view test-data/output_obiconvert.fasta @ 3:e614dcabd870 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/obitools commit 5d3c7a7b3f7d687bb03ef7993ddf1a6507d655bd"
author iuc
date Mon, 10 May 2021 19:34:04 +0000
parents 0de27b538106
children
line wrap: on
line source

>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=1; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
TTAGCCCTAAACACAAGTAATTATTATAACAAAATCATTCGCCAGAGTACTACCGGCAAT
AGCTCAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=2; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTGTTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=3; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAG
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=9; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATCCCCTT
>HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=10; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACAGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=11; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGGACTACTAGCAATA
GCTTAAAACTCAAAGGACTTGGCGGTGCTTTATATCCCT
>HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=12; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
TTAGCCCTAAACATAGATAATTTTACAACAAAATAATTCGCCAGAGGACTACTAGCAATA
GCTTAAAACTCAAAGAACTGGGCGGTGCTTTATATCCCG
>HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=14; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
TTAGCCCTAAACATAAACATTCAATAAACGAGAATGTTCGCCAGTGTACTTCTAGCAACA
GGCTGAAACTCAAAGGACTTGGCGGTGGTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=17; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
GCCTGAAACTCACAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=18; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
AGCATAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=19; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTGCTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACGCTT
>HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=21; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
TTAGCCCTAAACACAAGTAATTATTATAACAAAATTATTCGCCAGAGTTCTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTG
>HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=22; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACGCGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=23; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATAAACATTCAATAAACACGAATGTTCGCCAGAGTACTACTAGCAACA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=24; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTGCTACCTGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=25; obiclean_samplecount=1; obiclean_status={'13a_F730603': 's'}; obiclean_head=True; 
CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACAGGCAAT
AGCTCAAAACTCAAAGAACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:59:11971:12063#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=26; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGTCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:111:19168:18517#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=27; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATCCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:41:9316:2256#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=28; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGAAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:33:9900:9541#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=29; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
CTAGCCCTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=30; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTGATACTAGCAACA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=31; obiclean_samplecount=1; obiclean_status={'13a_F730603': 's'}; obiclean_head=True; 
CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACCGGCACT
AGCTTACAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:19:6313:16567#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=32; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
GCCTGAAACTCAAAGGGCTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=33; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
GCCTGGAACGCAAAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=34; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
GCCTGAAACTCAAAGCACTCGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=35; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTCATACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:89:9710:20652#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=36; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTATATCCCT
>HELIUM_000100422_612GNAAXX:7:71:17473:7401#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=37; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGTAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=5; obiclean_headcount=0; seq_rank=38; obiclean_samplecount=1; obiclean_status={'13a_F730603': 's'}; obiclean_head=True; 
CAATA
>HELIUM_000100422_612GNAAXX:7:99:8183:13912#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=39; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTC
>HELIUM_000100422_612GNAAXX:7:22:1798:3790#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=40; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTGCTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:115:14354:10118#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=41; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTCGCAACA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:103:3594:15996#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=42; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
CTAGCCTTAAACACAAATAGTTATGCAAACACAACTATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=43; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCACCAGAGTACTAGCGGCAAC
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:76:18268:14980#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=44; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
TTACCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:25:7789:3090#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=45; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACAGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:42:19757:3800#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=46; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATACAAAATTATTCGCCAGAGTACTACCGGCAATA
GCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:116:14244:17926#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=47; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCAAGAGTACTACTAGCAACA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:72:12959:5736#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=48; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACACCCCT
>HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=49; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTCGGCCAGAGTACTACTAGCAACA
GCATGAAACTCAAAGAACTGGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:120:16005:7955#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=98; obiclean_headcount=0; seq_rank=50; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
GCCGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=51; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATAATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=52; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTAGTACTAGCAACA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=53; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
TTAGCCCTAAACATAGATAATTTTACAACAAAATAATTCGCCAGAGGACTACTAGCAATA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=54; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTGCCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=55; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACGAGCAACA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=56; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
TTAGCCCTAAACACAAGACATTAATATAACGAGATTAATCGACAGAGTACTACCGGCTAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=57; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
CTAGCCTTAAACACAAATAGTTATGCAGACAAAACTATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=58; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATGAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB count=2; merged_sample={'29a_F260619': 2}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=7; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
TTAGCCCTAAACACAAGTAATTATTATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS_SUB_SUB_CMP count=2; merged_sample={'29a_F260619': 1, '15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=2; seq_length=100; obiclean_headcount=0; seq_rank=13; obiclean_samplecount=2; obiclean_status={'29a_F260619': 'i', '15a_F730814': 'i'}; obiclean_head=False; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCTGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS_SUB_SUB count=2; merged_sample={'26a_F040644': 2}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=15; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTTGCCAGAGTACTACTAGCAACA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
>HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS_SUB_SUB count=2; merged_sample={'15a_F730814': 2}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=20; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCTTT
>HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP count=3; merged_sample={'29a_F260619': 3}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=6; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
TTAGCCCTAAACACAAATAATTACACAAACAAAATTGTTCACCAGAGTACTAGCGGCAAC
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB count=7; merged_sample={'29a_F260619': 7}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=4; obiclean_headcount=0; seq_rank=16; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
TTTT
>HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB count=46; merged_sample={'13a_F730603': 46}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=1; seq_rank=8; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'h'}; obiclean_head=True; 
CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB count=61; merged_sample={'29a_F260619': 30, '15a_F730814': 31}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=2; seq_rank=4; obiclean_samplecount=2; obiclean_status={'29a_F260619': 'h', '15a_F730814': 'h'}; obiclean_head=True; 
TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
>HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP count=64; merged_sample={'26a_F040644': 64}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=99; obiclean_headcount=1; seq_rank=5; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'h'}; obiclean_head=True; 
TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT