BBCDDFFFHHHHGIIIHAFHHIJIGIJGJJIIJIJGEF=CFCDFDEC@C>>;;A@CDDBD=A3:>;;@7ABBB?-@@A>>CC###################
+@ERR884056.1246840
+TGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGACATATTGTGG
++
+@?@FFFFAFHFFHJJGHIJCHHJJJIHGEBBFFHAFECGHIEDHFEHJGIEGBHDDD1?8988/<,;@CCC>ACDC>4>A8>44>@C##############
+@ERR884056.1247185
+CCTGACGCCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCCATTTCTTCGCCAATAATAATCGCGCAGACTTTAATAAAAGCACAGCTAACGAGAA
++
+::;?AA))<0<CABC92<8<CCCA?D0@??<?0*9B?D9?88BB).8=.8@@;@C@;?>A#########################################
+@ERR884056.1248377
+GATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACCGCCTCTTCCAAGGATT
++
+:?;DDDD;CC?F@FGG6FFHFGAFGGAD@CDACCBBB>??C@CCAA/;@:8728AB058?>>>>8;88)02:CAC44+>A#####################
+@ERR884056.1250427
+ATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGACGCGCTAACAGCAAGTTCTGTCTCTTATACACATCTCCGAC
++
+<@@FDFFFHHHDHEH+CGHIIIHIIIIEIIG>FHGGBB@CC@@=@EFFCB?=@BB69:A@C<@BBB559@CB?<AC:4:@>@CA::A4+4:@@:43>49B#
+@ERR884056.1254124
+AAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCTGTCTCTTA
++
+BB@DBDFFHDHHHJEFHIJIGIJJJIGGFGFGHIJICHHGFGHIDDHEECB;?BEAECCACCCCCCCCA5:?ADDD@CCABC?1++8@B@###########
+@ERR884056.1256714
+CCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATGATAAACCACACCACCCCCGCCAGCATCACCGC
++
+BBCDDFFFHHHFGJIIIJJHHICGHGGHEBHFHGEGFHHGGHFHFABCB==@DHDFGG@DECHCECCFFFFBACCCCDD@5=A<@DDDDBDB<94:A####
+@ERR884056.1256943
+GTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTG
++
+CBBFFFFFHHHHHIHHGIIHIGHHIGIIIIJIJJHDFIJHDFHFHBCFHBBCHGHJGDGD?EHHE?CED>C?>ADDBB@AB;3;;43>>CB>9B9@?CC>:
+@ERR884056.1258361
+ACTATAAGCTGGTGCTGAAGAACGGCAGCTTTGTGGCGGGGGGGGGTGGGGGTGGGGGTGGGATTTTCACCGTGCTGCGGGGGTTCGACGGGCTGTCACAT
++
+?;?BDDADDDCDA::C9E<C+A?<@C)1::???BB##################################################################
+@ERR884056.1272125
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTG
++
+B@CFFFFFHHDHGIJIIGIHHEGGIFIIGHGIJGIIJJDIIHGEGHGIGGEEAEAAEDB?B6;?@@BD#################################
+@ERR884056.1273831
+GGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTTTTGCAAAGGCCTTTTTTTTGGGGGGTTAATT
++
+@@@DDDDDFF?FFIE?ADFFF8)0B)??B@@DDFFEFFFBB=<>>AB>;(5;;=?>>;@ADAA53:??@################################
+@ERR884056.1298180
+TATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATACGCCTCTGTTTCATTGTCGCTGTGG
++
+;:?DDDDDHH?FCFGHI>FDGE@GIB>:?FHE1CDFGGFFD><BF39??4?=BFF=8C:FGH=BAEHBD>@##############################
+@ERR884056.1301560
+CGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACCGTTGCCGCAGCAGCGACCAACAGACCAA
++
+C@BFFFFFHHDHHJJJJIGJIJJJJJIJJJIIHIGIJJJIGFFFEDEECECCDDDB@DDDDDBD@CC:@CACCBDB@B>9<BD@?BBDB>BBABDBA?BD<
+@ERR884056.1305951
+AACGAATCCCAGCGCCAGCGCCCCCGCCACAAAGCGTCCGTTCTTCAGCACCAGCTTATAGTCACGACCTGTCTCTTATACACCTCTCCTAGCCCACGAGC
++
+@@@DDDDAFFC??@FFE8FFGGGGH0DFHIEHG=@@-;=B(7@ACCE;C9??@(<AC@::5>ACC3?@B>C:>C###########################
+@ERR884056.1306815
+GTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTG
++
+@BBFDFFFHHHHHJJGGGHGFFGH<CDFH@EHIGGIE@))8?BF9BG48BFHIEGGHGFHGGGHEH8?7@;?C;>ABDCC@@5:CACAC@AC>;::95990
+@ERR884056.1307458
+GGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGCTTTGTTTGCCGCCTTGGCGGCGA
++
+?<?BDDDDHHHBFF>EGBAAF><EG9*:CFA:?;BFHG'5B<;8288(,((55,:>AC<ABC#######################################
+@ERR884056.1308086
+TACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATA
++
+BCCDFFFFHHHHGJIEHHHIJJJJJJHJJHJIIJHHFFFEEECEEEDDDDBBDBD@B@ABDDDDDD?????BDDDCCACC>CC<9@BDABB-5095?>CC:
+@ERR884056.1313228
+AGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTTGTGCAGAACGAAAAAGGAGATCGCTGCCAACGCG
++
+@@@DDDDDHHH?FHIGEHIGGGF?GHII?DFH?DDBFDGHGHGGF4==BD9,98:(5:52:9AA#####################################
+@ERR884056.1324474
+CTGCCAATGCGGCAAACAAGACAAACATCCCTTCCCAGGGCAGCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACG
++
+BCCFFFFFHGHHGIIGHIIIJIIIJJIJIIIJJIJJJJIHHIGHIJJIJJIJHGHHGFFDDB@@BDBDB??@05<<BBBCCCA5<3952<@::::<@####
+@ERR884056.1324910
+GTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTTTTGCAAGAGCCTATTTTTCGGGGGGTAATTTTGGGTGACATGCTTT
++
+@@@DDDDDFH?BDGABEEHAAH8CDD6@FFHGHA78CGCGEAECHFHGH?;?BE###############################################
+@ERR884056.1329269
+ATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGGTTGGGTTCCTACTTCAATGACCGCATATCGGGCGGGCGGGATGGTTTTACAATGGCTCCCGGG
++
+@@@ADDBDDFCDACBAEFGGIGHGGF:?GIIG6'=A73;?;AC;1,5>@####################################################
+@ERR884056.1330530
+TGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACCGCCTCTTCGAAGGA
++
+@CCAFFADHBFFFDFBDHGGIIIGIIIHIIIICHIIHBE>AB=@CAC9;@;=77ABBDDBB?C@A>>B@>0;<:4>ACCC:AC>:+299@BBCDC?A??B1
+@ERR884056.1332784
+CTCGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCG
++
+@C@FDDDFHDFFFGIIIIDHIJJIGGHIJJJIIJIHGIJIJJFIIG@FHIIGHGIGHFGFHHG;@CB.;@C@ACED>B>8/8A(:,2?C@?>C########
+@ERR884056.1334838
+GGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGGGGTGTGGGTTATTATTACCCGTCTGGCACTATTAACAGGCCAA
++
+?@@FFFFDDFHHHIJEHEEFFD?DH?BHI9B/*'-5'-;:-95=5>@9CCA===@BBBDD#########################################
+@ERR884056.1342828
+GCTATGAATATGGCTTTCTGCAAGTGGCTATTTTTGGGGCGGTAATTGCGGGGAACTTGCTGTTAGCGCGTCTGACCTGTCTTTTATACACATCTCCCAGC
++
+@@@DDDDDFFFFFIGI++33+3A:3A<A?<AFHG9):DF##############################################################
+@ERR884056.1345433
+TTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTACAAAGATAACCATCAGCGACAGCCACAAAATTCCTTTGACAAGTTTAAACAGTTTAAT
++
+@@@FFFFAHFDHDHIB@@GHIIGIIC??:CGH0:??F@DDD############################################################
+@ERR884056.1347621
+GGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGAGCGCCGGGTTAAATATTTATGCTTTCTGCAATAGTCTGGCGAATCCGCGAC
++
+=?1A?D<DD:<3<<@H:BDD?FHD40?B?**(06@AAABHED###########################################################
+@ERR884056.1363636
+CACCAGATTGACGACCATCACCATTAATTCGAGAATGCCTGATCGCACAAAGCAATCAGGCATTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCC
++
+CCCFFFFFHFHHHIHHGIJIJJGGIJJJIJJGIGGIJJIJJJJJJIIJJJJJFHCHGEGIHHHGGBBCDDDCDC>C<?@DBC:@>ACD>:>AC3>:>(:@#
+@ERR884056.1365050
+TCCCTTCCCAGGGCAGCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATA
++
+@@@FFFFFHHFHHIJJJJJJIJJIJJJJJEIGEHGIJJIIIIJHHFEDDDAACDDDDDBDDBDDDDC45>9BBB<ABDD@?0>ACCDDD<55?CDACACC:
+@ERR884056.1369900
+CTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCTCTACTTGGT
++
+CCCDFFFFHHHGHJJJIIIJJJJJJJJJJJIIJGGGGHHDGH=BDABCC@>AACDCDCD@BD@BBBCDDDDDB@<?ABB@@BB>ACC@CDDCA@ACEDC##
+@ERR884056.1385126
+ATCAATGCCCGCCTGATATTGTTCCACCACGGCCAACATACCGGGTTGAATCATCTCGTACGCGTTCTTCCGTTTGAATAAAAAATGCAACACACCGAGGG
++
+@@@DDDDDBFFFF@EB:EHFH92C<9C):?FGEGFFGDCFIIIIIBFB=@@?7=.=EDD##########################################
+@ERR884056.1387895
+CCAGACAGAGAGGGAAAAGTAACGCCTGACGTCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGAGTT
++
+@CCFFFDFHHHHHJJIJFIHHIHIIIJJIHIJJJIJJJEIIHIGHIJIH;AEHFFFFF>DD@CCEEEE>@5>CCDEDDB;3<=9A@AD(4@<?BDDD####
+@ERR884056.1388318
+GGTCAGACGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGA
++
+@@@DDDF?DHHHHGIEHGJJJJIJIIJJJJIJIJIIJIJH;BEF<>BCD>A>@BCCACDCA?<CB?CDCDDDDE@>:>>3:4>@#################
+@ERR884056.1398665
+AAAACATCCCGCCCGCCAGATATGCGGTCATTGAAGTAGGAACCCAATCAATGCCCGCCTGATATTGTTCCACCACGGCCAACATACCGGGTAGAATCATA
++
+1=@A?2ABBHHFFGIFG@CH9DBD>@A)86?D?B???BB==FH@F?6=C@@CA3=EBBC/6@@3>3>5>C(5@B<<BB@B08<<<:@##############
+@ERR884056.1406178
+TCGCCGCAGAAACCGTACCTTTACTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAAC
++
+@@@FDFDDHHHHHIJFHIJIGHIEIJJJJJHEGIGJJIJ@GHIGE=BCCHGHHHFFFB@C@;;,;=3(,;?BD28??<:>C>59<0993+4(4>CCC>:>C
+@ERR884056.1413487
+GGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGAGAAGATAAAGCACACCACCCCCGCCAGC
++
+@@=?:BBBDDD?;C+A?@E@;?E<FBB?9CDBBFCB300?B*99**9898;@FEH@ECG>CC#######################################
+@ERR884056.1422703
+GCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACACACCATGCCTGCAACCGC
++
+@??DBDDDFFFFFEB@A+AFF>F+<+ACGI?DEFDDB8BFB@GF?BFE>E<;@F>@DAE8-;?BDD@CAB###############################
+@ERR884056.1427125
+GCCTATACGCGTGGCGGTTTCAGGCATGGCTTGTTGCAGACCGAAAAAGGAGAACGCTGCCAAAGCGGGAAACAAAACAAAAAACCCTTTCCCGGGGCACA
++
+@<@DDDDDFDHFHIGGGHHG9BBHFGECF?FA#####################################################################
+@ERR884056.1427854
+GTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCTG
++
+??@DD:BDFCFHCGE@CAFBAGIFCHEDHDHABBC;F;@;59BEFFEAC@AC>;@'8;8<B5@B>:+4@CCC4:444(:<&990>4>>CCA?:50<>CA##
+@ERR884056.1428431
+AGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGG
++
+CCCFFFFFHHHHHIJJJHJJJJJJHIJJJJJJJJJJJJJJGIIHHHGHHEB?CFFDBABDDBCBDCDDCCCCDDA?:>CCC@C9?@5@>BBDBDCC?(25@
+@ERR884056.1430661
+AAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCAGAAGAATGGCCGCTTTGTGGCAGGGGTGCGCGCG
++
+@@@FFFFF?@FDHIGIJJGGGDEGGHCH@=)>FG@HHI@>EIHEH1-99>=A;@5>CDCC#########################################
+@ERR884056.1443357
+CTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGGGGGGTGGGTTTTTAATACCCTGTTGGCCACATTTTTTGCGCAAAA
++
+B@CFDFFDHGAHHJIFHIJFGIJEEHGFGBBF<CFBEAE>9??CCAC######################################################
+@ERR884056.1449623
+AGGTCAGACGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATG
++
+@@@DDDEFHHDHHIJJJJIIJJJGGIGIIHIJFIGIFIGIJJHGFFCCDDDCDDDDDCDDDDBCDDDDDCDEEEDEDDCCCDACACDDDDC@@########
+@ERR884056.1450187
+AACCGTACCTTTACTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCA
++
+BCCDFDDFHFHHFIIIHFHJJGHJJJJJJIJIJJJGHIJJHGHHHIJIBCGEGHEHHHHBEF?CDBC2>A?;?;@B9>3:@@:@:A>@>4>C#########
+@ERR884056.1461496
+ATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGGATGCTGCAAGTGCTGACCTTCGCGGTGGCA
++
+?@@?DDDDDDFH2CAEG=F;GGGBBDDGGE9D4?BFEE@@=FC@;FCHG>C48BA??;);;A#######################################
+@ERR884056.1477458
+AAGTAACGCCTGACGTCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGAGTTTAATAAAAGCACAGCT
++
+BBCDDDFFHHHGHGHCGGGIJGGHIGIJEHHGHGIIIGBFHGIJIJGIEHCHGGDECEHH?CHFFFACA>>;CDDBBBDB<0<:34>CC:>:(+89<<?A#
+@ERR884056.1480300
+GGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGGAAGGGCCTTTTTTCTGGGGGGTATATGGGGGG
++
+@CBDFFFFFFGDHIHIJFHIIJHGIHIJIHDHGIJJGIHGDBEBBE@ACA@CCADDDDDECDCA#####################################
+@ERR884056.1483059
+GAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGGGATGATAAACCACACCACCCCCGCCAGCATCACCGGACGGCGACCAATACGATCC
++
+@CCFFFEEHBHFDFGFBFHIICCF?GHIIII9<*??DDGCHIEGH)7@:C8C<B8=@FGGHGIFHHFFABB##############################
+@ERR884056.1483684
+GTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTTCTGCAAGTGGCTATTTTCGGGGGGTTTAATGCGTGGCACTTGTTGT
++
+@=@DDDDDDFAFDBAF9CFCCHHIGIJJEFF/88CECHHGEG?C9C=?EDDDED###############################################
+@ERR884056.1488198
+CCATTAATTCGAGAATGCCTGATCGCACAAAGCAATCAGGCATTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTAAAAAGATAACCATCAC
++
+@@@DDDBDH:CFHHGGGIIGICEFHGGDECFHDHHDGGGDBHGG000<@6@=CGCGGH?EED:@B>7;..6;@@ACCC@;>BC3,5>A@@?##########
+@ERR884056.1490832
+AGTAACGCCTGACGTCCAAGCCTGGCACCGGAAGCTAATTTATTGTGCATGAAATTGCTTCGCGATTAATAATCGGCAGGATTTTAATAAAGCACGAGCTA
++
+:?+=A:B0@DDDBEIAEIF>FABE9;C>D@D?@?BD>?<B#############################################################
+@ERR884056.1499945
+GATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATTTTTAGCGTTGGTATTGAAGTACGAAAC
++
+@?@DDDDDCDFFAG;?FGC=:)+CGEGIF<41:?FFF@:BBF?B?########################################################
+@ERR884056.1503123
+CTTCAACCTTGTCAACGGAATGTTGTGGCTGCCGCTGATGGTCATCTTTTTAAAAGATACACAGATGAGAAATTCTCACGAAGGGTAAAACATTGCCTTAT
++
+??8B;?DBDDDAD:CE?@CDF+2<9<F1?########################################################################
+@ERR884056.1503335
+CTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGACTGTCTCTTAT
++
+BC@FFFFFGHHHHIIJGHHJJJIJIJHIJIJIGHIJEHIIIIHIFIEIJI@GHIIEHGIGHHF;@B?:@AA@CEEDECC-;;:88=C?<?<88:CCDDDC>
+@ERR884056.1504718
+CATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGCACTCGGTCGCGACTAA
++
+??<ADDDDDD:)+<<4<?<CAE><E))11??@BDD;??B*?B@8?BCCD8-;A8A4/,,9?:;5>???>;AA>4A##########################
+@ERR884056.1508304
+CGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTTTTATTGGGTCGTTG
++
+B@@FFDFFHGHHHE@GGIEGIIIJJJIIIJGGGIIJIJJHGI<AB>B@B@BD??:CC<@;<@7CC>@C::@CABDDBBD######################
+@ERR884056.1516945
+CCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGC
++
+@@@DFDFBDDA:<CFHIEFHG@CHHGHD=DCHGDFHHFFD?AB?A9?B@C-:<CCC>:A?>@CBBB@BCCCABBB5<8<>C@@:+:3&58-59>@CA<<?A
+@ERR884056.1519482
+ACACCACCCCCGCCAGCATCACCGGACGGCGACCAATACGATCCGACAGCGGCCCCAGGAGCCCTGTCTCTTATACACATCTCCGAGCTCACCGGACTAAG
++
+;?@DABB?@CFAHHIII>DFHGIIIDDGGGDDFAABC@CB?95???BBB####################################################
+@ERR884056.1523716
+GCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGAGTTTAATAAAAGCACAGCAAACGAGAAAGCGAATTTTGA
++
+@@CFDFFBDD@DAFFHFBGH@BEGE9CFFFHG<DEBHGFG9*8DEFDDEGB848CHH;;ABD?######################################
+@ERR884056.1524408
+GTTGAGCAGCTATGAATATGGCTTTCTGCAAGTGCCTATTTTCGGGGGGGTAATTTCGGGTAACTTGCTGTTTGCGCGTCTGACCTCGCGCCCCACCGTAC
++
+@@@DDFFFDGHFHGGIGHIIJFGI9+++++2+:F@?:9?DDG*):@G######################################################
+@ERR884056.1531763
+TCTGTTTATCTTTTAAAAAGATAACCATCAGCGACAGCCACAAAATTCCGTTGACAAGGTTGAAGAGCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
++
+@BBDFFFFHFFHHJIJHHIJIHIHHIIIGHIIIGHHGIHJHHIDDHGIJG>C;@FH8=6@CCE?CEHEEFF>B>CC>>AC(555--558?:=B28?#####
+@ERR884056.1533035
+GTTGAAGAGATTAAACTGTCCGTTGCCCCCGTTCAGCCAGGCATGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCG
++
+@@CFFFFFGGHHHJJJIIHJJJIIJJIHIJJHHIGDGHGIIJJIJJJIIIGIIHGIIIIJIGGHHGF>?BEC>;@;A>>A>>@@@C>@ACCA#########
+@ERR884056.1534978
+ACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATGATAAACCACACCACCCCCGCCAGCATCACCGGACGGCGACCCATACGA
++
+@@CDDFBDBFHHBFHGGHHGHJHGHGHIJGIDGHGIHJJIHIEGGGAD?DFGHHIDFGHGIHIBEHDE-:9>B>@BBDCCCDDBBDB<9-5<<&)89?C<0
+@ERR884056.1540709
+GCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGGTCATTAAAGTAGGAACCCAATCAATGCCCGCCTGATATTGTTCCACCACGGCCACA
++
+???DD=21CBDB3<?+AEE<A<@82<A:C1?DD@DDD@=CEECAA55;@C7.=A..;7?@6;>?>?###################################
+@ERR884056.1545724
+ACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAACGAATCCCAGCCCCAGCGCCCCCCCCACAAAGCGGCCG
++
+CCCFFFFFHHHHDHIJJIJJJJIIGHBGIJJJIFFHHIEHFDFFDCDBBDCDDDDDDD?&23@######################################
+@ERR884056.1546375
+GTGCGGCGCGAGGTCAGACGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTC
++
+@:<DDF@DHFFFHDDGBH@0@FBHG=EHHDDD@.6>;A@?@DDDC@CDD<7@DBDDB@CAC:ACB?@A>@:@<33<??:>CCDE>CCCC:?>4((3:?C@>
+@ERR884056.1552045
+GAGGTCAGACGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCCCGCCGGTAAT
++
+@@CFDEFFHHHGGHEHHGIIJJIJBDIIIIHIJIHGIJJ@GIJHFFDDBA>A@C@ACCCCDCCDDCB<<>>ACCCCDDDDAA3::A?CD@###########
+@ERR884056.1563582
+GTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCCCTACTTCGTCC
++
+?@@DD<ADAFFD<D<GEGAFCG@FHII@FFDFHGGIHIIH:=B=??DFE96>;;>?=;?/3,&5@A###################################
+@ERR884056.1564935
+ATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCA
++
+@@@FDDFEHHFHHEH8@FGIGGGACFGHJIIII?DDDEGBDHHIIIGIIGAFBGHGEEHHHC<,9;@3;5>>:559>@@>>A8+2<<<(<9@B>>@A@###
+@ERR884056.1576701
+TTCTTCAGCACCAGCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCAGGGCTTTTTGTGAACCGAAACA
++
+@@@BDDBD?FHF?FGEGGHGGGHFHHIIIIHGG;DHIII@FBFCHGECBBFCCHIGG47??>DCA;>B@B@B@@B##########################
+@ERR884056.1577636
+ATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAACGAAACCCAGCCCCCGCGCCCCC
++
+@@CFFFFFHHHHHJJGIJIIIHIIIIJCFHIIHGHGIJJHEFAHG@BHFB?BA;@BBCDD@B?:@CCCD:<CD><A@########################
+@ERR884056.1582361
+ATCCACGCCAGCAATGGCAGGCTAACGAATCCCAGGGCCACCGCCCCCGCCACAAAGCGGCCGTTCTTTCCACCCAGCTTTTACTCCCGACGCGGTCGTTT
++
+@@CFBDD<FADHHIHGGHEHE)31?*1?B3)*?<*)0/7?(.75;ABE999>B################################################
+@ERR884056.1583891
+TTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTG
++
+??@DDDD?DDHHHIIEHIIIFGHIGGEBDEBF@FHIIFEF9=FE;@B<:B>>B>C3;@3,>5:>A@B8@;5@?1>:4@:(4::>C@@AA?###########
+@ERR884056.1595077
+CACCAGTCCCGCATTCGCCAGACCAATGCCGCAAGCATAAATACTTAACCCGGCGGTCATCCATAACTACGCTTCCAACAAGATAACCCTTACCGCCGCAG
++
+@<@BDAD?D?FH>HGGG>HFG>EB)?3CBBF)?@0?FHHDH8@FDFF8C)6@89A:?;7C:::(4@###################################
+@ERR884056.1608906
+CGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAAT
++
+@BBDFFFFHFFFHHIJIJIJIJIHIJHHGIHGCFIJIJGHH?FFGGIIIAFGA(==FHBA=.==@C@DDEE@CC3.;3;;69?##################
+@ERR884056.1609073
+ATCCACGCCAGCAATGGCAGGCTAACGAATCCCAGCGCCAGCGCCCCCGCCACAAAACGGCCGTTCTTCACCACCAGCTTATAGTCACGACGCGGTTCTTT
++
+@@?DDDDDHHHHHIIIIIIIH181?:?1CDBFE<B;:A@;6(;AHH8?9?###################################################
+@ERR884056.1609281
+CGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGT
++
+@@@DFFFDHHHDFIJJJJGGEIGIJJJJIGIG:BDHFGF>B<FHHFGGII9/8A@@>@A@B?8<A@:@CC>CCACCCC><B@@<ACC@@A###########
+@ERR884056.1622292
+AGGTTGAAGAGATTAAACTGTCCGTTGCCCCCGTTCAGCCAGGCATGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGC
++
+BCCDDFEEFFFHHJIIHIIIIJJIJIIGIJJJIGHIIJJJJJJIFGGIHCGIJG@HFGIB7@DDHGAHHF?CD>;;;;>>CCCC@ACD:><>CC;>:@CB8
+@ERR884056.1624738
+GGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCG
++
+?@<DD@DDFFAF@@CEB1?DF@=HD9F<DHHBDGHIIEABA8DEEHHFAAAHBD7?CAAC=?5;;;=;BB@B@BBCC@C@@C@A(>>A:AC>4+>>@CC@#
+@ERR884056.1627923
+GATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACCGCCTCTTCGAAGGATT
++
+BC@DFDFFHHHHHHHJGIIGHIJIJJIGHE@@GGFHDCDCCCDCDDBBB@;<ABB&5<BDDDC:7@@@53<@C@@CC@@A@CDDDB@09>C>><8A?@###
+@ERR884056.1630893
+TATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTGATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTGTGCTTTCGTCATTGGTC
++
+=+:A=ADDAFADFFFGEFFCFFIFFFCC:?D??D<FEFF<@)8.@;;E/='9?';?B############################################
+@ERR884056.1637785
+GTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGGGGGGGGGGGGGGGTGGGTTGGCTGGACCGTTTTGGGGGGGGTGCCCCCCCCCAGCGCTGATCTCATTT
++
+@@CFFD4BFHHHGIIGE<GIIID##############################################################################
+@ERR884056.1643573
+GGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCCGCAAATGCTGATCTTTACCGTTGGAGTTGAAATCA
++
+??1AAADDFDDHFHCGHIHIIIFIHH8?GHICHD<?:?F?DDA@8B<B<)84A@?8>B@;<?AC#####################################
+@ERR884056.1646141
+GCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCACTTTG
++
+CCCFDFFFHHGFHJJJJJJJHHIJJJJJJJFHIIGIJGG@AEHEHC7?D@BDCECAA@;;@BD1;?8;>?CD>CC>A@C?3<@:CC>>CC?B#########
+@ERR884056.1654192
+CCTATACGCGTGGCGGTTTCAGGCATGGCTTTTTGCAGACCGAAAAAGGAGATCGGTGCCCATGCGGCAAAACAGAAAAACAATCCTTCCCAGGCTCCGCC
++
+@<;BDDDDFA@DF>HI?DD9BFGH2BBFHII3.='./7@==<'59=;;??=@:@###############################################
+@ERR884056.1658355
+CAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGAAAAACAGATGGGAAATTTTCACGAAGGAGAAAA
++
+B@@DFFFFHGFHHIIIGIJFHIIHIFJJJHJGBHHHGHCB?B)?8?)@@DBD@BFHGGIH=CCDGC###################################
+@ERR884056.1658880
+GTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATCCCTGCC
++
+@@CFFFF;CFACDGHIJI@HHIIJHCHIGEHHHDAEDGGB4@A<ECDFFCB9@>@(66@;>@@>@AA(:A8?#############################
+@ERR884056.1667539
+GCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGC
++
+@@@ADDDDDHFHGEEGHFBHGFCEAAEFFGBFBCFEGHEHDFDGEDDGIHFFHJIE;DAE8B=B?@@CCCE>;@;,39>@#####################
+@ERR884056.1670465
+TACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTACCTTCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAAT
++
+B@BFFFFFHFHHGIHJEEGHGIJJJGJJJJHHGHJJIJIJGHIJJGIIIJBCGH?CEHFFCFEFDEEDECECDDDDD>@;@B@BBBDDD>9:(:ACC@DD>
+@ERR884056.1675490
+GTCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGAGTTTAATAAAAGCACAGCTAACGAGAAAGCGAT
++
+@@@FDFFFHGHHFHIIJGHGBFFFHGIJIJJJJJJIEGGCGHIEGGGGHIAFGEHGIGEIIBCH>BABDCDC;@CD@A@CBAC<C?CDCCB@9<BDA+5@#
+@ERR884056.1675603
+TTCTTCAGCACCAGCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTTTTTCAGACCGCAAAA
++
+@C@FFFFFFHHHHIJJHDIIEFHIJJIJJJIJHIEGIHIGHBFEGHGHHHFG@@FHGEHHHEDBCB@BB?09BA3>C98>2<BAA################
+@ERR884056.1679176
+TGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTACTTTTACTCATATCGCTGGCAAACAGGGTTAT
++
+@@CFDFFFGHDHF@FHHEHGE>DGIIHH?EEBFF?FFHG9?DGFHIIGGD?@DDCB<AGIHHAAB@###################################
+@ERR884056.1681951
+GGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTAAGTCTTTAAAAGCTAAACAGATGGGAAACTCTCACGA
++
+?@;ADBD?DHADFBEGEA3C4CHH?<FFHGE>1?FF):0?1B9B/?9?(=<8)5@'-;CEHE;)))7.?>@@6>A##########################
+@ERR884056.1687353
+CATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGGGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACCGCCTCTACGACG
++
+=@@B;2=ACFA:@G)<:)?DFCF;B=D:@@FE#####################################################################
+@ERR884056.1702697
+CTCGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAACTTGCATGCAAAATAAATTAGCTTCAGGTGACAGGCTTGGACGTCAGGGC
++
+@@@DDDDDAHH<FGHGIBAE9CD,<C?EE>E@F<FGGGI>DBC?DG:@/;3)7@A7=?A##########################################
+@ERR884056.1714945
+GGCGCTGGGATTCGTTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGCGCAGTTGGGCGGCTATGAGAATGGCTTGT
++
+@@@FFFFFHDDDDHGGIIIIBGEE?FFIIIIIGJGGG@BFFGFF;6.7AAEABAB@C@AD>>;>CD###################################
+@ERR884056.1716206
+CGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACCGTTGCGGCAGCAGCGACCAACAGACCAA
++
+CC@FFFFFHHGHHJJJJJGHJJJJBHIIGJIIIHFDFHGIHFFDEEEDCACCD@C@BDBDD@<BB@CCCC4>@;??<>-)05922+25)0<0(+22?BAC<
+@ERR884056.1721121
+GCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGCGCTGAAGAACGGCCGCTTTGTGGGGGTGGGGG
++
+?@@F1DDDHHHHHFFHG<CGHGFGGIG@GB>BFHIEHGEGGIA@;6=7?B?;9<@BCBC<5;:CCCC?1099@BA4(9+)5>B<B90?#############
+@ERR884056.1726331
+CTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGCTCACCGCGCTGATGGCGACCGTGGCGCTGATTG
++
+@@@FFFDDHHABFFEGF@FHGBGGGIFGGHGIEHGDFFHCFHAHGHGGCGB?6;<?8;?BADC######################################
+@ERR884056.1728787
+CGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCCGCAAGGGTTATCTCATCGCACGCGTATTTCTGTGTCTCGCT
++
+:?@F=DD<ADAD:?FBEFAB3?@G<FFF@F45(54@)7).=7=@9?C######################################################
+@ERR884056.1730603
+GTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGCTATT
++
+@@CFADDFFDFDHBGIEFHG<DGHICFGE;FHGEG<@FEEDEEAB??@CED@A5;;ACDEDC@DC>CCC5>85?22>@#######################
+@ERR884056.1730754
+CCAGTAATATTGCCAGACAGGTGATGATAAACCACACCACCCCCACCAGCATCACCGGACGGCGACCAATACGATCCGACAGCGGCCCCAGGAGCCATTGA
++
+?@@DDDDDFFFCFFAFFFFGC3A3<FFHIF@ABG1?CFCGGB0@(?D@FFFFICF8@;:4=?:=2)05?@BBBBB?#########################
+@ERR884056.1732986
+GCCCCCGTTCAGCCAGGCATGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACAGTACCTTAACTCATAT
++
+?@@?+=DD>AD?<B+A;<ABECFE9?CD@G<?*?CFADFFI=D?6?;=F)8====@)8;@A@@@=3?77=7)71533>=?#####################
+@ERR884056.1736774
+GTTGAGCAGCTATGAATATGGCTTTGTGCAAATGCCTATTTTCGGGGGGTTTATTTGGGGTAAACTGCTGTTTGCGCGCCTGCCCTCGCCCCGCGCCGTAC
++
+@@CADDFDHFHFHHGGHEDFGHII#############################################################################
+@ERR884056.1739204
+GGACAGTTTAATCTGTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGAA
++
+CCCFFFFFHHHHDHGJJJJGHIIJJJJIIJIGGHIJGIGFG:DGGBDBB@E@BFGC=.8)=@FHH?7@77-7=?@?C3;>@CDE-5;;;@CC:((3?B###
+@ERR884056.1741640
+GCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGTTGCAAGTGCCTATTTTTGGCG
++
+@@@DDDDDBFHHFEHH;GH?8EG??DHDDGEAGEEHIEBC9@C@@>5AAD6??=A5:ACCAA989(4:CDA>AA>8?########################
+@ERR884056.1751543
+CAAAGCGGCCGTTCTTCAGCACCAGCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTTTTGT
++
+@@@DFFFFHGHFH@FFGGHIJJJIGGGIGGGCDGIHEHIJIJGCEHHEF??@7@CC>>>C>5>CBB;:3::>A@559BD@)050(4@A#############
+@ERR884056.1752766
+GACATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAACGAATACCAGCGCCAGCC
++
+@@@DFFFFFFFHHGIJGGIJJIJIJIJFGGIJIFHHJGHHGIHFHA;FGIAA?=;;;3;;B?A?BB<;;<A?AC:?9<><?####################
+@ERR884056.1756976
+CAACAGAGTGAATTGTTCAATGTTTTGCACCAGGAATAATGCCAGACAGGTGAATATAAACGACACCACCCCCGCGAGCATCACCGGCGCCACGCCACTAC
++
++:?D+=DDD>DDD<+<A<F9DDAEEF9+2A#######################################################################
+@ERR884056.1758666
+GCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGGGGGCGGGTGGGGGTGG
++
+CCCFFFFFHHHDHGIIJIIGIIIIIJIJJDGGGHHIBAGHHCABB@==FG@@EDC4?EH)7?DFBAD8''3;?3+3?A#######################
+@ERR884056.1761856
+GCACCAGCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTGTTTCAGACACAAAAAAGAGAAG
++
+@@CDFDDFHHFHFIFHHGHIJJHFHDGIIIJJJGGFCFHII<B4BFFFFHFE==CEHF><8@@3,0+:A3+2:AB?<?#######################
+@ERR884056.1766400
+TCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCGTGAAACCGCCACGCGT
++
+=?@BBDFBDB?DHHIGHG>GIGIGGHICHGFFHIBHECDHH0@86.0=B)(-5-6;DEEEFHC;793(,8?;AC@=?########################
+@ERR884056.1774118
+GTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCA
++
+@@@FADDDHDFFFHGI@FIIGFEGGGDGAGHCBFGGICDHGIEHHH@FHEFGHHIJEGG=:=ECE3?DC:A>ACD5@CC;>>(,8880>CDAD?#######
+@ERR884056.1777973
+GACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGACGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCG
++
+@@@DDDEDDFHHHGIIJIDGGGJ?DG?FBHGIII?GGCHHIII;@;;E7?=4>/3/76B303:?C>5&5-5509:AB?C?#####################
+@ERR884056.1784946
+AACGTACGGTGCGGCGCGAGGTCAGACGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTA
++
+@@@DDDDDFDFDHG@D6@?@;<CGHGAEEBBB/=?CCBCCCCCDC>CBBB-093@A8@B;577)80444::>A?CACCCCAC###################
+@ERR884056.1785764
+GGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCT
++
+BC@DFFFFHFHHHJIIGGHHIJJGGJJIIHGFBFHBGGHFHHHIFHGIIEDEGGCHIJIJF<CHIEED:>>CECB6??CC(5:(5?CC5>CC@C#######
+@ERR884056.1790519
+CCTTTACTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATCCGCCAGACCAATGCCGACAGCATAAATACTTAACCTGGCGGTCATCCATAA
++
+?==BDDDDH?A<CEEBH1FHFHBFHCEE1CDGDDGCDA??FHE??@GHI'7;CCB>6?67=A@>A@B##################################
+@ERR884056.1792383
+CTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGCTGTCTCTTATACACATCTCCG
++
+@@CDDEEFGHFDHGIIHGIJBHIIG@*CGIJJJGGHGGBFHIGHGHIGHHGI@CH=:BB>>BCCCA>,9@C:>ACADB?9>:ACCCD:>@44(+4@CA:C3
+@ERR884056.1794348
+CGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGT
++
+@@@DFFFFHHHHHJIJHIFGHIIIJJHIHHGJCHGJHHIJHJBDG8BBBA?@DDDCDDCCD<?@?AC>:@CDCAAA@CDDDBD?CAAA>C9@#########
+@ERR884056.1795666
+GTTCCACCACGGCCAACATACCGGGTTGAATCATATCGTTGCCGATATAGGTTGAAAATTCGTAAAGCACCAGACAGAGAGGGAAAAGTAACGCCTGACGC
++
+@@@DFFFFBFH6?GGHGGCGIIIIIGGGIHEHIIIIIGIIIIIF4;BEEHGHFFF@BCCEEBC=ABA@#################################
+@ERR884056.1797391
+GTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTTATCGCACGCGTATTTATGGATGAC
++
+@@@FFFEDHFFFDHJEHHCHGGIGHGHAGIGGGGGG=AEE;CE@;?#######################################################
+@ERR884056.1800274
+ACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACCGCCTCTTCGAA
++
+CCCFFFFFHGHHHJJIGIIJJJJGHHIIJBFHI(..?EEEECCDBCCCCCCB;BBBDDDA@DB?8ACCC>9;909?@@C:>CCDCCA:?8>B50&+4>8A8
+@ERR884056.1816332
+CCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAA
++
+@@@DDDDDDCFD3AAEFHIAFHHIIIFHHGIEH@DHIIF?FHIIFG;CFHI@C@EHE:?DEDDCCCCC5=AAA>A:?CCC,8<B99>>@############
+@ERR884056.1818685
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTG
++
+@@@DDFFDHADFHGIJIJIJCEHIJJJGHIIIJ3DFGHGGHGHEHHGGJCEEFEFHHFFEC>A19358;<?CDDCC>>:>A39<55<<<>CC><>@#####
+@ERR884056.1822265
+CCTGACGTCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGAGTTTAATAAACGCACAGCAAACGAGAA
++
+@@CFFFDDHHHDFIIEGHGHJJIGGGGJEDGHC?FGCBBFFG<DGD8BG=9B@GHF;@AECCED;?DDB6;8?:<>@C@::>CC#################
+@ERR884056.1822809
+CCTTTACTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAA
++
+BBCFFFFFHDHFGIJJFGIIJJJJJJJJJJJJJC::B@GHIHJIFFHBHIIJHHDHH??B?:6;>@@BD?:>CDCDCC<@>DAAAB>&&05)5<ACD@3>@
+@ERR884056.1827187
+GGCTAACGAATCCCAGCGCCAGCGCCCCCGCCACAAAGCGGCCGTTCTTCAGCACCAGCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCT
++
+CCCFFFFFGGHHFJJJIJJJGIIJJHGGJIJJIEEGHHHHDACDBDDBDDACDDDDBBDACCDCCB@@@>@B;@B@??>B:>@:>4>>>>@>>>A@@@<BB
+@ERR884056.1828648
+ATATTGTTCCACCACGGCCAACATACCGGGTTGAATCATATCGTATGCCGTCTCCTGCTTGAAAAAGAAAATAACAGCAAAGGAGCAGAGACGGAGAGCAA
++
+81=BDDA:DFCD+A<BF@FD;A8B<::)C??;@FG?*/98BFFC#########################################################
+@ERR884056.1833811
+TCCCAGGGCAGCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCGATCTGCGCGGTGATCTTGATAGAACC
++
+?<?DDDDDDHDBF@HGHGGH>GHGHG???:@?;66@@GHIA:,3?=A;;@C?8385A3:CCAC######################################
+@ERR884056.1841589
+GATTCAACCCGGTATGTTGGCCGTGGTGGGACACTATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTAT
++
+@@@FDFFFHHFH:<EGHBHIIIIEGD1BG)0B?(*09?8BA3'5>:=C>>C>3:?<8?AC@A#######################################
+@ERR884056.1853993
+TTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGC
++
+CCCFFFFFHHGFHJGIIIIJJJJJIJGGIIIIIIFFHIFHGIJJEGGBBEHHCHEFDDD6;ACBD=?B??58099@B844>:4>>>>AC38<@########
+@ERR884056.1856689
+TCGTTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGGTGAGCAGCTATGAATATGGATTTCTCGAAGTCCCT
++
+@C@F=BDDHDHHHGGIDECE9FGGH11?F)CFA009*(0B-';(;;)..=;.=)7;9?<>;:;B?<A::23>9?###########################
+@ERR884056.1857520
+TCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCG
++
+@CCFFDFFGHHHDCFHIJIJIJJJIGIH+CCGHEDDHFAHIH@AFFHGBD=AACBBD=BDDEDCDDCDDD>ACCBC@C@CA>(09??<AC@+230?8?###
+@ERR884056.1864449
+ATTCGAGAATGCCTGATCGCACAAAGCAATCAGGCATTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTAAAAAGATACCCATCAGCGACAC
++
+@CCFFFFFHGHHHJJJJIIJIIDIJJIHEGIHIHIIJIGGHGAFHIGIJIIHHIFH=EHFEFFF?B>CDCEEA;ADCC@C>>:2(:>5(,:AA44@#####
+@ERR884056.1864997
+GTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCACTGTTTTGCGCCAGTAATATTGCCAGACAGGTGA
++
+@@@FFFEFHHFGAGEHIIHHIIJIGHJJJJJDGB9BGGGHGEGGCGHIGHGEHFFFB;C7;BC@ECE(6;>AAABD??=B?4:4:>C@#############
+@ERR884056.1872018
+GATTAAACTGTCCGTTGCCCCCGTTCAGCCAGGCATGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCAATCGCCGCACAAACC
++
+CCCFFFFFHHHHHJJJJJIJJJJHEHHHIJIJI:???BGEHHGF@HGGCHHGFG@G7;;85?;?=3;;??>6@C>AACD<;@A@>(,(55?BB########
+@ERR884056.1882876
+GTCATTGAAGTAGGAACCCAATCAATGCCCGCCTGATATTGTTCCACCACGGCCAACATACCGGGTTGAATCATCTCGTATGCCGTCTTTTGTTTGAAAAA
++
+BB@DFFDDBCA?FGEHGIHJJIJJJJIIEHI<D8DHDFHIEHIJG@HDHHHHIFE=ECAEHHDF@CC:CCC>CC@AC?B@A<>:<<@?8(44+33>@@448
+@ERR884056.1883857
+CCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGACGCGCGAACAGAAAGTTACCCGCAATTAACGCCCCGAA
++
+@CCFDFFFGHHHD<F@DE7CFAEG>GHHFFDB9*0*8?DFH(==;;)6'599?;<BB@###########################################
+@ERR884056.1886263
+GTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTTTGGTTGAC
++
+B@BFFDFFHHAHFHIIJIFHJJJIJJJIJECGH8@GEEHCCEDC@7;;CAE?;;@BBBB@@5?BDB8?05?@5:ACCCDCC####################
+@ERR884056.1887994
+AGGTTGAAGAGATTAAACTGTCCGTTGCCCCCGTTCAGCCAGGCATGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGC
++
+BC@FFFDFFHHDFGGIJIHEEHGIGGIIJHHGIHGHHJJGIFHHGHGIIHCFEHIJJIGIII;=7?=(5'(;?CC@C>5;A>@CAA((5:?@5;;:A++8?
+@ERR884056.1898375
+TGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGGTATCTTTTTAAAAGATAAAAAGT
++
+@C@DFFFBHHGDFGIFHIIGCAHBGGGHECECC=..7AEEFFEDF9C;>C;@A?5;?(:>;<A?5<82><(0;-4>:(933>AC:>@##############
+@ERR884056.1903553
+GTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGA
++
+@=?DDDD>FHDHFGBEE@GG+A<9A?3C@:DFHFFEFHGHGBFG@GBEAB?BDB;@C.;>>@A>=?;@BBCDC3::AC:(>CB0<85@A############
+@ERR884056.1903717
+CTGCTGCGGCAACGGTTATCTCATCGCACGCGTCTTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGGCTGGTG
++
+B@BDFFDFGHFHHJGGF<GHGFGIGHHGGHFHG5;CGGIDHEHHGECBB388888A:@:@CCDEDCC@DD(2&05@@########################
+@ERR884056.1909999
+ATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTATTACTTTTGGCTTTGG
++
+@@@DFFDFHHHCFHIGGGH<AFFGF?@*:CEHEDDHGHCEHFG>@;CG;C=BB>,9?A@##########################################
+@ERR884056.1912061
+GCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGACGCGCTAATAGTAAGTTACCCGCAATTAACGCACCGAAAATAGGCACTTGCGGCA
++
+@<?DFFFFHFHDHGHIGFHHGIJJGCFF@BGHI0FHGD<??'9:A>@8@B9BD5(+3+3:>3>ACC+))0)):4@C?########################
+@ERR884056.1915153
+CCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACCGCCTCTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGC
++
+<@@FDDDDHFH6FBDFHEIIJIIJGIBHIGHIHGGGECGEBAD?DCDCEA@CCDDDC;ABBD=@B3(4<8<29?AAC4@CCDD::35&&)09?<@CC1<AB
+@ERR884056.1918182
+ATTCGAGAATGCCTGATCGCACAAAGCAATCAGGCATTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTAACAAAGATAACCATCAGACACAG
++
+@@@DDDDDHDHDH@3CFAGH:CGBEHEH@BG<?F9GFEGII8F2=3@3=7;@C@(.=).7A;BD77;3;>>;;65;A########################
+@ERR884056.1919854
+GCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACCCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAAGCTC
++
+@@@DDDFFDDFHDGGHHC@GHJHIIGCGGIJHI=8=CGEEEBB9?B55;;-;@@9A(,,>CA@@CCC:>(4>>C+55&59?BDDD<@0:@C##########
+@ERR884056.1921183
+CAGTAATATTGCCAGACAGGTGATGATAAACCACACCACCCCCGCCAGCATCACCGGACGGCGACCAATACGATCCGACAGAGCCCCTCGCACCCATCGTA
++
+?@@FFFFFHHHHFIHGIEECFFBHBFAHBFCGH1:CCCH;@EH0AF85;7=@GH###############################################
+@ERR884056.1927577
+GGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGA
++
+BBBFFFFFHGGHHIJJJIIJJIBFGDHGHIGIJIEHIJJGGCDDGHHHFDFFECCEC66;>BB>ACDCC>CCCC:AC@CA@9><08<?#############
+@ERR884056.1930586
+CGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGAAGTGAAATCAGCAAACTTGCCTGGCTGAAGCGGG
++
+?@;DAAB=CADDFB:AFFEBCGD@<C+@??@07<FF=7CGGGD>@C?E>>7;3;;BBC>@ACC;?####################################
+@ERR884056.1937462
+TCTTGATACAAACCGCCTCTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAATG
++
+?@?DDDEB<CAFAA@@GAGGHFE?FHB@FCFIGGHGGIHD0FFBEHHECCD@DCCDD@??CCDDC@CCCC<?BCDCD(49@829AC99??BBB########
+@ERR884056.1938032
+GCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGC
++
+@@@DDFFAFD3CCE<BDHGIIIEIG<;CGIGIGCGHIDGGGE?FH@BDDGH;;@=C@;(5-;,;BDECE;>C@>5'89(555(59A<93>A@#########
+@ERR884056.1962262
+CGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAAAAATCCGCCAC
++
+?@@A=ABDFHDDDBGIIIIIIIB<AFF?'@8BBF4CFCHEGG/:9<ABB2;>@:@>:>A=??BBCBBB-9(8255&<02<?<><A92:A############
+@ERR884056.1967600
+ATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTGTGCCCTCCTT
++
+B@@DDFFFFHHHFHHIJG6@F?FIGHIGHFGGHHF@GGHGHHDDE?CEE@6;>@@AC@A;>>3=BBDDDBBBDB@##########################
+@ERR884056.1969034
+GCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGTGACTGGCGCG
++
+@@@DDDDDDFFHHIJ8C?GDHHI@GH>@FH'5@FHEECG;DCHHFHEDDDD359@A33>CC>>C@::::?DD@B@C#########################
+@ERR884056.1972738
+GGCGCGAGGTCAGACGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCGCCG
++
+@@@FFFFFGDFFDGHBGGIIJHIIJJJEHFHIJIHIJIHHHFFFF@CDDDBDDDDD@CCCBCCCCDDDDDDDDDDDDE:@CCCC@CCDDDDDDCD@:?@B@
+@ERR884056.1973933
+GAATTTCCCATCTGTTTATCTTTTAAAAAGATAACCATCAGCGACAGCCACAAAATTCCGTTGACAAGGTTGAAGAGATTAAACTGTCCGTTGCCCCCGTC
++
+CCCFFFFFHFHGDHHIJHDHGHAHJIHEGCGHIFFDFGGIEGHGHIJIGDGHDIFFGGAHCCHEEH>??BCD>@BA;>@A>C>CCC>A#############
+@ERR884056.1981194
+TAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGGGGGGCGCGCGGGTGGCGTCGC
++
+CCCFFFFFHHHHHJIJJJJJHHIHGIJJJJIIIJGHHIIHGGGHGHGIGFFHHGII@EFEFEABD?BBA@CBDDD##########################
+@ERR884056.1982067
+GTACGGTGCGGCGCGAGGTCAGACGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCTATATTCATAGCTGCTCAAC
++
+@@<DDFDD?HHADBF@DF6BB;FFGHBABDCE;;A=AC;AD<ACBB8<@CACCB8B5@B<<;->C43:>?CC@:3:AB(9<(>@DDC+4>A>((>?:@C>9
+@ERR884056.1983190
+ATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGGCAA
++
+?@@D1@DD?FHHDHIIEBBGEFHIDDFCGGGGGH@=DGGEEHHEH@BBC>;6>CCB;@BBBBCC#####################################
+@ERR884056.1992836
+CTCGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATCCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGCTGTCGC
++
+@?@DDDDFHHHHHJEHIIGAEHIECHGH@FEED:@;BFHGDH*?FHGI<;==@@4=E;)=C=??CDF@C################################
+@ERR884056.1995347
+TGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTACCTTTACTCATATCGCTGGCAAACAGGGTTAA
++
+CCCFFFFFHHHHFIHAF>FHGHHEECEHGIIIIGHEGGHIJIGGDGHHB???BBFH;;5AE<=ADDD==;ACACACDD35@@:1<<=BB34<<8<?#####
+@ERR884056.2009372
+ATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTTGGGCACGG
++
+@@@DDD8DFFFFFIIAFGII9D1??FFEG?8DFEB<<BFFFFFEFFF8?B(6;@?,3;?5<<7B)5;A@ABAA3&5<9BBA>A@B################
+@ERR884056.2014142
+TTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACAGT
++
+@@@FFFFFHHFHFHDGIGHGGGAFGGGGHGGGEHGAFGGEGGFFABGFHHABCEH;?@DCC>AAECCC;3599<>A:C@@182?ACCC3+::>CDCCC###
+@ERR884056.2027917
+ATACCGGGTTGAATCATATCGTTGCCGATATAGGTTGAAAATTCGTAAAGCACCAGACAGAGAGGGAAAAGTAACGCCTGACGACCAAGCCTGGCACCGGA
++
+???DDDDD0<C?DBEEEBDBE2<?CED0):)99B0B?9?/9..B6BCC68=7@6.?CDA##########################################
+@ERR884056.2042309
+ATCCACGCCAGCAATGGCAGGCGAACGAATCCCAGCGCCACCGCCCCCGCCACAAAGCGGCCGTTCTTCTCTACCAGCGTATAACTCTCTCCTATACACAA
++
+?;;DD:A?CDDDDC:?<E>C@?###############################################################################
+@ERR884056.2051948
+ACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCT
++
+CCCFFFFFFHHGGHCFHIIGIJGIIJJJIJJJ@GGIIIIIHGGHI<=;;?ACE?7@B;;@6;9;8>;C@:3:++8?8<<>>@:4>>:@3>((+)55<8ACA
+@ERR884056.2065465
+GCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTG
++
+BCCFFFFFHHHFHJIJIJJJJJJJJJJJJJIIIJIIIJIIJHFHHGHFFFDFFEEEEEDDDD@@BB;@>BDCDD@CDDCDCCCCDDDC>>?<@BD>B####
+@ERR884056.2066001
+ATACGATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGGTCATTGAAGTAGGAACCCAATCAATGCCCGCCTGATATTG
++
+BBCFFFFFHHFHDIJIJIJJJIHHGJIJJJJJHG@GEHIIJJGHHHA=>>BBDDDDECC;=BDDDEDDDDCCD>ACDBBBACCCDD@9ACB<@@#######
+@ERR884056.2070433
+GCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATGATAAACCACACCACCCCCGCCAGCATCACCGGACGGCGACCAA
++
+@@@FFFFDFFHFHIIII@AHDFHHHEFIIGIJIJIJHHJJJFG@HJGHH?889=FCC==FGGIGGIFHEHFEFDDDDB=28?CAC:C##############
+@ERR884056.2075724
+TCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTTCTGCAAGTGCCTTTTTTCTGGGCCGTAAATGGCGGTGAC
++
+@@@FFFFFHFADDEDAFGIHGHHIGGIGIJFIJGIJHHCHHE?@DDBDCCECEDD>@;ACB########################################
+@ERR884056.2079310
+GTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTG
++
+C@CFFFFFHHHHHBHGFF1CGGGEHIJJIJJJJIIIJGGIGGGHHBFHIGBFHHIIJIJJHHEHHCC@BCBA=A9>ABDDDD>>@::>:@AB@DBB8(+:@
+@ERR884056.2080224
+GTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGG
++
+@?<DDFFFBHHHFGGIIGFGBHIIDDEDGFBBD6<;FGE99?EEHHD>9>9@AACDCC6=@=89A?)()95055)95<>:<:>:4>AC::<?#########
+@ERR884056.2091648
+GGGCAGCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACCGCCC
++
+@;<DDDDDAFDHFIDEFFBEFGIAFGHIHGEDFEG</AE??DBD3>9>?='5<>>ACCB;575028?##################################
+@ERR884056.2094836
+GGGCGATCCACGCCAGCAATGGCAGGCTAAAGAATCCCAGCGCCAGCGCCCCCGCCACAAAGCGGCCGTTCTTCAGCACCAGCTTATAATCACCACCCAGT
++
+B@CFFFFFHHFHHGIHHHGHHJJJGH0)?G*:?D<4DF*0(7@F;/5::<==ABBD8;5<?########################################
+@ERR884056.2100024
+ACGTTTGCCATCAGCGCGGTGATCTTGATACAAACCGCCTCTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCC
++
+CCCFFFFFHHHHHJIJIJJ:CGHIIJIIIJJJJJJIIIJIIHBGHHGD;=EH??BDBE?CDCDDDB;BBAADDBBBA99BDBD@C>AAA?9AB<ACDDCDC
+@ERR884056.2101027
+AGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTTTCTCAAGTGACTTCTTT
++
+CCCFFFFFHHHHGIJJJJJJIAGHFGIGEHEGGGGHGBHHGGIIGACDD@>AE>A'8=?C,:(+:3>??((+4>@@#########################
+@ERR884056.2103308
+GATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGT
++
+@@@FDFFEFHHBDGGD>FHIIGCHIIIGGIIIIIFGGII3BFB9FGHIGHEB>BA>/;;8?>;;A@C:(>A@CD@@29@ACDD>:55?78>::>A<<?A##
+@ERR884056.2103500
+GAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGTTTTACGATTTTTCAACCTATATC
++
+@@@DDBBDHHHHHIIHIIIJICCHGGIEFEACDGHHIIJIJGIEFG?FBEFCFA;@A?E:?E;?@EFE#################################
+@ERR884056.2130157
+ATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGGCGGATCGTATTG
++
+CCCFFFFFHHHADIIIDGGIJJJHGIHDHIJFHIJGGIIIHHFFFEEFE@6;;5<B<:B7?+3:9<AD@AAD><3:<?+9?####################
+@ERR884056.2138937
+GGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATGATAAACCACACCACCCCCGCCAGC
++
+BB@FFFFFHHHHHJIJFHJGGGIJJJJJIIDGHGIIHDGIGIIGFDGGHHHIJGIHIIEGEC?EHHHFFFFDACEED;(->@C;<BA?@<?<@BDB@BB58
+@ERR884056.2143874
+GCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCT
++
+B@BADDFFBCFFHHGGGIJIGIHHFHCFHIBFFBGCGFHD?F?BD???9?B8BBFHGGFGGGICEEGCHEHGF8=<BA@0299?A@C:4>:>4>CC@>A23
+@ERR884056.2147023
+CGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTT
++
+??@DDFFFHDDHFHIJEGIEHIJJFHJJIGHCFF@FGIJJBEGIHGEAHIGII<DEHIIE7=ACDEFB@;;;@C>?/;;?5>@52<?<?4@@B><>9?###
+@ERR884056.2153651
+GGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGGTGTTTTTACACTGGCTCCC
++
+@@?DFFFFHGHHHGEICEFHIHGHIGIGDGHIIJJ<BHEC>BCDFD?B?CDDADDDDDEDDCABDDDD>:BDCDDD9<9<0&5>58?C#############
+@ERR884056.2153707
+GGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTACTGTCTCTTATACACATCTCCGAAGCCCACGAGACTAAGGCGGATCTCGTATGC
++
+BC@FFFFFHHHHHJIJJIG?GGHIGGHGHGGGHGFIF@GEAAEH>;CB@CD@@>AECC>>@CCCDA:@@@B;@BABD>-&))4::>A>0&505:>??8A9>
+@ERR884056.2163307
+CTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGGGCGGGGGCCGGGGGCGGTGGTCTTGCCTCTCTTGCGGTGGCGCGTCCCTCCCGCCTCT
++
+BB@FFFFFFFFFFHHIJJJGHHIJIIJIFGHEFDHHIJF?B############################################################
+@ERR884056.2172067
+GCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTGTTTCAGACCCAAAAAAGGAATCACTGCC
++
+@CBFFFFFHHHHHJIJJEHGIIIJIIIIIJJJJJIHIJJGHHIIFGFFGBGHADFBD3=@C:ACCDCA?1<?#############################
+@ERR884056.2172322
+TGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGCCGAGGATATGATTCCTGTCTCTTATATCC
++
+@@@?DDDDHHFHAAGC@DDHEH@8?DEGHIIFB<BFB??F??D>?CFFF=CCF5@2==C@;CH2=;B?>@D##############################
+@ERR884056.2173347
+CTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATCCTGGCGGGGGGGGTGGGGGTTTTAATAATCATTTCTGCAAATATTATTGCTGACAA
++
+:===BD?A@<@?DA8CE??)8?6B)*909D*7@;6@#################################################################
+@ERR884056.2176769
+ATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGA
++
+@@@FFFFFHHGHFIHIIHGHHCFEIIIIJJGGIIDDFHIGJDGHGHIJIIFHFHGGIEE>AEFFFEDFDECDEECBBB??C,89>C:?<><<<<<CDC::4
+@ERR884056.2177089
+GGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACG
++
+@@@DFFFFHFHHHJGHHHDCHIIGJJJIJIJHIEHGIIIIHIIEIJJIIG@ACCHHHFB?;?>A??=;)9>@BDCCAC:A@ACDDBBBDB<@CCCCBB9@>
+@ERR884056.2196555
+ACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGTCATCAGCGCGGGGATCGTGATACAAACCGACTCTCCGAG
++
+;:?D1=:B?FFFF@DF:::??F;D@F;6<6;BD6@C>EF94>''5=3@>35;B?###############################################
+@ERR884056.2203624
+CTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGCAGGGGAAAAAAATGCTTA
++
+CCCFFFFFGHHHDIIIIEGHIDH@HHGGGGIIECGHGEB:?4BB4@<9D?CHH==@C4-)77=.@;?E)).;>?@D#########################
+@ERR884056.2205724
+GCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACCTGTCTCTTATACACATCTCCGAACCCACGAGACTAAAGCG
++
+@@@DDDDDFD<CAGFH@C68C?CGHGGIIEDG=2=;@FGCCC=7:?C@,;<(;@AAA@A@>>>5ACCC@A@A(+4:4:@CC####################
+@ERR884056.2205764
+GGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTG
++
+@C?DDEFFHHDHHHIGFDHFE@GGGHHJFE?CEBDHHDF@GII8DG1-'8@8@@ED;(5=3@CDFE@AE>A@B############################
+@ERR884056.2207456
+GGTCGCCGTCCGGTGATGCTGGCGGGGGGGGGGGGGGTTTTTATCACCTTTCTGGCAATATTTCTGGCGCAAAACATTTAACAATTCACTTCTTTGGGCTT
++
+@C@FFFFFHHHFHFHBFHBG#################################################################################
+@ERR884056.2211588
+GTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGGGGGGTGGGTTTTCATCACCTCTCCGGCAAAAT
++
+@@@FFFFEHGHFFHGIJ>CGHIFGGHAFGHIBDDG688@FFC8=BEEA'9=>;,3,55:>@>@######################################
+@ERR884056.2211785
+CGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCG
++
+CCCFFFFFHHHHHJJJJJJJJJJJJJJIIJJIJJIIHJJJIJIJIJJHHHEHFDFFDEDACEEFDCCDDDDDDCDDDDDDDDDBDD<BBDCDDCDCA:@>@
+@ERR884056.2214745
+CCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTACTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCTC
++
+@@@DDDDDHHHDHGGHHFF:CD4?:?@*?99DACF8B=F(;@@=4==)77=;CE).=;3?C)>AC;9>38'&2>@>>@#######################
+@ERR884056.2218472
+ACCCCCGCCAGCATCACCGGACGGCGACCAATACGATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGGTCATTGAAGA
++
+@CCDFFF>FHHHHGI@GIHH?F@@FGAHHFF>DECBCAB?7=B8AB8@557?8?B8A@C@:3@A@D3>;BCCCB859@BB@@<ACC3>())055>@::@##
+@ERR884056.2218876
+GGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAACGGCTCCT
++
+BCBDFFFFHHHHHGIIAFHFHGGIIIIJIJJHHIJHHHHDBDFDFD;?BDCCDCDAACCCC@@@>;;8AC@ACCBDDD@9B&-++>CC?A34@########
+@ERR884056.2223777
+AGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATGATAAACCACACCACCCCCGCCAGCATCACCGGACGGCGACCAATACGATC
++
+?@@D4ADDFHBDF<CGEGCCFEAFHIHHGCFFEFHH>CDD?BFAEGD<94??FEGGC;9<=;;@GGIHA9AB:@?##########################
+@ERR884056.2227703
+TCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTACTATTGCCAGAGAGGGGTGGA
++
+BC@FFFFFGFHHHEDHHIJJJGEHIBCEGIJJHHFBGEADFAADF<FAHGDEH?=C>B@@D;@D@;@3;ACA@?###########################
+@ERR884056.2242826
+CGCCTGACGTCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGAGTTTAATAAAAGCACAGCTAACGAG
++
+@CCFFFFFHHHFHIJJJIJJJJJJJJHIHIJIIJJIJJGIIIIJIGIIIB=CCHIIIIGEF@BBDDDFDDCCBDD@B@@CDCCDCCD@B?CDCAC4>A?@@
+@ERR884056.2275730
+GCCCCCGCCACAAAGCGGCCGGTCTTCAGCACCAGCTTATAGTCACTACCGAGGTCTTTCAGTGACAATTTTACGCCTATACGCGGGGCGATTTGCGGCTA
++
+?<?DD@:D@<@DD3A+1?:?D0@A;B8))88=C(=@C;3?#############################################################
+@ERR884056.2276054
+GCGCGGTGATCTTGATACAAACCGCCTCTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGC
++
+BBCFFFDDHHHHHFHGEFHIIGGHGIIJIJGHGJJGIGHIJEGHIJJIJGHIFCD@BDDDDDADDDDDBCACAA@CC>9?8A?CC>AC<48ACA@######
+@ERR884056.2288894
+TTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCCTATTTATGGATGACCGCCGGGTTAAGTCTTTATCCTTTCCGCATTGGTCTC
++
+@@@D?DBDHHFFFGE@F<GBEG?AEA0@D@F??BGGGHBG9@CFH;E5:(.9)6;;@3@##########################################
+@ERR884056.2299455
+GTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCC
++
+CCCFFFFFHHHHHJJJJIJJJJIJJIIJJJJJGIJIIJJIJJHHHDDB;?BAB9B@BDEEEECC>@CCCDC?<CDDDDBDCCBBB>>8<BBBBC@CCDCC#
+@ERR884056.2318308
+GATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACCC
++
+@@@DDDDDHGGFFHED+?AFGIJDDHEG?CDGHJGFFGHIHCGHIHIIIB@<@(;;=EEE7?CDEFDBC1'35(>@CD?9((555>:>CC###########
+@ERR884056.2321059
+GGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCA
++
+CCCFFFFFFFGHFIHBHIIGGIJIJGGGGBGHIEGFGEHFHFECEBDH@DFB?FFBFGB=;B8CA;BABBB<AB>D@32444@CC@A@CACD#########
+@ERR884056.2327679
+AACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGA
++
+@CCFFFFFHHHHHJJJJGIIJJJJJJGHHIJJIJJJHIGIIGICHIJJHEAEFFFEFDFBDDCCEDDDDCCCDCA@C@?<)0)00:@A>A:>>>A######
+@ERR884056.2335253
+TGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGGCTGT
++
+@@CFDFFDDFHHHJEHIIIJJGGJGHIGIIIGIJJJIJJIIJI6GFHDHGBGH:EGHGIH?AEHDFEFFFFDC69??BC;<<CCACDBC9>BCCDC>B?8<
+@ERR884056.2336693
+CGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTGTTGCAAACCGAAAAAGGAGAACGCTCGCACAGCGGGAGA
++
+@@@FFFDDDFFHHJJGEHCAHIJGGIIJJHIJJJJG*?FGHJGEG>5<AAC@CD@>AB###########################################
+@ERR884056.2338086
+GGGCAGCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATAAAAACCGCCT
++
+CCCFFFFFHHHHHJJJIIGGHHIJJJJJHJIJJIIJHHHDFFDDECDD8=;??DDDD@B;<B;B<BBB89BBCAC>@BBD05?CCDACDDC##########
+@ERR884056.2339078
+GGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTT
++
+@@CADFF?FDFFHHHGIIIG@EDBB?FDG1BD8B@FDHGFEG>DGEBE9<?BEEEECC@@CC?B9?@CCCCB9;>&&0<AC3?CCC>>C::>@@C@(4:@A
+@ERR884056.2343529
+AGCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTTTTTGCTGTCTCTTTTACACATTCTCGC
++
+@@@DFFFFFHHHHEFH@F6E1CDGDDED?BFGIIICEHIEG?(@F@4=CFAA:=<<>??=BCC>>??##################################
+@ERR884056.2349709
+ATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGGTCATTGAAGTAGGAACCCAATCAATGCCCGCCTGATATTGTTCCA
++
+@@BFFFFFHHHGHJJJJHIHIHIJJJJGGIIIIHIJJCHGHEEH4@BDEE@DCDB@BBBAC@A:ACDDDDDDBBBDCDC4:4>++&0<983>@DDCD####
+@ERR884056.2350645
+GTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCA
++
+;@@DDDD)<@BFF9GHEIIIIGG@@DDFHHCFDGFGIB??86@H;=);F>CADH/9>AABC;;A3(<A@C@3:<5985?8@@@##################
+@ERR884056.2357350
+GCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAACGAATCCCAGCGCCAGCC
++
+BBBFDDFFGHHHHJJJIGHIJJIGGJJJJJJHHIIIJJJJGIGGIIJJIGEEEEACBDDDDDCDDDDDDDCDDCCAC?<9234(8?BA<CD@>AB######
+@ERR884056.2358743
+GATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTTTGTTTTCGGCATTG
++
+B@@FFFFFHFDHHGHIJGIGAFHHHIDHDFGC?FBGBFGF>FGEGFGIIDG=?<A'3=AD;>CD@::@@59@#############################
+@ERR884056.2364113
+TTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAATGTCCTTTTTTCTGGCCGTTCTATCGGGGGAGATCTGCTCTCACCGCC
++
+<??D;B4D>??,ACEC1@E::@??DBDBDEDIE4DDACE<BCA##########################################################
+@ERR884056.2365186
+GGCTAACGAATCCCAGCGCCAGCGCCCCCGCCACAAAGCGGCCGTTCTTCAGCACCAGCTTATAGTCACGACCGAGCTCTTTCAGTGACAGTTTCTCGCCT
++
+??@DDFEDHHFHHIIIHFGHGEIGGGG:DAF@FHE@=EHFECCBBDC?A@>CDDB??8?@::C@::AC:;<9@############################
+@ERR884056.2366292
+CCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCCCCCCTACTTGGTCCGCTGGTGCTGTCTTTTATACACATC
++
+@@@D?DDDFFHD<E?8?C?):9DBDEFD<B?FH@@<B8AEE@)49AB@@?@=;'55:3@>3(((&088?@>C#############################
+@ERR884056.2366863
+GGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACGG
++
+B@BDDDDFHHHHHJJIIJJJJJJJIJIIIGIJJHBGIJGHIJIGGIHHIHFBHIHIIDD;8?BDEEEEA>.;;>;8;@<>CCAAAC88344?>ACCC####
+@ERR884056.2372228
+TTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGATTCTGCGACGATGGGAATG
++
+@CCFFEFEHHHHHJ<EGHIHGIJJGGGGIJIJJGIBHIG@GIHGHEBCHF@BFACCCCCCC@@BB::@555@C@CC(4:99(09>(4>9&)55?BBBC9?:
+@ERR884056.2392358
+GTTGAGCAGCTATGAATATGGCTTTCTGCAAGTGCCTATTTTTCGGGCGGTAATTGCGGGGAACTTTCTGTTAGCGCGTCTGACCTCCCGCCGCACCGCTC
++
+BB@DDDFFHHFBDHIIJFHHJIHH3+<+A+2211*11*1CGI<?@HGEG####################################################
+@ERR884056.2401930
+AAACTACACCACCCCCGCCAGCATCACCGGACGGCGACCAATACGATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGG
++
+B@CDDFFFHHHFHHIIIIIIJJIJJFGGGIIJJGBEBDDBBCCCDBBB?A2:<B<9@@7@D???B?<BCC@C:AC(::584>9?#################
+@ERR884056.2414650
+GAGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGACGCGC
++
+@@CFFFFDHHBFHIGE?FHHDEDGGHIGHF@GIIHIIJJGIJF>AH/:5??D=8;@@BCDAACDDDD@@>959B(<<@5<1&&&5<B>>@>0(:3@35><<
+@ERR884056.2429225
+GAATCATATCGTTGCCGATATAGGTTGAAAATTCGTAAAGCACCAGACAGAGAGGGAAAAGTAACGCCTGACGTCCAAGCCTGGAACCGGAAGCTAATTTT
++
+@@@FBDDBFHHFDGICH@F:FCD>FGFBBBGIGGGHGEDHGHCAGB;FCF;=7;;@AGE==;=;)(39ACC>@BB##########################
+@ERR884056.2432703
+GATCTTGATACAAACCGCCTCTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCACCAGAG
++
+C@CFFFFFHHHHFJJIJJJJJJJJJIIIIJIJJIGGGHIIJIJJJIHBEDDFFFBEDBD?@BCDDD@CDDCCDBDCC@(+4?AABDDCC<?CBBB&)<??<
+@ERR884056.2435667
+CTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGGTGATGGTCGTA
++
+@@@FFFFFFDHDFGGGE@FCCFGGCCEGGHCHGGGEGGIJ::BDAFFBAHG@CD@AGG;)=?A;?;B>9A8>A3(55>>>@A###################
+@ERR884056.2441237
+AGATTAAACTGTCCGTTGCCCCCGTTCAGCCAGGCATGTTTGCTGATTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCCTGTCTCTTAT
++
+CCCFFFFFHHHHHJJJJJJJJJJJFHIJIJJJJIJJIJJJJJIJJGHGHIIHGIHGIJJIJHHHHHFEFD@CCCCCEC>5>A@CCDCC>?ACDCDDDCC##
+@ERR884056.2441819
+TGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGATTGCTTTGTGCGATCAGGCATTCTCGAATTAATGGTGAT
++
+@@BDFFFFHHHHHIJJIGIJJIIJJJJJJJIJJJJIIIIIJJGIIJIFFHGHHHIJHIIIHGHHGHFFFFEFDDCBBB@>ABDDCDDBCCDDDCEDCDCC#
+@ERR884056.2452526
+ATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAAGAAATCCCAGCGCCAGCGCCGCC
++
+BB@DFFFFHHHGHIGGIGJJJJIIGIJ?DFGIEHIGGIJIJDEGIGBEFFD?A:3?BC:<;?BDDCDDD@?CB############################
+@ERR884056.2458707
+CATCACCATTAATTCGAGAATGCCTGATCGCACAAAGCAATCAGGCATTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTAAAAAGATAATC
++
+?@@BABD:CDC<FAFFBBCECA<<CBGBF1CDCDFB@DG*:DCB?08?B*??@HEIC3==E=D?D?@>.....5>@CC#######################
+@ERR884056.2465496
+GTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAAATGCCTGTTTGCTTTGTGC
++
+CCCFFFFFHHHHHJFGGIHCHGCDGHHBHCGBDDG*?FGHIADGHD;DA@C)8BFAF=FHGGGG=?37?E5?B<9.55-5538,:AC@4+449+>AA####
+@ERR884056.2465843
+GGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCT
++
+BB@DDFFAHHGGHJIIJJJAGIIIIIGCE8?BGGBHI@EHGEEDDD;CCCACEC@>BB@B7A#######################################
+@ERR884056.2473957
+GCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGACGCGCTAACAGCAAGTTCACCGCAAT
++
+;;?7:ADDHHHHDHFGBH?<CCHD@FG?DDHIIGFGEGFAC;88=@EE@EH=D?>A@############################################
+@ERR884056.2480276
+GTACGGTGCGGCGCGAGGTCAGACGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAAC
++
+@?@DFFFD@FHCDFF:GH@FCFGGI8EEFFDEEEBDCCCDEDACDBBB@ACCDDDDDB;77<5>>@C:@<C@@:>A>8938??@CDAB@CA@>CCCC34:3
+@ERR884056.2482988
+CTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGC
++
+BCCFFFFFHFHHHJJEIIIJIJIJGJIJJIJJGIGIIJIGIHHHH=;BDDCDA?CDCDDDAADDDDD:?A>:5>@55<<CA(:@CC@C:@:A@>3+:@?8>
+@ERR884056.2491700
+GGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGG
++
+@@7DDFDFHDFHHGIJJIGIIIJJ>FGAFG@FGHIIIJJIGEDEEEEEECDDAACABDB7<<BADDD:?BDD5;<<0091(+59A?<5<B>>A@@A@DA48
+@ERR884056.2501314
+GCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATTTTTTTAAAAGAA
++
+C@@FFFFFHHHGHIIIBEGGHHHIIIJIHHIDBHHEHGHHHBEDFFFFECAECDCADDABBBDDDCCD<98ABB832?--&++4>3(44+4><BA>@C:?#
+@ERR884056.2513155
+CAGCAGCGACCAACAGACCAATAATAATAGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGACGCGCTAACAGCAAGTTACCC
++
+?<@D?>=)@CFFHI?GF;FHHBGF@4:4:?FHICBDDGDHGB>HGHGH;CA??/5?A>;A@3,5,;=8@BBB@><5(49A@9059-&5>:><39?4@A###
+@ERR884056.2515778
+GATATGCGGTCATTGAAGTAGGAACCCAATCAATGCCCGCCTGATATTGTTCCACCACGGCCAACATACCGGGTTGAATCATATCGTTGACTGTCTCTTAT
++
+@@CFFFFDFFHGDHACFCHHDFHIGHHHEFFFHIGGHIIGGHGEFGHI@GGFGDGFGHD@8?B?ABEDEC@,88<;,>::44:@CBC1((++(+:A@4A>A
+@ERR884056.2517781
+ATACAAACCGCCTCTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTG
++
+@B@DFFFDHHGHHIJJIJIGIJGGGDFBGHGHGI<FH>EHIGH;?A??B?>=@@BCDD>ACCDCDD@ACCC>A>?@AB<ACCCC>90550?ACD::4>C:3
+@ERR884056.2518086
+CCGAAAAAGGAGATCGCTGCCAATGCGGCAAACAAGACAAACATCCCTTCCCAGGTCAGCACATGGATCCACGCCGCGCTCACCAGCGGACCAAGTAGCGG
++
+@@<D=@:DC1D+CEBC=FFAEA@DA@8GB:DFCFFBFEFEA=@=@EEEBEEEE>?);)7>ACA######################################
+@ERR884056.2518242
+GGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTTCTACTTCAATGACCGCATATTCTGTCTCTTATTCACATTTTCGCGCCCACGA
++
+?@@BDEFDFDAADGFHH@A<<ABGGF?:EGHGIIIA:?A))7@.;6;;(-5>@>>@>:>:@>(,8;7?:(++:4:>:@C@#####################
+@ERR884056.2525965
+TCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGT
++
+@@C?DEDDBHHDHJIIJJIGGIIHHIEGHIGCFGGDFHIJGIH8@@GFGCCFHIG7@EHEHHHEBB=A8>=C@@5=9,9<(5::>C:?4>A25<@######
+@ERR884056.2533545
+CGCGCTAACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAAT
++
+@@@FFDDFGHHHHIGHIJJJJJJIDHGGHHBFDGIHHIIIJH@?EHHFCDD?CDEECDBDDACDDFED@ACDD:@ACCC93>@@BDBD59@DDCD@CC:::
+@ERR884056.2533585
+GTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAA
++
+@@@FFFFDHDDHGHEDHGIE;AHIAGHGEIEEE>EEDDEFDD>ABDDB?BCC;A9AC>@CCAC>C@7;BBDDC:?##########################
+@ERR884056.2539491
+GCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACCGTTGCCGCAGCAGAGACCACCAGCCCAATAATAATTGGCAAACCACC
++
+?8?DFFAEDHHFHIIIIIIIII@FD?DHGCGCADCH=@;AEB83;>C@(;>>C################################################
+@ERR884056.2543596
+CAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTTGGGGCGTTAATTTCGGGGAAATTGCTGTTAGCGCGTCTGACCCCCCGCCGCCCCGT
++
+BCCFFFFFHHHHHFIIIJIIJJJIHJ)+22**?C9B4C*1:BBG*)8?D:5-::;7?############################################
+@ERR884056.2557328
+CAGCGCGGTGATCTTGATACAAACCGCCTCTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACACAGGCTTATGCCCTGCAAGAAGC
++
+@@@FFFFF@DFCFHIIJIJIIJHHIGIGHIIFFHEHGIJJIIGHIGGCGC@=-=?9?BB>ACDDDDBDDDDD@ADCD3(+28<A+((((434(+9@C??##
+@ERR884056.2561466
+GGTGATGATAAACCACACCACCCCCGCCAGCATCACCGGACGGCGACCAATACGATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCACGCCCCCCA
++
+B@=BDEFDHGHHHI@GHIJJJJJJJJJJFIHGGHHHIIJJJHD8<828?BCACD?BDD?<;B@B;;55;><28<@BDCCA3(4>>A@##############
+@ERR884056.2568832
+AATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACCGTTGCCGC
++
+@@@FDBDDHFHFDGIGIGEHE?GHHGGGGEIEHGIJHGIIIJGFGEGIIG7?EFEFBDCDD7@@CCCDDCDDDDDA@B5959BB5>ACCCDDA52<@BC@@
+@ERR884056.2573662
+GCGCCAGCGCCCCCGCCACAAAGCGGCCGTTCTTCAGCACCAGCTTATAGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCCCGC
++
+@@@DDDDBFD?FHIIEIAHG?FB9FHBAB;:=ADC;?;B;=>??ACC3->;@A@3<?87;788AC@ACCC(:>@C>:>@(+42(5>9>>@A##########
+@ERR884056.2574628
+ACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGGTTTTACAATGGC
++
+@B@FDDDDHHHHFIIIEFHICFIIHIJGBGFGEIGIJJHB>C@>>CC@==?<ACD>>CCCACC>CCC5>50(>CD##########################
+@ERR884056.2580363
+GCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCCAACGAACGGTGCGGCGCGAGGCAAAACCCCTTAACACCAAGTTACCTCCAAT
++
+?@@DDADDDF;FHIIIEHHHHECB?6?CDFIF)87AEDG;C@GG@C=@)@7;A((5>>=A/92=;@###################################
+@ERR884056.2585006
+GCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCCGGTTTAGTATTTATGCTCTG
++
+?@@DD7?@0@D1AB4ACEGC9<99<<C?B:0:@AGC39?'7A65@5?=A@;7;?;7(,,33387<3>BB################################
+@ERR884056.2586239
+GGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAGGCCTCTGTTTCTTTG
++
+@?:BADDFFDHH?EGE>EGGEABDBBBFECHCEFGHCFFGDHAGBAGEC)=CCGGFGIIGGCED>=3?:8993@:C@3;(3<?CC((,,55>AAC@:(4@C
+@ERR884056.2587906
+GCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACCGCCTCTTCA
++
+@@@FFFFF<HHFFHHIJJJGIHIJJGIIJIIJJIIGHEEHCED>@B??CCC@ABDDDDDDBABBBDDDDACB9&5008CCD>:>@AC@A############
+@ERR884056.2589555
+TCCCTTCCCAGGGCAGCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATA
++
+@@CFDDDDFHH=FAGHAFBHHDDHHI?CF@FHGGIJJJIIIGGGHFDCBBA=>CDDB@?BBBCCDDDC050;BB<<?-9-8@DCCD<<<-9<(::>>@>A:
+@ERR884056.2590713
+AGTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTGTCGCGGGCCCGAAAACGCGATCGCCTGCCCTGGG
++
+???B=DADFDA@DFFFBGFF4?CGHIGF00:?<BBGEFGBAF@F>4::/?9,;@((5:(5:<?A#####################################
+@ERR884056.2594437
+ACAAAATTCGCTTTCTCGTTAGCTGTGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATGGCATGCAAAATAAATTAGCTTCCGGTGCCAGGC
++
+?@?ADADEHDHHHIEAEECC@;EC<FHEFG<C?C4?C>F<DGBFDHI6@C7)=8@CD@E<A',3>;@((,>;?>;A#########################
+@ERR884056.2598748
+TGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCCCTGATGGTTATCTCTTTAAAAGATAAACAGATGGA
++
+@@BFFFFFHHHHHIIJJJJJFFBF=D@FHHEIEEIIJIIHHHC=;;BBDDDDDCCCC;9<BDD9A####################################
+@ERR884056.2605978
+GTCACGACCGAGTTCTTTCAGTGACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTTTTGCAGACCCAAAACAGGAGTAGCTTCCAATGCGG
++
+@B@FFFFDHHHHHIDFHHJEHHHHGIJJFIFGIIIJIHIJJGIG;;EBBA,9=CCCDDBDD?ACB####################################
+@ERR884056.2607345
+GATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAA
++
+@@@FDFDDHHHHDHHGIGJEGF?FDDGHEFICHGHGGIJGIHEHEFDCE>>;@BBDBBB8<5ACC>@ACCD?BBBBD7?CD:B>((4:(4>@@########
+@ERR884056.2616973
+ACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATCCAGGAATCCTCCGAAGCGGCG
++
+@@@DD;DDH>;FDFGG>BDHIHIIIADEDBHH@EEIEFEGCGHGGIG?B9B)=48BC=FEHIHE=79?@>CCC############################
+@ERR884056.2622950
+AAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCTCTCTCTGACTGGTGCTTTACGAATTTTCAACCTATATCGGCAACCATATGT
++
+@?@DADDBDH8FBEHEF:CDD?FFEBFHBFC?FEB?@FG(.77;CF=FI)=CCCEH:)77.;;?@@B@>C?A(5;@;>C>:<::@@###############
+@ERR884056.2637351
+CTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGTGGCAG
++
+?@BFFFFDHDHHGBGGGHGEHFGHGDHIIHGHGAE=?;BFFB>8<@BC;C>>CCDC9<?@B@;-<87&500:@++:>A:44<@A#################
+@ERR884056.2643014
+GACAGTTTCTCGCCTATACGCGTGGCGGTTTCAGGCATGGCTTGTTGCAGACCGAAAAAAGAGATTGCTCCCCATGGCGGAAAAAAAAAAAAAAACCCTCC
++
+@@@FFFFFGHHGHIH>AFDGHJGIEHIJDFGFH@D>;=@EC@A##########################################################
+@ERR884056.2646708
+GGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGGGGGGGGGGTTTTTATCACCTGTATGGCAAATTTTATGTCGCAAAACATCTAA
++
+@CCDFFFFFFHHHIII@FFHCG??DGG@@GGGF;@DCGEGGCHBA;B@#####################################################
+@ERR884056.2647297
+GATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAATGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGT
++
+@@@DDFFFHGHHGGI:ACDGCHGHDEHEFHIJFGGEHGFHFHGGH*?GHCHHA;CBE??=ACADACE>>;>A@CCABCC@A>ACCBB7<<4::><A<<882
+@ERR884056.2655488
+CGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACGGTTGCGGCAGCAGCGACCACAAGAGCAA
++
+@@@DDDBDABD8DG9CBCDG;C>FGGGEGC<FCGH9DAFB<5'9@(66;>@C3;5=;=2750580>ACC::A#############################
+@ERR884056.2660618
+GGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTTTAAGCGAAAAACTGTCACTA
++
+@@@DDDADABFFFDGFGEHI1@EE@?9EFF?0???DCGE<F<99?'-''8=C>CDG)??>EBCDEECCCC###############################
+@ERR884056.2660902
+GGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTT
++
+@@?DDFFFHHHHHIIII@GHGI?GHGGEHGHHHFHHGIGIIJJIJFBEB>BDE;AECCE@CCDBDB;@CCCBDD<B<B><ACDDDCDDDC44:>@C@>AC:
+@ERR884056.2685877
+GTTGCCCCCGTTCAGCCAGGCATGTTTGCTGATTTCAATACCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCCTTTTC
++
+=:=ADDDDD:CDDACEE>EAF;?EEEEEDIDDD?D4BDD>DDD>?9BDDDBDBB=CCEEIEA@45:<D@;939?###########################
+@ERR884056.2694148
+GCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATACAAACCGCCTCTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACA
++
+@@@FFFFFGHHHHJIJIIIHGGIJJIGHJIJFHI>FHEHFGHIIJJAAEDACDCDDB@=B;ACDCBDDCCD:AC9>BD99?B>@CDDB?9959BCCCC###
+@ERR884056.2694342
+GATATGCGGTCATTGAAGTAGGAACCCAATCAATGCCCGCCTGATATTGTTCCACCACGGCCAACATACCGGCTGTCTCTTATACACATCTCCGAGCCCAC
++
+@@@DDDDDHHHHHJGIIHJJIGCDHIHGHIGGHHGIGDB@DFB3BEHIGI=FHE>@FHGBHB=;??C@CDD8=?;?CC>AACC:>@@>ACD>:>59>B###
+@ERR884056.2695888
+CCTGACGTCCAAGCCTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCCAATAATAATCGCGCAGAGTTTAATAAAAGCACAGCTAACGAGAA
++
+BCCFFFFFHHHFFIGGIIHIGHIJGGHGHIIJIGGIIIJJJJIIIJJJEGIHHCGHAAEHHHEFFFFF;A>:@?AAC@(>CDDCDC8><C??@CAADB<99
+@ERR884056.2697910
+TAAATACGCGTGCGATGAGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGCGCGGGC
++
+@<@DBBDDHH?FFIJC@C?ECFHHHA?@DAFDFGG>FHG<GE/9?5?>ABBCDDD@ACCA:1;;)&288;@&5>3>A:CA#####################
+@ERR884056.2712338
+CCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACCGTTGCCGCAGCAGCCACCAACAGACCAATAATAAT
++
+@C@FFDDDHHHGFHIIHIIJJJJJIJI<GHIIJIAB<EFEHCEFBBB@AA;@B@@BDDCDCA@:ACB<8<@39@###########################
+@ERR884056.2719283
+GTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCTGTCTCATATAGACATCCCCCAC
++
+::=:D?DDAF?FA8FFF>F9A<<8)1)1:B@GAAG9D6?(<))B=8.6@=@E9CEA=A=E@B#######################################
+@ERR884056.2722198
+GGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGAAATGCTGCAAATGCTGATTTT
++
+@@=DDFDDFCFHFGIFI:FGBH@AGEA?FHHIIIEG@FGGIHIIHB4A??B;A@CCC3;5;@?@98=AC@A##############################
+@ERR884056.2723354
+GCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAACAGGCGGTTTGTATCAAGATCGCCCCGCTAGTGGCAAACGTA
++
+?@@DAB2AAFBD:A,:AA?:BF>3@)1:C;<8CDCA0:D0;@A)=77@@CE##################################################
+@ERR884056.2728974
+CCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCCGGGTCCGCCGTCGGATCGTATTAGTTGGCCGCCGGTGATGGTGGGCGGGGGGTGTCTCTCT
++
+@@@DD@DDBF:CFFFFD@A>/6;,5@@B(5:AA@>?8@?23<B##########################################################
+@ERR884056.2739815
+GCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGATCTTGATCTGTCTCTTATACACATCTCCGCGCCCACGAGA
++
+?+?DDADAD=FHDGGEGF@G?FHCFG<FF9=BFF7@F/@EE<?>2'9>B5>(;32=86;@8333:4(+::++>3@:4:@AC@C::>AC>5&&0)5@@B###
+@ERR884056.2749313
+GCGACCAATACGATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGGTCATTGAAGTGGGAACCCAATCAATGCCCGCCT
++
+B@BBBDDFHHDFHIHIJGJEIBHGIHJIIHHGHHHIEEGGGH=ECBDDE@B==3;;BB?BDCCC4>>B593@C############################
+@ERR884056.2750406
+CGATGAGATAACCGTTGCCGCAGCAGCGACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGAC
++
+@@@DFFFDHBDHHIIIJIJBAGGHGH@FBGHGIIJIIHCDC=CGHGGGAAA9?4;BCB?@BDD3>AD3:@CDD9<>99A<<@7(25<B<B@@#########
+@ERR884056.2750613
+GGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAACTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGT
++
+BC@DDEFFHGHHHJGIIEHJIIIGJJJJJJJIBHIJJJIGAGG;ACHID=CCHHEHHFFFFF@CCEECECCDC@BBBDDDBBD##################
+@ERR884056.2751170
+GTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGG
++
+@@BFFDFFHHHHHIIIIJJJJIJDGHJIJIJ4DFHBFHIJADBFEDEEEE@A>CCBDDB@B5<AACACDBCBDCDDCCDBBBDDC@:ACCCCC9&59>CBD
+@ERR884056.2751601
+ACCCCCGCCAGCATCACCGGACGGCGACCAATACGATCCGACAGCGGCCCCAGGAGCCATTGTAAAAACATCCCGCCCGCCAGATATGCGATCATTGTAGA
++
+@@@FFFFFHGGGHGGJIGCAFDDHB<@EEBDFEEC<AB?B?/2',595&)708@D72<3:@@@>4:@C@################################
+@ERR884056.2755181
+GCCAATGCGGCAAACAAGACAAACATCCCTTCCCAGGGCAGCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTT
++
+?@@DFFEBHHGDHGEHGBEFGDHHEFEHBGDFHIEBB:BFBHCCCFHDAEDHCHE=??A888==B>??A09;BB###########################
+@ERR884056.2770314
+GCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGAT
++
+?@@FFFFDHHFHHIIJIIDIIIDHHGJEFGGFHGJEIJJIDHIIGIGGIHAHCBBCDA@@@C:ACCCA@?BD7599>>>::A@(4:@BBBBDB@B?BC>@:
+@ERR884056.2780542
+GATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGGATTGGCAGGGATCTCCTTTTTCGGTCTGTAACAAGCCATCGCTGAAACCGCCACGG
++
+=;1BABBDDA?CAEGFEFEI+3ACC2ACGFID?9D<FFEIB############################################################
+@ERR884056.2789404
+TTTCAATACCAACGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTACCTTTACTCATATCGCTGTCAAACAGGGTTAATCGAACCAGC
++
+?@@DDDDDAC<DDF62AE>:+<AEFEEFDGEFGEFIFFF>GGA)6?FDAFFFI>E2-?=BDD#######################################
+@ERR884056.2794338
+GACCAACAGACCAATAATAATCGGCCAGCCGCCCATAATAATCAGCGAACGTACGGTGCGGCGCGAGGTCAGACGCGCTAACAGCAAGTTACCCGCAATTA
++
+CCCFFFFFHGHHHIIJIGHHHII@EHGGGIJIIIJIIEHIBGHICHIG;=B=??@=6;3;=?B;;B>;-9C?>49BD3<>&++(+9??44@@#########
+@ERR884056.2797331
+ATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAACGAAATCCAGCGCCAGCGCGCGC
++
+@@@D;A:BF4FBCBF>FE;CHGFAGGBDHGIIGGGIICC@G6DFHGB=B.;?A>9?;A??8(''2AC>:><9?############################
+@ERR884056.2797463
+CTTCCCAGGGCAGCACATGGATCCACGCCGCGCCCACCAGCGGACCAAGTAGCGGAGCAATCAGCGCCACGTTCGCCATCAGCGCGGTGTTCTGGATACTA
++
+?<@DDD?DF<+<CF@FEE?C2ACGE;CFEEFFD;<FFBC;@E'98>6;555(5;8;B-+3::(3@8>>B################################
+@ERR884056.2797781
+AACAGCAAGTTACCCGCAATTAACGCCCCGAAAATAGGCACTTGCAGCAAGCCATATTCATAGCTGCTCAACTGCTCCCCGGTAATGATGATAATCGGGGA
++
+@@CFFFFDHHHHHGFFHIIGHIIJHHHDDEHGIIFHGGFEGGFC@GHGA7==?C@@B7;>@C6(>A9AAD@CDAA@#########################
+@ERR884056.2800871
+GTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTTGCCGCCCGGTGGTGCTCGG
++
+@BBFFFFFFHHHGJFHIHHEGECHGIEGIIJI>=BD73<CDDD@BA8>ACC??983+9?<BB@;&)0@055?#############################
+@ERR884056.2806022
+CGGTAAAGATCAGCATTTGCAGCATTCCCATCGCCGCAGAAACCGTACCTTTACTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCC
++
+CCCFFFFFHHHGHJIIJJJJJJGGHIJIIFIGGGJJJGIGGGIFHGHHHHBGHHIIIDHHF=ABDBAC;>BDDA,5<<@C@???@58AC@+4935@#####
+@ERR884056.2808507
+CTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGGGGGGGGCCGGGGTTTGTTTGCTCCGCGCTTACGGGGTGGGTGGCCCCCCCGTCCGCTT
++
+@CCFDFFFHGHAFHHGEHDBGHG@:FHDGGEHCB;BFHB##############################################################
+@ERR884056.2808940
+CGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGCGTGCGATGAGATAACCGTTGCGGCAGCAGCGAGCAACAGACCAA
++
+@C@DFFFFHHDHGJJJJJIIJGEHHGIIHIJIIJJBH>FHH?DFAA>ACCCCCCCABB;5<7;?-@C>(:4>:9@?<5)&))58?8A<9&0532?######
+@ERR884056.2824864
+CTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGGGGCGGGCCGGGGGTTCGTTCGTTCCGCTCGCTTGCCTTGGGCGGCGCGCCCCCGCTCT
++
+@B@DFDDFHHHFDHGIFIIHGGHIJJIGIHGB?####################################################################
+@ERR884056.2834864
+TGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACAGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGG
++
+CBBFFFFFHHHAHIJIJHIGHIJGHIGIHIIGIHEHCHGJIFG;B??DBFHHJJFDD?5>38@?<>>5@4>3:>>>>C>@+9((+4>4@B)2+2>C@####
+@ERR884056.2840702
+GAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATGATAAACCACACCACCCCCGCCAGCATCACTGGACGGCGACCAATACGATCCGAGA
++
+?@@DDDAB=DDHDIGBGBIGGIIECAEGIE*:CD4C@BFHI?D>DHAF4D49BHGIEEHCCH5:?DCB?B=AC############################
+@ERR884056.2852599
+TCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTTCAAGTGCCTATTTTCGGGGGGTTAATTTGGGGGAACTTGTTGTTTAGGCGGCTG
++
+@CCFFFDFHHHHGIIGHGIHGJICHIIJJJIIFJGGHGGBHIC##########################################################
+@ERR884056.2852677
+GCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTCTGTCTCTTATACACATCTCCGA
++
+BCCDFFFFHHHHHJIJIFHHHHDHHIIJJIFHIJIIGGIIIHHFHGCDED@CFEEACDDDCBB8=BB=C?CCCC@CAACDDCCDDC>>>:>>C>4>@CC##
+@ERR884056.2858390
+GGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATGATAAACCACACCACCCCCGCCAGC
++
+BB@FFFFFHHHHHJJJHHHIHIJJIJJIJI?FGIIJJJJHDGHHDFHGFGHGIJI@GGIIGCACEHHDBB??6;.6>A>AC@C;<?A?59?@BDD######
+@ERR884056.2859125
+CGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGAACCGTTTCCGCCGCGATGCGCACGCCGCCACTAC
++
+???DDAD3+<A:A3CEE1<2CC1)0?D)8/?D0:=.5=@ADAAA;))7AC###################################################
+@ERR884056.2867288
+CGCCAGATATGCGGTCATTGAAGTAGGAACCCAATCAATGACCGCCTGATATTGTTCCACCAAGGCCAACATACCGGGTTGAATCATCTCGTATGCCGTCT
++
+CCCDFFFFHHHGHIGFHIJJIJJFFGHIIJJJJIIJJICEGHIIJJJJIIFFFHHEHIIEHF=EDFFD?CCCDDD:@@2<'5:>>:44>@A<BC?CD####
+@ERR884056.2868977
+CGGTGATCTTGATACAAACCGCCTCTTCGAAGGATTCCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCTGTCTCTTATACACAT
++
+@@@DDDBDFHDHDGHEHIJFGHGIFFIIF9FG@DAGBGHG@GDF?DFGAA8=BEB>>>?5;@B8=8ACC@CD#############################
+@ERR884056.2875483
+TTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAAAGCCTAATTTCGGGGCGTTAATTCGGGGTGAACTTCTGTTATCGGGGCTTCACTCC
++
+@@CFADDFHDFFFGHGCGGIJIIIDFIHCIIIE?FHI'.=)73@C########################################################
+@ERR884056.2878314
+TTTTTTTACCCTTCGTGAGAATTTCCCATCTGTTTATCTTTTAAAAAGATAACCATCAGCGACAGCCACAAAATTCCGTTGACAAGGTTGAAGAGATTAAA
++
+@BCDFFFFDHHHHIGHGGHIIJJJJJJ@GHIIIHIJJHJIIGGHH@GE?G=BF=;C@>@7;=EDFEAEEABA?>5>@>5:19A>(92@@9>>A>?CCC###
+@ERR884056.2889097
+CCTGAATTGCGGCGTATCCCACAGCGCCAATGAAACAGAGGCTTATGCCCTGCAAGAAGCGCAACAGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATT
++
+CCCFFFFFHHHGGJJJIGGHIIIHGFHHGIJHGC=FGHGIIFCCEECFFFCCBEC;CCC?>BDDBBBCC>AADDAACC>ADDCD@@98:9555>CC:3>CC
+@ERR884056.2890162
+CTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAACAGGCGGTTTGTATCAAGATCAC
++
+BC@FFFFFHHHHHJFIGIJJJJJIJJIIIJJJHHIJIIJIJJJIJJJJIGAEGGCFHBCA?BCCAC>CADC>ACD??8()<AB>9<B<@############
+@ERR884056.2890892
+GCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGCTGTCTCTTTTACACATCTCCGACCCCACGAGACTAAGGCGAAACTC
++
+BBBDDDDDHHHHHJIIIBGGHHHIGIIHIGIIIJIGD@CDB=338?<:5;@C>>CCB8>@::3(+(4++4@@>4:<5&&08@<9-&&5::@AD########
+@ERR884056.2892198
+GGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCT
++
+@B@DFFDFHHFFHIGGIGIJJJJJJJJGJIJIIJGIEGDGIIGICGFHH;EBFHIIIGGGHEFHIHBFF;>CCAC<=5ACA3:?AC@:>;:5;@CCCCB##
+@ERR884056.2892595
+GGTTGAAAATTCGTAAAGCACCAGACAGAGAGGGAAAAGTAACGCCTGACGTCCAAGACTGGCACCGGAAGCTAATTTATTTTGCATGCAATTTCTTCGCA
++
+@@BDDFEFHHHHHIIIJIJJIHGJIIJJHIHIIIJIJGF9?FGHIIEHGGA@;@;C7(.7AA?CF;ABBBB?:>5AA>CD@CAC#################
+@ERR884056.2892663
+AGAGTGAATTGTTCAATGTTTTGCGCCAGTAATATTGCCAGACAGGTGATGATAAACCACACCACCCCCGCCAGCATCACCGGACGGCGACCAATACGATC
++
+@@CF=BDEHHGHHIHIGDCJHJEHIJIIJFHIBIJJDHIGFHIGFH?FHGDEEFGGIH;B@CFHHIIHHBADDDDDDDDCC?55@@BBD30<9?3>>8<<A
+@ERR884056.2895985
+GATCACCGCGCTGATGGCGAACGTGGCGCTGGTTTCTCCGCTACTTGGTCCGCTGGTTCGCGCGTCGTGGATCCCTGTGCTGCCCTGGGAAGGCATGCTTG
++
+??@7=+=AC18@D@F4C9E10@DG9BB@A:F######################################################################
+@ERR884056.2898975
+CTCATATCGCTGGCAAACAGGGTTAATCGCACCAGTCCCGCATTCGCCAGACCAATGCCGAAAGCATAAATACTTAACCCGGCGGTCATCCATAAATACGC
++
+@BCDDDFFCFHHHJHJJJIIHIFHHGIHIIIJJEHIJJJJIIHFFGIGGHHFHHGFFFCBABB;ACCCA>@CCC(;,,+85>>B<>@9AACCDCAA>>A?5
+@ERR884056.2901629
+TTACCGGCGAGCAGTTGAGCAGCTCTGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGGAACTTGCTTGTTGGGGGTTCGACCTCC
++
+@@@DFFFFHHHHFHDHGDFHGEHI3?DHGIIGG88BG@6C;=)=7).=@9)..7=749AC3)07)<@@#################################
+@ERR884056.2909363
+ATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCTAACGAATCCCAGACACAGCGCACCC
++
+<@@DFFFDFFFFH4EHIEHGHGDAFHFC@DGGICHCFIJJJ<:@@;:5=?B9<;>??AC8=@:/+<?CC(2><5)2@C#######################
+@ERR884056.2921952
+ATCCACGCCAGCAATGGCAGGCTAACGAATCCCAGCGGCAGCGCCCCCGCCACAAAGCGGCCGCTCTTCAGCACCAGCTTATAGTCACGACCGAGTTACTT
++
+@@@DDDDDHHHHHIIIIHHII68CC?::?)6BHEBDG(;45;@AEBB>/;8=@(9A>9;;7<@&082>@################################
+@ERR884056.2922822
+ATTCATAGCTGCTCAACTGCTCGCCGGTAATGATGATAATCGGCGACTGGGCGATCCACGCCAGCAATGGCAGGCCAACGAATCCCAGCCCCCGCGCGCCC
++
+@CCFFFFFHHHHGJJIJJJJJJJJJJEHHIJJJJIIJJGIGGHIJIHFDDDDDB@DDDDDDDDBDDAAC:ACDB###########################
Binary file test-data/ecoli_cgMLST/ecoli_b0842_1to5.comp.b has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ecoli_cgMLST/ecoli_b0842_1to5.fasta	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,10 @@
+>b0842_1
+ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCGATGACCGCGTATCTGGCGGGCGGGATGTTTTTACAATGGCTGCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGAGTGGTGTGGTTTATCGTCACCTGTCTGGCAATATTGCTGGCGCAAAACATTGAACAATTCACCCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAGGGGATGTTTGTTTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACGAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGTCTGCCGTTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATGATTGGTCTATTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACTGCCGGGTTAAGTATTTATGCTTTCGGTATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCCGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACTGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAA
+>b0842_2
+ATGCAAAACCGATTACAAACCGGCGCACGACTGGGGCGTTCGGCGTTACTTTTTCCTCTTTGTCTGGTCCTGTACGAATTCTCGACATATATCGCTAACGATATGATTCAGCCCGGCATGTTGGCTGTAGTGGAGCAATATCAGGCTGGAATTGACTGGGTGCCAACGTCCATGACTGCCTATCTGGCAGGTGGCATGTTCTTACAATGGTTACTTGGGCCGTTGTCGGATCGTGTTGGTCGCCGTCCGGTGATGCTGGTGGGGGTGGTGTGGTTTATCGTCACCTGTCTCGCCACGTTACTGGCACAAAATATTGAACAATTTACGGTGTTACGTTTTTTACAAGGAATTAGCCTCTGTTTTATTGGTGCTGTGGGCTATGCTGCAATTCAGGAGTCTTTCGAAGAGTCGGTATGTATTAAAATTACAGCGCTTATGGCGAACGTCGCTCTGATTGCTCCTCTCCTTGGCCCTTTAGTAGGGGCCGCCTGGGTGCATATGCTGCCCTGGGAGGGGATGTTTATCCTCTTTGCAGTGCTGGCGGCCATTTCCTTTGTGGGCCTGCAGCGAGCAATGCCAGAAACAGCAACCCGTATCGGTGAAAAGCTCTCTTTAAAAGAGTTAGGTCGTGACTACAAACAGGTATTAAAGAATGGTCGCTTTGTAGCCGGAGCTCTGGCCCTGGGATTTGTTAGCTTGCCATTACTGGCGTGGATTGCCCAATCACCCATTATCATTATCACGGGCGAGAAATTAAGCAGCTATGAATATGGCCTGTTACAGGTGCCTGTTTTTGGCGCACTGATTGCTGGCAACCTGGTACTGGCACGGTTAACTGCACGGCGCACAGTACGTTCGTTGATCATTATGGGTGGCTGGCCGATTGTTATCGGGCTGGTCGTTGCTGCGATCGCGACGGCTTTCTCCTCACATGCCTATTTATGGATGACAGCGGGATTAAGTATCTATGCTTTTGGTATTGGCCTGGCCAATGCCGGATTGGTTCGTTTGACCTTGTTTGCCAGTGATATGAGTAAAGGTACAGTGTCGGCGGCCATGGGAATGGTACAGATGCTGATCTTTACGGTGGGAATTGAAGTCAGTAAACACGCATGGTTAGGGGGTGGTAATGGCATGTTTAACCTGTTCAATCTGGCGAATGGTGTTATCTGGCTGCTGTTGATGGTGATTTTTTTACGTGATAAAAGCGTTGGAAATTCACAGAAAGCTTAA
+>b0842_3
+ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCAATGACCGCATATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGGGTGGTGTGGTTTATCATCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACTCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACAAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGCCTGCCATTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATTATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGCATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTCGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACTGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAA
+>b0842_4
+ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCGATGACTGCGTATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGTTGTCGGATCGTATTGGCCGCCGTCCGGTGATGTTGGCGGGAGTGGTGTGGTTTATCGTCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACCCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCCGTTTGTATCAAGATCACCGCGCTAATGGCGAACGTGGCGCTGATTGCTCCACTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAAGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACGAGCTATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCGCTGAAAGAACTCGGTCGTGACTATAAGTTGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGCCTGCCGTTGTTGGCGTGGATCGCCCAGTCGCCGATTATCATTATTACCGGTGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATGATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTATTTATGCTTTCGGTATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGGATGCTGCAAATGCTGATCTTTACCGTCGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACTGTTTAATCTCTTCAACCTTGTCAACGGCATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCGCACGAAGGGTAA
+>b0842_5
+ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGGTTCCTACTTCGATGACCGCGTATCTGGCGGGCGGGATGTTTTTACAATGGCTCCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGATGCTGGCGGGAGTGGTGTGGTTTATCGTCACCTGTCTGGCAATATTACTGGCGCAAAACATTGAACAATTCACCCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAGTCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAGGGGATGTTTGTCTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGGTCTGCAACGAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCGCTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGGTCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGCCTGCCGTTGTTGGCGTGGATCGCCCAGTCGCCGATTATCATTATTACCGGTGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTTGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGCCGATTATGATTGGTCTGTTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACCGCCGGGTTAAGTCTTTATGCTTTCGGTATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCGGCGATGGGGATGCTGCAAATGCTGATCTTTACCGTCGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGGCAACGGACTGTTTAATCTCTTCAACCTTGTCAACGGCATTTTGTGGCTGTTGCTGATGGTTATCTTTTTAAAAGATAAACAGATGGGAAATTCGCACGAAGGGTAA
Binary file test-data/ecoli_cgMLST/ecoli_b0842_1to5.index.b has changed
Binary file test-data/ecoli_cgMLST/ecoli_b0842_1to5.length.b has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ecoli_cgMLST/ecoli_b0842_1to5.name	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,5 @@
+b0842_1
+b0842_2
+b0842_3
+b0842_4
+b0842_5
Binary file test-data/ecoli_cgMLST/ecoli_b0842_1to5.seq.b has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/generate_test_data.sh	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,30 @@
+#!/usr/bin/bash
+
+# E. coli locus b0842 (b0842.fasta.gz) downloaded from Enterobase E. coli cgMLST scheme
+# requires: wget, kma, bwa, samtools, bedtools
+
+gunzip b0842.fasta.gz
+
+# Take first 5 alleles to reduce size of test data
+mkdir ecoli_cgMLST
+head -n 10 b0842.fasta > ecoli_cgMLST/ecoli_b0842_1to5.fasta
+
+kma index -k 8 -i ecoli_cgMLST/ecoli_b0842_1to5.fasta -o ecoli_cgMLST/ecoli_b0842_1to5
+
+wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR884/ERR884056/ERR884056_1.fastq.gz
+
+# Use bwa to map reads to reduced E. coli locus b0842
+# and extract only mapped reads (to reduce size of test dataset)
+bwa index ecoli_cgMLST/ecoli_b0842_1to5.fasta
+
+bwa mem ecoli_cgMLST/ecoli_b0842_1to5.fasta ERR884056_1.fastq.gz -o ERR884056_1_ecoli_b0842_1to5.sam
+
+samtools view ERR884056_1_ecoli_b0842_1to5.sam -bo ERR884056_1_ecoli_b0842_1to5.bam
+
+# Select mapped reads
+samtools view -b -F 4 ERR884056_1_ecoli_b0842_1to5.bam > ERR884056_1_ecoli_b0842_1to5.mapped.bam
+
+samtools sort -n ERR884056_1_ecoli_b0842_1to5.mapped.bam -o ERR884056_1_ecoli_b0842_1to5.mapped.sort.bam
+
+bedtools bamtofastq -i ERR884056_1_ecoli_b0842_1to5.mapped.sort.bam -fq ERR884056_ecoli_b0842.mapped_R1.fastq
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_database.loc	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,7 @@
+# Tab separated with three columns:
+# - value (Galaxy records this in the Galaxy DB)
+# - name (Galaxy shows this in the UI)
+# - path (folder name containing the KMA index)
+#
+#
+test_index	"Test Index"	${__HERE__}/ecoli_cgMLST/ecoli_b0842_1to5
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,8 @@
+<?xml version="1.0"?>
+<tables>
+    <!-- Locations of KMA index in the required format -->
+    <table name="kma_index" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="tool-data/kma_index.loc" />
+    </table>
+</tables>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test	Sat Feb 15 15:32:58 2020 -0500
@@ -0,0 +1,8 @@
+<?xml version="1.0"?>
+<tables>
+    <!-- Locations of KMA index in the required format -->
+    <table name="kma_index" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="${__HERE__}/test-data/test_database.loc" />
+    </table>
+</tables>