Mercurial > repos > iuc > msa_datatypes
view test-data/1.stockholm @ 0:70227007b991 draft default tip
Imported from capsule None
author | iuc |
---|---|
date | Tue, 22 Apr 2014 13:55:42 -0400 |
parents | |
children |
line wrap: on
line source
# STOCKHOLM 1.0 #=GF ID UPSK #=GF SE Predicted; Infernal #=GF SS Published; PMID 9223489 #=GF RN [1] #=GF RM 9223489 #=GF RT The role of the pseudoknot at the 3' end of turnip yellow mosaic #=GF RT virus RNA in minus-strand synthesis by the viral RNA-dependent RNA #=GF RT polymerase. #=GF RA Deiman BA, Kortlever RM, Pleij CW; #=GF RL J Virol 1997;71:5990-5996. AF035635.1/619-641 UGAGUUCUCGAUCUCUAAAAUCG M24804.1/82-104 UGAGUUCUCUAUCUCUAAAAUCG J04373.1/6212-6234 UAAGUUCUCGAUCUUUAAAAUCG M24803.1/1-23 UAAGUUCUCGAUCUCUAAAAUCG #=GC SS_cons .AAA....<<<<aaa....>>>> //