changeset 3:e614dcabd870 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/obitools commit 5d3c7a7b3f7d687bb03ef7993ddf1a6507d655bd"
author iuc
date Mon, 10 May 2021 19:34:04 +0000
parents 12b9e285ca1c
children
files macros.xml obisort.xml test-data/illuminapairedend.output.fastq.gz test-data/output_ngsfilter_error_3.fastq test-data/output_ngsfilter_error_3.fastq.gz test-data/output_ngsfilter_unidentified.fastq test-data/output_obiannotate.fasta.gz test-data/output_obiclean_advanced.fasta.gz test-data/output_obigrep_predicat.fasta.gz test-data/output_obisort.fastq test-data/output_obiuniq.fasta.gz test-data/output_obiuniq_family.fasta.gz test-data/wolf_small.F.fastq.gz test-data/wolf_small.R.fastq.gz
diffstat 14 files changed, 404 insertions(+), 246 deletions(-) [+]
line wrap: on
line diff
--- a/macros.xml	Thu Nov 28 15:51:52 2019 -0500
+++ b/macros.xml	Mon May 10 19:34:04 2021 +0000
@@ -6,7 +6,8 @@
         </requirements>
     </xml>
 
-    <token name="@TOOL_VERSION@">1.2.11</token>
+    <token name="@TOOL_VERSION@">1.2.13</token>
+    <token name="@PROFILE@">21.01</token>
 
     <xml name="stdio">
         <stdio>
@@ -14,6 +15,80 @@
         </stdio>
     </xml>
 
+    <token name="@INPUT_FORMATS@">fastqsanger,fastqsanger.gz,fastqsolexa,fastqsolexa.gz,fasta,fasta.gz</token>
+    <token name="@GUNZIP_INPUT@"><![CDATA[
+        #if $input.ext.endswith(".gz")
+            gunzip -c '$input' > input &&
+        #else
+            ln -s '$input' input &&
+        #end if
+    ]]></token>
+    <token name="@GZIP_OUTPUT@"><![CDATA[
+        #if $input.ext.endswith(".gz")
+        | gzip -c 
+    #end if
+    ]]></token>
+    
+    <!-- generate galaxy.json to determine output format
+        - by default same as input
+        - if out_format can be specified 
+          - fasta/fastq depending on $out_format (if != "")
+          - or fasta if the tool does not support choosing the output format, e.g. obiuniq which always outputs fasta
+        - gz if $input is zipped 
+    
+        A list of outputs to include in the json can be given by
+        setting a variable $outputs = [...] listing pairs of output names and the actual output
+        (defaults to [("output", $output)])
+    -->
+    <token name="@GENERATE_GALAXY_JSON@"><![CDATA[
+        #import json
+
+        #try:
+            #silent $outputs[0]
+        #except 
+            #set outputs = [("output", $output)]
+        #end try
+
+        #if $input.ext.startswith("fastq")
+            #set ext = "fastqsanger"
+        #else if $input.ext.startswith("fasta")
+            #set ext = "fasta"
+        #end if
+
+        #try
+            #if $out_format == "fasta"
+                #set ext = "fasta"
+            #else if $out_format == "fastq"
+                #set ext = "fastqsanger"
+            #end if
+        #except
+            #set ext = "fasta"
+        #end try
+
+        #if $input.ext.endswith(".gz")
+            #set ext = ext + ".gz"
+        #end if
+
+        #set gxy_json = {}
+        #for oname, o in $outputs
+            #silent gxy_json[oname] = {"ext": ext}
+        #end for
+        && echo '${json.dumps(gxy_json)}' >> galaxy.json
+    ]]></token>
+    
+    <token name="@OUT_FORMAT@"><![CDATA[
+        #if $out_format
+            --${out_format}-output
+        #end if
+    ]]></token>
+    
+    <xml name="out_format_macro">
+        <param name="out_format" type="select" optional="true" label="Output data type" help="For FASTA/Q the the default output type is the same as the input type">
+            <option value="fasta">fasta</option>
+            <option value="fastq">fastq</option>
+        </param>
+    </xml>
+
     <token name="@OBITOOLS_LINK@">
 <![CDATA[
 --------
@@ -105,15 +180,43 @@
         <option value="taxid">taxid</option>
     </xml>
 
-    <xml name="inputtype">
-        <option value="--genbank">genbank</option>
-        <option value="--embl">embl</option>
-        <option value="--sanger">sanger</option>
-        <option value="--solexa">solexa</option>
-        <option value="--ecopcr">ecopcr</option>
-        <option value="--ecopcrdb">ecopcrdb</option>
-        <option value="--fasta" selected="true">fasta</option>
+    <xml name="input_format_options_macro">
+        <section name="input_format_options" title="Input format options" expanded="false">
+            <param name="options_inputtype" type="select"  optional="true" label="Specify the input datatype" help="default: determine automatically (should only be necessay for non FASTA/FASTQ datasets)">
+                <option value="--genbank">genbank</option>
+                <option value="--embl">embl</option>
+                <option value="--sanger">sanger</option>
+                <option value="--solexa">solexa</option>
+                <option value="--ecopcr">ecopcr</option>
+                <option value="--ecopcrdb">ecopcrdb</option>
+                <option value="--fasta">fasta (including obitools fasta extentions)</option>
+                <option value="--raw-fasta">raw fasta (more tolerant format variant)</option>
+            </param>
+            <param name="options_seqtype" type="select" optional="true" label="Specify the sequence datatype" >
+                <option value="--nuc">nucleic</option>
+                <option value="--prot">protein</option>
+            </param>
+        </section>
     </xml>
+    
+    <token name="@INPUT_FORMAT@"><![CDATA[
+        #if $input_format_options.options_inputtype
+            $input_format_options.options_inputtype
+        #else
+            #if $input.ext.startswith("fasta")
+                --fasta
+            #else if $input.ext.startswith("fastqsolexa")
+                ## input file is in fastq nucleic format produced by solexa sequencer
+                --solexa
+            #else
+                ## input file is in sanger fastq nucleic format (standard fastq)
+                --sanger
+            #end if
+        #end if
+        #if $input_format_options.options_seqtype
+            $input_format_options.options_seqtype
+        #end if
+    ]]></token>
 
     <xml name="sanitizer">
         <sanitizer invalid_char="test">
--- a/obisort.xml	Thu Nov 28 15:51:52 2019 -0500
+++ b/obisort.xml	Mon May 10 19:34:04 2021 +0000
@@ -1,67 +1,62 @@
-<tool id="obi_sort" name="obisort" version="@TOOL_VERSION@">
-    <description>sorts sequence records according to the value of a given attribute, which can be either numeric or alphanumeric</description>
-    <macros>
-        <import>macros.xml</import>
-    </macros>
-    <expand macro="requirements"/>
-    <expand macro="stdio"/>
-
-    <command>
-
-        <![CDATA[
-            obisort
-            -k '$key'
-            ${reverse}
-            '$input' > '$output'
-        ]]>
-
-    </command>
-
-    <inputs>
-        <param name="input" type="data" format="fastq,fasta,txt,tabular" label="Input sequences file" />
-        <param name="key" type="text" label="key" />
-        <param name="reverse" type="boolean" checked="false" truevalue="-r" falsevalue="" label="sorts in reverse order?" />
-        <param name="out_format" type="select" label="Output data type">
-            <option value="fasta">fasta</option>
-            <option value="fastq">fastq</option>
-        </param>
-
-    </inputs>
-    <outputs>
-        <data format="fastq" name="output" label="output with ${tool.name} on ${on_string}" >
-            <change_format>
-                <when input="out_format" value="fasta" format="fasta" />
-            </change_format>
-        </data>
-    </outputs>
-    <tests>
-        <test>
-            <param name="input" value="output_obiclean_advanced.fasta" />
-            <param name="key" value="count"/>
-            <param name="reverse" value="False"/>
-            <param name="out_format" value="fasta"/>
-            <output name="output" file="output_obisort.fasta" ftype="fasta"/>
-        </test>
-        <test>
-            <param name="input" value="output_obiclean_advanced.fasta" />
-            <param name="key" value="count"/>
-            <param name="reverse" value="True"/>
-            <param name="out_format" value="fastq"/>
-            <output name="output" file="output_obisort.fastq" ftype="fastq"/>
-        </test>
-    </tests>
-    <help><![CDATA[
-
-.. class:: infomark
-
-**What it does**
-
-obisort sorts sequence records according to the value of a given attribute, which can be either numeric or alphanumeric.
-
-@OBITOOLS_LINK@
-
-        ]]>
-
-    </help>
-    <expand macro="citation" />
-</tool>
+<tool id="obi_sort" name="obisort" version="@TOOL_VERSION@" profile="@PROFILE@">
+    <description>sorts sequence records according to the value of a given attribute</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <expand macro="stdio"/>
+
+    <command><![CDATA[
+        @GUNZIP_INPUT@
+        obisort
+        --without-progress-bar
+        -k '$key'
+        ${reverse}
+        @INPUT_FORMAT@
+        @OUT_FORMAT@
+        input
+        @GZIP_OUTPUT@
+        > '$output'
+        @GENERATE_GALAXY_JSON@
+    ]]></command>
+    <inputs>
+        <param name="input" type="data" format="@INPUT_FORMATS@,txt,tabular" label="Input sequences file" />
+        <param name="key" type="text" label="key"/>
+        <param name="reverse" type="boolean" checked="false" truevalue="-r" falsevalue="" label="sorts in reverse order?" />
+        <expand macro="input_format_options_macro"/>
+        <expand macro="out_format_macro"/>
+    </inputs>
+    <outputs>
+        <data format="auto" name="output"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="output_obiclean_advanced.fasta" />
+            <param name="key" value="count"/>
+            <param name="reverse" value="False"/>
+            <param name="out_format" value="fasta"/>
+            <output name="output" file="output_obisort.fasta" ftype="fasta"/>
+        </test>
+        <test>
+            <param name="input" value="output_obiclean_advanced.fasta" />
+            <param name="key" value="count"/>
+            <param name="reverse" value="True"/>
+            <param name="out_format" value="fastq"/>
+            <output name="output" file="output_obisort.fastq" ftype="fastqsanger"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+
+.. class:: infomark
+
+**What it does**
+
+obisort sorts sequence records according to the value of a given attribute, which can be either numeric or alphanumeric.
+
+@OBITOOLS_LINK@
+
+        ]]>
+
+    </help>
+    <expand macro="citation" />
+</tool>
Binary file test-data/illuminapairedend.output.fastq.gz has changed
Binary file test-data/output_ngsfilter_error_3.fastq has changed
Binary file test-data/output_ngsfilter_error_3.fastq.gz has changed
Binary file test-data/output_ngsfilter_unidentified.fastq has changed
Binary file test-data/output_obiannotate.fasta.gz has changed
Binary file test-data/output_obiclean_advanced.fasta.gz has changed
Binary file test-data/output_obigrep_predicat.fasta.gz has changed
--- a/test-data/output_obisort.fastq	Thu Nov 28 15:51:52 2019 -0500
+++ b/test-data/output_obisort.fastq	Mon May 10 19:34:04 2021 +0000
@@ -1,172 +1,232 @@
->HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP count=64; merged_sample={'26a_F040644': 64}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=99; obiclean_headcount=1; seq_rank=5; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'h'}; obiclean_head=True; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
-gcctgaaactcaaaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB count=61; merged_sample={'29a_F260619': 30, '15a_F730814': 31}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=2; seq_rank=4; obiclean_samplecount=2; obiclean_status={'29a_F260619': 'h', '15a_F730814': 'h'}; obiclean_head=True; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB count=46; merged_sample={'13a_F730603': 46}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=1; seq_rank=8; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'h'}; obiclean_head=True; 
-ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB count=7; merged_sample={'29a_F260619': 7}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=4; obiclean_headcount=0; seq_rank=16; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
+@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP count=64; merged_sample={'26a_F040644': 64}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=99; obiclean_headcount=1; seq_rank=5; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'h'}; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB count=61; merged_sample={'29a_F260619': 30, '15a_F730814': 31}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=2; seq_rank=4; obiclean_samplecount=2; obiclean_status={'29a_F260619': 'h', '15a_F730814': 'h'}; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB count=46; merged_sample={'13a_F730603': 46}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=1; seq_rank=8; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'h'}; obiclean_head=True; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB count=7; merged_sample={'29a_F260619': 7}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=4; obiclean_headcount=0; seq_rank=16; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
 tttt
->HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP count=3; merged_sample={'29a_F260619': 3}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=6; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
-ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB count=2; merged_sample={'29a_F260619': 2}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=7; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
-ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS_SUB_SUB_CMP count=2; merged_sample={'29a_F260619': 1, '15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=2; seq_length=100; obiclean_headcount=0; seq_rank=13; obiclean_samplecount=2; obiclean_status={'29a_F260619': 'i', '15a_F730814': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacctgcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS_SUB_SUB count=2; merged_sample={'26a_F040644': 2}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=15; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaaca
-gcctgaaactcaaaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS_SUB_SUB count=2; merged_sample={'15a_F730814': 2}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=20; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccttt
->HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=1; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
-ttagccctaaacacaagtaattattataacaaaatcattcgccagagtactaccggcaat
-agctcaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=2; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=3; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaag
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=9; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttatcccctt
->HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=10; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
-ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=11; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
-gcttaaaactcaaaggacttggcggtgctttatatccct
->HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=12; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
-ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
-gcttaaaactcaaagaactgggcggtgctttatatcccg
->HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=14; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
-ttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaaca
-ggctgaaactcaaaggacttggcggtggtttacatccct
->HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=17; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
-gcctgaaactcacaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=18; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
-agcataaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=19; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctaccggcaat
-agcttaaaactcaaaggacttggcggtgctttatacgctt
->HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=21; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
-ttagccctaaacacaagtaattattataacaaaattattcgccagagttctaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctg
->HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=22; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacgcgcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=23; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacataaacattcaataaacacgaatgttcgccagagtactactagcaaca
-gcctgaaactcaaaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=24; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctacctgcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=25; obiclean_samplecount=1; obiclean_status={'13a_F730603': 's'}; obiclean_head=True; 
-ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
-agctcaaaactcaaagaacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:59:11971:12063#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=26; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatataacaaaattattcgtcagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:111:19168:18517#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=27; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatataacaaaattatccgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:41:9316:2256#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=28; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagaaattaatataacaaaattattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:33:9900:9541#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=29; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
-ctagccctaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=30; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtgatactagcaaca
-gcctgaaactcaaaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=31; obiclean_samplecount=1; obiclean_status={'13a_F730603': 's'}; obiclean_head=True; 
-ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcact
-agcttacaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:19:6313:16567#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=32; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
-gcctgaaactcaaagggcttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=33; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
-gcctggaacgcaaaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=34; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
-gcctgaaactcaaagcactcggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=35; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtcataccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:89:9710:20652#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=36; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
-gcctgaaactcaaaggacttggcggtgctttatatccct
->HELIUM_000100422_612GNAAXX:7:71:17473:7401#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=37; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggtaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=5; obiclean_headcount=0; seq_rank=38; obiclean_samplecount=1; obiclean_status={'13a_F730603': 's'}; obiclean_head=True; 
++
+IIII
+@HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP count=3; merged_sample={'29a_F260619': 3}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=6; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaacagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB count=2; merged_sample={'29a_F260619': 2}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=7; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS_SUB_SUB_CMP count=2; merged_sample={'29a_F260619': 1, '15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=2; seq_length=100; obiclean_headcount=0; seq_rank=13; obiclean_samplecount=2; obiclean_status={'29a_F260619': 'i', '15a_F730814': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacctgcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS_SUB_SUB count=2; merged_sample={'26a_F040644': 2}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=15; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS_SUB_SUB count=2; merged_sample={'15a_F730814': 2}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=20; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccttt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=1; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
+ttagccctaaacacaagtaattattataacaaaatcattcgccagagtactaccggcaatagctcaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=2; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=3; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaagagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=9; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatcccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=10; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=11; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaatagcttaaaactcaaaggacttggcggtgctttatatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=12; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaatagcttaaaactcaaagaactgggcggtgctttatatcccg
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=14; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaacaggctgaaactcaaaggacttggcggtggtttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=17; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcacaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=18; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcataaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=19; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctaccggcaatagcttaaaactcaaaggacttggcggtgctttatacgctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=21; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagttctaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctg
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=22; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacgcgcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=23; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacacgaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=24; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctacctgcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=25; obiclean_samplecount=1; obiclean_status={'13a_F730603': 's'}; obiclean_head=True; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaatagctcaaaactcaaagaacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:59:11971:12063#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=26; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgtcagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:111:19168:18517#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=27; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattatccgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:41:9316:2256#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=28; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagaaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:33:9900:9541#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=29; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
+ctagccctaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=30; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtgatactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=31; obiclean_samplecount=1; obiclean_status={'13a_F730603': 's'}; obiclean_head=True; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcactagcttacaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:19:6313:16567#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=32; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaagggcttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=33; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctggaacgcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=34; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaagcactcggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=35; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtcataccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:89:9710:20652#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=36; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttatatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:71:17473:7401#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=37; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggtaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=5; obiclean_headcount=0; seq_rank=38; obiclean_samplecount=1; obiclean_status={'13a_F730603': 's'}; obiclean_head=True; 
 caata
->HELIUM_000100422_612GNAAXX:7:99:8183:13912#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=39; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
-ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctc
->HELIUM_000100422_612GNAAXX:7:22:1798:3790#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=40; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
-ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtgctaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:115:14354:10118#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=41; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactcgcaaca
-gcctgaaactcaaaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:103:3594:15996#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=42; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
-ctagccttaaacacaaatagttatgcaaacacaactattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=43; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
-ttagccctaaacacaagtaattaatataacaaaattattcaccagagtactagcggcaac
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:76:18268:14980#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=44; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
-ttacccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:25:7789:3090#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=45; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacaggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:42:19757:3800#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=46; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatatacaaaattattcgccagagtactaccggcaata
-gcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:116:14244:17926#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=47; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacataaacattcaataaacaagaatgttcgcaagagtactactagcaaca
-gcctgaaactcaaaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:72:12959:5736#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=48; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
-gcctgaaactcaaaggacttggcggtgctttacacccct
->HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=49; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
-ttagccctaaacataaacattcaataaacaagaatgtcggccagagtactactagcaaca
-gcatgaaactcaaagaactgggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:120:16005:7955#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=98; obiclean_headcount=0; seq_rank=50; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
-gccgaaactcaaaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=51; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatataacaaaataattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=52; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtagtactagcaaca
-gcctgaaactcaaaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=53; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
-ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
-gcctgaaactcaaaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=54; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactgccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=55; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactacgagcaaca
-gcctgaaactcaaaggacttggcggtgctttacatccct
->HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=56; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
-ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=57; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
-ctagccttaaacacaaatagttatgcagacaaaactattcgccagagtactaccggcaat
-agcttaaaactcaaaggacttggcggtgctttataccctt
->HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=58; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
-ttagccctaaacatgaacattcaataaacaagaatgttcgccagagtactactagcaaca
-gcctgaaactcaaaggacttggcggtgctttacatccct
++
+IIIII
+@HELIUM_000100422_612GNAAXX:7:99:8183:13912#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=39; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctc
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:22:1798:3790#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=40; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtgctaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:115:14354:10118#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=41; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactcgcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:103:3594:15996#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=42; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
+ctagccttaaacacaaatagttatgcaaacacaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=43; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcaccagagtactagcggcaacagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:76:18268:14980#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=44; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
+ttacccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:25:7789:3090#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=45; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacaggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:42:19757:3800#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=46; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatatacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:116:14244:17926#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=47; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgcaagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:72:12959:5736#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=48; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacacccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=49; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgtcggccagagtactactagcaacagcatgaaactcaaagaactgggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:120:16005:7955#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=98; obiclean_headcount=0; seq_rank=50; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagccgaaactcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=51; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaataattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=52; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtagtactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=53; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaatagcctgaaactcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=54; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactgccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=55; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactacgagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=56; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; 
+ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=57; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; 
+ctagccttaaacacaaatagttatgcagacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=58; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; 
+ttagccctaaacatgaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
Binary file test-data/output_obiuniq.fasta.gz has changed
Binary file test-data/output_obiuniq_family.fasta.gz has changed
Binary file test-data/wolf_small.F.fastq.gz has changed
Binary file test-data/wolf_small.R.fastq.gz has changed