view test-data/output_obiuniq.fasta @ 3:e614dcabd870 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/obitools commit 5d3c7a7b3f7d687bb03ef7993ddf1a6507d655bd"
author iuc
date Mon, 10 May 2021 19:34:04 +0000
parents 0de27b538106
children
line wrap: on
line source

>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=47; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=115.761290673; seq_a_mismatch=1; forward_tag=gcctcct; seq_b_mismatch=13; experiment=wolf_diet; mid_quality=69.1492537313; avg_quality=68.8701298701; seq_a_single=46; score_norm=1.86711759151; status=full; direction=reverse; seq_b_insertion=1; seq_b_deletion=1; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ttagccctaaacacaagtaattattataacaaaatcattcgccagagtactaccggcaat
agctcaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=60; sminR=40.0; tail_quality=66.9; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=231.881364714; seq_a_mismatch=0; forward_tag=gcctcct; seq_b_mismatch=2; experiment=wolf_diet; mid_quality=78.447761194; avg_quality=76.9545454545; seq_a_single=46; score_norm=3.74002201152; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=52; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=167.91734192; seq_a_mismatch=5; forward_tag=gcctcct; seq_b_mismatch=5; experiment=wolf_diet; mid_quality=75.0820895522; avg_quality=74.0064935065; seq_a_single=46; score_norm=2.70834422451; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=66.6; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaag
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB sminR=40.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 30, '15a_F730814': 31}; forward_score=72.0; experiment=wolf_diet; reverse_score=72.0; seq_length_ori=154; count=61; seq_length=100; status=full; mode=alignment; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP ali_length=63; sminR=40.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 64}; forward_score=72.0; forward_tag=gaatatc; experiment=wolf_diet; seq_a_single=45; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=64; seq_length=99; status=full; mode=alignment; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP ali_length=62; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 3}; forward_score=72.0; seq_a_mismatch=2; forward_tag=gcctcct; experiment=wolf_diet; seq_a_single=46; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=3; seq_length=100; mode=alignment; seq_b_single=46; 
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB ali_length=62; sminR=40.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 2}; forward_score=72.0; forward_tag=gcctcct; experiment=wolf_diet; seq_a_single=46; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=2; seq_length=100; status=full; mode=alignment; seq_b_single=46; 
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB sminR=40.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'13a_F730603': 46}; forward_score=72.0; forward_tag=aattaac; experiment=wolf_diet; status=full; seq_b_deletion=0; seq_a_insertion=0; reverse_tag=aattaac; count=46; seq_length=100; mode=alignment; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=59; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'15a_F730814': 1}; forward_score=72.0; score=223.86908915; seq_a_mismatch=2; forward_tag=gaagtag; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=77.4552238806; avg_quality=76.0519480519; seq_a_single=46; score_norm=3.61079176049; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gaagtag; count=1; seq_length=100; mode=alignment; head_quality=66.3; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttatcccctt
>HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS_SUB_SUB ali_length=62; seq_ab_match=58; sminR=40.0; tail_quality=63.3; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'13a_F730603': 1}; forward_score=72.0; score=215.812703412; seq_a_mismatch=3; forward_tag=aattaac; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=76.2388059701; avg_quality=74.6883116883; seq_a_single=46; score_norm=3.48085005502; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=aattaac; count=1; seq_length=100; mode=alignment; head_quality=65.3; seq_b_single=46; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=62; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=243.872474161; seq_a_mismatch=1; forward_tag=gaatatc; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=79.0; avg_quality=77.431372549; seq_a_single=45; score_norm=3.87099165336; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=67.0; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=59; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=219.686655506; seq_a_mismatch=0; forward_tag=gaatatc; seq_b_mismatch=4; experiment=wolf_diet; mid_quality=67.7443609023; avg_quality=67.3986928105; seq_a_single=45; score_norm=3.48708976993; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=63.2; seq_b_single=45; 
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcttaaaactcaaagaactgggcggtgctttatatcccg
>HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS_SUB_SUB_CMP ali_length=62; sminR=40.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1, '15a_F730814': 1}; forward_score=72.0; seq_b_mismatch=0; experiment=wolf_diet; seq_a_single=46; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; count=2; seq_length=100; mode=alignment; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacctgcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB ali_length=63; seq_ab_match=56; sminR=40.0; tail_quality=47.6; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=195.576462373; seq_a_mismatch=0; forward_tag=gaatatc; seq_b_mismatch=7; experiment=wolf_diet; mid_quality=58.2105263158; avg_quality=57.1699346405; seq_a_single=45; score_norm=3.10438829164; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=52.9; seq_b_single=45; 
ttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaaca
ggctgaaactcaaaggacttggcggtggtttacatccct
>HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS_SUB_SUB ali_length=63; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 2}; forward_score=72.0; forward_tag=gaatatc; seq_b_mismatch=0; experiment=wolf_diet; seq_a_single=45; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=2; seq_length=99; status=full; mode=alignment; head_quality=67.0; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB ali_length=58; sminR=40.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=50; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 7}; forward_score=72.0; forward_tag=gcctcct; experiment=wolf_diet; seq_a_single=0; status=full; seq_b_insertion=0; seq_b_deletion=50; seq_a_insertion=0; seq_length_ori=58; reverse_tag=gcctcct; count=7; seq_length=4; mode=alignment; seq_b_single=0; 
tttt
>HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS_SUB_SUB ali_length=63; seq_ab_match=57; sminR=40.0; tail_quality=66.7; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=203.860719115; seq_a_mismatch=5; forward_tag=gaatatc; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=75.6541353383; avg_quality=74.1764705882; seq_a_single=45; score_norm=3.23588443039; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=62.0; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcacaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=60; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=231.924768153; seq_a_mismatch=2; forward_tag=gcctcct; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=78.0820895522; avg_quality=76.5714285714; seq_a_single=46; score_norm=3.74072206698; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=65.9; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcataaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=57; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=207.883730153; seq_a_mismatch=4; forward_tag=gcctcct; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=75.3208955224; avg_quality=74.2532467532; seq_a_single=46; score_norm=3.35296338956; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=67.2; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctaccggcaat
agcttaaaactcaaaggacttggcggtgctttatacgctt
>HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS_SUB_SUB ali_length=62; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'15a_F730814': 2}; forward_score=72.0; seq_a_mismatch=1; forward_tag=gaagtag; experiment=wolf_diet; seq_a_single=46; status=full; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gaagtag; count=2; seq_length=100; mode=alignment; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccttt
>HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=60; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=231.873033258; seq_a_mismatch=2; forward_tag=gcctcct; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=77.4179104478; avg_quality=76.0649350649; seq_a_single=46; score_norm=3.7398876332; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ttagccctaaacacaagtaattattataacaaaattattcgccagagttctaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctg
>HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=60; sminR=40.0; tail_quality=67.1; reverse_match=tagaacaggctcctctag; seq_a_deletion=1; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'15a_F730814': 1}; forward_score=72.0; score=219.874676069; seq_a_mismatch=1; forward_tag=gaagtag; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=77.5149253731; avg_quality=76.1558441558; seq_a_single=46; score_norm=3.54636574304; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=1; seq_length_ori=154; reverse_tag=gaagtag; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacgcgcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS_SUB_SUB ali_length=63; seq_ab_match=58; sminR=40.0; tail_quality=66.8; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=211.83390837; seq_a_mismatch=5; forward_tag=gaatatc; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=77.3834586466; avg_quality=75.9803921569; seq_a_single=45; score_norm=3.36244299; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=66.5; seq_b_single=45; 
ttagccctaaacataaacattcaataaacacgaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=57; sminR=40.0; tail_quality=65.3; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'15a_F730814': 1}; forward_score=72.0; score=207.828655885; seq_a_mismatch=4; forward_tag=gaagtag; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=76.552238806; avg_quality=75.1948051948; seq_a_single=46; score_norm=3.35207509492; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gaagtag; count=1; seq_length=100; mode=alignment; head_quality=66.9; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctacctgcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP ali_length=61; seq_ab_match=54; sminR=40.0; tail_quality=66.9; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'13a_F730603': 1}; forward_score=72.0; score=181.620394786; seq_a_mismatch=1; forward_tag=aattaac; seq_b_mismatch=6; experiment=wolf_diet; mid_quality=66.3880597015; avg_quality=66.4545454545; seq_a_single=46; score_norm=2.97738352108; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=1; seq_a_insertion=0; seq_length_ori=154; reverse_tag=aattaac; count=1; seq_length=100; mode=alignment; head_quality=66.9; seq_b_single=47; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
agctcaaaactcaaagaacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:59:11971:12063#0/2_CONS_SUB_SUB ali_length=62; seq_ab_match=62; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=247.995051728; seq_a_mismatch=0; forward_tag=gcctcct; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=78.9850746269; avg_quality=77.4285714286; seq_a_single=46; score_norm=3.99992018915; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgtcagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:111:19168:18517#0/2_CONS_SUB_SUB ali_length=63; seq_ab_match=60; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'15a_F730814': 1}; forward_score=72.0; score=223.825469474; seq_a_mismatch=1; forward_tag=gaagtag; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=77.8955223881; avg_quality=76.4805194805; seq_a_single=45; score_norm=3.55278522975; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=1; seq_length_ori=154; reverse_tag=gaagtag; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattatccgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:41:9316:2256#0/2_CONS_SUB_SUB ali_length=62; seq_ab_match=61; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=239.993848494; seq_a_mismatch=1; forward_tag=gcctcct; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=78.6343283582; avg_quality=77.1233766234; seq_a_single=46; score_norm=3.87086852409; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ttagccctaaacacaagaaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:33:9900:9541#0/2_CONS_SUB_SUB ali_length=62; seq_ab_match=62; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'13a_F730603': 1}; forward_score=72.0; score=247.949713348; seq_a_mismatch=0; forward_tag=aattaac; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=78.8955223881; avg_quality=77.3506493506; seq_a_single=46; score_norm=3.99918892497; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=aattaac; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ctagccctaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=54; sminR=40.0; tail_quality=66.8; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=179.847313607; seq_a_mismatch=6; forward_tag=gaatatc; seq_b_mismatch=3; experiment=wolf_diet; mid_quality=74.2932330827; avg_quality=73.2418300654; seq_a_single=45; score_norm=2.8547192636; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=65.7; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtgatactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB ali_length=62; seq_ab_match=58; sminR=40.0; tail_quality=57.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'13a_F730603': 1}; forward_score=72.0; score=215.988419267; seq_a_mismatch=4; forward_tag=aattaac; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=76.0746268657; avg_quality=74.2142857143; seq_a_single=46; score_norm=3.48368418172; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=aattaac; count=1; seq_length=100; mode=alignment; head_quality=66.5; seq_b_single=46; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcact
agcttacaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:19:6313:16567#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=60; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=227.826165596; seq_a_mismatch=3; forward_tag=gaatatc; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=77.4135338346; avg_quality=76.0261437908; seq_a_single=45; score_norm=3.61628834279; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=66.6; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaagggcttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=57; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=203.794981474; seq_a_mismatch=5; forward_tag=gaatatc; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=76.3909774436; avg_quality=75.1241830065; seq_a_single=45; score_norm=3.23484097578; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=66.4; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctggaacgcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=56; sminR=40.0; tail_quality=62.3; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=195.641193686; seq_a_mismatch=0; forward_tag=gaatatc; seq_b_mismatch=7; experiment=wolf_diet; mid_quality=63.1954887218; avg_quality=63.091503268; seq_a_single=45; score_norm=3.10541577279; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=62.5; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaagcactcggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB ali_length=62; seq_ab_match=58; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'15a_F730814': 1}; forward_score=72.0; score=215.812113201; seq_a_mismatch=3; forward_tag=gaagtag; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=75.723880597; avg_quality=74.5519480519; seq_a_single=46; score_norm=3.4808405355; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gaagtag; count=1; seq_length=100; mode=alignment; head_quality=66.4; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtcataccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:89:9710:20652#0/2_CONS_SUB_SUB ali_length=63; seq_ab_match=62; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=243.910293117; seq_a_mismatch=0; forward_tag=gaatatc; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=78.8421052632; avg_quality=77.2941176471; seq_a_single=45; score_norm=3.87159195424; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=67.0; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:71:17473:7401#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=60; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'15a_F730814': 1}; forward_score=72.0; score=231.883938289; seq_a_mismatch=1; forward_tag=gaagtag; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=77.2089552239; avg_quality=75.7857142857; seq_a_single=46; score_norm=3.74006352079; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gaagtag; count=1; seq_length=100; mode=alignment; head_quality=65.5; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggtaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB ali_length=59; seq_ab_match=59; sminR=40.0; tail_quality=93.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=49; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'13a_F730603': 1}; forward_score=72.0; score=235.999642017; seq_a_mismatch=0; forward_tag=aattaac; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=93.0; avg_quality=93.0; seq_a_single=0; score_norm=3.99999393249; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=49; seq_a_insertion=0; seq_length_ori=59; reverse_tag=aattaac; count=1; seq_length=5; mode=alignment; head_quality=93.0; seq_b_single=0; 
caata
>HELIUM_000100422_612GNAAXX:7:99:8183:13912#0/2_CONS_SUB_SUB ali_length=62; seq_ab_match=60; sminR=40.0; tail_quality=67.1; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'13a_F730603': 1}; forward_score=72.0; score=231.903850642; seq_a_mismatch=1; forward_tag=aattaac; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=78.3358208955; avg_quality=76.8701298701; seq_a_single=46; score_norm=3.74038468777; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=aattaac; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctc
>HELIUM_000100422_612GNAAXX:7:22:1798:3790#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=59; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'13a_F730603': 1}; forward_score=72.0; score=223.82253574; seq_a_mismatch=3; forward_tag=aattaac; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=78.3208955224; avg_quality=76.8506493506; seq_a_single=46; score_norm=3.61004089903; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=aattaac; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtgctaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:115:14354:10118#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=59; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=219.850378027; seq_a_mismatch=2; forward_tag=gaatatc; seq_b_mismatch=2; experiment=wolf_diet; mid_quality=78.045112782; avg_quality=76.6013071895; seq_a_single=45; score_norm=3.4896885401; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=67.0; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactcgcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:103:3594:15996#0/2_CONS_SUB_SUB ali_length=62; seq_ab_match=60; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'13a_F730603': 1}; forward_score=72.0; score=231.92194325; seq_a_mismatch=2; forward_tag=aattaac; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=78.3805970149; avg_quality=76.9090909091; seq_a_single=46; score_norm=3.74067650404; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=aattaac; count=1; seq_length=100; mode=alignment; head_quality=67.1; seq_b_single=46; 
ctagccttaaacacaaatagttatgcaaacacaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB ali_length=62; seq_ab_match=61; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=239.985379811; seq_a_mismatch=1; forward_tag=gcctcct; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=78.8134328358; avg_quality=77.2792207792; seq_a_single=46; score_norm=3.87073193244; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:76:18268:14980#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=61; sminR=40.0; tail_quality=66.9; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=239.985254914; seq_a_mismatch=1; forward_tag=gcctcct; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=78.3208955224; avg_quality=76.8441558442; seq_a_single=46; score_norm=3.87072991797; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=67.0; seq_b_single=46; 
ttacccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:25:7789:3090#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=59; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=223.705772044; seq_a_mismatch=0; forward_tag=gcctcct; seq_b_mismatch=3; experiment=wolf_diet; mid_quality=72.4179104478; avg_quality=71.6818181818; seq_a_single=46; score_norm=3.60815761361; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=66.5; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacaggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:42:19757:3800#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=57; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=1; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'15a_F730814': 1}; forward_score=72.0; score=187.78301321; seq_a_mismatch=1; forward_tag=gaagtag; seq_b_mismatch=3; experiment=wolf_diet; mid_quality=77.7669172932; avg_quality=76.3660130719; seq_a_single=45; score_norm=3.02875827758; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=1; seq_a_insertion=1; seq_length_ori=153; reverse_tag=gaagtag; count=1; seq_length=99; mode=alignment; head_quality=67.1; seq_b_single=46; 
ttagccctaaacacaagtaattaatatacaaaattattcgccagagtactaccggcaata
gcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:116:14244:17926#0/2_CONS_SUB_SUB ali_length=63; seq_ab_match=55; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=187.882758912; seq_a_mismatch=5; forward_tag=gaatatc; seq_b_mismatch=3; experiment=wolf_diet; mid_quality=76.5338345865; avg_quality=75.2875816993; seq_a_single=45; score_norm=2.98226601448; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=67.0; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgcaagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:72:12959:5736#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=56; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=195.664863172; seq_a_mismatch=0; forward_tag=gaatatc; seq_b_mismatch=7; experiment=wolf_diet; mid_quality=63.5263157895; avg_quality=63.5098039216; seq_a_single=45; score_norm=3.10579147892; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=59.8; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacacccct
>HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=52; sminR=40.0; tail_quality=63.4; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=151.662770749; seq_a_mismatch=0; forward_tag=gaatatc; seq_b_mismatch=10; experiment=wolf_diet; mid_quality=60.1879699248; avg_quality=60.3333333333; seq_a_single=45; score_norm=2.40734556744; status=full; direction=reverse; seq_b_insertion=1; seq_b_deletion=1; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=59.2; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgtcggccagagtactactagcaaca
gcatgaaactcaaagaactgggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:120:16005:7955#0/2_CONS_SUB_SUB_CMP ali_length=64; seq_ab_match=61; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=231.880428082; seq_a_mismatch=1; forward_tag=gaatatc; seq_b_mismatch=2; experiment=wolf_diet; mid_quality=78.8939393939; avg_quality=77.3289473684; seq_a_single=44; score_norm=3.62313168878; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=152; reverse_tag=gaatatc; count=1; seq_length=98; mode=alignment; head_quality=67.0; seq_b_single=44; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gccgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=57; sminR=40.0; tail_quality=66.9; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1}; forward_score=72.0; score=207.90944986; seq_a_mismatch=2; forward_tag=gcctcct; seq_b_mismatch=3; experiment=wolf_diet; mid_quality=75.9402985075; avg_quality=74.7532467532; seq_a_single=46; score_norm=3.35337822355; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gcctcct; count=1; seq_length=100; mode=alignment; head_quality=66.7; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaataattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB ali_length=63; seq_ab_match=59; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=219.864332815; seq_a_mismatch=4; forward_tag=gaatatc; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=78.2105263158; avg_quality=76.7450980392; seq_a_single=45; score_norm=3.48991004469; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=67.0; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtagtactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=61; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=235.877819976; seq_a_mismatch=2; forward_tag=gaatatc; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=78.8646616541; avg_quality=77.3137254902; seq_a_single=45; score_norm=3.74409238057; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=67.0; seq_b_single=45; 
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP ali_length=62; seq_ab_match=59; sminR=40.0; tail_quality=66.6; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'15a_F730814': 1}; forward_score=72.0; score=223.876050008; seq_a_mismatch=3; forward_tag=gaagtag; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=77.6567164179; avg_quality=76.1818181818; seq_a_single=46; score_norm=3.61090403239; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gaagtag; count=1; seq_length=100; mode=alignment; head_quality=66.0; seq_b_single=46; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactgccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=58; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=211.837822462; seq_a_mismatch=4; forward_tag=gaatatc; seq_b_mismatch=1; experiment=wolf_diet; mid_quality=77.7969924812; avg_quality=76.385620915; seq_a_single=45; score_norm=3.36250511845; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=67.0; seq_b_single=45; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactacgagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB ali_length=62; seq_ab_match=52; sminR=40.0; tail_quality=65.6; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'15a_F730814': 1}; forward_score=72.0; score=167.712615339; seq_a_mismatch=0; forward_tag=gaagtag; seq_b_mismatch=10; experiment=wolf_diet; mid_quality=59.9104477612; avg_quality=58.6623376623; seq_a_single=46; score_norm=2.70504218289; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=gaagtag; count=1; seq_length=100; mode=alignment; head_quality=35.0; seq_b_single=46; 
ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB ali_length=62; seq_ab_match=60; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'13a_F730603': 1}; forward_score=72.0; score=231.857703869; seq_a_mismatch=0; forward_tag=aattaac; seq_b_mismatch=2; experiment=wolf_diet; mid_quality=78.5; avg_quality=77.0194805195; seq_a_single=46; score_norm=3.73964038498; status=full; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=154; reverse_tag=aattaac; count=1; seq_length=100; mode=alignment; head_quality=67.2; seq_b_single=46; 
ctagccttaaacacaaatagttatgcagacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP ali_length=63; seq_ab_match=60; sminR=40.0; tail_quality=67.0; reverse_match=tagaacaggctcctctag; seq_a_deletion=0; reverse_score=72.0; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'26a_F040644': 1}; forward_score=72.0; score=227.901935995; seq_a_mismatch=3; forward_tag=gaatatc; seq_b_mismatch=0; experiment=wolf_diet; mid_quality=78.5939849624; avg_quality=77.0784313725; seq_a_single=45; score_norm=3.61749104754; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=153; reverse_tag=gaatatc; count=1; seq_length=99; mode=alignment; head_quality=67.0; seq_b_single=45; 
ttagccctaaacatgaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct