changeset 0:0b103d43a2c7 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/presto commit 5d4da3eb59439ce5b1eea211b4ad1d47807d7acb
author iuc
date Wed, 30 May 2018 15:35:32 -0400
parents
children c3bf9c466305
files presto_macros.xml presto_partition.xml test-data/presto_alignsets_test_in.fastq test-data/presto_alignsets_test_out.fastq test-data/presto_assemblepairs_test_align_out.fastq test-data/presto_assemblepairs_test_join_out.fastq test-data/presto_assemblepairs_test_r1_in.fastq test-data/presto_assemblepairs_test_r2_in.fastq test-data/presto_assemblepairs_test_reference_out.fastq test-data/presto_assemblepairs_test_sequential_out.fastq test-data/presto_buildconsensus_test_input.fastq test-data/presto_buildconsensus_test_maxdiv_output.fastq test-data/presto_buildconsensus_test_maxerror_output.fastq test-data/presto_collapseseq_test_in.fastq test-data/presto_collapseseq_test_output.fastq test-data/presto_filterseq_length_test_out.fastq test-data/presto_filterseq_maskqual_test_out.fastq test-data/presto_filterseq_missing_test_out.fastq test-data/presto_filterseq_quality_test_out.fastq test-data/presto_filterseq_repeats_test_out.fastq test-data/presto_filterseq_test_in.fastq test-data/presto_filterseq_trimqual_test_out.fastq test-data/presto_maskprimers_with_barcode_test_align_out.fastq test-data/presto_maskprimers_with_barcode_test_in.fastq test-data/presto_maskprimers_with_barcode_test_score_out.fastq test-data/presto_maskprimers_without_barcode_test_align_out.fastq test-data/presto_maskprimers_without_barcode_test_in.fastq test-data/presto_maskprimers_without_barcode_test_score_out.fastq test-data/presto_pairseq_test1_r1_in.fastq test-data/presto_pairseq_test1_r1_out.fastq test-data/presto_pairseq_test1_r2_in.fastq test-data/presto_pairseq_test1_r2_out.fastq test-data/presto_parseheaders_test_add_out.fastq test-data/presto_parseheaders_test_collapse_out.fastq test-data/presto_parseheaders_test_copy_out.fastq test-data/presto_parseheaders_test_delete_out.fastq test-data/presto_parseheaders_test_expand_out.fastq test-data/presto_parseheaders_test_in.fastq test-data/presto_parseheaders_test_rename_out.fastq test-data/presto_parseheaders_test_table_out.tsv test-data/presto_parselog_test_in.txt test-data/presto_parselog_test_out.txt test-data/presto_splitseq_partition_test_in.fastq test-data/presto_splitseq_partition_test_out_atleast.fastq test-data/presto_splitseq_partition_test_out_under.fastq test-data/prestor_logs/assemble_table.tab test-data/prestor_logs/consensus-1_table.tab test-data/prestor_logs/consensus-2_table.tab test-data/prestor_logs/cregion_table.tab test-data/prestor_logs/maskqual_table.tab test-data/prestor_logs/primers-1_table.tab test-data/prestor_logs/primers-2_table.tab test-data/prestor_logs/quality-1_table.tab test-data/prestor_logs/quality-2_table.tab test-data/read1_primers.fasta test-data/read2_primers.fasta test-data/reference_repertoire.fasta
diffstat 57 files changed, 7618 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/presto_macros.xml	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,58 @@
+<macros>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1093/bioinformatics/btu138</citation>
+            <yield />
+        </citations>
+    </xml>
+    
+    <xml name="requirements">
+        <requirements>
+              <requirement type="package" version="0.5.4">presto</requirement>
+        </requirements>
+    </xml>
+    
+    <xml name="presto-coord-param">
+        <param argument="--coord" type="select"  value="presto"  label="Coordinate" help="The format of the sequence identifier which defines shared coordinate information across mate pairs.">
+            <option value="illumina">Illumina</option>
+            <option value="solexa">Solexa</option>
+            <option value="sra">SRA</option>
+            <option value="454">454</option>
+            <option value="presto">pRESTO</option>
+        </param>
+    </xml>
+    
+    <xml name="presto-log-param">
+        <param name="capture_log" type="boolean" value="false" label="Generate Detailed Log" help="Generate detailed log information that can be summarized with ParseLog."/>
+    </xml>
+    
+    <xml name="presto-log-output">
+        <data name="log_out" format="txt" label="Log from ${tool.name} on ${on_string}">
+            <filter>capture_log</filter>
+        </data>
+    </xml>
+    
+    <xml name="text-regex-validator">
+        <validator type="regex" message="Value may include alphanumeric characters, underscores and spaces.">[A-Za-z0-9_ ]+</validator>
+    </xml>
+
+    <token name="@PRESTO_URL_BASE@">https://presto.readthedocs.io/en/latest/tools</token>
+    
+    <!-- When modifying this file ensure that the version here matches the version above in requirements. -->
+    <token name="@PRESTO_VERSION@">0.5.4</token>
+    
+    <token name="@HELP_NOTE@"><![CDATA[
+
+====
+
+**Note about limitations of pRESTO tools within Galaxy:**
+
+pRESTO tools in galaxy have the following limitations vs. when run at the command line:
+
+* Inputs must be FASTQ format and cannot be FASTA format.
+* Multiple inputs files are not supported per argument (e.g. ``-1``, ``-2`` or ``-s``), i.e.
+    - Steps that take a pair of fastq inputs can only take two files, not two sets of files
+    - Steps that take a single set of fastq inputs can only take a single file
+* The ``--outdir`` and ``--outname`` options are not supported; output files are named directly
+    ]]></token>
+</macros>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/presto_partition.xml	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,53 @@
+<tool id="presto_partition" name="pRESTO Partition" version="@PRESTO_VERSION@">
+    <description>Partition a file in two</description>
+    
+    <macros>
+        <import>presto_macros.xml</import>
+    </macros>
+    
+    <expand macro="requirements"/>
+    
+    <version_command>SplitSeq.py --version</version_command>
+    <command detect_errors="exit_code"><![CDATA[
+        ln -s '$fastq_in' in.fastq &&
+        SplitSeq.py group
+          -s in.fastq
+          -f '$field'
+          --num '$threshold'
+          --outname=tmp_group &&
+        mv './tmp_group_under-${threshold}.fastq' '$lower_out' &&
+        mv './tmp_group_atleast-${threshold}.fastq' '$upper_out'
+    ]]></command>
+
+    <inputs>
+        <param argument="-s" name="fastq_in" type="data" format="fastq" label="Input FASTQ file" help="FASTQ file of sequences with barcodes/UMIs in an annotation."/>
+        <param argument="-f" name="field" type="text" value="" label="Annotation Field" help="Name of the numeric annotation field to partition by."/>
+        <param argument="--num" name="threshold" type="integer" value="0" label="Threshold" help="Numeric threshold. File will be partitions be into n &lt; threshold and n &gt;= threshold."/>
+    </inputs>
+
+    <outputs>
+        <data name="lower_out" format="fastq" label="Sequences with $field &lt; $threshold"/>
+        <data name="upper_out" format="fastq" label="Sequences with $field &gt;= $threshold"/>
+    </outputs>
+    
+    <tests>
+        <test>
+            <param  name="fastq_in" value="presto_splitseq_partition_test_in.fastq"/>
+            <param  name="field" value="CONSCOUNT"/>
+            <param  name="threshold" value="3"/>
+            <output name="lower_out" file="presto_splitseq_partition_test_out_under.fastq" sort="true"/>
+            <output name="upper_out" file="presto_splitseq_partition_test_out_atleast.fastq" sort="true"/>
+        </test>
+    </tests>
+    
+    <help><![CDATA[
+Uses pRESTO SplitSeq.py group to partition a file of sequences into two files. The input file is split based on a numeric
+annotation field to yield one file which contains all sequences with the field value less than the provided threshold and
+a second file with all sequences with the field value greater than or equal to the threshold.
+
+See the `pRESTO online help <@PRESTO_URL_BASE@/SplitSeq.html>`_ for more information.
+
+@HELP_NOTE@
+    ]]></help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_alignsets_test_in.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,16 @@
+@M01873:M01873:000000000-B9G3J:1:2117:22257:24972 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTATTCTCTCAGAGTGTCAAGCAACCCTGCCTGGCCAGGATTGGAATCCGGCCACAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTCGACCACTGAGTATGAATGAACCACAAAGTCCAAGTGCCATTTCCATAGCAAGCTACCAC
++
+EFGGFGGGG,CAFFGG,ECFFGGGGGFEGFGGFGGEDFGGGGGFGGGGGGGFGGCFGGGGGGFGGGGGGGEGGDGFGGGGDGGFFC,,C<CDC7FF??FGGGGGGGGGGG,FB,<FFG9?97EFGGGCDFEEF9FFFAEFFG?FDEGFG,:><,8AF7DFFGGG7=FF++88DCDEGGFC+++43D<,@,<DCCEDE;EFGC7,:C?9C4@CCF;7D7EFF,7E?*/*>,<8B9+;@CFFF7?######################################
+@M01873:M01873:000000000-B9G3J:1:2101:15710:11332 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTCTTCTCTCAGAGTGTCCAGCAACCCTGCCTGGCCAGGATTGGAATCCGTCCCCAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTAGACCACTGAGTATGAATGAACCACAAAGTCCAAGGGCCATTTCAGTAGAAAGCTCACAC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGDGGGGGGGGGGGGGGEGGGGGGGGGGFGGGGGGGGGGGGFFGGGGGGGGGGGGGFGGFFGGGGGGFGFFAAFFCBFFGGGGGGGFGGGGGDEFGGGGGGGGGFGGGGG,EGGGGGE+6DEGGGFGGGGGGDGGFGFDGFGGGGEFE@CFGFFGFGGGGGGGFFGFGFGG@:>FGGGGFGFFF@CCFF==5D<DFFCCGFDCCFAFFC;)/@C9
+@M01873:M01873:000000000-B9G3J:1:1112:27925:17799 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTCTTCTCTCAGAGTGTCCAGCAACCCTGCCTGGCCAGGATTGGAATCCGTCCACAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTAGACCACTGAGTATGAATGAACCACAAAGGCCAAGGGCCATTTCAGTAGAAAGCTCCAAC
++
+GG?FGCEAE6CFGGGCFGFFEGGCFF<FGGGGFFGGFGGFE<DF9FFGGGGGGGGGDDGGG@FGGDC@EEDGGDGFFFCGFGG9CC<CF<DFE@BF9FG?,EFC8FCFGGGGGGGGGAEFFGFF,??FADEGGFGGCGGGGG,5:?ADC?BEE@,,A>EFG8,3@>DB@GBF,334=46DEFG6:E9DFF:@,>C9=@EFF,EFGGFG7ECFEDF:,@?>FC69;86/A8?FC:@F=:D8C8CCCA785**2;5CC*::C5C7@68;?#############
+@M01873:M01873:000000000-B9G3J:1:1104:19905:10776 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTCTTCTCTCAGAGTGTCCAGCAACCCTGCCTGGCCAGGATTGGAATCCGTCCACAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTAGACCACTGAGTATGAATGAACCACAAAGTCCAAGGGCCATTTCAGTAGAAAGCTCACAC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFCFGGGCFFFF=FGFFGCFFGGGGGGGGGGDFCAFEFCCEFFFAF@GF4
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_alignsets_test_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,16 @@
+@M01873:M01873:000000000-B9G3J:1:2117:22257:24972 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTATTCTCTCAGAGTGTCAAGCAACCCTGCCTGGCCAGGATTGGAATCCGGCCACAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTCGACCACTGAGTATGAATGAACCACAAAGTCCAAGTGCCATTTCCATAGCAAGCTACCAC
++
+EFGGFGGGG,CAFFGG,ECFFGGGGGFEGFGGFGGEDFGGGGGFGGGGGGGFGGCFGGGGGGFGGGGGGGEGGDGFGGGGDGGFFC,,C<CDC7FF??FGGGGGGGGGGG,FB,<FFG9?97EFGGGCDFEEF9FFFAEFFG?FDEGFG,:><,8AF7DFFGGG7=FF++88DCDEGGFC+++43D<,@,<DCCEDE;EFGC7,:C?9C4@CCF;7D7EFF,7E?*/*>,<8B9+;@CFFF7?######################################
+@M01873:M01873:000000000-B9G3J:1:1112:27925:17799 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTCTTCTCTCAGAGTGTCCAGCAACCCTGCCTGGCCAGGATTGGAATCCGTCCACAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTAGACCACTGAGTATGAATGAACCACAAAGGCCAAGGGCCATTTCAGTAGAAAGCTCCAAC
++
+GG?FGCEAE6CFGGGCFGFFEGGCFF<FGGGGFFGGFGGFE<DF9FFGGGGGGGGGDDGGG@FGGDC@EEDGGDGFFFCGFGG9CC<CF<DFE@BF9FG?,EFC8FCFGGGGGGGGGAEFFGFF,??FADEGGFGGCGGGGG,5:?ADC?BEE@,,A>EFG8,3@>DB@GBF,334=46DEFG6:E9DFF:@,>C9=@EFF,EFGGFG7ECFEDF:,@?>FC69;86/A8?FC:@F=:D8C8CCCA785**2;5CC*::C5C7@68;?#############
+@M01873:M01873:000000000-B9G3J:1:1104:19905:10776 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTCTTCTCTCAGAGTGTCCAGCAACCCTGCCTGGCCAGGATTGGAATCCGTCCACAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTAGACCACTGAGTATGAATGAACCACAAAGTCCAAGGGCCATTTCAGTAGAAAGCTCACAC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFCFGGGCFFFF=FGFFGCFFGGGGGGGGGGDFCAFEFCCEFFFAF@GF4
+@M01873:M01873:000000000-B9G3J:1:2101:15710:11332 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTCTTCTCTCAGAGTGTCCAGCAACCCTGCCTGGCCAGGATTGGAATCCGTCCCCAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTAGACCACTGAGTATGAATGAACCACAAAGTCCAAGGGCCATTTCAGTAGAAAGCTCACAC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGDGGGGGGGGGGGGGGEGGGGGGGGGGFGGGGGGGGGGGGFFGGGGGGGGGGGGGFGGFFGGGGGGFGFFAAFFCBFFGGGGGGGFGGGGGDEFGGGGGGGGGFGGGGG,EGGGGGE+6DEGGGFGGGGGGDGGFGFDGFGGGGEFE@CFGFFGFGGGGGGGFFGFGFGG@:>FGGGGFGFFF@CCFF==5D<DFFCCGFDCCFAFFC;)/@C9
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_assemblepairs_test_align_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,96 @@
+@ATCTTTGCGGCTGGTTA|CONSCOUNT=1,1|PRCONS=Human-IGK
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@CGGTTTGGTGCATCTAG|CONSCOUNT=1,1|PRCONS=Human-TRA
+GTGAGTGAACCAGGGCAGAAAAGAATGATGATATCCTTGAGAGTTTTACTGGTGATCCTGTGGCTTCAGTTAAGCTGGGTTTGGAGCCAACGGAAGGAGGTGGAGCAGGATCCTGGACCCTTCAATGTTCCAGAGGGAGCCACTGTCGCTTTCAACTGTACTTACAGCAACAGTGCTTCTCAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTGCTGATGTCCGTATACTCCAGTGGTAATGAAGATGGAAGGTTTACAGCACAGCTCAATAGAGCCGGCCAGTATATTTCCCTGCTCATCAGAGACTCCAAGCTCAGTGATTCAGCCACCTACCTCTGTGTGGTGAACTCTCTACTCTGGTTCTGCAAGGCAACTGACCTTTGGATCTGGGACACAATTGACTGTTTTACCTGATATCCA
++
+GEGFGGGGGGGGFGGGGGGGGGGGDGGGGGGGFGGGGGGCGEFFCFDGGGGGGGGGGGGFGF8BFGGGGGFFDFCFGGGGEGGGGGGD=FFGGGGDDGCGGCFFGGCFGGG8FGGCGFGGGGGGCCF;FFGGFGGGGEE7FFFFGGGG6CFDFFGFFFFC9,=CFGGGGGGC6CFGFGGGGGGFGG9B6FGGFCDFFGGGGGFFGGGFFGFFGGGGGGEFGGGFGFGGGGGGECFEFFGGFGGGGG?GFD;CGGGGGG>GGGGDGGFFGGGGGGGEGGGGGGGGGGGEEGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGFF9GGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGG
+@CTTGCTTATGATTCCAG|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGAAGGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
+@TTTCTTTAGTGAAATGC|CONSCOUNT=1,1|PRCONS=Human-IGK
+AGGAACTGTTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCACAGATATCAACGGAGCAATTGTGTTGACACAGTTTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGGGCCACCCTCTCCTGCAGGGCCAGCCAGGCTGTTGGTACCTACTTAGCCTGGTACCAACAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCGTCCAACAGGGCCACTGGCGTCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCGACAGCCTAGAGCCTGAAGATTTTGCAGTTTATTTCTGTCAGCAACGTAGCGACTGGTGTACTTTCGGCGGGGGGACCAAGGTGGAGATCAAGCGAA
++
+GGGDEFGGGGGDGGFGGFGFGEGGGGGGECDFGGGFC9FFGCFCEGCG<FDFFGGFGGAEECGGGCF,CFGGGFFFG,EFEDF?FG,?=C>FG+B,CFFEEFG=,CE,,EEFFGFFFFFCGGGGGEGAFFFFDEGGFFGGFG?9A?GDDD:>@BF?EGGDFGGF=CGGG8<,D9>FGD>>FCC;?CGGGFFFEFCF:?CBFGGCGGFFGGFC>GGGEGE=,GF@8A5BB?:CC>FFFGGEGGE@CGGFFAD:7FCCFDC@GGF8GGGGEFFGDGGGFGGGCGGGGGGFGGGGGGGGGGGGGDGGFGGGGGEGGGGGGGGGGFGGGGGGGGGGGGCFGGCCGGGFGFGGGGGGGGGGGGGGEFGGGGGGGGGGGGGGGGGGDGGGGGGGGGFE;EGGGGGGGGGGGCGGGGGGGG
+@ATTTCTATGGCTTTGTT|CONSCOUNT=1,1|PRCONS=Human-TRB
+CGAATGTTCGCTTAGATTGAGAATGATTAACCTTATTGTGTCTGTTTTGATCAATGTCTGGTTGTTCGAGTGCAGTGCGTGCAGTCTTTCGCTTATTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATGTATAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTATTTCTATGGCTTTGTTCGATACGGGGACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAGAGAAATACATGAGACTCTCATATACCTGCAAAAGTGAGCTATATCTCGATCACGTATTACAAGTCAGTACAGCCAGAAAAGAGGAATGTCGAAGATACTCC
++
+#################################################################################################GGEB>BCCB6GFFGGFFGGGEC:GGGGGGGD;7GGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGGGFGGGGGGGEGGGGGF:AFE=FFEGGGGG=BFCC3DFEG@EFGFG@FEFF9CDFCFGGGC8DEGEE>7CFGCECFFFD:CE5E#######################################################################################################
+@GGGACTCCAAAATTAAT|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAAGCTCCTCATCCATAGCAATACTCAGCGGCCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCTACATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>4G?CFGFG6BEC+:?7=CC78>?=CEGGFFFFGGGGGECFCC:>CDDGC<+:;ECGGGFGGGFGFDEC7GC<;-8*GGEDGGGFC*E87GGGBFCECGFFCGGFFFGFGGGGGCGFGFGGGGFGFGGDGGGGGGGGGGFGGFFGGFGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGG
+@CCTTGTCCGAGATGTCT|CONSCOUNT=1,1|PRCONS=Human-IGK
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTAGCAGCTCTGTAAATTGGTATCAGCTGAAGCCAGGGAAATCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGGCGTCCCGTCAAGGTTCAGTGGGAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTCTGTCACCAGACTTACAATCCCCCGCTCGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGAA
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGE93>8BEFA>7C,>9DFGADFCCGEDF>7;=?GGDC<84;E=*=CCGFCFDFECEC6<CC76C>1?GGF@58C=04+9=**G@E:=>=*?<,?,?,,EFFFGFFB<?,FCD>,?,FGF>>:11*<AGEGFGFFC@+3*FDBFD8GGFDFGGGGGFFFAEFF9GFGFFEF<GFCFFGFFGGEE?GEGGGGGGGGFEEA<GGGGGCFDGF<FGGGGFCF9GGGGGGGFEEFGFEFGGCFF:GGGFFC7GGGGFGGGGGGGGFFGFGGGGGGDFGGGGEFEE
+@CGATGTAATCTTAGCTG|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGACAAGGGCCCTCGCTACTTGATGACGGTTAAGAGTGATGGCAGCCACATCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGAGCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF7@D77DGF8/:DCD>:@CEE>EG76F><C6C>7C>FGGEDF>6DG>A%CGEGEGEC7CFCGGGEEC79ECCGFC<D4C-GF?FCFDEF=C;?CFC6GGECGGGFGFGGEGC,GF@F1<CFFCGGGFGFGGGFCF>GGGGGGFF<7F*CGGFECFCFCFEFCF<GGGGGGFCGGGGF=9FFGGGGFCGF=99GGGGFFGGDFGGGGGGGCFEGGGGGGGF8GDGGGGGGGGGGGGGDGFGFGFGGGGGGGGGGGCF,GGGGGGGDGFGGGGGGGGGGDGGGG
+@CTTGATAGGAATGAATA|CONSCOUNT=1,1|PRCONS=Human-TRB
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@TTAGCTACATGTAATTG|CONSCOUNT=1,1|PRCONS=Human-IGK
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCATCATATACAGTGATGGAACCAACTACTTGCGCTGGTTTCAGCAGCGGCCCGGCCAATCTCCAACGCGCCTAATATATAAAGTTTCTAACCTGGTCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGTACAGGCACGGATTTCACACTGAAAATCAGTAGGGTGGGGGCTGAGGATGTTGGCATTTATTACTGCATGCAAACTACACCCTGTCCTTACACTTCTGGCCAGGGGACCAAGCTCCAGATCAAACGAA
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDED9=FFEGFGF4B@7EAGG5,@DF*@7,,@,,7:;C,53@**3(@ADE695=9@*7@CGGF8F###"##"####""######EFEC<5)+@,*,,AFC9DD=,3*,DC>173,>1*=3*AFB6++>GFFA,,C5BAF9FECDDF?,=<:,:?55E:+C=B7,,,FAGGGF?FGFE9CFAFFD8EFF@CGFF,DGFFFFFC9,,6,EFFFEE<C,,E9ECFE9C9E<FF@B68,F6<,<FEC@C9GFED;,,CFC,6<FFF<6,;C;,,FFGFBC9@@EFE
+@ACTTAACGGCCAATTAA|CONSCOUNT=2,2|PRCONS=Human-TRB
+GAGTCTGCCCACAGCAGGGCTGGGAGACACAAGATCCTGCCCTGGAGCTGAAATGGGCACGAGGCTCTTCTTCTATGTGGCCCTTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGAAATCACCCAGAGCCCAAGACACAAGATCACAGAGACAGGAAGGNAGGTGACCTTGGCGTGTCACCAGACTTGGAACCACAACAATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCCATTACTCATATGGTGTTCAAGACACTAACAAAGGAGAAGTCTCAGATGGCTACAGTGTCTCTAGATCAAACACAGAGGACCTCCCCCTCACTCTGGAGTCTGCTGCCTCCTCCCAGACATCTGTATATTTCTGCGCCAGCTCATTAGGGGCCAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+lmmmmmmmjlmmmmmmfkjkkkmkjmmmmmmmmjmmmmmmmmmmffklmmmlmmmmmmmmjmmmmmmmlmlmmkmmlmimmlihimmkjjillmieekjmRg^LFcjklkmkhijRhlkmgYflljMbjgiklll][]OhlQdgO>Ximg]klRRfPOigY!]j^7OhglgQY^\eegmicdhkkkd`[TbW_gYcR]d]fe[YP^P__Q^YYPgkmlZ_fdfQQ_imidLbEblmmmmikhlg]]_ilmllliaR\]ejmlmlmkhmmlk_kllmmmmlmlllalkljRmmmlmlfecglilkiimilillmiijllmmllimmmmmmmkmmmmmmmmlimmmmmmmmmmmmmmmmmlhljmmmkgl]mmmlmmmmmmmmmmmmmlmlllmmlmmmmmlmmmmmlmmmmmmmlkimmmmlmmmmmmmmmmmmlmmmmmmmmmmmmmmmmmlmmmmmm
+@TCCAGATTCGGATTACA|CONSCOUNT=2,2|PRCONS=Human-TRA
+AGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTTATATTCCTGTGGCTGCAGCTGGACTTGGTGAATGGAGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCAAACTACTTCCCTTGGTATAAGCAAGAACTTGGAAAAAGACCTCAGCTTATTATAGACATTCGTTCAAATGTGGGCGAAAAGAAAGACCAACGAATTGCTGTTACATTGAACAAGACAGCCAAACATTTCTCCCTGCACATCACAGAGACCCAACCTGAAGACTCGGCTGTCTACTTCTGTGCAGCAAGCCCCGATGGGCATGGAAACAAACTGGTCTTTGGCGCAGGAACCATTCTGAGAGTCAAGTCCTATATCCA
++
+lmilmmlmmmmmmlmblmmmmmmmkmmllmmmmmmmmlmmmmmmmmmmllmmmmmmmmmmilmmmmmmmmm^lmmmjkmmmmmmlmmlmmmlmll_k[\ldlilmiffklmmmmlllkmmmlej]eklkkll_gllmlmgbckkmml^fcimkZfkikmiijlXkgmi^k^RfeiQekmllmlim\gjklkimflmllf_ciak]Q<M\ifYVaPbhilmimldlclf`S]kah^chYkdklllmmk\dOWRRROaQ\iXdcRlmmljikihYhklmlki\dkd^illmljfR^liZfRljfRgmmllllmmmmllmmmlillldd^jljllgiRbmmkmmmljlbkiRlmmmkgjlmmkiklmlmmlmmmmmmmmmmmmmmmmmliml^mmmllimmkiRliimmmmmmmmlmmmmmmmmmmmmmmmmmmmmmmllllmmllmmmmmmmmmmmmmllmmmlmmmmm
+@CGCATATATCTGCAAAA|CONSCOUNT=1,1|PRCONS=Human-IGHA
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGGCTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTATCGCAGGACCTGGGTCCGCCAGGCTCCGGGGAAGGGGCTGGAGTGGGTCTCATCCATTGATGCTAGTAGAAGTTACATATACTATGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTGTATTACTGTTCTCGAGAATATAGCAGTGGCTGGCATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C(25FF:??@?771%F?CGF>;ECEGFE>B>C3?@:9EF=*:@GFD>:*@:CFC<+E7FA+FGFGF9C7FFC=?FGCC7CGFC:F5DGGGGFGGCFGGFD66DCD;FGGGGGGGGGGGGFGGCGFFDFAFFCF;;GGGGGFFDGGGGGGGGGGDGGFGGGFEEGGGGGGGGGGGGGGGGGGEDGGGGEGFFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF?GGFEGEGGDGGGGGGGGGGGGGGGGGGGGGGGG
+@ATTAGTTCATAAATTCC|CONSCOUNT=2,2|PRCONS=Human-IGK
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTACCAACAGAAACCTGGCCAGNCTCCCAGGCTCCTCATCTATGATGCATCCAATAGGGCCACTGGCANCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACANNCTTCACTCTCACCANCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGCGAGTGGCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAACGAA
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmkETNP^Qfh[idOFNIMLEdMfkk^hTIW[TNIPXBEEIHOLa[IIIHIHEFEIIAI!IIIIIlkbYdjeggibZ%R\jc]khf%fSff[Y\bil_jmhhiif!OcigRRg]%bR_illdjlcllc\QlgRee[_`R`!!Rgee_`RRlljQfl!mjlhRRReeckbcilkmlhRele_lmlmmlkjlilbjci_ml`]lfRkmmll^ili]i^_R\RmlfQmmkmml^Rfmmmmmmmimimmmmmmmmmmmmmml
+@ACTCGTGCTAATCCTTC|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@AATTAATGGTGTTGAGA|CONSCOUNT=1,1|PRCONS=Human-IGL
+AGGCTCTGCTTCAGCTGTGGGCACAAGAGGCAGCACTCAGGACAATCTCCAGCATGGCCTGCTCTCCTCTCCTCCTCACTCTCCTCGCTCACTGCACAGGGTCCTGGGCCCAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCCCTGGGAACAGCTCCAACATGGGGGCAGGTCATGATGTTCACTGGTACCAGCAGCTACCAGGAACAGCCCCCAAACTCCTCCTCTTTGGTAACAACAATCGGCCCTCAGGACGCCCTGACCGCTTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCACTGGCCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTTCTGTGGTTTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+@CEGGGGGGGGGGGGGGGFGGE8@FAEFCFGFE,EF@F,EFFGFGFGG9FF?FCFE<FGGF,EFA@FGGGGGFFGGGAFEAEC8FF,=FFGGGFFCA<BFGDEEFA=B<?FFGF@EFF?,E,9A+?BFCG+F:F@@FFEGF=FD8FC+3+8BE78@8@D8:C:@FCCF7D;FF9,8@2?EF8,,*DFFDFG###"#"#########"C:(<@CFC9+**+7DFGFF?F<00.)200)5A8?:588CC@<*./*5CF;(<68?GEEGFF@..*7CC:7:B**<;*C7=3*,B:B8:E<CC?,,F23BECFD79C@7F3:>:<>GEFCCGEFFC7BFC<FFBCC>>D:7FB7EFEFDCC@GGGFGGFF??C,9FFCGGGGFE,CE,,B9<DE,CGDGGGC=BA44<GFFFF<GCGGGGGGGGGGGGGGGGGC?GGGGGGGGGGGCGGCGFDGF<GGGGGFGGGGGGGDGDGG
+@TAGCCTTCACTTTAGTT|CONSCOUNT=1,1|PRCONS=Human-IGK
+GGATCAGGACTTCTCAGTTCATCTTCTCACCATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATCCCTGGATCCAATGCGGATATTGTGATGACCCAAACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGCCAGAGCCTCCTACATAGTGATGGAAAGACCTACATATTTTGGTTCCTGCAGAAGCCAGGCCAGTCTCCAGAACTCCTAATTTATGACGTTTCCAGCCGAGTCTCCGGAGTGCCAGAAAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCACCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTATTGTATGCAAGGTATGCGCGCTTCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAACGAA
++
+GGGGGGGCGGGGGGGGGGGGFGGGGAEGGGFGFGGGGGGGGGFGFGGFGGGFGGFFGDGGFGGGGGGGFGGGGGGGGGGGGCFFGFFCFFGG+F:DGGGFGGGFGGGG7FFGCGGGGGGGFGGGGCFGFGGGFGGGGG8BEFCFGGGGGFFGGGFGGGGG?GCFGGGGGGGFGFGGFGGGGGDDFCFF@DFGFEDGGGGGC9FFCFAFGGGGEGGGGGGFGGGFGFFGFGFGGGGGGGGGGF?GGGEGGFC@EGGGGGGGGE>FCBFCGEGGGGGGGGGGGGGGFGGGGGGGGGGGGGEGDGGGGGGFGGGGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGFGGGGGGGGGFDGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@GAAGAATTGTAACAATC|CONSCOUNT=1,1|PRCONS=Human-IGL
+GGCTGGGGTCTCAGGAGGCAGCACTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTCCTCCTCAGCCTCCTCACTCAGGGCACAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCGCTCAGTGTCCGGGTCTCCTGGCCAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGTACCCAGGCAAAGCCCCCAAAGTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTCCCGGATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCTGCTCATATGCAGGCAGCTACACTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGFGGGGGGGGGGFGGGGGGGGGGFFGGGGGGGCFCEFGGGGGGGGGGGGGGFGEFGGGFFGGFGGGFGGGGGGGGFGGG,=?FCFF<EFGGGGCDGGGGC<EFGGGGG,AD9FGGGG:FEE6@FD;FFGFFGGGEGGGFGC,@8DFG,;,5EEFCCFFFGGGGFGGG78:FGGGF?C?CFGGFFEFGG?>AEF7@FGFFGFFF@GFFGGGGDGFEGFFGGGGCECC7;7GEGFGGGGF>7CFCFGFDGGGGGGGFFGGGECCEGGGFFGGEGGGGEE@:8EC:CCGFDGGFGGFCFAFGFGGGGGGGGGGFFFF7GGGGGGGGGFCGFFGGGGGGFFGGFGGGGGGGGGGGGGGGGFEGGGGFFFFGGGEAGFFGGGGGGGGGGGGGGGGGGGGGGGFBGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGEGEGGGGG
+@GAGACTTTGCTTGTACA|CONSCOUNT=1,1|PRCONS=Human-TRB
+GATTCCAGCCTCTGACAAACTCTGCACATTAGGCCAGGAGAAGCCCCCGAGCCAAGTCTCTTTTCTCATTCTCTTCCAACAAGTGCTTGGAGCTCCAAGAAGGCCCCCTTTGCACTATGAGCAACCAGGTGCTCTGCTGTGTGGTCCTTTGTCTCCTGGGAGCAAACACCGTGGATGGTGGAATCACTCAGTCCCCTAAGTACCTTTTCAGAACGACAGGACAGAATGTGACCCTGATGTGTGACCAGAATTTGAAACACGAGGCCATGTACTGGTACCGACAGGACCCAGGGCAAGGGATGAGATTGTTCTACTACTCACAGATAGTAAATGACTTTAAGAAAGGAGATATAGCTGAAGGGTACAGCGTCTCTCGGGAGAAGAAGGAATCCTTTCCTCTCACTGTGACATCGGCCCAAAAGAACCCGACAGCTTTCTATCTCTGTGCCAGTACTGGACCCGGGGGCCGTGTTAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+GGGGCFGAFFCEGGGGGGGGFFGGGGGAEGF<<EFFGGGGGC<FFGGGE::C@FGGFFFFDFGGGGFFGF9FFGGCFFFGGGFGGGGC,:=FCEFEGFCFGGFGGDG7FFEFGFGDFFCEFCGGGGCECGF,4EEDFGG;=FFEGGGGGGGGGGD=EF,=DC>FFGGGFGGGFDD6D7EC>C::9CFGF7,@:??E*/97D:C7C###################################################"#D:7)6444D7>>:777D57)700*@9):1**<*<77C<9:;+GFC8C820+7<GFFA1@77=><17FFFFE>1+5++2=5,9?FBFCGCGDC?GFFGGGGGGGGGCEF@GF>EC>*7GGGGGFGGGGF9ECGFGFFGGFF9GFFCGGFFF>FEFF<>+GF@9FB?<C:FCFGGGGGGGGFF@EE=FF<GF?FGGGGFGGGDFCGGGGCGEGGGFCGGGGFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGCEFGGGGGGGGGGGGGGGGGGG
+@GTTCGTACTCTAATAGA|CONSCOUNT=1,1|PRCONS=Human-IGL
+AGTTGGTAGATGCCCCTCTGGGAGAGATCCCCAGGGGTGACAGCCATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGTCCCAGGCAGCGCTGGCCCCTGCTGCTGCTGGGTCTGGCCATGGTCGCCCATGGCCTGCTGCGCCCAATGGTTGCACCGCAAAGCGGGGACCCAGACCCTGGAGCCTCAGTTGGAAGCAGCCGATCCAGCCTGCGGAGCCTGTGGGGCAGGTCCGCTCAAGGCCACCCCCTTG
++
+GGGGGGGGGGGGGGGGGGGGGDFGDGGGGGGGGGGGGEGGGGGEGGGFFGGGGGGCGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGFGGGFCFGGGGGGGGGGGGGGGGFGGGFD@GCGGGGGGGGGGGGGFG@GGCGGGGEFGGFGGFGGGGGGFGGGGGGGGGGGGGGGFFEGGGEFGGGFDGGGGGGGGGGGGFGG:CG>DGGGGGGGGGGGFG4GGGGGEGGEGFGEGEFAGGGGCGGFFFCGGEGGEGGGEGGGGFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGG
+@ATGCATATGAGTGTGGC|CONSCOUNT=1,1|PRCONS=Human-TRB
+ACAAGATCCTGCCCTGGAGCTGAAATGGGCACCAGGCTCTTCTTCTATGTGGCCCTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGGAATCACCCAGAGCCCAAGATACAAGATCACAGAGACAGGAAGGCAGGTGACCTTGATGTGTCACCAGACTTGGAGCCACAGCTATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCTATTACTCAGCAGCTGCTGATATTACAGATAAAGGAGAAGTCCCCGATGGCTATGTTGTCTCCAGATCCAAGACAGAGAATTTCCCCCTCACTCTGGAGTCAGCTACCCGCTCCCAGACATCTGTGTATTTCTGCGCCAGCAGCCCTGGGGGAGGCAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+DGCEFGFFGGFGCFGGFGGGGGGGGGGGGCGGGFFDFFGGGGGGGGGGGDFGGFGGGGGGGGGGGGFFFEFFGGDGGGGG?F7FFDFGGGFGGGGGGGGFGGFGGFCEFFCFFGFFCF8?EFFCG8FGGGG>D@@CC,,:F;FC=DFF;FGGFGGCGGGFG8C==EFFCE=F?>FGFGGGCC9ECDDC@FDGGFDCCEED1:GC5GGGGGGDGGGGFGGGGFC9GGGC.FGGC?>GGGGGGEGGGGGGGGFGCGGGGGGGGGGGGGGFGDFGGEGGGFFAGFGGFCDGFFEFCGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGFG
+@CGGAATACTCACAAATT|CONSCOUNT=2,2|PRCONS=Human-IGHA
+GTCTGGGAGAGGAGCCCAGCACTAGAAGTCGGCGGTGTTTCCATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCGTTTAAGAGGTGTCCAGTGTCAGGTCGAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCCGGGAGGTCCCTGATTCTCGCAAGTGAAGCCCCTGGATCCAGAGTCAGTGCCTATGNCTTGCNCTGGGACGGCGNGTTTCCNGGCAGGGGGCNGGCCNGGTTTGATGTCTGGGGCCAAGGGACAGTGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+ilmmmmmmmmmmmmmmmmmmmmmlmmmllmlmmikjlmmlm_lmlmik[dlllmmjillmmmmmmmiOakimimmU[mFmmIllldkkmlmjLmmliPmllimlmlmmmmmjilFgRRiRmkkBGkjgkglih^eglelGk\jlEmlleJ]glIhgkFQk\eiigmmk`RPihHPKYGkKBkkB\WckhKkA;ASIQP9-=X-78:V:E:>;-V=3-S+5,,,4m9E5,-<!,kmHI!HIHH@]2TFFT!;RVmGG!EHE%i%%%%%!%%m%!%%ilmmmmmmmmmmlmmmmljjmmljllmmmmmmmmmmmlkllmmmmmmjmmlmmmmmmmmmmmmmmmmmmhjm
+@TTAAGATACTAACAGGT|CONSCOUNT=1,1|PRCONS=Human-IGK
+TGGAGGAACTGCTCAGTTAGGACCCAGACGGGACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCTGCCACCCTGTCTCTGTCTCCAGGGGACAGAGCCACCCTCTCCTGCAGGGCCAGTGAGACTGTTAGAACCAAGGTAGTCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTGGTATCCCAGCCAGGTTCAGAGGCAGTGGGTCTGGGACAGAGTTCACTCTCGCCATCAGCAGCCTGCAGTCTGAAGATTTTGCAATTTATTACTGTCAGCAATATCATAAGTGGCCTCCGTACACTTTTGGCCAGGGGACCAAGTTGGAGATCAACCGAA
++
+CGGDFEGFFFFGEEEFGGGGGGGGGGGGGG>EFBFGDFGGGG?EFEGGGGG@FFFGAEFFGGGGGGGFGGCGFGGGGGFGCF,AEECEF<EFE@EGFFEFGGGFFGGGGGGCGEGFE9:8@FGGDFDFGGAE;7EF9,FFGGCGGGGGFF>FGDGGGGGGCGFCF@6FGGGGFGGFGGGGGFGFGGGFGGGGGGGGGGGGGEFGGGGDGGGGGGCFFFGFG<GCFFGGGFE?GGFF@GGGGGFGGGGDGGF>GFGFCDCFF8FGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGFFFCGGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGFEF?GGGGGGFGGEGEFGFGFFAF>GCGCFGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGG
+@GGGCCTCTTTATTTGTC|CONSCOUNT=1,1|PRCONS=Human-TRB
+GGGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCCCTGGAACCAGCAGTGACGTTGGTGGTTATAACTCTGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCACCGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCGGTCACT
++
+GGGGGGG8:CFG8CC<F8EEEGG8C+85*?CE?FF?EGGGGFG58CC58:8EGCFFCCFGGGGGGGF5;CFD71<F?F6/;8AF>>D8@FF76@CGGECCFG7:+AC>FGGEF+<8AFFE:@8C8EGC@C*:*;87@+:?>6C*3<88CF58?@:CFGF96@88FFFDFEC;8F7>A+C3D7;F8?FG@C?A9CFG;99;FGF9CC<:=27GC;;DEFFGGCFFGCFGGGEC>CA<++:EFGFC:?C@7GC6?GFD:5;7B3EE=*8E:6*>GGE9GGGGGGGGGGCFGGFGFECGFECF:FCFFFFGEGEFEGGGECFGFFDFFFGGGGGCGGGFDFGCFGGGGGGGGGFFGGGGGGGGGGGGFE?CGGGGGGGFFGGGGGGGGGGGFGGGGGGGGGGEGFGGGGCGGGFFCGGGDGEFFFFGGGGFGGFGGGGGF@GGGFFC7FFEFGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_assemblepairs_test_join_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+@ATCTTTGCGGCTGGTTA|CONSCOUNT=1,1|PRCONS=Human-IGK
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCCACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGCCCCTGACCGATTCAGTGGCCGCGGGTCTGGGACAGAGTTCACTCTCAACATCAGCAGCATGCAGTCGGAAGANNNNNNNNNNAACTGCAAGTCCAACCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCAGTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFGFEFDG?EFGGCFFFGFF9CFE,E+ABE@EGFEGEFGGCFGGGGEGCGGGGGGDDFGGCFGDF,>D+44,@3DCFGC8CGGGFGC9@CGGGGGD8CGG?C79,1556C*00BC5D*/=EC5C4C<EDEC+:0<*:*19)8>*);7ECF*;>*0:9+<AC#############################!!!!!!!!!!CC?4C40**))2*+>7GFFGGDC7C>;+@4GC;0*FFC?FD:7DGC>,+,6C5,=,FFE;=<@6=97C@:9FFFGGGGFCC>8FGFDEFD6FFFDE@,FGGFCCGGGGF>EGEDEGGFEECFCEFCGGGGFCEF@FFFCFFA,,8EGEFBE?F8FCFCFGGFEAGGFGFE,4,DF9E?9EFFACGFGGGCGGGFGDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@CGGTTTGGTGCATCTAG|CONSCOUNT=1,1|PRCONS=Human-TRA
+GTGAGTGAACCAGGGCAGAAAAGAATGATGATATCCTTGAGAGTTTTACTGGTGATCCTGTGGCTTCAGTTAAGCTGGGTTTGGAGCCAACGGAAGGAGGTGGAGCAGGATCCTGGACCCTTCAATGTTCCAGAGGGAGCCACTGTCGCTTTCAACTGTACTTACAGCAACAGTGCTTCTCAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTGCTGATGTCCGTATACTCCCGTGGTAATGAAAATGGAAGGTTTACANNNNNNNNNNACTGTACTTACAGCAACAGTGCTTCTCAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTGCTGATGTCCGTATACTCCAGTGGTAATGAAGATGGAAGGTTTACAGCACAGCTCAATAGAGCCGGCCAGTATATTTCCCTGCTCATCAGAGACTCCAAGCTCAGTGATTCAGCCACCTACCTCTGTGTGGTGAACTCTCTACTCTGGTTCTGCAAGGCAACTGACCTTTGGATCTGGGACACAATTGACTGTTTTACCTGATATCCA
++
+GEGFGGGGGGGGFGGGGGGGGGGGDGGGGGGGFGGGGGGCGEFFCFDGGGGGGGGGGGGFGF8BFGGGGGFFDFCFGGGGEGGGGGGD=FFGGGGDDGCGGCFFGGCFGGG8FGGCGFGGGGGGCCF;FFGGFGGGGEE7FFFFGGGG6CFDFFG8==EA,,;CFGGGGGGC6CFF7;DCGGGFCG9B,;CCF6DFCGGGGGFFF4FFCFFFGE,AF6EFGGGFGFGFFF,:9BFCFF:.2AB+>)*:/989?C9@FF,29>+;98*??>C@7!!!!!!!!!!:FFFFC9+=?FGF<=FA64CFGFGGGGGFFGD6?6FGGFCC8FGGGGFC7GGGFFGF>EGGGGGEFGCFDFFGGGGGGEC6ECFGGFGGGGGGGFD;CGGGGGGGGGGGDGGFFGGGGGGGEGGGGGGGGGGGEEGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGFF9GGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGG
+@CTTGCTTATGATTCCAG|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGATCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGAAGGGCCCTCGGTCTCTGGTTAAGGTTAACAGTGATGGCAGACGAAGCAAGGGGGAAGGGGTCCCGGATCNNNNNNNNNNGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGAAGGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9,2,,7,;,;6CF>>,8:8;<DE7**4*:7?DC5,,486DD:FC#############################################################################!!!!!!!!!!4F<:<@4<6?:?:9*575DCC75C5DC@>@CB@9*FA0<C:GFFFGFFF>*1*GD>3GGECCGGGECGGGGFFGCCGGGGCDGCFF?GFGDGGEFCFGFDGGEECFEFFGFCGFFEF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
+@TTTCTTTAGTGAAATGC|CONSCOUNT=1,1|PRCONS=Human-IGK
+AGGAACTGTTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCACAGATATCAACGGAGCAATTGTGTTGACACAGTTTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGGGCCACCCTCTCCTGCAGGGCCAGCCAGGCTGTTGGTACCTACTTAGCCTGTTACCAACAGAAACCTGGCCCGGCTCCCAGCCCCCTCCTCTATTATGCTTCCAACAGGGCCCCTGGCGTCCCCGCCCGGNNNNNNNNNNCCAGGGGAAAGGGCCACCCTCTCCTGCAGGGCCAGCCAGGATGTTGGTACCTACTTAGCCTGGTACCAACAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCGTCCAACAGGGCCACTGGCGTCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCGACAGCCTAGAGCCTGAAGATTTTGCAGTTTATTTCTGTCAGCAACGTAGCGACTGGTGTACTTTCGGCGGGGGGACCAAGGTGGAGATCAAGCGAA
++
+GGGDEFGGGGGDGGFGGFGFGEGGGGGGECDFGGGFC9FFGCFCEGCG<FDFFGGFGGAEECGGGCF,CFGGGFFFG,EFEDF?FG,?=C>FG+B,CFFEEFG=,CE,,EEFFGFFFFFCGGGGGEGAFFFFDEGGAFGEEG7,A?6+++3>@BF?EGGDFGGF6CGGG88,D8FFG?>,8C@;,,5DFC33E?>D,5?BFF?*4D6,;=C################################################################!!!!!!!!!!9FFFFGFF?95*GDDD:81*/*73*14GGF=55:**<+C9*CED7>FCC9?CGGGFFF>FCFC?C87GGCGGFFGGFC>GGGGGE=,GF@8A7BD?:CC@FFFGGGGGE@EGGFFAD:7FCCFFC@GGF8GGGGGFFGFGGGFGGGCGGGGGGFGGGGGGGGGGGGGDGGFGGGGGEGGGGGGGGGGFGGGGGGGGGGGGCFGGCCGGGFGFGGGGGGGGGGGGGGEFGGGGGGGGGGGGGGGGGGDGGGGGGGGGFE;EGGGGGGGGGGGCGGGGGGGG
+@ATTTCTATGGCTTTGTT|CONSCOUNT=1,1|PRCONS=Human-TRB
+GACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAGAGAAATACATGAGACTCTCATATACCTGCAAAAGTGAGCTATATCTCGATCACGTATTACAAGTCAGTACAGCCAGAAAAGAGGAATGTCGAAGATACTCCNNNNNNNNNNCGAATGTTCGCTTAGATTGAGAATGATTAACCTTATTGTGTCTGTTTTGATCAATGTCTGGTTGTTCGAGTGCAGTGCGTGCAGTCTTTCGCTTATTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATGTATAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTATTTCTATGGCTTTGTTCGATACGGGGACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAAG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGFFFGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGDCGGGGGFFGGGFGGGGGGGEGGGGGF:AFE=FFEGGGGG=BFCC3DFEG@EFGFG@FEFF9CDFCFGGGC8DEGEE>7CFGCECFFFD:CE5E#######################################################################################################!!!!!!!!!!#################################################################################################GGEB>BCCB6GFFGGFFGGGEC:GGGGGGGD;7GGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@GGGACTCCAAAATTAAT|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAACCTCCTCATCCATCGCAATACCCAGCGGCCCNNNNNNNNNNGCAGCTCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAAGCTCCTCATCCATAGCAATACTCAGCGGCCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCTACATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>48=CDGEG,BEC++,4=C+18>?:CCGGFFFFG6F8C55*1C5>73)1)<*:1:7?C##########################!!!!!!!!!!#############G?6FGFC67::*:?7*7C7*7<=CE:6>D<:GGGGGECFC::*CDDGC;+6GECGGGFGGGFGFFEC7GC<;/8*GGEDGGGFC*E87GGGBFCECGFFCGGFFFGFGGGGGCGFGFGGGGFGFGGDGGGGGGGGGGFGGFFGGFGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGG
+@CCTTGTCCGAGATGTCT|CONSCOUNT=1,1|PRCONS=Human-IGK
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTAGCAGCTCTGTAAATGGGTATCAGCTGAAGCCAGGGAAATCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGGCTTTCCGTCAAGGGTTNNNNNNNNNNGTAGCCATATTGTCCATCGCTTGCCGGGCAAACCAGAGCTGTATCAGCTCTGTAAATTGGTATCAGCTGAAGCCAGGGAAATCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGGCGTCCCGTCAAGGTTCAGTGGGAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTCTGTCACCAGACTTACAATCCCCCGCTCGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGAA
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGG93@8BGFC>9E,>9D8@ADF8CGECE>*;EFGGD7<8;CE=3=CC9F?FDFE@C@,<C#################################################################################!!!!!!!!!!################BFG>>DC<1*DF>72*)FC4C92**/21*06GFC7DE7CEC>+?C76C>1?GGF@58C=04+9=**G@E:=>=*?<,?,?,,EFFFGFFB<?,FCD>,?,FGF>>:11*<CGGGFGFFC@+3,FFBFD8GGFDFGGGGGFFFAEFF9GFGFFEF<GFCFFGFFGGEE?GEGGGGGGGGFEEA<GGGGGCFDGF<FGGGGFCF9GGGGGGGFEEFGFEFGGCFF:GGGFFC7GGGGFGGGGGGGGFFGFGGGGGGDFGGGGEFEE
+@CGATGTAATCTTAGCTG|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCTGCAGCAGCCAGACAAGGGCCCTCGCTACTTGATGACGGTTAAGCGTGATGGCAGCCCCATCAAGGGGGACGGGGNNNNNNNNNNAGTGAGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGAGAAGGGCCCTCGCTACTTGATGACGGTTAAGAGTGATGGCAGCCACATCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGAGCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF78D6DDC:8,:D8D>7@CEE>EG755**C6,6*0,,4<1B686CG5=*7C***=***;:8**3;@C799CCCC9:D4C3*/*/:CD8*:*;***2*0<<??*??#####!!!!!!!!!!#@<74AGF6/+=C>>::58*3D?56F><2*C>7CGFGGEDF>6DD>A*CGEGEGEC7CFCGGGEE<*5E:CGFC<2+@7GF?FCFCEF=C+GCFC6GGECGGGFGFGGGGC,GF@F1<CFFCGGGFGFGGGFCF>GGGGGGFF<7F*CGGFECFCFCFEFCF<GGGGGGFCGGGGF=9FFGGGGFCGF=99GGGGFFGGDFGGGGGGGCFEGGGGGGGF8GDGGGGGGGGGGGGGDGFGFGFGGGGGGGGGGGCF,GGGGGGGDGFGGGGGGGGGGDGGGG
+@CTTGATAGGAATGAATA|CONSCOUNT=1,1|PRCONS=Human-TRB
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCCCCGGCCCCCTGGGTTCCCTTANNNNNNNNNNGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77FEEGEGGDGGGGGGGF:@CGGFFGGFECF5E7F7C:?CD7:494CF;C6FF3C3>FGGGFDGDF4CF*+9*2<7:4<7>F6)2(;F?):CG*?C###############!!!!!!!!!!GF<A:FFAF6)75@CFFGFFFGFGGGGFFGGFFGFFCFGGFDF;>GGGGFF4C=5EDCEFFCFGGGGGGGFGECGGGGDGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@TTAGCTACATGTAATTG|CONSCOUNT=1,1|PRCONS=Human-IGK
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCATCATATACAGTGATGGAACCAACTACTTGCGCTGGTTTCAGCAGCGGCCCGGCCAATATCACAGGCGGCTAATTGATAAGGAGTTTAACAGGGGCTNNNNNNNNNNACCTCCCGCAGTACGATTCTAAGCCTCATATACAGTGATGTCAACATCTACTTGATCTGGTTTCAGAAGAGGCCATGCCAATCTCCAACGCGCCTAATATATAAAGTTTCTAACCTGGTCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGTACAGGCACGGATTTCACACTGAAAATCAGTAGGGTGGGGGCTGAGGATGTTGGCATTTATTACTGCATGCAAACTACACCCTGTCCTTACACTTCTGGCCAGGGGACCAAGCTCCAGATCAAACGAA
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDEF9=FFGGFGF6D@9ECGG7,@DF,@7,,@,,7:;C,53@,,3*@AFE695=9@,9@CGGF8F##########################################################!!!!!!!!!!##################################################################################GFEE>5++@,,,,AFC;FD=,3,,FE>373,>3,=3,AFB6++>GFFA,,C5BAF9FECDDF?,=<:,:?55E:+C=B7,,,FAGGGF?FGFE9CFAFFD8EFF@CGFF,DGFFFFFC9,,6,EFFFEE<C,,E9ECFE9C9E<FF@B68,F6<,<FEC@C9GFED;,,CFC,6<FFF<6,;C;,,FFGFBC9@@EFE
+@ACTTAACGGCCAATTAA|CONSCOUNT=2,2|PRCONS=Human-TRB
+GAGTCTGCCCACAGCAGGGCTGGGAGACACAAGATCCTGCCCTGGAGCTGAAATGGGCACGAGGCTCTTCTTCTATGTGGCCCTTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGAAATCACCCAGAGCCCAAGACACAAGATCACAGAGACAGGAAGGNAGGTGACCTTGGCGTGTCACCNNACTTGGAACCACAACAATATGTTCTGGTATCGACAAGACCNNGGACNTGGGCTGNGGCTGATCCNTTACTCANNTGGTGTTCAANACNCTNNNNNNNNNNGTCACCAGACTTGGAACCACAACAATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCCATTACTCATATGGTGTTCAAGACACTAACAAAGGAGAAGTCTCAGATGGCTACAGTGTCTCTAGATCAAACACAGAGGACCTCCCCCTCACTCTGGAGTCTGCTGCCTCCTCCCAGACATCTGTATATTTCTGCGCCAGCTCATTAGGGGCCAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+lmmmmmmmjlmmmmmmfkjkkkmkjmmmmmmmmjmmmmmmmmmmffklmmmlmmmmmmmmjmmmmmmmlmlmmkmmlmimmlihimmkjjillmieekjmRg^LFcjklkmkhijRhlkmgYflljMbjgiklll][]OhlQdgO>Ximg]klRRfPOigY!]j^7OhglgQY^\eegmiZdh!!EQ`[G\R_TObP]]Nfe[YP5P^]P^YAIg]gIFFE:,,C!!H<<:!EIF:HH?!95?@H7E<@!>-CAH9-!!--EIEEA%%%!%%!%%!!!!!!!!!!2HBcY]kkkd]OTbWWgYcRUd]e^YYG^N__QSSYPckmlZ_fdfQQ_imidLbDblmmmmikhlg]]_ilmllliaR\]ejmlmlmkhmmlk_kllmmmmlmlllalkljRmmmlmlfecglilkiimilillmiijllmmllimmmmmmmkmmmmmmmmlimmmmmmmmmmmmmmmmmlhljmmmkgl]mmmlmmmmmmmmmmmmmlmlllmmlmmmmmlmmmmmlmmmmmmmlkimmmmlmmmmmmmmmmmmlmmmmmmmmmmmmmmmmmlmmmmmm
+@TCCAGATTCGGATTACA|CONSCOUNT=2,2|PRCONS=Human-TRA
+AGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTTATATTCCTGTGGCTGCAGCTGGACTTGGTGAATGGAGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCAANCTACTTCCCTTGGTATAAGCAAGAACTTGGAAAAAGACCTCAGCTTATTATNGACATTCGTTNNNNNNNNNNTGTACTTATTCAGACAGTNCCTCAAACTACTTCCCTNGGTATAAGCAAGAACTTGGAAAAAGACCTCAGCTTATTATAGACATTCGTTCAAATGTGGGCGAAAAGAAAGACCAACGAATTGCTGTTACATTGAACAAGACAGCCAAACATTTCTCCCTGCACATCACAGAGACCCAACCTGAAGACTCGGCTGTCTACTTCTGTGCAGCAAGCCCCGATGGGCATGGAAACAAACTGGTCTTTGGCGCAGGAACCATTCTGAGAGTCAAGTCCTATATCCA
++
+lmilmmlmmmmmmlmblmmmmmmmkmmllmmmmmmmmlmmmmmmmmmmllmmmmmmmmmmilmmmmmmmmm^lmmmjkmmmmmmlmmlmmmlmll_k[\ldlilmiffklmmmmlllkmmmlej]eklkkll_gllmlmgbckkmml^fcimkZfkikmiijlXkgmi^k^RfeiQekmllmlim\gjklkimflmlfeNciak]Q<KVMQ!VVPa_ilmimlO<VJDSSZB]hOThYkdkckhI8C,:F>9,>8<HI=GE-9!EH;3=EHFHH!!!!!!!!!!86`aW[SZKTclf_\`WC!P;M\ifYQaNbhbBZbb!dlclf`P]kae^cZONPNlllmmk\dOWRRROaQ\iXdcRlmmljikihYhklmlki\dkd^illmljfR^liZfRljfRgmmllllmmmmllmmmlillldd^jljllgiRbmmkmmmljlbkiRlmmmkgjlmmkiklmlmmlmmmmmmmmmmmmmmmmmliml^mmmllimmkiRliimmmmmmmmlmmmmmmmmmmmmmmmmmmmmmmllllmmllmmmmmmmmmmmmmllmmmlmmmmm
+@CGCATATATCTGCAAAA|CONSCOUNT=1,1|PRCONS=Human-IGHA
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGGCTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTATCGCAGGACCTGGGTCCGCCAGGCTCCGGGGAAGGGGCTGGAGTGGGTTGTNNNNNNNNNNCCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTGATGCTAGTAGAAGTTACATATACTATGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTGTATTACTGTTCTCGAGAATATAGCAGTGGCTGGCATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C*2577:*2*7271*2?CC>/;ECEEEE*;:@######!!!!!!!!!!###FF:??@?70)*F?:GF>7944GF?>B>C3?@<;GF=*:@GFD>:*@:CFC<+E7FA+FGFGF9C7FFC=?FGCC7CGFC:F5DGGGGFGGCFGGFD66DCD;FGGGGGGGGGGGGFGGCGFFDFAFFCF;;GGGGGFFDGGGGGGGGGGDGGFGGGFEEGGGGGGGGGGGGGGGGGGEDGGGGEGFFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF?GGFEGEGGDGGGGGGGGGGGGGGGGGGGGGGGG
+@ATTAGTTCATAAATTCC|CONSCOUNT=2,2|PRCONS=Human-IGK
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCANGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTNCCAACAGAAACCTGNCCAGNCTCCCNGGCTCCTCATCTATGATGCATCCAANAGGNCCACNGGCANCCCNGCCAGNNNNNNNNNNNGNGGAAAGAGTCACCCTCNCCTGCAGGGNCAGNNAGAGTATNAGCAGCTACTNAGGCTGNTACCAANAGAAACCTGGCCAGNCTCCCAGGCTCCTCATCNATGATGCANCCAATAGGGCCACTGGCANCCCAGCCANGTTCAGTGGCAGTGGGTCTGGGACANNCTTCACTCTCACCANCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGCGAGTGGCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAACGAA
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmk!TNP^Qfh[idOFNDMLCdMfkk^hTBW[TNEPXBE!;COLa[.3E9?G:F!II.<!?4DGF!%%%%%%%%%%%%%%%%%%%%%%%%%!%%%!%%%%!%%%%!%%%!%%%%%!!!!!!!!!!!>!DHAHIHHHHIHIIE<1!EIEEEEEII!EFH!!4,>E?II!E69@IIIIII!IHIIHH!EEIHIH!;IIIHIHEEEH:AI!IIIIIlkbYdjeggibZ!R\jc]khf!fSff[Y\bil_jmhhiif!OcigRRg]!bR_illdjlcllc\QlgRee[_`R`!!Rgee_`RRlljQfl!mjlhRRReeckbcilkmlhRele_lmlmmlkjlilbjci_ml`]lfRkmmll^ili]i^_R\RmlfQmmkmml^Rfmmmmmmmimimmmmmmmmmmmmmml
+@ACTCGTGCTAATCCTTC|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGGGGTACCAGCAGCCCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCCCTGGGGTCCCTGCNNNNNNNNNNGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG>FGGGGD5@ECGCGG84A,<:,BFGFGE+**/AEGGF+:C*=*=CEG5*::*2<CFGGC5E#############################################!!!!!!!!!!CGF??;4=*4@D4GGFGGGGFD>>7FGGFCFFFGGFGGF6<GGGGGGGGGGGGFEGGGEE8*+EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFGGGGGGGGGGGGGEEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@AATTAATGGTGTTGAGA|CONSCOUNT=1,1|PRCONS=Human-IGL
+AGGCTCTGCTTCAGCTGTGGGCACAAGAGGCAGCACTCAGGACAATCTCCAGCATGGCCTGCTCTCCTCTCCTCCTCACTCTCCTCGCTCACTGCACAGGGTCCTGGGCCCAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCCCTGGGAACAGCTCCAACATGGGGGCAGGTCATATTGTTCACTGGTACCAGCAGCCTCCACCTACAGCCCCCAACCTCCTCTTCTTTTTTAACCCCACTCNNNNNNNNNNCCAACCTCGGGGCAGGTTATGATGTTCACTGGTACCAGCAGCTACCAGGAACAGCCCCCAAACTCCTCCTCTTTGGTAACAACAATCGGCCCTCAGGACGCCCTGACCGCTTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCACTGGCCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTTCTGTGGTTTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+@CEGGGGGGGGGGGGGGGFGGE8@FAEFCFGFE,EF@F,EFFGFGFGG9FF?FCFE<FGGF,EFA@FGGGGGFFGGGAFEAEC8FF,=FFGGGFFCA<BFGDEEFA=B<?FFGF@EFF?,E,9A+?BFCG+F:F@@FFEGF=FD8FC+3+8BE78@8@D8:C:@FCCF7D;FF9,8@2?EF8,,*DFFDFG#####################################################################################!!!!!!!!!!##################C:*>@CFC9+**+7DFGFF?F<000+200+7C8?:588CC@<*0/*5CF;*<68?GGGGFF@00*7EC:7:B**<;*C7=3*,B:B8:E<CC?,,F23BECFD79C@7F3:>:<>GEFCCGEFFC7BFC<FFBCC>>D:7FB7EFEFDCC@GGGFGGFF??C,9FFCGGGGFE,CE,,B9<DE,CGDGGGC=BA44<GFFFF<GCGGGGGGGGGGGGGGGGGC?GGGGGGGGGGGCGGCGFDGF<GGGGGFGGGGGGGDGDGG
+@TAGTCAGAAGATTATCT|CONSCOUNT=1,1|PRCONS=Human-IGHA
+TCTCAGAGAGGTGCCTTAGCCCTGGATTCCAAGGCATCTCCACTTGGTGATCAGCACTGCACACAGAGGACTCACCATGGAGTTGGGGCTGTGTTGGGTTTTCCTTGTTGCTATGTTAGAAGGTGTCCAGTGTGAGGTTCAGTTGGTGGCGTCTGGGGTAGGCTTGGTACAGCATGGAGGGTCCCTGCGACTCTCCTGTGTAAGCTCAGGATTCGCCTCAAGTCGTCATGAAATGAATGGGGGCCGCCAGCCCCCCGGGACGGGGTCGGGTGGNNNNNNNNNNAGGGGCTGGAGTGGGTTTAAGACAATAGAAGAAATTGAACAACCGAGTACTATGCAGATTCTGTGAAGTTCCGATTCAGCATCTCCAGAGACAACGCCAAGAATTCACTTTATCTGCAAATGAACGGCCTGACAGCAGAGGACACGGCTGTTTATTACTGTGCGAGGGATACGACGACTGTAGTGGGAGCTACAACGGAGGTGGCGGAGTTTGACTTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCTGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+CFEGCDAFGGDAF8E9<CGGFG?88<C<FAFECF@,C@FFFDG9<<EE7F,,9C@,BFE,:BC<7@FGF8B8F<BA9EF8,AB?,98:F7C,B,BF8FG+CDADE<<5CFE,,9?9@,@FGG?E@FC?C8=E,9;F,E,,,C=;EC@+@,+6@+3>,@+63+98F8+3E;C9,,,3,,6++58::C:,*@CEEFAFGF###########################################################################!!!!!!!!!!#######################################################F<5+6FC>+GFB3****+A+99?9+GGFEE;9?;?**CE>C:,,9D@,7,,,,F?,,CF3,,F73,<@*FC<7;9@33,>3,,=@,F@@+:,,C,CFFFB,FDGGGGF<FCEFAD+:DB+GEC?F?E8FDB,9CAFECFGC@CFEFE:EFEC?<CGFFGEEC,:@C,F?GGGGF@FEEECCFDC6B,GE,C76,FCEC8++CGGGGGFCGFFDGF<CFC7F7GGFC
+@TAGCCTTCACTTTAGTT|CONSCOUNT=1,1|PRCONS=Human-IGK
+GGATCAGGACTTCTCAGTTCATCTTCTCACCATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATCCCTGGATCCAATGCGGATATTGTGATGACCCAAACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGCCAGAGCCTCCTACATAGTGATGGAAAGACCTACATATTTTGGTTCCTGCAGAAGCCAGGCCAGTCTCCAGAACACCTAATTTATGACGTTTCCCGCCGAGTCTCCGGNNNNNNNNNNATCTCCTGCAAGTCTAGCCAGAGCCTCCTACATAGTGATGGAAAGACCTACATATTTTGGTTCCTGCAGAAGCCAGGCCAGTCTCCAGAACTCCTAATTTATGACGTTTCCAGCCGAGTCTCCGGAGTGCCAGAAAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCACCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTATTGTATGCAAGGTATGCGCGCTTCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAACGAA
++
+GGGGGGGCGGGGGGGGGGGGFGGGGAEGGGFGFGGGGGGGGGFGFGGFGGGFGGFFGDGGFGGGGGGGFGGGGGGGGGGGGCFFGFFCFFGG+F:DGGGFGGGFGGGG7FFGCGGGGGGGFGGGGCFGFGGGFGGGGG8BEFCFGGGGGFFGGGFGGGGG?3BFGGCFFGGF:FGGFGFGGG8DDCFF@DFG6DC5?EEC,51=CF@FGGEFCGF+,55++?BF=9*/:8CC5++4+?3;5C*;EFE6@9C*02A7CE5FG<+58/>**;@FGGG5!!!!!!!!!!####@2CBF?GC9<:GGGGFDGCDF=GGGFGD>F<*?<37CFEDGGGGGC9FF@:A*FFGGECGGGGGFGGGFGFFGFGFGGGGGGGGGGFGGGGEGGFB@EGGGGGGGDEFFCBFCGEGGGGGGGGGGGGGGFGGGGGGGGGGGGGEGDGGGGGGFGGGGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGFGGGGGGGGGFDGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@GAAGAATTGTAACAATC|CONSCOUNT=1,1|PRCONS=Human-IGL
+GGCTGGGGTCTCAGGAGGCAGCACTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTCCTCCTCAGCCTCCTCACTCAGGGCACAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCGCTCAGTGTCCGGGTCTCCTGGCCAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGTACCCAGGCAAAGCCCCCAAATTCATGATTTATGATGTCAGTCACCGGCCCTCCGGNNNNNNNNNNCCAGCAGTGATGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGTACCCAGGCAAAGCCCCCAAAGTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTCCCGGATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCTGCTCATATGCAGGCAGCTACACTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGFGGGGGGGGGGFGGGGGGGGGGFFGGGGGGGCFCEFGGGGGGGGGGGGGGFGEFGGGFFGGFGGGFGGGGGGGGFGGG,=?FCFF<EFGGGGCDGGGGC<EFGGGGG,AD9FGGGG:FEE6@FD;FFGFFGGGEGGGFGC,@8DFG,;,5EEFCCFFFGGGGFGGG78:FGGGF?C?CFGG9CCFCG58AEF7@FG>:1=FC@CC7FC>F?GCEGCC++<=C57C/;76CGFGGCD4**<+<E77DF7+++<@E##################!!!!!!!!!!FFF?F>?94:FGFFEDGD?>=:*7>DDFFGFDF3GFFGGGGDDF7FFFGGGGCECC7*5GEEEGFGGFF7CFCFGFCGGGGGGGFFGGGGCEEGGGFFGGGGGGGEE@:8EC:CCGFDGGFGGFCFAFGFGGGGGGGGGGFFFF7GGGGGGGGGFCGFFGGGGGGFFGGFGGGGGGGGGGGGGGGGFEGGGGFFFFGGGEAGFFGGGGGGGGGGGGGGGGGGGGGGGFBGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGEGEGGGGG
+@GAGACTTTGCTTGTACA|CONSCOUNT=1,1|PRCONS=Human-TRB
+GATTCCAGCCTCTGACAAACTCTGCACATTAGGCCAGGAGAAGCCCCCGAGCCAAGTCTCTTTTCTCATTCTCTTCCAACAAGTGCTTGGAGCTCCAAGAAGGCCCCCTTTGCACTATGAGCAACCAGGTGCTCTGCTGTGTGGTCCTTTGTCTCCTGGGAGCAAACACCGTGGATGGTGGAATCACTCAGTCCCCTAAGTACCTTTTCAGAACGACAGGACAGAATGTGACCCTGATGTGTGACCAGAATTTGAAACCCGAGGCCATGTACTGGNNNNNNNNNNATTTGAACCACGAGGCCATGTACTGGTACCGACAGGACCCAGGGCAAGGGATGAGATTGTTCTACTACTCACAGATAGTAAATGACTTTAAGAAAGGAGATATAGCTGAAGGGTACAGCGTCTCTCGGGAGAAGAAGGAATCCTTTCCTCTCACTGTGACATCGGCCCAAAAGAACCCGACAGCTTTCTATCTCTGTGCCAGTACTGGACCCGGGGGCCGTGTTAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+GGGGCFGAFFCEGGGGGGGGFFGGGGGAEGF<<EFFGGGGGC<FFGGGE::C@FGGFFFFDFGGGGFFGF9FFGGCFFFGGGFGGGGC,:=FCEFEGFCFGGFGGDG7FFEFGFGDFFCEFCGGGGCECGF,4EEDFGG;=FFEGGGGGGGGGGD=EF,=DC>FFGGGFGGGFDD6D7EC>C::9CFGF7,@:??E*/97D:C7C######################################################################!!!!!!!!!!#########F:7)6444D7>>:777D57)700*@9):1**<*<77C<9:;+GFC8C820+7<GFFA1@77=><17FFFFE>1+5++2=5,9?FBFCGCGDC?GFFGGGGGGGGGCEF@GF>EC>*7GGGGGFGGGGF9ECGFGFFGGFF9GFFCGGFFF>FEFF<>+GF@9FB?<C:FCFGGGGGGGGFF@EE=FF<GF?FGGGGFGGGDFCGGGGCGEGGGFCGGGGFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGCEFGGGGGGGGGGGGGGGGGGG
+@GTTCGTACTCTAATAGA|CONSCOUNT=1,1|PRCONS=Human-IGL
+AGTTGGTAGATGCCCCTCTGGGAGAGATCCCCAGGGGTGACAGCCATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGTCCCAGGCAGCGCTGGCCCCTGCTGCTGCTGGGTCTGGCCATGGTCGCCCATGGCCTGCTGCGCCCAATGGTTGCACCCCAAAGCGGGGACCCCGACCCCGGGGCCCCCGGTGGAAGCAGCCGACCCCGCCNNNNNNNNNNGGGACAGACATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGTCCCAGGCAGCGCTGGCCCCTGCTGCTGCTGGGTCTGGCCATGGTCGCCCATGGCCTGCTGCGCCCAATGGTTGCACCGCAAAGCGGGGACCCAGACCCTGGAGCCTCAGTTGGAAGCAGCCGATCCAGCCTGCGGAGCCTGTGGGGCAGGTCCGCTCAAGGCCACCCCCTTG
++
+GGGGGGGGGGGGGGGGGGGGGDFGDGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGCG8@FFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGDGGGGGGGGGFGGGFCFGGGGGGGGGFFGCFCDDFGGFD@GCGGGGGFGGEGCECFG++:CEEDGEFGFBFGCFCGGGGC:><8:FFFFGDGGGG=:E8=9CFGEGFC+9*2AC:5*<FCFGG6<8*1/*;9@5:C=*:ECE5<EEG################################!!!!!!!!!!########CFC>F884@7?<FGG<:1**?C8997C?<2+FGFFCCGF?:CCGFCE@6@FGGGGGGDCFFFEEFCA0+6FFCDGEFGGGGGGGGFGGGE;5C>GGFGEGGGGGGGGFF@GGCGGGFC7GGFGGFGGGGGGFGGGGGGGGGGGGEGGFFDGGGECGGDEDGGGGGGGGGGGGFEC:CGFDGGGGGGGGGGGFGGGGGGGGGGGGFGGGGFCGGGGCGGFFFCGGGGGGGGGEGGGGFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGG
+@ATGCATATGAGTGTGGC|CONSCOUNT=1,1|PRCONS=Human-TRB
+ACAAGATCCTGCCCTGGAGCTGAAATGGGCACCAGGCTCTTCTTCTATGTGGCCCTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGGAATCACCCAGAGCCCAAGATACAAGATCACAGAGACAGGAAGGCAGGTGACCTTGATGTGTCACCAGACTTGGAGCCACAGCTATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCTATTCCTCATCAGCGTCTGATATTACAGATAAAGGAGAAGTCCCCGATGGCTATTTNNNNNNNNNNACCAGACTTGGAGCCACAGCTATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCTATTACTCAGCAGCTGCTGATATTACAGATAAAGGAGAAGTCCCCGATGGCTATGTTGTCTCCAGATCCAAGACAGAGAATTTCCCCCTCACTCTGGAGTCAGCTACCCGCTCCCAGACATCTGTGTATTTCTGCGCCAGCAGCCCTGGGGGAGGCAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+DGCEFGFFGGFGCFGGFGGGGGGGGGGGGCGGGFFDFFGGGGGGGGGGGDFGGFGGGGGGGGGGGGFFFEFFGGDGGGGG?F7FFDFGGGFGGGGGGGGFGGFGGFCEFFCFFGFFCF8?EFFCG8FGGGG>D@@CC,,:F;FC=DFF;FGGFGGCGGGFG8@==EF8,3=F=>@CFGGGCC7ECD;C@*AE68:,8,9D1:C*,6:;D5*1:**:,,,5,?,5,>,,,4=<C**3**1++1:++++1A9@CB+:8<EGGFGFC8?*/:CC####!!!!!!!!!!#######?4B7C58+FFCE:7?7FGD;GGC89***D9<FDGGFDCCEE<+6GC5GGGGGGDGGGGFGGGGFCGGGGC6FGGCGFGGGGGGEGGGGGGGGFGCGGGGGGFGGGGGGGFGDFGGGGGGFFAGFGGFCDGFFEFCGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGFG
+@CGGAATACTCACAAATT|CONSCOUNT=2,2|PRCONS=Human-IGHA
+GTCTGGGAGAGGAGCCCAGCACTAGAAGTCGGCGGTGTTTCCATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGTCCAGTGTCAGGTGGAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGNCTCTCCTGTGCAGCCTCTGGATTCAGCGTCAGTGCCTATGNCNTGCNCTGGGTCCGCCNGGCTCCNGGCANGGGGCNGGNCNGGGNNNNNNNNNNCAGGNNCNAGGNANGGGNNNGNNNNGGNNNNANNTNNNNTCNNNNNNNGNANNTNNNAANNCNNNNGNNNNNNCNNNNANGNNCNGNTNNNCCNNNNCNNNNNNNANTNCNANNANNNNNNNNTTNNNGNAANNNANNNNCNNNNNNCNNNANNNNNNGNNNNNNNNTTNNNNNNNNANGNNGNNTTTNNNNNNNGNNNNNNNNCNNNNTTTGATGTCTGGGGCCAAGGGACAGTGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+ilmmmmmmmmmmmmmmmmmmmmmlmmmllmlmmikjlmmlm_lmlmik[dlllmmjillmmmmmmmmOakimmmmmlmlmmhllldkkmlmjlmmlilmllimlmlmmmmmjil_gkRilmkkbgkjgkglih^eglel^k\jlimllek]glkhgkikk\eidgmmk`RP[hiPMYjkKakkB\Wckh]!A;AHIIE9-=;-78:?:E:>;->=3--+5,,,429E5,-<!,!@HI!HIHH@42CFFF!;G::GG!EHE%!%%%%%!%%!%!%%%!!!!!!!!!!%%%%!!%!%B6!k!bXT!!!L!!!!VW!!!!M!!\!!!!FC!!!!!!!h!F!!H!!!^[!!V!!!!e!!!!!!i!!!!g!`!!Z!g!_!!!bI!!!!i!!!!!!!i!\!f!d!!\!!!!!!!!mk!!!m!lh!!!l!!!!l!!!!!!k!!!^!!!!!!m!!!!!!!!km!!!!!!!!m!l!!m!!lim!!!!!!!i!!!!!!!!m!!!!mlmmmmmmmmmmlmmmmljjmmljllmmmmmmmmmmmlkllmmmmmmjmmlmmmmmmmmmmmmmmmmmmhjm
+@TTAAGATACTAACAGGT|CONSCOUNT=1,1|PRCONS=Human-IGK
+TGGAGGAACTGCTCAGTTAGGACCCAGACGGGACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCTGCCACCCTGTCTCTGTCTCCAGGGGACAGAGCCACCCTCTCCTGCAGGGCCAGTGAGACTGTTAGAACCAAGGTAGTCTGGTACCAGCAGAAACCTGGCCAGCCTCCCAGGCTCCTCCTCTATGATGCATCCACCAGGCCCACTGGTATCCCGGCNNNNNNNNNNGACAGAGCCACCCTCTCCTGCAGGGCCAGTGAGACTGTTAGAACCAAGGTAGTCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTGGTATCCCAGCCAGGTTCAGAGGCAGTGGGTCTGGGACAGAGTTCACTCTCGCCATCAGCAGCCTGCAGTCTGAAGATTTTGCAATTTATTACTGTCAGCAATATCATAAGTGGCCTCCGTACACTTTTGGCCAGGGGACCAAGTTGGAGATCAACCGAA
++
+CGGDFEGFFFFGEEEFGGGGGGGGGGGGGG>EFBFGDFGGGG?EFEGGGGG@FFFGAEFFGGGGGGGFGGCGFGGGGGFGCF,AEECEF<EFE@EGFFEFGGGFFGGGGGGCGEGFE9:8@FGGDFDFGGAE;7EF9,FFGGCGGGGGF86FGDGGGGGGCC8C,@6EGGGG@D??,>;8CEGFGCFFCF7>*CFC=>CBF?FFGCC8?FF@C=ACFFGE=*2=AFDF)3*+*3<+)=;CGG979EGC=C?#######################!!!!!!!!!!7>6>6FF>C7@5DGCDFCGFCF>*FFF7FFGGFGGGGGFDDGGGCGGGGGGGGGGGGGECGGGGDGGGGGGCFFFDFGDGCFCGGGFE?GGFFGGGGGGFGGGFDGGF>GFGFCFCFF8FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFCGGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGFEF?GGGGGGFGGEGEFGFGFFAF>GCGCFGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGG
+@GGGCCTCTTTATTTGTC|CONSCOUNT=1,1|PRCONS=Human-TRB
+GGGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCCCTGGAACCAGCCGTTACGTTGGTGGTTATAACTCTGTCTCCTGGTCACAAACGCACCCAGGCAAAGCCCCCAAACTAATGATTTATGATGTCCGTTAGAGGCCCTACGGGNNNNNNNNNNGCAGTGACGTTGGTGGTTATAACTATGGCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCACCGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCGGTCACT
++
+GGGGGGG8:CFG8CC<F8EEEGG8C+85*?CE?FF?EGGGGFG58CC58:8EGCFFCCFGGGGGGGF5;CFD71<F?F6/;8AF>>D8@FF76@CGGECCFG7:+AC>FGGEF+<8AFFE:@8C8EGC@C*:*;87@+:?>6C*3<88CF58?@:CFGF96@88FFFDFEC;855*A**/;*;F8=FG>C7A9CFGF99CFGF9CC+0++3++**1**18CCCFG*C6CF###########################################!!!!!!!!!!#FD><1C3D7*75??C@>?3++790***1**0+7<:E:7GCCCDEFFGG?FFCCFGGGEC>CA<++:GFGFC:?C@7GC6?GFF:5=7B5EE=*8E<8*>GGE9GGGGGGGGGGCFGGFGFECGFECF:FCFFFFGEGEFEGGGECFGFFDFFFGGGGGCGGGFDFGCFGGGGGGGGGFFGGGGGGGGGGGGFE?CGGGGGGGFFGGGGGGGGGGGFGGGGGGGGGGEGFGGGGCGGGFFCGGGDGEFFFFGGGGFGGFGGGGGF@GGGFFC7FFEFGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_assemblepairs_test_r1_in.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+@ATCTTTGCGGCTGGTTA|CONSCOUNT=1|PRIMER=TS-shift3|PRCOUNT=1
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCCACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGCCCCTGACCGATTCAGTGGCCGCGGGTCTGGGACAGAGTTCACTCTCAACATCAGCAGCATGCAGTCGGAAGA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFGFEFDG?EFGGCFFFGFF9CFE,E+ABE@EGFEGEFGGCFGGGGEGCGGGGGGDDFGGCFGDF,>D+44,@3DCFGC8CGGGFGC9@CGGGGGD8CGG?C79,1556C*00BC5D*/=EC5C4C<EDEC+:0<*:*19)8>*);7ECF*;>*0:9+<AC#############################
+@CGGTTTGGTGCATCTAG|CONSCOUNT=1|PRIMER=TS-shift4|PRCOUNT=1
+GTGAGTGAACCAGGGCAGAAAAGAATGATGATATCCTTGAGAGTTTTACTGGTGATCCTGTGGCTTCAGTTAAGCTGGGTTTGGAGCCAACGGAAGGAGGTGGAGCAGGATCCTGGACCCTTCAATGTTCCAGAGGGAGCCACTGTCGCTTTCAACTGTACTTACAGCAACAGTGCTTCTCAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTGCTGATGTCCGTATACTCCCGTGGTAATGAAAATGGAAGGTTTACA
++
+GEGFGGGGGGGGFGGGGGGGGGGGDGGGGGGGFGGGGGGCGEFFCFDGGGGGGGGGGGGFGF8BFGGGGGFFDFCFGGGGEGGGGGGD=FFGGGGDDGCGGCFFGGCFGGG8FGGCGFGGGGGGCCF;FFGGFGGGGEE7FFFFGGGG6CFDFFG8==EA,,;CFGGGGGGC6CFF7;DCGGGFCG9B,;CCF6DFCGGGGGFFF4FFCFFFGE,AF6EFGGGFGFGFFF,:9BFCFF:.2AB+>)*:/989?C9@FF,29>+;98*??>C@7
+@CTTGCTTATGATTCCAG|CONSCOUNT=1|PRIMER=TS-shift3|PRCOUNT=1
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGATCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGAAGGGCCCTCGGTCTCTGGTTAAGGTTAACAGTGATGGCAGACGAAGCAAGGGGGAAGGGGTCCCGGATC
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9,2,,7,;,;6CF>>,8:8;<DE7**4*:7?DC5,,486DD:FC#############################################################################
+@TTTCTTTAGTGAAATGC|CONSCOUNT=1|PRIMER=TS-shift2|PRCOUNT=1
+AGGAACTGTTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCACAGATATCAACGGAGCAATTGTGTTGACACAGTTTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGGGCCACCCTCTCCTGCAGGGCCAGCCAGGCTGTTGGTACCTACTTAGCCTGTTACCAACAGAAACCTGGCCCGGCTCCCAGCCCCCTCCTCTATTATGCTTCCAACAGGGCCCCTGGCGTCCCCGCCCGG
++
+GGGDEFGGGGGDGGFGGFGFGEGGGGGGECDFGGGFC9FFGCFCEGCG<FDFFGGFGGAEECGGGCF,CFGGGFFFG,EFEDF?FG,?=C>FG+B,CFFEEFG=,CE,,EEFFGFFFFFCGGGGGEGAFFFFDEGGAFGEEG7,A?6+++3>@BF?EGGDFGGF6CGGG88,D8FFG?>,8C@;,,5DFC33E?>D,5?BFF?*4D6,;=C################################################################
+@ATTTCTATGGCTTTGTT|CONSCOUNT=1|PRIMER=TS-shift3|PRCOUNT=1
+GACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAGAGAAATACATGAGACTCTCATATACCTGCAAAAGTGAGCTATATCTCGATCACGTATTACAAGTCAGTACAGCCAGAAAAGAGGAATGTCGAAGATACTCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGFFFGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGDCGGGGGFFGGGFGGGGGGGEGGGGGF:AFE=FFEGGGGG=BFCC3DFEG@EFGFG@FEFF9CDFCFGGGC8DEGEE>7CFGCECFFFD:CE5E#######################################################################################################
+@GGGACTCCAAAATTAAT|CONSCOUNT=1|PRIMER=TS-shift4|PRCOUNT=1
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAACCTCCTCATCCATCGCAATACCCAGCGGCCC
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>48=CDGEG,BEC++,4=C+18>?:CCGGFFFFG6F8C55*1C5>73)1)<*:1:7?C##########################
+@CCTTGTCCGAGATGTCT|CONSCOUNT=1|PRIMER=TS-shift2|PRCOUNT=1
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTAGCAGCTCTGTAAATGGGTATCAGCTGAAGCCAGGGAAATCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGGCTTTCCGTCAAGGGTT
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGG93@8BGFC>9E,>9D8@ADF8CGECE>*;EFGGD7<8;CE=3=CC9F?FDFE@C@,<C#################################################################################
+@CGATGTAATCTTAGCTG|CONSCOUNT=1|PRIMER=TS-shift1|PRCOUNT=1
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCTGCAGCAGCCAGACAAGGGCCCTCGCTACTTGATGACGGTTAAGCGTGATGGCAGCCCCATCAAGGGGGACGGGG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF78D6DDC:8,:D8D>7@CEE>EG755**C6,6*0,,4<1B686CG5=*7C***=***;:8**3;@C799CCCC9:D4C3*/*/:CD8*:*;***2*0<<??*??#####
+@CTTGATAGGAATGAATA|CONSCOUNT=1|PRIMER=TS-shift4|PRCOUNT=1
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCCCCGGCCCCCTGGGTTCCCTTA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77FEEGEGGDGGGGGGGF:@CGGFFGGFECF5E7F7C:?CD7:494CF;C6FF3C3>FGGGFDGDF4CF*+9*2<7:4<7>F6)2(;F?):CG*?C###############
+@TTAGCTACATGTAATTG|CONSCOUNT=1|PRIMER=TS-shift3|PRCOUNT=1
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCATCATATACAGTGATGGAACCAACTACTTGCGCTGGTTTCAGCAGCGGCCCGGCCAATATCACAGGCGGCTAATTGATAAGGAGTTTAACAGGGGCT
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDEF9=FFGGFGF6D@9ECGG7,@DF,@7,,@,,7:;C,53@,,3*@AFE695=9@,9@CGGF8F##########################################################
+@ACTTAACGGCCAATTAA|CONSCOUNT=2|PRIMER=TS-shift2|PRCOUNT=2
+GAGTCTGCCCACAGCAGGGCTGGGAGACACAAGATCCTGCCCTGGAGCTGAAATGGGCACGAGGCTCTTCTTCTATGTGGCCCTTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGAAATCACCCAGAGCCCAAGACACAAGATCACAGAGACAGGAAGGNAGGTGACCTTGGCGTGTCACCNNACTTGGAACCACAACAATATGTTCTGGTATCGACAAGACCNNGGACNTGGGCTGNGGCTGATCCNTTACTCANNTGGTGTTCAANACNCT
++
+lmmmmmmmjlmmmmmmfkjkkkmkjmmmmmmmmjmmmmmmmmmmffklmmmlmmmmmmmmjmmmmmmmlmlmmkmmlmimmlihimmkjjillmieekjmRg^LFcjklkmkhijRhlkmgYflljMbjgiklll][]OhlQdgO>Ximg]klRRfPOigY!]j^7OhglgQY^\eegmiZdh!!EQ`[G\R_TObP]]Nfe[YP5P^]P^YAIg]gIFFE:,,C!!H<<:!EIF:HH?!95?@H7E<@!>-CAH9-!!--EIEEA%%%!%%!%%
+@TCCAGATTCGGATTACA|CONSCOUNT=2|PRIMER=TS-shift3|PRCOUNT=2
+AGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTTATATTCCTGTGGCTGCAGCTGGACTTGGTGAATGGAGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCAANCTACTTCCCTTGGTATAAGCAAGAACTTGGAAAAAGACCTCAGCTTATTATNGACATTCGTT
++
+lmilmmlmmmmmmlmblmmmmmmmkmmllmmmmmmmmlmmmmmmmmmmllmmmmmmmmmmilmmmmmmmmm^lmmmjkmmmmmmlmmlmmmlmll_k[\ldlilmiffklmmmmlllkmmmlej]eklkkll_gllmlmgbckkmml^fcimkZfkikmiijlXkgmi^k^RfeiQekmllmlim\gjklkimflmlfeNciak]Q<KVMQ!VVPa_ilmimlO<VJDSSZB]hOThYkdkckhI8C,:F>9,>8<HI=GE-9!EH;3=EHFHH
+@CGCATATATCTGCAAAA|CONSCOUNT=1|PRIMER=TS-shift0|PRCOUNT=1
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGGCTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTATCGCAGGACCTGGGTCCGCCAGGCTCCGGGGAAGGGGCTGGAGTGGGTTGT
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C*2577:*2*7271*2?CC>/;ECEEEE*;:@######
+@ATTAGTTCATAAATTCC|CONSCOUNT=2|PRIMER=TS-shift2|PRCOUNT=2
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCANGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTNCCAACAGAAACCTGNCCAGNCTCCCNGGCTCCTCATCTATGATGCATCCAANAGGNCCACNGGCANCCCNGCCAGN
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmk!TNP^Qfh[idOFNDMLCdMfkk^hTBW[TNEPXBE!;COLa[.3E9?G:F!II.<!?4DGF!%%%%%%%%%%%%%%%%%%%%%%%%%!%%%!%%%%!%%%%!%%%!%%%%%!
+@ACTCGTGCTAATCCTTC|CONSCOUNT=1|PRIMER=TS-shift4|PRCOUNT=1
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGGGGTACCAGCAGCCCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCCCTGGGGTCCCTGC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG>FGGGGD5@ECGCGG84A,<:,BFGFGE+**/AEGGF+:C*=*=CEG5*::*2<CFGGC5E#############################################
+@AATTAATGGTGTTGAGA|CONSCOUNT=1|PRIMER=TS-shift1|PRCOUNT=1
+AGGCTCTGCTTCAGCTGTGGGCACAAGAGGCAGCACTCAGGACAATCTCCAGCATGGCCTGCTCTCCTCTCCTCCTCACTCTCCTCGCTCACTGCACAGGGTCCTGGGCCCAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCCCTGGGAACAGCTCCAACATGGGGGCAGGTCATATTGTTCACTGGTACCAGCAGCCTCCACCTACAGCCCCCAACCTCCTCTTCTTTTTTAACCCCACTC
++
+@CEGGGGGGGGGGGGGGGFGGE8@FAEFCFGFE,EF@F,EFFGFGFGG9FF?FCFE<FGGF,EFA@FGGGGGFFGGGAFEAEC8FF,=FFGGGFFCA<BFGDEEFA=B<?FFGF@EFF?,E,9A+?BFCG+F:F@@FFEGF=FD8FC+3+8BE78@8@D8:C:@FCCF7D;FF9,8@2?EF8,,*DFFDFG#####################################################################################
+@TAGTCAGAAGATTATCT|CONSCOUNT=1|PRIMER=TS-shift4|PRCOUNT=1
+TCTCAGAGAGGTGCCTTAGCCCTGGATTCCAAGGCATCTCCACTTGGTGATCAGCACTGCACACAGAGGACTCACCATGGAGTTGGGGCTGTGTTGGGTTTTCCTTGTTGCTATGTTAGAAGGTGTCCAGTGTGAGGTTCAGTTGGTGGCGTCTGGGGTAGGCTTGGTACAGCATGGAGGGTCCCTGCGACTCTCCTGTGTAAGCTCAGGATTCGCCTCAAGTCGTCATGAAATGAATGGGGGCCGCCAGCCCCCCGGGACGGGGTCGGGTGG
++
+CFEGCDAFGGDAF8E9<CGGFG?88<C<FAFECF@,C@FFFDG9<<EE7F,,9C@,BFE,:BC<7@FGF8B8F<BA9EF8,AB?,98:F7C,B,BF8FG+CDADE<<5CFE,,9?9@,@FGG?E@FC?C8=E,9;F,E,,,C=;EC@+@,+6@+3>,@+63+98F8+3E;C9,,,3,,6++58::C:,*@CEEFAFGF###########################################################################
+@TAGCCTTCACTTTAGTT|CONSCOUNT=1|PRIMER=TS-shift1|PRCOUNT=1
+GGATCAGGACTTCTCAGTTCATCTTCTCACCATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATCCCTGGATCCAATGCGGATATTGTGATGACCCAAACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGCCAGAGCCTCCTACATAGTGATGGAAAGACCTACATATTTTGGTTCCTGCAGAAGCCAGGCCAGTCTCCAGAACACCTAATTTATGACGTTTCCCGCCGAGTCTCCGG
++
+GGGGGGGCGGGGGGGGGGGGFGGGGAEGGGFGFGGGGGGGGGFGFGGFGGGFGGFFGDGGFGGGGGGGFGGGGGGGGGGGGCFFGFFCFFGG+F:DGGGFGGGFGGGG7FFGCGGGGGGGFGGGGCFGFGGGFGGGGG8BEFCFGGGGGFFGGGFGGGGG?3BFGGCFFGGF:FGGFGFGGG8DDCFF@DFG6DC5?EEC,51=CF@FGGEFCGF+,55++?BF=9*/:8CC5++4+?3;5C*;EFE6@9C*02A7CE5FG<+58/>**;@FGGG5
+@GAAGAATTGTAACAATC|CONSCOUNT=1|PRIMER=TS-shift2|PRCOUNT=1
+GGCTGGGGTCTCAGGAGGCAGCACTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTCCTCCTCAGCCTCCTCACTCAGGGCACAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCGCTCAGTGTCCGGGTCTCCTGGCCAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGTACCCAGGCAAAGCCCCCAAATTCATGATTTATGATGTCAGTCACCGGCCCTCCGG
++
+GGGFGGGGGGGGGGFGGGGGGGGGGFFGGGGGGGCFCEFGGGGGGGGGGGGGGFGEFGGGFFGGFGGGFGGGGGGGGFGGG,=?FCFF<EFGGGGCDGGGGC<EFGGGGG,AD9FGGGG:FEE6@FD;FFGFFGGGEGGGFGC,@8DFG,;,5EEFCCFFFGGGGFGGG78:FGGGF?C?CFGG9CCFCG58AEF7@FG>:1=FC@CC7FC>F?GCEGCC++<=C57C/;76CGFGGCD4**<+<E77DF7+++<@E##################
+@GAGACTTTGCTTGTACA|CONSCOUNT=1|PRIMER=TS-shift2|PRCOUNT=1
+GATTCCAGCCTCTGACAAACTCTGCACATTAGGCCAGGAGAAGCCCCCGAGCCAAGTCTCTTTTCTCATTCTCTTCCAACAAGTGCTTGGAGCTCCAAGAAGGCCCCCTTTGCACTATGAGCAACCAGGTGCTCTGCTGTGTGGTCCTTTGTCTCCTGGGAGCAAACACCGTGGATGGTGGAATCACTCAGTCCCCTAAGTACCTTTTCAGAACGACAGGACAGAATGTGACCCTGATGTGTGACCAGAATTTGAAACCCGAGGCCATGTACTGG
++
+GGGGCFGAFFCEGGGGGGGGFFGGGGGAEGF<<EFFGGGGGC<FFGGGE::C@FGGFFFFDFGGGGFFGF9FFGGCFFFGGGFGGGGC,:=FCEFEGFCFGGFGGDG7FFEFGFGDFFCEFCGGGGCECGF,4EEDFGG;=FFEGGGGGGGGGGD=EF,=DC>FFGGGFGGGFDD6D7EC>C::9CFGF7,@:??E*/97D:C7C######################################################################
+@GTTCGTACTCTAATAGA|CONSCOUNT=1|PRIMER=TS-shift2|PRCOUNT=1
+AGTTGGTAGATGCCCCTCTGGGAGAGATCCCCAGGGGTGACAGCCATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGTCCCAGGCAGCGCTGGCCCCTGCTGCTGCTGGGTCTGGCCATGGTCGCCCATGGCCTGCTGCGCCCAATGGTTGCACCCCAAAGCGGGGACCCCGACCCCGGGGCCCCCGGTGGAAGCAGCCGACCCCGCC
++
+GGGGGGGGGGGGGGGGGGGGGDFGDGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGCG8@FFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGDGGGGGGGGGFGGGFCFGGGGGGGGGFFGCFCDDFGGFD@GCGGGGGFGGEGCECFG++:CEEDGEFGFBFGCFCGGGGC:><8:FFFFGDGGGG=:E8=9CFGEGFC+9*2AC:5*<FCFGG6<8*1/*;9@5:C=*:ECE5<EEG################################
+@ATGCATATGAGTGTGGC|CONSCOUNT=1|PRIMER=TS-shift2|PRCOUNT=1
+ACAAGATCCTGCCCTGGAGCTGAAATGGGCACCAGGCTCTTCTTCTATGTGGCCCTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGGAATCACCCAGAGCCCAAGATACAAGATCACAGAGACAGGAAGGCAGGTGACCTTGATGTGTCACCAGACTTGGAGCCACAGCTATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCTATTCCTCATCAGCGTCTGATATTACAGATAAAGGAGAAGTCCCCGATGGCTATTT
++
+DGCEFGFFGGFGCFGGFGGGGGGGGGGGGCGGGFFDFFGGGGGGGGGGGDFGGFGGGGGGGGGGGGFFFEFFGGDGGGGG?F7FFDFGGGFGGGGGGGGFGGFGGFCEFFCFFGFFCF8?EFFCG8FGGGG>D@@CC,,:F;FC=DFF;FGGFGGCGGGFG8@==EF8,3=F=>@CFGGGCC7ECD;C@*AE68:,8,9D1:C*,6:;D5*1:**:,,,5,?,5,>,,,4=<C**3**1++1:++++1A9@CB+:8<EGGFGFC8?*/:CC####
+@CGGAATACTCACAAATT|CONSCOUNT=2|PRIMER=TS-shift1|PRCOUNT=2
+GTCTGGGAGAGGAGCCCAGCACTAGAAGTCGGCGGTGTTTCCATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGTCCAGTGTCAGGTGGAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGNCTCTCCTGTGCAGCCTCTGGATTCAGCGTCAGTGCCTATGNCNTGCNCTGGGTCCGCCNGGCTCCNGGCANGGGGCNGGNCNGGG
++
+ilmmmmmmmmmmmmmmmmmmmmmlmmmllmlmmikjlmmlm_lmlmik[dlllmmjillmmmmmmmmOakimmmmmlmlmmhllldkkmlmjlmmlilmllimlmlmmmmmjil_gkRilmkkbgkjgkglih^eglel^k\jlimllek]glkhgkikk\eidgmmk`RP[hiPMYjkKakkB\Wckh]!A;AHIIE9-=;-78:?:E:>;->=3--+5,,,429E5,-<!,!@HI!HIHH@42CFFF!;G::GG!EHE%!%%%%%!%%!%!%%%
+@TTAAGATACTAACAGGT|CONSCOUNT=1|PRIMER=TS-shift3|PRCOUNT=1
+TGGAGGAACTGCTCAGTTAGGACCCAGACGGGACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCTGCCACCCTGTCTCTGTCTCCAGGGGACAGAGCCACCCTCTCCTGCAGGGCCAGTGAGACTGTTAGAACCAAGGTAGTCTGGTACCAGCAGAAACCTGGCCAGCCTCCCAGGCTCCTCCTCTATGATGCATCCACCAGGCCCACTGGTATCCCGGC
++
+CGGDFEGFFFFGEEEFGGGGGGGGGGGGGG>EFBFGDFGGGG?EFEGGGGG@FFFGAEFFGGGGGGGFGGCGFGGGGGFGCF,AEECEF<EFE@EGFFEFGGGFFGGGGGGCGEGFE9:8@FGGDFDFGGAE;7EF9,FFGGCGGGGGF86FGDGGGGGGCC8C,@6EGGGG@D??,>;8CEGFGCFFCF7>*CFC=>CBF?FFGCC8?FF@C=ACFFGE=*2=AFDF)3*+*3<+)=;CGG979EGC=C?#######################
+@GGGCCTCTTTATTTGTC|CONSCOUNT=1|PRIMER=TS-shift4|PRCOUNT=1
+GGGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCCCTGGAACCAGCCGTTACGTTGGTGGTTATAACTCTGTCTCCTGGTCACAAACGCACCCAGGCAAAGCCCCCAAACTAATGATTTATGATGTCCGTTAGAGGCCCTACGGG
++
+GGGGGGG8:CFG8CC<F8EEEGG8C+85*?CE?FF?EGGGGFG58CC58:8EGCFFCCFGGGGGGGF5;CFD71<F?F6/;8AF>>D8@FF76@CGGECCFG7:+AC>FGGEF+<8AFFE:@8C8EGC@C*:*;87@+:?>6C*3<88CF58?@:CFGF96@88FFFDFEC;855*A**/;*;F8=FG>C7A9CFGF99CFGF9CC+0++3++**1**18CCCFG*C6CF###########################################
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_assemblepairs_test_r2_in.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+@ATCTTTGCGGCTGGTTA|CONSCOUNT=1|PRCONS=Human-IGK|PRFREQ=1.0
+TTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
++
+FFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
+@CGGTTTGGTGCATCTAG|CONSCOUNT=1|PRCONS=Human-TRA|PRFREQ=1.0
+TGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCAGAGTAGAGAGTTCACCACACAGAGGTAGGTGGCTGAATCACTGAGCTTGGAGTCTCTGATGAGCAGGGAAATATACTGGCCGGCTCTATTGAGCTGTGCTGTAAACCTTCCATCTTCATTACCACTGGAGTATACGGACATCAGCAACTTAGGTTCTTTCCTGCAATCCTGTCTGTACCAGAAGAAAGACTGAGAAGCACTGTTGCTGTAAGTACAGT
++
+GGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGG9FFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGGGGEEGGGGGGGGGGGEGGGGGGGFFGGDGGGGGGGGGGGC;DFGGGGGGGFGGFCE6CEGGGGGGFFDFCGFEGGGGGE>FGFFGGG7CFGGGGF8CCFGGF6?6DGFFGGGGGFGFC46AF=<FGF?=+9CFFFF:
+@CTTGCTTATGATTCCAG|CONSCOUNT=1|PRCONS=Human-IGL|PRFREQ=1.0
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCAAGTGCCAGCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGTGCTCAGCCCCAGAGGTGGAGCCAGAGAAGCGATCAGGGATCCCGTCCCCCTTGCTGTGACTGCCATCACTGTTAACCTTCATCAGATACCGAGGGCCCTTCTGTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCCCACTGC
++
+GGEFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGEFCGGGGGGGGGGGGGGGGGFGGFGGGFGGGGCGGCGFDFFGEFEC<FCEFGGGGGFFGGFGGGFFGGGFEGGGGGDCGGGGGGGGFDGGG<C@FEFFGCFGFFEFCEEGGDFGFCFEGGDGFG?FFCGDCGGGGCCGFFGGGGCEGGGCCEGG3>DG*1*>FFFGFFFG:C<0AF*9@BC@>@CD5C57CCD575*9:?:?6<4@<:<F4
+@TTTCTTTAGTGAAATGC|CONSCOUNT=1|PRCONS=Human-IGK|PRFREQ=1.0
+TTCGCTTGATCTCCACCTTGGTCCCCCCGCCGAAAGTACACCAGTCGCTACGTTGCTGACAGAAATAAACTGCAAAATCTTCAGGCTCTAGGCTGTCGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGACGCCAGTGGCCCTGTTGGACGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGGCTAAGTAGGTACCAACATCCTGGCTGGCCCTGCAGGAGAGGGTGGCCCTTTCCCCTGG
++
+GGGGGGGGCGGGGGGGGGGGE;EFGGGGGGGGGDGGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGFGFGGGCCGGFCGGGGGGGGGGGGFGGGGGGGGGGEGGGGGFGGDGGGGGGGGGGGGGFGGGGGGCGGGFGGGFGFFGGGGG8FGG@CFFCCF7:DAFFGGE@EGGGGGFFF@CC:?DB7A8@FG,=EGGGGG>CFGGFFGGCGG78C?CFCF>FFFGGGC?9CCF>7DEC*9C+<**:55=FGG41*37*/*18:DDDG*59?FFGFFFF9
+@ATTTCTATGGCTTTGTT|CONSCOUNT=1|PRCONS=Human-TRB|PRFREQ=1.0
+CTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATTGCTACACAGTGCATCATGAGTGTCCCCGTATCGAACAAAGCCATAGAAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAATAAGCGAAAGACTGCACGCACTGCACTCGAACAACCAGACATTGATCAAAACAGACACAATAAGGTTAATCATTCTCAATCTAAGCGAACATTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGG7;DGGGGGGG:CEGGGFFGGFFG6BCCB>BEGG#################################################################################################
+@GGGACTCCAAAATTAAT|CONSCOUNT=1|PRCONS=Human-IGL|PRFREQ=1.0
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAACCATTCAGGCTGTCATCCCATGTAGCACAGTAATAATCAGCCTCATCCTCAGACTGGAGCCCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCTGAGGGCCGCTGAGTATTGCTATGGATGAGGAGCTTGGGGGCCGTTCCGGGGAGTTGCTGGTACCAGTTTACATTATTACTTCCGATGTTGGAGCTGC
++
+GGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGFGGFFGGFGGGGGGGGGGDGGFGFGGGGFGFGCGGGGGFGFFFGGCFFGCECFBGGG78E*CFGGGDEGG*8/;<CG7CEFFGFGGGFGGGCEG6+;CGDDC*::CFCEGGGGG:<D>6:EC=<7*7C7*7?:*::76CFGF6?G#############
+@CCTTGTCCGAGATGTCT|CONSCOUNT=1|PRCONS=Human-IGK|PRFREQ=1.0
+TTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGCGAGCGGGGGATTGTAAGTCTGGTGACAGAAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAATCTGTCCCAGATCCACTCCCACTGAACCTTGACGGGACGCCACTGTGCAAACTGGATGCAGCATAGATCAGGAGCTTAGGGGATTTCCCTGGCTTCAGCTGATACCAATTTACAGAGCTGATACAGCTCTGGTTTGCCCGGCAAGCGATGGACAATATGGCTAC
++
+EEFEGGGGFDGGGGGGFGFFGGGGGGGGFGGGG7CFFGGG:FFCGGFEFGFEEFGGGGGGG9FCFGGGGF<FGDFCGGGGG<AEEFGGGGGGGGEG?EEGGFFGFFCFG<FEFFGFG9FFEAFFFGGGGGFDFGG8DFBFF,3+@CFFGFGGGC<*11:>>FGF,?,>DCF,?<BFFGFFFE,,?,?,<?*=>=:E@G**=9+40=C85@FGG?1>C67C?+>CEC7ED7CFG60*12/**29C4CF)*27>FD*1<CD>>GFB################
+@CGATGTAATCTTAGCTG|CONSCOUNT=1|PRCONS=Human-IGL|PRFREQ=1.0
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAATGCCAGTGCCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGCGCTCAGCCCCAGAGCTGGAGCCTGAGAAGCGATCAGGGATCCCGTCCCCCTTGATGTGGCTGCCATCACTCTTAACCGTCATCAAGTAGCGAGGGCCCTTCTCTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCTCACT
++
+GGGGDGGGGGGGGGGFGDGGGGGGG,FCGGGGGGGGGGGFGFGFGDGGGGGGGGGGGGGDG8FGGGGGGGEFCGGGGGGGFDGGFFGGGG99=FGCFGGGGFF9=FGGGGCFGGGGGG<FCFEFCFCFCEFGGC*F7<FFGGGGGG>FCFGGGFGFGGGCFFC<1F@FG,CGGGGFGFGGGCEGG6CFCG+C=FECFCF?FG7@+2<CFGC:E5*<EEGGGCFC7CEGEGEGC*A>DD6>FDEGGFGC7>C*2<>F65?D3*85::>>C=+/6FGA47<@#
+@CTTGATAGGAATGAATA|CONSCOUNT=1|PRCONS=Human-TRB|PRFREQ=1.0
+AGTGACAGTGGGGTTGGCCTTGGGCTGACTTAGGACGGTGACCCTGGTCCCAGTTCCGAAGACCACAGTGCTGCTGTCCCACACCTGACAGGAATAGTCAGCCTCATCCCCGGCTTGGGCTCTGCTGATAATCAGGGTGGCCGTGTTCCCCGAGTTGGAGCCAGAGAATCGGTCAGGGATCCCAGAGGGCCGGTGGATATCCCTATAGATGATCAGCACAGGGGCCTGGCCTGGCTTCTGCTGGAACCAGTACACACTTTTACTTCCAATGTTGTTTCCCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFEGGGGGGGGFEGFFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGDGGGGCEGFGGGGGGGFCFFECDE5=C4FFGGGG>;FDFGGFCFFGFFGGFFGGGGFGFFFGFFC@57)6FAFF:A<FG
+@TTAGCTACATGTAATTG|CONSCOUNT=1|PRCONS=Human-IGK|PRFREQ=1.0
+TTCGTTTGATCTGGAGCTTGGTCCCCTGGCCAGAAGTGTAAGGACAGGGTGTAGTTTGCATGCAGTAATAAATGCCAACATCCTCAGCCCCCACCCTACTGATTTTCAGTGTGAAATCCGTGCCTGTACCACTGCCGCTGAATCTGTCTGGGACCCCAGAGACCAGGTTAGAAACTTTATATATTAGGCGCGTTGGAGATTGGCATGGCCTCTTCTGAAACCAGATCAAGTAGATGTTGACATCACTGTATATGAGGCTTAGAATCGTACTGCGGGAGGT
++
+EFE@@9CBFGFF,,;C;,6<FFF<6,CFC,,;DEFG9C@CEF<,<6F,86B@FF<E9C9EFCE9E,,C<EEFFFE,6,,9CFFFFFGD,FFGC@FFE8DFFAFC9EFGF?FGGGAF,,,7B=C+:E55?:,:<=,?FDDCEF9FAB5C,,AFFG>++6BFA,3=,3>,373>EF,,3,=DF;CFA,,,,@++5>EEFG##################################################################################
+@ACTTAACGGCCAATTAA|CONSCOUNT=2|PRCONS=Human-TRB|PRFREQ=1.0
+GTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGGCCCCTAATGAGCTGGCGCAGAAATATACAGATGTCTGGGAGGAGGCAGCAGACTCCAGAGTGAGGGGGAGGTCCTCTGTGTTTGATCTAGAGACACTGTAGCCATCTGAGACTTCTCCTTTGTTAGTGTCTTGAACACCATATGAGTAATGGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATTGTTGTGGTTCCAAGTCTGGTGAC
++
+mmmmmmlmmmmmmmmmmmmmmmmmlmmmmmmmmmmmmlmmmmiklmmmmmmmlmmmmmlmmmmmlmmlllmlmmmmmmmmmmmmmlmmm]lgkmmmjlhlmmmmmmmmmmmmmmmmmilmmmmmmmmkmmmmmmmillmmlljiimllilimiiklilgceflmlmmmRjlklalllmlmmmmllk_klmmhkmlmlmje]\Railllmli_]]glhkimmmmlbDbLdimi_QQfdf_ZlmkcPYSSQ__N^GYY^e]dURcYgWWbTO]dkkk]YcBH2
+@TCCAGATTCGGATTACA|CONSCOUNT=2|PRCONS=Human-TRA|PRFREQ=1.0
+TGGATATAGGACTTGACTCTCAGAATGGTTCCTGCGCCAAAGACCAGTTTGTTTCCATGCCCATCGGGGCTTGCTGCACAGAAGTAGACAGCCGAGTCTTCAGGTTGGGTCTCTGTGATGTGCAGGGAGAAATGTTTGGCTGTCTTGTTCAATGTAACAGCAATTCGTTGGTCTTTCTTTTCGCCCACATTTGAACGAATGTCTATAATAAGCTGAGGTCTTTTTCCAAGTTCTTGCTTATACCNAGGGAAGTAGTTTGAGGNACTGTCTGAATAAGTACA
++
+mmmmmlmmmllmmmmmmmmmmmmmllmmllllmmmmmmmmmmmmmmmmmmmmmmlmmmmmmmmiilRikmmillmmm^lmilmmmmmmmmmmmmmmmmmlmmlmlkikmmljgkmmmlRikbljlmmmkmmbRiglljlj^ddlllilmmmllmmmmllllmmgRfjlRfZil^Rfjlmlli^dkd\iklmlkhYhikijlmmlRcdXi\QaORRRWOd\kmmlllNPNOZc^eak]P`flcld!bbZBbhbNaQYfi\M;P!CW`\_flcTKZS[Wa`68
+@CGCATATATCTGCAAAA|CONSCOUNT=1|PRCONS=Human-IGHA|PRFREQ=1.0
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCATTGTCCCTTGGCCCCACATATCAAAAGCATGCCAGCCACTGCTATATTCTCGAGAACAGTAATACACAGCCGTGTCGTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCTTCACTGAGTCTGCATAGTATATGTAACTTCTACTAGCATCAATGGATGAGACCCACTCCAGCCCCTTCCCTGGAGCCTGGCGGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGDGGEGEFGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFFGEGGGGDEGGGGGGGGGGGGGGGGGGEEFGGGFGGDGGGGGGGGGGDFFGGGGG;;FCFFAFDFFGCGGFGGGGGGGGGGGGF;DCD66DFGGFCGGFGGGGD5F:CFGC7CCGF?=CFF7C9FGFGF+AF7E+<CFC:@*:>DFG@:*=FG;<@?3C>B>?FG4497>FG:?F*)07?@??:FF###
+@ATTAGTTCATAAATTCC|CONSCOUNT=2|PRCONS=Human-IGK|PRFREQ=1.0
+TTCGTTTGATCTCCACCCTGGTCCCTCCGCCGAAAGTGAGAGGCCACTCGCTACGGTGCTGACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGNTGGTGAGAGTGAAGNNTGTCCCAGACCCACTGCCACTGAACNTGGCTGGGNTGCCAGTGGCCCTATTGGNTGCATCATNGATGAGGAGCCTGGGAGNCTGGCCAGGTTTCTNTTGGTANCAGCCTNAGTAGCTGCTNATACTCTNNCTGNCCCTGCAGGNGAGGGTGACTCTTTCCNC
++
+lmmmmmmmmmmmmmmimimmmmmmmfR^lmmkmmQflmR\R_^i]ili^llmmkRfl]`lm_icjbliljklmmlml_eleRhlmklicbkceeRRRhljm!lfQjllRR`_eegR!!`R`_[eeRglQ\cllcljdlli_Rb!]gRRgicO!fiihhmj_lib\Y[ffSf!fhk]cj\R!ZbiggejdYbklIIIII!IA:HEEEHIHIII;!HIHIEE!HHIIHI!IIIIII@96E!II?E>,4!!HFE!IIEEEEEIE!1<EIIHIHHHHIHAHD!>
+@ACTCGTGCTAATCCTTC|CONSCOUNT=1|PRCONS=Human-IGL|PRFREQ=1.0
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCCCCTGCCGGCATCATAAGACTGACAGTAGTAGTCAGCCTCGTCCTCAGTCTTCAGTCCAGAGATGGTGAGGGAGGCAGAGTTGGAGGAGCTGTCGATGGAGCCAGAGAACCGATCAGGGACCCCAGAGGGTCTTTCGTTATCCTCATAGATCACAGTGGTGGGGGCACTGCCCGGGCGCTGCTGGTACCACTGCACATAGTTGCTGGCAATGCTGCCACTGC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGFGFFGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFFEEGGGGGGGGGGGGGFFGECGFFGGFGGGGGGGGFGGGGGGGGGGFE+*8EEGGGEFGGGGGGGGGGGG<6FGGFGGFFFCFGGF7>>DFGGGGFGG4D@4*=4;??FGC
+@AATTAATGGTGTTGAGA|CONSCOUNT=1|PRCONS=Human-IGL|PRFREQ=1.0
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAAAACCACAGAACCACTCAGGCTGCTGTCATAGGACTGGCAGTAATAATCAGCCTCATCCTCAGCCTGGAGGCCAGTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAAGCGGTCAGGGCGTCCTGAGGGCCGATTGTTGTTACCAAAGAGGAGGAGTTTGGGGGCTGTTCCTGGTAGCTGCTGGTACCAGTGAACATCATAACCTGCCCCGAGGTTGG
++
+GGDGDGGGGGGGFGGGGG<FGDFGCGGCGGGGGGGGGGG?CGGGGGGGGGGGGGGGGGCG<FFFFG<44AB=CGGGDGC,ED<9B,,EC,EFGGGGCFF9,C??FFGGFGGG@CCDFEFE7BF7:D>>CCBFF<CFB7CFFEGCCFEG><:>:3F7@C97DFCEB32F,,?CC<E:8B:B,*3=7C*;<**B:7:CE7*00@FFGGGG?86<*;FC5*/0*<@CC885:?8C7+002+000<F?FFGFD7+**+9CFC@>*:C##################
+@TAGTCAGAAGATTATCT|CONSCOUNT=1|PRCONS=Human-IGHA|PRFREQ=1.0
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCAGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGAAGTCAAACTCCGCCACCTCCGTTGTAGCTCCCACTACAGTCGTCGTATCCCTCGCACAGTAATAAACAGCCGTGTCCTCTGCTGTCAGGCCGTTCATTTGCAGATAAAGTGAATTCTTGGCGTTGTCTCTGGAGATGCTGAATCGGAACTTCACAGAATCTGCATAGTACTCGGTTGTTCAATTTCTTCTATTGTCTTAAACCCACTCCAGCCCCT
++
+CFGG7F7CFC<FGDFFGCFGGGGGC++8CECF,67C,EG,B6CDFCCEEEF@FGGGG?F,C@:,CEEGFFGC<?CEFE:EFEFC@CGFCEFAC9,BDF8E?F?CEG+BD:+DAFECF<FGGGGDF,BFFFC,C,,:+@@F,@=,,3>,33@9;7<CF*@<,37F,,3FC,,?F,,,,7,@D9,,:C>EC**?;?9;EEFGG+9?99+A+****3BFG+>CF6+5<F#######################################################
+@TAGCCTTCACTTTAGTT|CONSCOUNT=1|PRCONS=Human-IGK|PRFREQ=1.0
+TTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGAAGCGCGCATACCTTGCATACAATAATAAACCCCAACATCCTCAGCCTCCACCCGGGTGATTTTCAGTGTGAAATCTGTCCCTGACCCGCTGCCACTGAACCTTTCTGGCACTCCGGAGACTCGGCTGGAAACGTCATAAATTAGGAGTTCTGGAGACTGGCCTGGCTTCTGCAGGAACCAAAATATGTAGGTCTTTCCATCACTATGTAGGAGGCTCTGGCTAGACTTGCAGGAGAT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGDFGGGGGGGGGFGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFFGGGGFGGGGGGDGEGGGGGGGGGGGGGFGGGGGGGGGGGGGGEGCFBCFFEDGGGGGGGE@BFGGEGGGGFGGGGGGGGGGFGFGFFGFGGGFGGGGGCEGGFF*A:@FF9CGGGGGDEFC73<?*<F>DGFGGG=FDCGDFGGGG:<9CG?FBC2@####
+@GAAGAATTGTAACAATC|CONSCOUNT=1|PRCONS=Human-IGL|PRFREQ=1.0
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCACAGTGTAGCTGCCTGCATATGAGCAGCAGTAATAATCAGCCTCATCCTCAGCCTGGAGCCCAGAGATGGTCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGATCCGGGACCCCTGAGGGCCGCTTACTGACATCATAAATCATGACTTTGGGGGCTTTGCCTGGGTACTGTTGGTACCAGGAGACATAGTTATAACCACCAACATCACTGCTGG
++
+GGGGGEGEGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGBFGGGGGGGGGGGGGGGGGGGGGGGFFGAEGGGFFFFGGGGEFGGGGGGGGGGGGGGGGFGGFFGGGGGGFFGCFGGGGGGGGG7FFFFGGGGGGGGGGFGFAFCFGGFGGDFGCC:CE8:@EEGGGGGGGFFGGGEECGGGGFFGGGGGGGCFGFCFC7FFGGFGEEEG5*7CCECGGGGFFF7FDDGGGGFFG3FDFGFFDD>7*:=>?DGDEFFGF:49?>F?FFF
+@GAGACTTTGCTTGTACA|CONSCOUNT=1|PRCONS=Human-TRB|PRFREQ=1.0
+GTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTAACACGGCCCCCGGGTCCAGTACTGGCACAGAGATAGAAAGCTGTCGGGTTCTTTTGGGCCGATGTCACAGTGAGAGGAAAGGATTCCTTCTTCTCCCGAGAGACGCTGTACCCTTCAGCTATATCTCCTTTCTTAAAGTCATTTACTATCTGTGAGTAGTAGAACAATCTCATCCCTTGCCCTGGGTCCTGTCGGTACCAGTACATGGCCTCGTGGTTCAAAT
++
+GGGGGGGGGGGGGGGGGGGFECGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFGGGGCFGGGEGCGGGGCFDGGGFGGGGF?FG<FF=EE@FFGGGGGGGGFCF:C<?BF9@FG+><FFEF>FFFGGCFFG9FFGGFFGFGCE9FGGGGFGGGGG7*>CE>FG@FECGGGGGGGGGFFG?CDGCGCFBF?9,5=2++5+1>EFFFF71<>=77@1AFFG<7+028C8CFG+;:9<C77<*<**1:)9@*007)75D777:>>7D4446)7:F#########
+@GTTCGTACTCTAATAGA|CONSCOUNT=1|PRCONS=Human-IGL|PRFREQ=1.0
+CAAGGGGGTGGCCTTGAGCGGACCTGCCCCACAGGCTCCGCAGGCTGGATCGGCTGCTTCCAACTGAGGCTCCAGGGTCTGGGTCCCCGCTTTGCGGTGCAACCATTGGGCGCAGCAGGCCATGGGCGACCATGGCCAGACCCAGCAGCAGCAGGGGCCAGCGCTGCCTGGGACCAGCAGGGCTGTTACAGTACACCCCAGTCCATTGGCTCTGTCCTCTCCCTGGACTGGCTCTGGTCCCTGTCCCTAGCCCAGGCCCTTCCAGGGTCCATGTCTGTCCC
++
+GGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGFGGGGEGGGGGGGGGCFFFGGCGGGGCFGGGGFGGGGGGGGGGGGFGGGGGGGGGGGDFGC:CEFGGGGGGGGGGGGDEDGGCEGGGDFFGGEGGGGGGGGGGGGFGGGGGGFGGFGG7CFGGGCGG@FFGGGGGGGGEGFGG>C5;EGGGFGGGGGGGGFEGDCFF6+0ACFEEFFFCDGGGGGGF@6@ECFGCC:?FGCCFFGF+2<?C7998C?**1:<GGF<?7@488F>CFC########
+@ATGCATATGAGTGTGGC|CONSCOUNT=1|PRCONS=Human-TRB|PRFREQ=1.0
+GTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGCCTCCCCCAGGGCTGCTGGCGCAGAAATACACAGATGTCTGGGAGCGGGTAGCTGACTCCAGAGTGAGGGGGAAATTCTCTGTCTTGGATCTGGAGACAACATAGCCATCGGGGACTTCTCCTTTATCTGTAATATCAGCAGCTGCTGAGTAATAGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATAGCTGTGGCTCCAAGTCTGGT
++
+GFGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGCFEFFGDCFGGFGAFFGGGGGGFDGFGGGGGGGFGGGGGGCGFGGGGGGGGEGGGGGGFGCGGF6CGGGGCFGGGGFGGGGDGGGGGG5CG6+<EECCDFGGDF<9D***98CGG;DGF7?7:ECFF+85C7B4?#######
+@CGGAATACTCACAAATT|CONSCOUNT=2|PRCONS=Human-IGHA|PRFREQ=1.0
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCACTGTCCCTTGGCCCCAGACATCAAANNNNGNNNNNNNNCNNNNNNNAAANNCNNCNTNNNNNNNNAANNNNNNNNCNNNNNNTNNNGNNNNNNGNNNNTNNNTTNCNNNAANNNNNNNNTNNTNGNANTNNNNNNNGNNNNGGNNNANCNGNNCNTNNNNGNNNNNNCNNNNGNNTTNNNANNTNCNNNNNNNGANNNNANNTNNNNCCNNNNCNNNCCCNTNCCTNGNNCCTG
++
+mjhmmmmmmmmmmmmmmmmmmlmmjmmmmmmllklmmmmmmmmmmmlljlmmjjlmmmmlmmmmmmmmmmlm!!!!m!!!!!!!!i!!!!!!!mil!!m!!l!m!!!!!!!!mk!!!!!!!!m!!!!!!^!!!k!!!!!!l!!!!l!!!hl!m!!!km!!!!!!!!\!!d!f!\!i!!!!!!!i!!!!Ib!!!_!g!Z!!`!g!!!!i!!!!!!e!!!!V!![^!!!H!!F!h!!!!!!!CF!!!!\!!M!!!!WV!!!!L!!!TXb!k!6B%!%!!%%%%
+@TTAAGATACTAACAGGT|CONSCOUNT=1|PRCONS=Human-IGK|PRFREQ=1.0
+TTCGGTTGATCTCCAACTTGGTCCCCTGGCCAAAAGTGTACGGAGGCCACTTATGATATTGCTGACAGTAATAAATTGCAAAATCTTCAGACTGCAGGCTGCTGATGGCGAGAGTGAACTCTGTCCCAGACCCACTGCCTCTGAACCTGGCTGGGATACCAGTGGCCCTGGTGGATGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGCTGGTACCAGACTACCTTGGTTCTAACAGTCTCACTGGCCCTGCAGGAGAGGGTGGCTCTGTC
++
+GGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGFCGCG>FAFFGFGFEGEGGFGGGGGG?FEFGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGGCFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF8FFCFCFGFG>FGGDFGGGFGGGGGGFFGG?EFGGGCFCGDGFDFFFCGGGGGGDGGGGCEGGGGGGGGGGGGGCGGGDDFGGGGGFGGFF7FFF*>FCFGCFDCGD5@7C>FF6>6>7
+@GGGCCTCTTTATTTGTC|CONSCOUNT=1|PRCONS=Human-TRB|PRFREQ=1.0
+AGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCACGGTGCTGCTTGTATATGAGCTGCAGTAATAATCAGCCTCGTCCTCAGCCTGGAGCCCAGAGATGGTCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGATTAGAAACCCCTGAGGGCCGCTTACTGACATCATAAATCATGAGTTTGGGGGCTTTGCCTGGGTGCTGTTGGTACCAGGAGCCATAGTTATAACCACCAACGTCACTGC
++
+GGGGFEFF7CFFGGG@FGGGGGFGGFGGGGFFFFEGDGGGCFFGGGCGGGGFGEGGGGGGGGGGFGGGGGGGGGGGFFGGGGGGGC?EFGGGGGGGGGGGGFFGGGGGGGGGFCGFDFGGGCGGGGGFFFDFFGFCEGGGEFEGEGFFFFCF:FCEFGCEFGFGGFCGGGGGGGGGG9EGG>*8<E8*=EE5B7=5:FFG?6CG7@C?:CFGFG:++<AC>CEGGGFCCFF?GGFFEDCCCG7:E:<7+0**1***097++3?>@C??57*7D3C1<>DF#
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_assemblepairs_test_reference_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,88 @@
+@ATCTTTGCGGCTGGTTA|CONSCOUNT=1,1|PRCONS=Human-IGK
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@CGGTTTGGTGCATCTAG|CONSCOUNT=1,1|PRCONS=Human-TRA
+GTGAGTGAACCAGGGCAGAAAAGAATGATGATATCCTTGAGAGTTTTACTGGTGATCCTGTGGCTTCAGTTAAGCTGGGTTTGGAGCCAACGGAAGGAGGTGGAGCAGGATCCTGGACCCTTCAATGTTCCAGAGGGAGCCACTGTCGCTTTCAACTGTACTTACAGCAACAGTGCTTCTCAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTGCTGATGTCCGTATACTCCAGTGGTAATGAAGATGGAAGGTTTACAGCACAGCTCAATAGAGCCGGCCAGTATATTTCCCTGCTCATCAGAGACTCCAAGCTCAGTGATTCAGCCACCTACCTCTGTGTGGTGAACTCTCTACTCTGGTTCTGCAAGGCAACTGACCTTTGGATCTGGGACACAATTGACTGTTTTACCTGATATCCA
++
+GEGFGGGGGGGGFGGGGGGGGGGGDGGGGGGGFGGGGGGCGEFFCFDGGGGGGGGGGGGFGF8BFGGGGGFFDFCFGGGGEGGGGGGD=FFGGGGDDGCGGCFFGGCFGGG8FGGCGFGGGGGGCCF;FFGGFGGGGEE7FFFFGGGG6CFDFFGFFFFC9,=CFGGGGGGC6CFGFGGGGGGFGG9B6FGGFCDFFGGGGGFFGGGFFGFFGGGGGGEFGGGFGFGGGGGGECFEFFGGFGGGGG?GFD;CGGGGGG>GGGGDGGFFGGGGGGGEGGGGGGGGGGGEEGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGFF9GGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGG
+@CTTGCTTATGATTCCAG|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGAAGGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
+@TTTCTTTAGTGAAATGC|CONSCOUNT=1,1|PRCONS=Human-IGK
+AGGAACTGTTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCACAGATATCAACGGAGCAATTGTGTTGACACAGTTTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGGGCCACCCTCTCCTGCAGGGCCAGCCAGGCTGTTGGTACCTACTTAGCCTGGTACCAACAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCGTCCAACAGGGCCACTGGCGTCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCGACAGCCTAGAGCCTGAAGATTTTGCAGTTTATTTCTGTCAGCAACGTAGCGACTGGTGTACTTTCGGCGGGGGGACCAAGGTGGAGATCAAGCGAA
++
+GGGDEFGGGGGDGGFGGFGFGEGGGGGGECDFGGGFC9FFGCFCEGCG<FDFFGGFGGAEECGGGCF,CFGGGFFFG,EFEDF?FG,?=C>FG+B,CFFEEFG=,CE,,EEFFGFFFFFCGGGGGEGAFFFFDEGGFFGGFG?9A?GDDD:>@BF?EGGDFGGF=CGGG8<,D9>FGD>>FCC;?CGGGFFFEFCF:?CBFGGCGGFFGGFC>GGGEGE=,GF@8A5BB?:CC>FFFGGEGGE@CGGFFAD:7FCCFDC@GGF8GGGGEFFGDGGGFGGGCGGGGGGFGGGGGGGGGGGGGDGGFGGGGGEGGGGGGGGGGFGGGGGGGGGGGGCFGGCCGGGFGFGGGGGGGGGGGGGGEFGGGGGGGGGGGGGGGGGGDGGGGGGGGGFE;EGGGGGGGGGGGCGGGGGGGG
+@GGGACTCCAAAATTAAT|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAAGCTCCTCATCCATAGCAATACTCAGCGGCCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCTACATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>4G?CFGFG6BEC+:?7=CC78>?=CEGGFFFFGGGGGECFCC:>CDDGC<+:;ECGGGFGGGFGFDEC7GC<;-8*GGEDGGGFC*E87GGGBFCECGFFCGGFFFGFGGGGGCGFGFGGGGFGFGGDGGGGGGGGGGFGGFFGGFGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGG
+@CCTTGTCCGAGATGTCT|CONSCOUNT=1,1|PRCONS=Human-IGK
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTAGCAGCTCTGTAAATTGGTATCAGCTGAAGCCAGGGAAATCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGGCGTCCCGTCAAGGTTCAGTGGGAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTCTGTCACCAGACTTACAATCCCCCGCTCGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGAA
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGE93>8BEFA>7C,>9DFGADFCCGEDF>7;=?GGDC<84;E=*=CCGFCFDFECEC6<CC76C>1?GGF@58C=04+9=**G@E:=>=*?<,?,?,,EFFFGFFB<?,FCD>,?,FGF>>:11*<AGEGFGFFC@+3*FDBFD8GGFDFGGGGGFFFAEFF9GFGFFEF<GFCFFGFFGGEE?GEGGGGGGGGFEEA<GGGGGCFDGF<FGGGGFCF9GGGGGGGFEEFGFEFGGCFF:GGGFFC7GGGGFGGGGGGGGFFGFGGGGGGDFGGGGEFEE
+@CGATGTAATCTTAGCTG|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGACAAGGGCCCTCGCTACTTGATGACGGTTAAGAGTGATGGCAGCCACATCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGAGCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF7@D77DGF8/:DCD>:@CEE>EG76F><C6C>7C>FGGEDF>6DG>A%CGEGEGEC7CFCGGGEEC79ECCGFC<D4C-GF?FCFDEF=C;?CFC6GGECGGGFGFGGEGC,GF@F1<CFFCGGGFGFGGGFCF>GGGGGGFF<7F*CGGFECFCFCFEFCF<GGGGGGFCGGGGF=9FFGGGGFCGF=99GGGGFFGGDFGGGGGGGCFEGGGGGGGF8GDGGGGGGGGGGGGGDGFGFGFGGGGGGGGGGGCF,GGGGGGGDGFGGGGGGGGGGDGGGG
+@CTTGATAGGAATGAATA|CONSCOUNT=1,1|PRCONS=Human-TRB
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@TTAGCTACATGTAATTG|CONSCOUNT=1,1|PRCONS=Human-IGK
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCATCATATACAGTGATGGAACCAACTACTTGCGCTGGTTTCAGCAGCGGCCCGGCCAATCTCCAACGCGCCTAATATATAAAGTTTCTAACCTGGTCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGTACAGGCACGGATTTCACACTGAAAATCAGTAGGGTGGGGGCTGAGGATGTTGGCATTTATTACTGCATGCAAACTACACCCTGTCCTTACACTTCTGGCCAGGGGACCAAGCTCCAGATCAAACGAA
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDED9=FFEGFGF4B@7EAGG5,@DF*@7,,@,,7:;C,53@**3(@ADE695=9@*7@CGGF8F###"##"####""######EFEC<5)+@,*,,AFC9DD=,3*,DC>173,>1*=3*AFB6++>GFFA,,C5BAF9FECDDF?,=<:,:?55E:+C=B7,,,FAGGGF?FGFE9CFAFFD8EFF@CGFF,DGFFFFFC9,,6,EFFFEE<C,,E9ECFE9C9E<FF@B68,F6<,<FEC@C9GFED;,,CFC,6<FFF<6,;C;,,FFGFBC9@@EFE
+@ACTTAACGGCCAATTAA|CONSCOUNT=2,2|PRCONS=Human-TRB
+GAGTCTGCCCACAGCAGGGCTGGGAGACACAAGATCCTGCCCTGGAGCTGAAATGGGCACGAGGCTCTTCTTCTATGTGGCCCTTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGAAATCACCCAGAGCCCAAGACACAAGATCACAGAGACAGGAAGGNAGGTGACCTTGGCGTGTCACCAGACTTGGAACCACAACAATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCCATTACTCATATGGTGTTCAAGACACTAACAAAGGAGAAGTCTCAGATGGCTACAGTGTCTCTAGATCAAACACAGAGGACCTCCCCCTCACTCTGGAGTCTGCTGCCTCCTCCCAGACATCTGTATATTTCTGCGCCAGCTCATTAGGGGCCAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+lmmmmmmmjlmmmmmmfkjkkkmkjmmmmmmmmjmmmmmmmmmmffklmmmlmmmmmmmmjmmmmmmmlmlmmkmmlmimmlihimmkjjillmieekjmRg^LFcjklkmkhijRhlkmgYflljMbjgiklll][]OhlQdgO>Ximg]klRRfPOigY!]j^7OhglgQY^\eegmicdhkkkd`[TbW_gYcR]d]fe[YP^P__Q^YYPgkmlZ_fdfQQ_imidLbEblmmmmikhlg]]_ilmllliaR\]ejmlmlmkhmmlk_kllmmmmlmlllalkljRmmmlmlfecglilkiimilillmiijllmmllimmmmmmmkmmmmmmmmlimmmmmmmmmmmmmmmmmlhljmmmkgl]mmmlmmmmmmmmmmmmmlmlllmmlmmmmmlmmmmmlmmmmmmmlkimmmmlmmmmmmmmmmmmlmmmmmmmmmmmmmmmmmlmmmmmm
+@TCCAGATTCGGATTACA|CONSCOUNT=2,2|PRCONS=Human-TRA
+AGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTTATATTCCTGTGGCTGCAGCTGGACTTGGTGAATGGAGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCAAACTACTTCCCTTGGTATAAGCAAGAACTTGGAAAAAGACCTCAGCTTATTATAGACATTCGTTCAAATGTGGGCGAAAAGAAAGACCAACGAATTGCTGTTACATTGAACAAGACAGCCAAACATTTCTCCCTGCACATCACAGAGACCCAACCTGAAGACTCGGCTGTCTACTTCTGTGCAGCAAGCCCCGATGGGCATGGAAACAAACTGGTCTTTGGCGCAGGAACCATTCTGAGAGTCAAGTCCTATATCCA
++
+lmilmmlmmmmmmlmblmmmmmmmkmmllmmmmmmmmlmmmmmmmmmmllmmmmmmmmmmilmmmmmmmmm^lmmmjkmmmmmmlmmlmmmlmll_k[\ldlilmiffklmmmmlllkmmmlej]eklkkll_gllmlmgbckkmml^fcimkZfkikmiijlXkgmi^k^RfeiQekmllmlim\gjklkimflmllf_ciak]Q<M\ifYVaPbhilmimldlclf`S]kah^chYkdklllmmk\dOWRRROaQ\iXdcRlmmljikihYhklmlki\dkd^illmljfR^liZfRljfRgmmllllmmmmllmmmlillldd^jljllgiRbmmkmmmljlbkiRlmmmkgjlmmkiklmlmmlmmmmmmmmmmmmmmmmmliml^mmmllimmkiRliimmmmmmmmlmmmmmmmmmmmmmmmmmmmmmmllllmmllmmmmmmmmmmmmmllmmmlmmmmm
+@CGCATATATCTGCAAAA|CONSCOUNT=1,1|PRCONS=Human-IGHA
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGGCTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTATCGCAGGACCTGGGTCCGCCAGGCTCCGGGGAAGGGGCTGGAGTGGGTCTCATCCATTGATGCTAGTAGAAGTTACATATACTATGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTGTATTACTGTTCTCGAGAATATAGCAGTGGCTGGCATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C(25FF:??@?771%F?CGF>;ECEGFE>B>C3?@:9EF=*:@GFD>:*@:CFC<+E7FA+FGFGF9C7FFC=?FGCC7CGFC:F5DGGGGFGGCFGGFD66DCD;FGGGGGGGGGGGGFGGCGFFDFAFFCF;;GGGGGFFDGGGGGGGGGGDGGFGGGFEEGGGGGGGGGGGGGGGGGGEDGGGGEGFFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF?GGFEGEGGDGGGGGGGGGGGGGGGGGGGGGGGG
+@ATTAGTTCATAAATTCC|CONSCOUNT=2,2|PRCONS=Human-IGK
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTACCAACAGAAACCTGGCCAGNCTCCCAGGCTCCTCATCTATGATGCATCCAATAGGGCCACTGGCANCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACANNCTTCACTCTCACCANCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGCGAGTGGCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAACGAA
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmkETNP^Qfh[idOFNIMLEdMfkk^hTIW[TNIPXBEEIHOLa[IIIHIHEFEIIAI!IIIIIlkbYdjeggibZ%R\jc]khf%fSff[Y\bil_jmhhiif!OcigRRg]%bR_illdjlcllc\QlgRee[_`R`!!Rgee_`RRlljQfl!mjlhRRReeckbcilkmlhRele_lmlmmlkjlilbjci_ml`]lfRkmmll^ili]i^_R\RmlfQmmkmml^Rfmmmmmmmimimmmmmmmmmmmmmml
+@ACTCGTGCTAATCCTTC|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@AATTAATGGTGTTGAGA|CONSCOUNT=1,1|PRCONS=Human-IGL
+AGGCTCTGCTTCAGCTGTGGGCACAAGAGGCAGCACTCAGGACAATCTCCAGCATGGCCTGCTCTCCTCTCCTCCTCACTCTCCTCGCTCACTGCACAGGGTCCTGGGCCCAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCCCTGGGAACAGCTCCAACATGGGGGCAGGTCATGATGTTCACTGGTACCAGCAGCTACCAGGAACAGCCCCCAAACTCCTCCTCTTTGGTAACAACAATCGGCCCTCAGGACGCCCTGACCGCTTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCACTGGCCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTTCTGTGGTTTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+@CEGGGGGGGGGGGGGGGFGGE8@FAEFCFGFE,EF@F,EFFGFGFGG9FF?FCFE<FGGF,EFA@FGGGGGFFGGGAFEAEC8FF,=FFGGGFFCA<BFGDEEFA=B<?FFGF@EFF?,E,9A+?BFCG+F:F@@FFEGF=FD8FC+3+8BE78@8@D8:C:@FCCF7D;FF9,8@2?EF8,,*DFFDFG###"#"#########"C:(<@CFC9+**+7DFGFF?F<00.)200)5A8?:588CC@<*./*5CF;(<68?GEEGFF@..*7CC:7:B**<;*C7=3*,B:B8:E<CC?,,F23BECFD79C@7F3:>:<>GEFCCGEFFC7BFC<FFBCC>>D:7FB7EFEFDCC@GGGFGGFF??C,9FFCGGGGFE,CE,,B9<DE,CGDGGGC=BA44<GFFFF<GCGGGGGGGGGGGGGGGGGC?GGGGGGGGGGGCGGCGFDGF<GGGGGFGGGGGGGDGDGG
+@TAGTCAGAAGATTATCT|CONSCOUNT=1,1|PRCONS=Human-IGHA
+TCTCAGAGAGGTGCCTTAGCCCTGGATTCCAAGGCATCTCCACTTGGTGATCAGCACTGCACACAGAGGACTCACCATGGAGTTGGGGCTGTGTTGGGTTTTCCTTGTTGCTATGTTAGAAGGTGTCCAGTGTGAGGTTCAGTTGGTGGCGTCTGGGGTAGGCTTGGTACAGCATGGAGGGTCCCTGCGACTCTCCTGTGTAAGCTCAGGATTCGCCTCAAGTCGTCATGAAATGAATGGGGGCCGCCAGCCCCCCGGGACGGGGTCGGGTGGGGTTTAAGACAATAGAAGAAATTGAACAACCGAGTACTATGCAGATTCTGTGAAGTTCCGATTCAGCATCTCCAGAGACAACGCCAAGAATTCACTTTATCTGCAAATGAACGGCCTGACAGCAGAGGACACGGCTGTTTATTACTGTGCGAGGGATACGACGACTGTAGTGGGAGCTACAACGGAGGTGGCGGAGTTTGACTTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCTGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+CFEGCDAFGGDAF8E9<CGGFG?88<C<FAFECF@,C@FFFDG9<<EE7F,,9C@,BFE,:BC<7@FGF8B8F<BA9EF8,AB?,98:F7C,B,BF8FG+CDADE<<5CFE,,9?9@,@FGG?E@FC?C8=E,9;F,E,,,C=;EC@+@,+6@+3>,@+63+98F8+3E;C9,,,3,,6++58::C:,*@CEEFAFGF##############################################################"####""##"""###########################################F<5+6FC>+GFB3****+A+99?9+GGFEE;9?;?**CE>C:,,9D@,7,,,,F?,,CF3,,F73,<@*FC<7;9@33,>3,,=@,F@@+:,,C,CFFFB,FDGGGGF<FCEFAD+:DB+GEC?F?E8FDB,9CAFECFGC@CFEFE:EFEC?<CGFFGEEC,:@C,F?GGGGF@FEEECCFDC6B,GE,C76,FCEC8++CGGGGGFCGFFDGF<CFC7F7GGFC
+@TAGCCTTCACTTTAGTT|CONSCOUNT=1,1|PRCONS=Human-IGK
+GGATCAGGACTTCTCAGTTCATCTTCTCACCATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATCCCTGGATCCAATGCGGATATTGTGATGACCCAAACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGCCAGAGCCTCCTACATAGTGATGGAAAGACCTACATATTTTGGTTCCTGCAGAAGCCAGGCCAGTCTCCAGAACTCCTAATTTATGACGTTTCCAGCCGAGTCTCCGGAGTGCCAGAAAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCACCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTATTGTATGCAAGGTATGCGCGCTTCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAACGAA
++
+GGGGGGGCGGGGGGGGGGGGFGGGGAEGGGFGFGGGGGGGGGFGFGGFGGGFGGFFGDGGFGGGGGGGFGGGGGGGGGGGGCFFGFFCFFGG+F:DGGGFGGGFGGGG7FFGCGGGGGGGFGGGGCFGFGGGFGGGGG8BEFCFGGGGGFFGGGFGGGGG?GCFGGGGGGGFGFGGFGGGGGDDFCFF@DFGFEDGGGGGC9FFCFAFGGGGEGGGGGGFGGGFGFFGFGFGGGGGGGGGGF?GGGEGGFC@EGGGGGGGGE>FCBFCGEGGGGGGGGGGGGGGFGGGGGGGGGGGGGEGDGGGGGGFGGGGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGFGGGGGGGGGFDGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@GAAGAATTGTAACAATC|CONSCOUNT=1,1|PRCONS=Human-IGL
+GGCTGGGGTCTCAGGAGGCAGCACTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTCCTCCTCAGCCTCCTCACTCAGGGCACAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCGCTCAGTGTCCGGGTCTCCTGGCCAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGTACCCAGGCAAAGCCCCCAAAGTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTCCCGGATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCTGCTCATATGCAGGCAGCTACACTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGFGGGGGGGGGGFGGGGGGGGGGFFGGGGGGGCFCEFGGGGGGGGGGGGGGFGEFGGGFFGGFGGGFGGGGGGGGFGGG,=?FCFF<EFGGGGCDGGGGC<EFGGGGG,AD9FGGGG:FEE6@FD;FFGFFGGGEGGGFGC,@8DFG,;,5EEFCCFFFGGGGFGGG78:FGGGF?C?CFGGFFEFGG?>AEF7@FGFFGFFF@GFFGGGGDGFEGFFGGGGCECC7;7GEGFGGGGF>7CFCFGFDGGGGGGGFFGGGECCEGGGFFGGEGGGGEE@:8EC:CCGFDGGFGGFCFAFGFGGGGGGGGGGFFFF7GGGGGGGGGFCGFFGGGGGGFFGGFGGGGGGGGGGGGGGGGFEGGGGFFFFGGGEAGFFGGGGGGGGGGGGGGGGGGGGGGGFBGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGEGEGGGGG
+@GAGACTTTGCTTGTACA|CONSCOUNT=1,1|PRCONS=Human-TRB
+GATTCCAGCCTCTGACAAACTCTGCACATTAGGCCAGGAGAAGCCCCCGAGCCAAGTCTCTTTTCTCATTCTCTTCCAACAAGTGCTTGGAGCTCCAAGAAGGCCCCCTTTGCACTATGAGCAACCAGGTGCTCTGCTGTGTGGTCCTTTGTCTCCTGGGAGCAAACACCGTGGATGGTGGAATCACTCAGTCCCCTAAGTACCTTTTCAGAACGACAGGACAGAATGTGACCCTGATGTGTGACCAGAATTTGAAACACGAGGCCATGTACTGGTACCGACAGGACCCAGGGCAAGGGATGAGATTGTTCTACTACTCACAGATAGTAAATGACTTTAAGAAAGGAGATATAGCTGAAGGGTACAGCGTCTCTCGGGAGAAGAAGGAATCCTTTCCTCTCACTGTGACATCGGCCCAAAAGAACCCGACAGCTTTCTATCTCTGTGCCAGTACTGGACCCGGGGGCCGTGTTAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+GGGGCFGAFFCEGGGGGGGGFFGGGGGAEGF<<EFFGGGGGC<FFGGGE::C@FGGFFFFDFGGGGFFGF9FFGGCFFFGGGFGGGGC,:=FCEFEGFCFGGFGGDG7FFEFGFGDFFCEFCGGGGCECGF,4EEDFGG;=FFEGGGGGGGGGGD=EF,=DC>FFGGGFGGGFDD6D7EC>C::9CFGF7,@:??E*/97D:C7C###################################################"#D:7)6444D7>>:777D57)700*@9):1**<*<77C<9:;+GFC8C820+7<GFFA1@77=><17FFFFE>1+5++2=5,9?FBFCGCGDC?GFFGGGGGGGGGCEF@GF>EC>*7GGGGGFGGGGF9ECGFGFFGGFF9GFFCGGFFF>FEFF<>+GF@9FB?<C:FCFGGGGGGGGFF@EE=FF<GF?FGGGGFGGGDFCGGGGCGEGGGFCGGGGFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGCEFGGGGGGGGGGGGGGGGGGG
+@ATGCATATGAGTGTGGC|CONSCOUNT=1,1|PRCONS=Human-TRB
+ACAAGATCCTGCCCTGGAGCTGAAATGGGCACCAGGCTCTTCTTCTATGTGGCCCTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGGAATCACCCAGAGCCCAAGATACAAGATCACAGAGACAGGAAGGCAGGTGACCTTGATGTGTCACCAGACTTGGAGCCACAGCTATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCTATTACTCAGCAGCTGCTGATATTACAGATAAAGGAGAAGTCCCCGATGGCTATGTTGTCTCCAGATCCAAGACAGAGAATTTCCCCCTCACTCTGGAGTCAGCTACCCGCTCCCAGACATCTGTGTATTTCTGCGCCAGCAGCCCTGGGGGAGGCAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+DGCEFGFFGGFGCFGGFGGGGGGGGGGGGCGGGFFDFFGGGGGGGGGGGDFGGFGGGGGGGGGGGGFFFEFFGGDGGGGG?F7FFDFGGGFGGGGGGGGFGGFGGFCEFFCFFGFFCF8?EFFCG8FGGGG>D@@CC,,:F;FC=DFF;FGGFGGCGGGFG8C==EFFCE=F?>FGFGGGCC9ECDDC@FDGGFDCCEED1:GC5GGGGGGDGGGGFGGGGFC9GGGC.FGGC?>GGGGGGEGGGGGGGGFGCGGGGGGGGGGGGGGFGDFGGEGGGFFAGFGGFCDGFFEFCGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGFG
+@TTAAGATACTAACAGGT|CONSCOUNT=1,1|PRCONS=Human-IGK
+TGGAGGAACTGCTCAGTTAGGACCCAGACGGGACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCTGCCACCCTGTCTCTGTCTCCAGGGGACAGAGCCACCCTCTCCTGCAGGGCCAGTGAGACTGTTAGAACCAAGGTAGTCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTGGTATCCCAGCCAGGTTCAGAGGCAGTGGGTCTGGGACAGAGTTCACTCTCGCCATCAGCAGCCTGCAGTCTGAAGATTTTGCAATTTATTACTGTCAGCAATATCATAAGTGGCCTCCGTACACTTTTGGCCAGGGGACCAAGTTGGAGATCAACCGAA
++
+CGGDFEGFFFFGEEEFGGGGGGGGGGGGGG>EFBFGDFGGGG?EFEGGGGG@FFFGAEFFGGGGGGGFGGCGFGGGGGFGCF,AEECEF<EFE@EGFFEFGGGFFGGGGGGCGEGFE9:8@FGGDFDFGGAE;7EF9,FFGGCGGGGGFF>FGDGGGGGGCGFCF@6FGGGGFGGFGGGGGFGFGGGFGGGGGGGGGGGGGEFGGGGDGGGGGGCFFFGFG<GCFFGGGFE?GGFF@GGGGGFGGGGDGGF>GFGFCDCFF8FGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGFFFCGGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGFEF?GGGGGGFGGEGEFGFGFFAF>GCGCFGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGG
+@GGGCCTCTTTATTTGTC|CONSCOUNT=1,1|PRCONS=Human-TRB
+GGGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCCCTGGAACCAGCAGTGACGTTGGTGGTTATAACTCTGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCACCGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCGGTCACT
++
+GGGGGGG8:CFG8CC<F8EEEGG8C+85*?CE?FF?EGGGGFG58CC58:8EGCFFCCFGGGGGGGF5;CFD71<F?F6/;8AF>>D8@FF76@CGGECCFG7:+AC>FGGEF+<8AFFE:@8C8EGC@C*:*;87@+:?>6C*3<88CF58?@:CFGF96@88FFFDFEC;8F7>A+C3D7;F8?FG@C?A9CFG;99;FGF9CC<:=27GC;;DEFFGGCFFGCFGGGEC>CA<++:EFGFC:?C@7GC6?GFD:5;7B3EE=*8E:6*>GGE9GGGGGGGGGGCFGGFGFECGFECF:FCFFFFGEGEFEGGGECFGFFDFFFGGGGGCGGGFDFGCFGGGGGGGGGFFGGGGGGGGGGGGFE?CGGGGGGGFFGGGGGGGGGGGFGGGGGGGGGGEGFGGGGCGGGFFCGGGDGEFFFFGGGGFGGFGGGGGF@GGGFFC7FFEFGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_assemblepairs_test_sequential_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+@ATCTTTGCGGCTGGTTA|CONSCOUNT=1,1|PRCONS=Human-IGK
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@CGGTTTGGTGCATCTAG|CONSCOUNT=1,1|PRCONS=Human-TRA
+GTGAGTGAACCAGGGCAGAAAAGAATGATGATATCCTTGAGAGTTTTACTGGTGATCCTGTGGCTTCAGTTAAGCTGGGTTTGGAGCCAACGGAAGGAGGTGGAGCAGGATCCTGGACCCTTCAATGTTCCAGAGGGAGCCACTGTCGCTTTCAACTGTACTTACAGCAACAGTGCTTCTCAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTGCTGATGTCCGTATACTCCAGTGGTAATGAAGATGGAAGGTTTACAGCACAGCTCAATAGAGCCGGCCAGTATATTTCCCTGCTCATCAGAGACTCCAAGCTCAGTGATTCAGCCACCTACCTCTGTGTGGTGAACTCTCTACTCTGGTTCTGCAAGGCAACTGACCTTTGGATCTGGGACACAATTGACTGTTTTACCTGATATCCA
++
+GEGFGGGGGGGGFGGGGGGGGGGGDGGGGGGGFGGGGGGCGEFFCFDGGGGGGGGGGGGFGF8BFGGGGGFFDFCFGGGGEGGGGGGD=FFGGGGDDGCGGCFFGGCFGGG8FGGCGFGGGGGGCCF;FFGGFGGGGEE7FFFFGGGG6CFDFFGFFFFC9,=CFGGGGGGC6CFGFGGGGGGFGG9B6FGGFCDFFGGGGGFFGGGFFGFFGGGGGGEFGGGFGFGGGGGGECFEFFGGFGGGGG?GFD;CGGGGGG>GGGGDGGFFGGGGGGGEGGGGGGGGGGGEEGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGFF9GGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGG
+@CTTGCTTATGATTCCAG|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGAAGGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
+@TTTCTTTAGTGAAATGC|CONSCOUNT=1,1|PRCONS=Human-IGK
+AGGAACTGTTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCACAGATATCAACGGAGCAATTGTGTTGACACAGTTTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGGGCCACCCTCTCCTGCAGGGCCAGCCAGGCTGTTGGTACCTACTTAGCCTGGTACCAACAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCGTCCAACAGGGCCACTGGCGTCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCGACAGCCTAGAGCCTGAAGATTTTGCAGTTTATTTCTGTCAGCAACGTAGCGACTGGTGTACTTTCGGCGGGGGGACCAAGGTGGAGATCAAGCGAA
++
+GGGDEFGGGGGDGGFGGFGFGEGGGGGGECDFGGGFC9FFGCFCEGCG<FDFFGGFGGAEECGGGCF,CFGGGFFFG,EFEDF?FG,?=C>FG+B,CFFEEFG=,CE,,EEFFGFFFFFCGGGGGEGAFFFFDEGGFFGGFG?9A?GDDD:>@BF?EGGDFGGF=CGGG8<,D9>FGD>>FCC;?CGGGFFFEFCF:?CBFGGCGGFFGGFC>GGGEGE=,GF@8A5BB?:CC>FFFGGEGGE@CGGFFAD:7FCCFDC@GGF8GGGGEFFGDGGGFGGGCGGGGGGFGGGGGGGGGGGGGDGGFGGGGGEGGGGGGGGGGFGGGGGGGGGGGGCFGGCCGGGFGFGGGGGGGGGGGGGGEFGGGGGGGGGGGGGGGGGGDGGGGGGGGGFE;EGGGGGGGGGGGCGGGGGGGG
+@ATTTCTATGGCTTTGTT|CONSCOUNT=1,1|PRCONS=Human-TRB
+CGAATGTTCGCTTAGATTGAGAATGATTAACCTTATTGTGTCTGTTTTGATCAATGTCTGGTTGTTCGAGTGCAGTGCGTGCAGTCTTTCGCTTATTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATGTATAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTATTTCTATGGCTTTGTTCGATACGGGGACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAGAGAAATACATGAGACTCTCATATACCTGCAAAAGTGAGCTATATCTCGATCACGTATTACAAGTCAGTACAGCCAGAAAAGAGGAATGTCGAAGATACTCC
++
+#################################################################################################GGEB>BCCB6GFFGGFFGGGEC:GGGGGGGD;7GGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGGGFGGGGGGGEGGGGGF:AFE=FFEGGGGG=BFCC3DFEG@EFGFG@FEFF9CDFCFGGGC8DEGEE>7CFGCECFFFD:CE5E#######################################################################################################
+@GGGACTCCAAAATTAAT|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAAGCTCCTCATCCATAGCAATACTCAGCGGCCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCTACATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>4G?CFGFG6BEC+:?7=CC78>?=CEGGFFFFGGGGGECFCC:>CDDGC<+:;ECGGGFGGGFGFDEC7GC<;-8*GGEDGGGFC*E87GGGBFCECGFFCGGFFFGFGGGGGCGFGFGGGGFGFGGDGGGGGGGGGGFGGFFGGFGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGG
+@CCTTGTCCGAGATGTCT|CONSCOUNT=1,1|PRCONS=Human-IGK
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTAGCAGCTCTGTAAATTGGTATCAGCTGAAGCCAGGGAAATCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGGCGTCCCGTCAAGGTTCAGTGGGAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTCTGTCACCAGACTTACAATCCCCCGCTCGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGAA
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGE93>8BEFA>7C,>9DFGADFCCGEDF>7;=?GGDC<84;E=*=CCGFCFDFECEC6<CC76C>1?GGF@58C=04+9=**G@E:=>=*?<,?,?,,EFFFGFFB<?,FCD>,?,FGF>>:11*<AGEGFGFFC@+3*FDBFD8GGFDFGGGGGFFFAEFF9GFGFFEF<GFCFFGFFGGEE?GEGGGGGGGGFEEA<GGGGGCFDGF<FGGGGFCF9GGGGGGGFEEFGFEFGGCFF:GGGFFC7GGGGFGGGGGGGGFFGFGGGGGGDFGGGGEFEE
+@CGATGTAATCTTAGCTG|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGACAAGGGCCCTCGCTACTTGATGACGGTTAAGAGTGATGGCAGCCACATCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGAGCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF7@D77DGF8/:DCD>:@CEE>EG76F><C6C>7C>FGGEDF>6DG>A%CGEGEGEC7CFCGGGEEC79ECCGFC<D4C-GF?FCFDEF=C;?CFC6GGECGGGFGFGGEGC,GF@F1<CFFCGGGFGFGGGFCF>GGGGGGFF<7F*CGGFECFCFCFEFCF<GGGGGGFCGGGGF=9FFGGGGFCGF=99GGGGFFGGDFGGGGGGGCFEGGGGGGGF8GDGGGGGGGGGGGGGDGFGFGFGGGGGGGGGGGCF,GGGGGGGDGFGGGGGGGGGGDGGGG
+@CTTGATAGGAATGAATA|CONSCOUNT=1,1|PRCONS=Human-TRB
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@TTAGCTACATGTAATTG|CONSCOUNT=1,1|PRCONS=Human-IGK
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCATCATATACAGTGATGGAACCAACTACTTGCGCTGGTTTCAGCAGCGGCCCGGCCAATCTCCAACGCGCCTAATATATAAAGTTTCTAACCTGGTCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGTACAGGCACGGATTTCACACTGAAAATCAGTAGGGTGGGGGCTGAGGATGTTGGCATTTATTACTGCATGCAAACTACACCCTGTCCTTACACTTCTGGCCAGGGGACCAAGCTCCAGATCAAACGAA
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDED9=FFEGFGF4B@7EAGG5,@DF*@7,,@,,7:;C,53@**3(@ADE695=9@*7@CGGF8F###"##"####""######EFEC<5)+@,*,,AFC9DD=,3*,DC>173,>1*=3*AFB6++>GFFA,,C5BAF9FECDDF?,=<:,:?55E:+C=B7,,,FAGGGF?FGFE9CFAFFD8EFF@CGFF,DGFFFFFC9,,6,EFFFEE<C,,E9ECFE9C9E<FF@B68,F6<,<FEC@C9GFED;,,CFC,6<FFF<6,;C;,,FFGFBC9@@EFE
+@ACTTAACGGCCAATTAA|CONSCOUNT=2,2|PRCONS=Human-TRB
+GAGTCTGCCCACAGCAGGGCTGGGAGACACAAGATCCTGCCCTGGAGCTGAAATGGGCACGAGGCTCTTCTTCTATGTGGCCCTTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGAAATCACCCAGAGCCCAAGACACAAGATCACAGAGACAGGAAGGNAGGTGACCTTGGCGTGTCACCAGACTTGGAACCACAACAATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCCATTACTCATATGGTGTTCAAGACACTAACAAAGGAGAAGTCTCAGATGGCTACAGTGTCTCTAGATCAAACACAGAGGACCTCCCCCTCACTCTGGAGTCTGCTGCCTCCTCCCAGACATCTGTATATTTCTGCGCCAGCTCATTAGGGGCCAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+lmmmmmmmjlmmmmmmfkjkkkmkjmmmmmmmmjmmmmmmmmmmffklmmmlmmmmmmmmjmmmmmmmlmlmmkmmlmimmlihimmkjjillmieekjmRg^LFcjklkmkhijRhlkmgYflljMbjgiklll][]OhlQdgO>Ximg]klRRfPOigY!]j^7OhglgQY^\eegmicdhkkkd`[TbW_gYcR]d]fe[YP^P__Q^YYPgkmlZ_fdfQQ_imidLbEblmmmmikhlg]]_ilmllliaR\]ejmlmlmkhmmlk_kllmmmmlmlllalkljRmmmlmlfecglilkiimilillmiijllmmllimmmmmmmkmmmmmmmmlimmmmmmmmmmmmmmmmmlhljmmmkgl]mmmlmmmmmmmmmmmmmlmlllmmlmmmmmlmmmmmlmmmmmmmlkimmmmlmmmmmmmmmmmmlmmmmmmmmmmmmmmmmmlmmmmmm
+@TCCAGATTCGGATTACA|CONSCOUNT=2,2|PRCONS=Human-TRA
+AGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTTATATTCCTGTGGCTGCAGCTGGACTTGGTGAATGGAGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCAAACTACTTCCCTTGGTATAAGCAAGAACTTGGAAAAAGACCTCAGCTTATTATAGACATTCGTTCAAATGTGGGCGAAAAGAAAGACCAACGAATTGCTGTTACATTGAACAAGACAGCCAAACATTTCTCCCTGCACATCACAGAGACCCAACCTGAAGACTCGGCTGTCTACTTCTGTGCAGCAAGCCCCGATGGGCATGGAAACAAACTGGTCTTTGGCGCAGGAACCATTCTGAGAGTCAAGTCCTATATCCA
++
+lmilmmlmmmmmmlmblmmmmmmmkmmllmmmmmmmmlmmmmmmmmmmllmmmmmmmmmmilmmmmmmmmm^lmmmjkmmmmmmlmmlmmmlmll_k[\ldlilmiffklmmmmlllkmmmlej]eklkkll_gllmlmgbckkmml^fcimkZfkikmiijlXkgmi^k^RfeiQekmllmlim\gjklkimflmllf_ciak]Q<M\ifYVaPbhilmimldlclf`S]kah^chYkdklllmmk\dOWRRROaQ\iXdcRlmmljikihYhklmlki\dkd^illmljfR^liZfRljfRgmmllllmmmmllmmmlillldd^jljllgiRbmmkmmmljlbkiRlmmmkgjlmmkiklmlmmlmmmmmmmmmmmmmmmmmliml^mmmllimmkiRliimmmmmmmmlmmmmmmmmmmmmmmmmmmmmmmllllmmllmmmmmmmmmmmmmllmmmlmmmmm
+@CGCATATATCTGCAAAA|CONSCOUNT=1,1|PRCONS=Human-IGHA
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGGCTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTATCGCAGGACCTGGGTCCGCCAGGCTCCGGGGAAGGGGCTGGAGTGGGTCTCATCCATTGATGCTAGTAGAAGTTACATATACTATGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTGTATTACTGTTCTCGAGAATATAGCAGTGGCTGGCATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C(25FF:??@?771%F?CGF>;ECEGFE>B>C3?@:9EF=*:@GFD>:*@:CFC<+E7FA+FGFGF9C7FFC=?FGCC7CGFC:F5DGGGGFGGCFGGFD66DCD;FGGGGGGGGGGGGFGGCGFFDFAFFCF;;GGGGGFFDGGGGGGGGGGDGGFGGGFEEGGGGGGGGGGGGGGGGGGEDGGGGEGFFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF?GGFEGEGGDGGGGGGGGGGGGGGGGGGGGGGGG
+@ATTAGTTCATAAATTCC|CONSCOUNT=2,2|PRCONS=Human-IGK
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTACCAACAGAAACCTGGCCAGNCTCCCAGGCTCCTCATCTATGATGCATCCAATAGGGCCACTGGCANCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACANNCTTCACTCTCACCANCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGCGAGTGGCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAACGAA
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmkETNP^Qfh[idOFNIMLEdMfkk^hTIW[TNIPXBEEIHOLa[IIIHIHEFEIIAI!IIIIIlkbYdjeggibZ%R\jc]khf%fSff[Y\bil_jmhhiif!OcigRRg]%bR_illdjlcllc\QlgRee[_`R`!!Rgee_`RRlljQfl!mjlhRRReeckbcilkmlhRele_lmlmmlkjlilbjci_ml`]lfRkmmll^ili]i^_R\RmlfQmmkmml^Rfmmmmmmmimimmmmmmmmmmmmmml
+@ACTCGTGCTAATCCTTC|CONSCOUNT=1,1|PRCONS=Human-IGL
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@AATTAATGGTGTTGAGA|CONSCOUNT=1,1|PRCONS=Human-IGL
+AGGCTCTGCTTCAGCTGTGGGCACAAGAGGCAGCACTCAGGACAATCTCCAGCATGGCCTGCTCTCCTCTCCTCCTCACTCTCCTCGCTCACTGCACAGGGTCCTGGGCCCAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCCCTGGGAACAGCTCCAACATGGGGGCAGGTCATGATGTTCACTGGTACCAGCAGCTACCAGGAACAGCCCCCAAACTCCTCCTCTTTGGTAACAACAATCGGCCCTCAGGACGCCCTGACCGCTTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCACTGGCCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTTCTGTGGTTTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+@CEGGGGGGGGGGGGGGGFGGE8@FAEFCFGFE,EF@F,EFFGFGFGG9FF?FCFE<FGGF,EFA@FGGGGGFFGGGAFEAEC8FF,=FFGGGFFCA<BFGDEEFA=B<?FFGF@EFF?,E,9A+?BFCG+F:F@@FFEGF=FD8FC+3+8BE78@8@D8:C:@FCCF7D;FF9,8@2?EF8,,*DFFDFG###"#"#########"C:(<@CFC9+**+7DFGFF?F<00.)200)5A8?:588CC@<*./*5CF;(<68?GEEGFF@..*7CC:7:B**<;*C7=3*,B:B8:E<CC?,,F23BECFD79C@7F3:>:<>GEFCCGEFFC7BFC<FFBCC>>D:7FB7EFEFDCC@GGGFGGFF??C,9FFCGGGGFE,CE,,B9<DE,CGDGGGC=BA44<GFFFF<GCGGGGGGGGGGGGGGGGGC?GGGGGGGGGGGCGGCGFDGF<GGGGGFGGGGGGGDGDGG
+@TAGTCAGAAGATTATCT|CONSCOUNT=1,1|PRCONS=Human-IGHA
+TCTCAGAGAGGTGCCTTAGCCCTGGATTCCAAGGCATCTCCACTTGGTGATCAGCACTGCACACAGAGGACTCACCATGGAGTTGGGGCTGTGTTGGGTTTTCCTTGTTGCTATGTTAGAAGGTGTCCAGTGTGAGGTTCAGTTGGTGGCGTCTGGGGTAGGCTTGGTACAGCATGGAGGGTCCCTGCGACTCTCCTGTGTAAGCTCAGGATTCGCCTCAAGTCGTCATGAAATGAATGGGGGCCGCCAGCCCCCCGGGACGGGGTCGGGTGGGGTTTAAGACAATAGAAGAAATTGAACAACCGAGTACTATGCAGATTCTGTGAAGTTCCGATTCAGCATCTCCAGAGACAACGCCAAGAATTCACTTTATCTGCAAATGAACGGCCTGACAGCAGAGGACACGGCTGTTTATTACTGTGCGAGGGATACGACGACTGTAGTGGGAGCTACAACGGAGGTGGCGGAGTTTGACTTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCTGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+CFEGCDAFGGDAF8E9<CGGFG?88<C<FAFECF@,C@FFFDG9<<EE7F,,9C@,BFE,:BC<7@FGF8B8F<BA9EF8,AB?,98:F7C,B,BF8FG+CDADE<<5CFE,,9?9@,@FGG?E@FC?C8=E,9;F,E,,,C=;EC@+@,+6@+3>,@+63+98F8+3E;C9,,,3,,6++58::C:,*@CEEFAFGF##############################################################"####""##"""###########################################F<5+6FC>+GFB3****+A+99?9+GGFEE;9?;?**CE>C:,,9D@,7,,,,F?,,CF3,,F73,<@*FC<7;9@33,>3,,=@,F@@+:,,C,CFFFB,FDGGGGF<FCEFAD+:DB+GEC?F?E8FDB,9CAFECFGC@CFEFE:EFEC?<CGFFGEEC,:@C,F?GGGGF@FEEECCFDC6B,GE,C76,FCEC8++CGGGGGFCGFFDGF<CFC7F7GGFC
+@TAGCCTTCACTTTAGTT|CONSCOUNT=1,1|PRCONS=Human-IGK
+GGATCAGGACTTCTCAGTTCATCTTCTCACCATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATCCCTGGATCCAATGCGGATATTGTGATGACCCAAACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGCCAGAGCCTCCTACATAGTGATGGAAAGACCTACATATTTTGGTTCCTGCAGAAGCCAGGCCAGTCTCCAGAACTCCTAATTTATGACGTTTCCAGCCGAGTCTCCGGAGTGCCAGAAAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCACCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTATTGTATGCAAGGTATGCGCGCTTCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAACGAA
++
+GGGGGGGCGGGGGGGGGGGGFGGGGAEGGGFGFGGGGGGGGGFGFGGFGGGFGGFFGDGGFGGGGGGGFGGGGGGGGGGGGCFFGFFCFFGG+F:DGGGFGGGFGGGG7FFGCGGGGGGGFGGGGCFGFGGGFGGGGG8BEFCFGGGGGFFGGGFGGGGG?GCFGGGGGGGFGFGGFGGGGGDDFCFF@DFGFEDGGGGGC9FFCFAFGGGGEGGGGGGFGGGFGFFGFGFGGGGGGGGGGF?GGGEGGFC@EGGGGGGGGE>FCBFCGEGGGGGGGGGGGGGGFGGGGGGGGGGGGGEGDGGGGGGFGGGGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGFGGGGGGGGGFDGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@GAAGAATTGTAACAATC|CONSCOUNT=1,1|PRCONS=Human-IGL
+GGCTGGGGTCTCAGGAGGCAGCACTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTCCTCCTCAGCCTCCTCACTCAGGGCACAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCGCTCAGTGTCCGGGTCTCCTGGCCAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGTACCCAGGCAAAGCCCCCAAAGTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTCCCGGATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCTGCTCATATGCAGGCAGCTACACTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGFGGGGGGGGGGFGGGGGGGGGGFFGGGGGGGCFCEFGGGGGGGGGGGGGGFGEFGGGFFGGFGGGFGGGGGGGGFGGG,=?FCFF<EFGGGGCDGGGGC<EFGGGGG,AD9FGGGG:FEE6@FD;FFGFFGGGEGGGFGC,@8DFG,;,5EEFCCFFFGGGGFGGG78:FGGGF?C?CFGGFFEFGG?>AEF7@FGFFGFFF@GFFGGGGDGFEGFFGGGGCECC7;7GEGFGGGGF>7CFCFGFDGGGGGGGFFGGGECCEGGGFFGGEGGGGEE@:8EC:CCGFDGGFGGFCFAFGFGGGGGGGGGGFFFF7GGGGGGGGGFCGFFGGGGGGFFGGFGGGGGGGGGGGGGGGGFEGGGGFFFFGGGEAGFFGGGGGGGGGGGGGGGGGGGGGGGFBGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGEGEGGGGG
+@GAGACTTTGCTTGTACA|CONSCOUNT=1,1|PRCONS=Human-TRB
+GATTCCAGCCTCTGACAAACTCTGCACATTAGGCCAGGAGAAGCCCCCGAGCCAAGTCTCTTTTCTCATTCTCTTCCAACAAGTGCTTGGAGCTCCAAGAAGGCCCCCTTTGCACTATGAGCAACCAGGTGCTCTGCTGTGTGGTCCTTTGTCTCCTGGGAGCAAACACCGTGGATGGTGGAATCACTCAGTCCCCTAAGTACCTTTTCAGAACGACAGGACAGAATGTGACCCTGATGTGTGACCAGAATTTGAAACACGAGGCCATGTACTGGTACCGACAGGACCCAGGGCAAGGGATGAGATTGTTCTACTACTCACAGATAGTAAATGACTTTAAGAAAGGAGATATAGCTGAAGGGTACAGCGTCTCTCGGGAGAAGAAGGAATCCTTTCCTCTCACTGTGACATCGGCCCAAAAGAACCCGACAGCTTTCTATCTCTGTGCCAGTACTGGACCCGGGGGCCGTGTTAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+GGGGCFGAFFCEGGGGGGGGFFGGGGGAEGF<<EFFGGGGGC<FFGGGE::C@FGGFFFFDFGGGGFFGF9FFGGCFFFGGGFGGGGC,:=FCEFEGFCFGGFGGDG7FFEFGFGDFFCEFCGGGGCECGF,4EEDFGG;=FFEGGGGGGGGGGD=EF,=DC>FFGGGFGGGFDD6D7EC>C::9CFGF7,@:??E*/97D:C7C###################################################"#D:7)6444D7>>:777D57)700*@9):1**<*<77C<9:;+GFC8C820+7<GFFA1@77=><17FFFFE>1+5++2=5,9?FBFCGCGDC?GFFGGGGGGGGGCEF@GF>EC>*7GGGGGFGGGGF9ECGFGFFGGFF9GFFCGGFFF>FEFF<>+GF@9FB?<C:FCFGGGGGGGGFF@EE=FF<GF?FGGGGFGGGDFCGGGGCGEGGGFCGGGGFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGCEFGGGGGGGGGGGGGGGGGGG
+@GTTCGTACTCTAATAGA|CONSCOUNT=1,1|PRCONS=Human-IGL
+AGTTGGTAGATGCCCCTCTGGGAGAGATCCCCAGGGGTGACAGCCATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGTCCCAGGCAGCGCTGGCCCCTGCTGCTGCTGGGTCTGGCCATGGTCGCCCATGGCCTGCTGCGCCCAATGGTTGCACCGCAAAGCGGGGACCCAGACCCTGGAGCCTCAGTTGGAAGCAGCCGATCCAGCCTGCGGAGCCTGTGGGGCAGGTCCGCTCAAGGCCACCCCCTTG
++
+GGGGGGGGGGGGGGGGGGGGGDFGDGGGGGGGGGGGGEGGGGGEGGGFFGGGGGGCGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGFGGGFCFGGGGGGGGGGGGGGGGFGGGFD@GCGGGGGGGGGGGGGFG@GGCGGGGEFGGFGGFGGGGGGFGGGGGGGGGGGGGGGFFEGGGEFGGGFDGGGGGGGGGGGGFGG:CG>DGGGGGGGGGGGFG4GGGGGEGGEGFGEGEFAGGGGCGGFFFCGGEGGEGGGEGGGGFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGG
+@ATGCATATGAGTGTGGC|CONSCOUNT=1,1|PRCONS=Human-TRB
+ACAAGATCCTGCCCTGGAGCTGAAATGGGCACCAGGCTCTTCTTCTATGTGGCCCTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGGAATCACCCAGAGCCCAAGATACAAGATCACAGAGACAGGAAGGCAGGTGACCTTGATGTGTCACCAGACTTGGAGCCACAGCTATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCTATTACTCAGCAGCTGCTGATATTACAGATAAAGGAGAAGTCCCCGATGGCTATGTTGTCTCCAGATCCAAGACAGAGAATTTCCCCCTCACTCTGGAGTCAGCTACCCGCTCCCAGACATCTGTGTATTTCTGCGCCAGCAGCCCTGGGGGAGGCAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC
++
+DGCEFGFFGGFGCFGGFGGGGGGGGGGGGCGGGFFDFFGGGGGGGGGGGDFGGFGGGGGGGGGGGGFFFEFFGGDGGGGG?F7FFDFGGGFGGGGGGGGFGGFGGFCEFFCFFGFFCF8?EFFCG8FGGGG>D@@CC,,:F;FC=DFF;FGGFGGCGGGFG8C==EFFCE=F?>FGFGGGCC9ECDDC@FDGGFDCCEED1:GC5GGGGGGDGGGGFGGGGFC9GGGC.FGGC?>GGGGGGEGGGGGGGGFGCGGGGGGGGGGGGGGFGDFGGEGGGFFAGFGGFCDGFFEFCGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGFG
+@CGGAATACTCACAAATT|CONSCOUNT=2,2|PRCONS=Human-IGHA
+GTCTGGGAGAGGAGCCCAGCACTAGAAGTCGGCGGTGTTTCCATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCGTTTAAGAGGTGTCCAGTGTCAGGTCGAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCCGGGAGGTCCCTGATTCTCGCAAGTGAAGCCCCTGGATCCAGAGTCAGTGCCTATGNCTTGCNCTGGGACGGCGNGTTTCCNGGCAGGGGGCNGGCCNGGTTTGATGTCTGGGGCCAAGGGACAGTGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+ilmmmmmmmmmmmmmmmmmmmmmlmmmllmlmmikjlmmlm_lmlmik[dlllmmjillmmmmmmmiOakimimmU[mFmmIllldkkmlmjLmmliPmllimlmlmmmmmjilFgRRiRmkkBGkjgkglih^eglelGk\jlEmlleJ]glIhgkFQk\eiigmmk`RPihHPKYGkKBkkB\WckhKkA;ASIQP9-=X-78:V:E:>;-V=3-S+5,,,4m9E5,-<!,kmHI!HIHH@]2TFFT!;RVmGG!EHE%i%%%%%!%%m%!%%ilmmmmmmmmmmlmmmmljjmmljllmmmmmmmmmmmlkllmmmmmmjmmlmmmmmmmmmmmmmmmmmmhjm
+@TTAAGATACTAACAGGT|CONSCOUNT=1,1|PRCONS=Human-IGK
+TGGAGGAACTGCTCAGTTAGGACCCAGACGGGACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCTGCCACCCTGTCTCTGTCTCCAGGGGACAGAGCCACCCTCTCCTGCAGGGCCAGTGAGACTGTTAGAACCAAGGTAGTCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTGGTATCCCAGCCAGGTTCAGAGGCAGTGGGTCTGGGACAGAGTTCACTCTCGCCATCAGCAGCCTGCAGTCTGAAGATTTTGCAATTTATTACTGTCAGCAATATCATAAGTGGCCTCCGTACACTTTTGGCCAGGGGACCAAGTTGGAGATCAACCGAA
++
+CGGDFEGFFFFGEEEFGGGGGGGGGGGGGG>EFBFGDFGGGG?EFEGGGGG@FFFGAEFFGGGGGGGFGGCGFGGGGGFGCF,AEECEF<EFE@EGFFEFGGGFFGGGGGGCGEGFE9:8@FGGDFDFGGAE;7EF9,FFGGCGGGGGFF>FGDGGGGGGCGFCF@6FGGGGFGGFGGGGGFGFGGGFGGGGGGGGGGGGGEFGGGGDGGGGGGCFFFGFG<GCFFGGGFE?GGFF@GGGGGFGGGGDGGF>GFGFCDCFF8FGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGFFFCGGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGFEF?GGGGGGFGGEGEFGFGFFAF>GCGCFGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGG
+@GGGCCTCTTTATTTGTC|CONSCOUNT=1,1|PRCONS=Human-TRB
+GGGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCCCTGGAACCAGCAGTGACGTTGGTGGTTATAACTCTGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCACCGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCGGTCACT
++
+GGGGGGG8:CFG8CC<F8EEEGG8C+85*?CE?FF?EGGGGFG58CC58:8EGCFFCCFGGGGGGGF5;CFD71<F?F6/;8AF>>D8@FF76@CGGECCFG7:+AC>FGGEF+<8AFFE:@8C8EGC@C*:*;87@+:?>6C*3<88CF58?@:CFGF96@88FFFDFEC;8F7>A+C3D7;F8?FG@C?A9CFG;99;FGF9CC<:=27GC;;DEFFGGCFFGCFGGGEC>CA<++:EFGFC:?C@7GC6?GFD:5;7B3EE=*8E:6*>GGE9GGGGGGGGGGCFGGFGFECGFECF:FCFFFFGEGEFEGGGECFGFFDFFFGGGGGCGGGFDFGCFGGGGGGGGGFFGGGGGGGGGGGGFE?CGGGGGGGFFGGGGGGGGGGGFGGGGGGGGGGEGFGGGGCGGGFFCGGGDGEFFFFGGGGFGGFGGGGGF@GGGFFC7FFEFGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_buildconsensus_test_input.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,16 @@
+@M01873:M01873:000000000-B9G3J:1:2117:22257:24972 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTATTCTCTCAGAGTGTCAAGCAACCCTGCCTGGCCAGGATTGGAATCCGGCCACAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTCGACCACTGAGTATGAATGAACCACAAAGTCCAAGTGCCATTTCCATAGCAAGCTACCAC
++
+EFGGFGGGG,CAFFGG,ECFFGGGGGFEGFGGFGGEDFGGGGGFGGGGGGGFGGCFGGGGGGFGGGGGGGEGGDGFGGGGDGGFFC,,C<CDC7FF??FGGGGGGGGGGG,FB,<FFG9?97EFGGGCDFEEF9FFFAEFFG?FDEGFG,:><,8AF7DFFGGG7=FF++88DCDEGGFC+++43D<,@,<DCCEDE;EFGC7,:C?9C4@CCF;7D7EFF,7E?*/*>,<8B9+;@CFFF7?######################################
+@M01873:M01873:000000000-B9G3J:1:2101:15710:11332 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTCTTCTCTCAGAGTGTCCAGCAACCCTGCCTGGCCAGGATTGGAATCCGTCCCCAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTAGACCACTGAGTATGAATGAACCACAAAGTCCAAGGGCCATTTCAGTAGAAAGCTCACAC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGDGGGGGGGGGGGGGGEGGGGGGGGGGFGGGGGGGGGGGGFFGGGGGGGGGGGGGFGGFFGGGGGGFGFFAAFFCBFFGGGGGGGFGGGGGDEFGGGGGGGGGFGGGGG,EGGGGGE+6DEGGGFGGGGGGDGGFGFDGFGGGGEFE@CFGFFGFGGGGGGGFFGFGFGG@:>FGGGGFGFFF@CCFF==5D<DFFCCGFDCCFAFFC;)/@C9
+@M01873:M01873:000000000-B9G3J:1:1112:27925:17799 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTCTTCTCTCAGAGTGTCCAGCAACCCTGCCTGGCCAGGATTGGAATCCGTCCACAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTAGACCACTGAGTATGAATGAACCACAAAGGCCAAGGGCCATTTCAGTAGAAAGCTCCAAC
++
+GG?FGCEAE6CFGGGCFGFFEGGCFF<FGGGGFFGGFGGFE<DF9FFGGGGGGGGGDDGGG@FGGDC@EEDGGDGFFFCGFGG9CC<CF<DFE@BF9FG?,EFC8FCFGGGGGGGGGAEFFGFF,??FADEGGFGGCGGGGG,5:?ADC?BEE@,,A>EFG8,3@>DB@GBF,334=46DEFG6:E9DFF:@,>C9=@EFF,EFGGFG7ECFEDF:,@?>FC69;86/A8?FC:@F=:D8C8CCCA785**2;5CC*::C5C7@68;?#############
+@M01873:M01873:000000000-B9G3J:1:1104:19905:10776 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCACTTCCAGCACTTAC
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTCTTCTCTCAGAGTGTCCAGCAACCCTGCCTGGCCAGGATTGGAATCCGTCCACAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTAGACCACTGAGTATGAATGAACCACAAAGTCCAAGGGCCATTTCAGTAGAAAGCTCACAC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFCFGGGCFFFF=FGFFGCFFGGGGGGGGGGDFCAFEFCCEFFFAF@GF4
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_buildconsensus_test_maxdiv_output.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,4 @@
+@TCACTTCCAGCACTTAC|CONSCOUNT=4|PRCONS=Human-TRB|PRFREQ=1.0
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTCTTCTCTCAGAGTGTCCAGCAACCCTGCCTGGCCAGGATTGGAATCCGTCCACAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTAGACCACTGAGTATGAATGAACCACAAAGTCCAAGGGCCATTTCAGTAGAAAGCTCNCAC
++
+{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{i{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{s_{{{{{jv{{{{{{{{{{lihiool_N!flP
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_buildconsensus_test_maxerror_output.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,4 @@
+@TCACTTCCAGCACTTAC|CONSCOUNT=4|PRCONS=Human-TRB|PRFREQ=1.0
+CTTGTTCAGGTCCTCTGGTCAATATCTGATGGGATGGTCCACATTTCCTCCTCCCCTGGGGCAGGAGGGTGTGGTAGCTTGTCCAGGATGGCTGAAATCCCATGGAAGTTGATGGTCATGGGATTAACCCTTTCTTCTCTCAGAGTGTCCAGCAACCCTGCCTGGCCAGGATTGGAATCCGTCCACAGTTAAGCTTTGCATTCTCAAAAGTAGTACAAGCTAGACCACTGAGTATGAATGAACCACAAAGTCCAAGGGCCATTTCAGTAGAAAGCTCNCAC
++
+{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{i{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{s_{{{{{jv{{{{{{{{{{lihiool_N!flP
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_collapseseq_test_in.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,4 @@
+@CTTGCTTATGATTCCAG|CONSCOUNT=1|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGNANGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_collapseseq_test_output.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,4 @@
+@CTTGCTTATGATTCCAG|CONSCOUNT=1|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGNANGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_filterseq_length_test_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,92 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
++
+CCCCCGFGGGGGGGGGGGFFFFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
+@M01873:M01873:000000000-B9G3J:1:2103:2227:11139 1:N:0:CTATAC
+GGGTGCTGCAGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCAGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGAAGTCAAACTCCGCCACCTCCGTTGTAGCTCCCACTACAGTCGTCGTATCCCTCGCACAGTAATAAACAGCCGTGTCCTCTGCTGTCAGGCCGTTCATTTGCAGATAAAGTGAATTCTTGGCGTTGTCTCTGGAGATGCTGAATCGGAACTTCACAGAATCTGCATAGTACTCGGTTGTTCAATTTCTTCTATTGTCTTAAACCCACTCCAGCCCCT
++
+B@C<C7FFDGFAFDFGAC@CFGG7F7CFC<FGDFFGCFGGGGGC++8CECF,67C,EG,B6CDFCCEEEF@FGGGG?F,C@:,CEEGFFGC<?CEFE:EFEFC@CGFCEFAC9,BDF8E?F?CEG+BD:+DAFECF<FGGGGDF,BFFFC,C,,:+@@F,@=,,3>,33@9;7<CF*@<,37F,,3FC,,?F,,,,7,@D9,,:C>EC**?;?9;EEFGG+9?99+A+****3BFG+>CF6+5<F#######################################################
+@M01873:M01873:000000000-B9G3J:1:2110:13535:17883 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGCTTGATCTCCACCTTGGTCCCCCCGCCGAAAGTACACCAGTCGCTACGTTGCTGACAGAAATAAACTGCAAAATCTTCAGGCTCTAGGCTGTCGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGACGCCAGTGGCCCTGTTGGACGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGGCTAAGTAGGTACCAACATCCTGGCTGGCCCTGCAGGAGAGGGTGGCCCTTTCCCCTGG
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGE;EFGGGGGGGGGDGGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGFGFGGGCCGGFCGGGGGGGGGGGGFGGGGGGGGGGEGGGGGFGGDGGGGGGGGGGGGGFGGGGGGCGGGFGGGFGFFGGGGG8FGG@CFFCCF7:DAFFGGE@EGGGGGFFF@CC:?DB7A8@FG,=EGGGGG>CFGGFFGGCGG78C?CFCF>FFFGGGC?9CCF>7DEC*9C+<**:55=FGG41*37*/*18:DDDG*59?FFGFFFF9
+@M01873:M01873:000000000-B9G3J:1:1115:18550:17263 1:N:0:CTATAC
+GGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGTAGATCTCCGCTATCCAAAGACCAGACCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAACGACCAGACTAAGATCGTTAAAAGAAAATGAGTTGATACAGTAGAGCACAGAAGAGTACAAGCACGTGA
++
+A--A@CG<FFCFFGGGGGD+C+EFGCFE@CCDFGFGFEC@FGGFFDGGFGG,,@B@CGG7CCC7=F7FFECFGGGFGGDFGECD@F7=<FFCAFDF8F8F9F9EF@F9,5,,DACEDBCBDFFGFGGF>,FF8>F@FGGGGGGEE@7>,@@FCCGGGG7:1D7>FDCCEFFFFEE<*,=EFCCF++BCCGF9CF+<CC++3<6==*<19E38*A+++<+0ACE7CG8:EEE#####################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10006:14034 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACCTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATTGCTACACAGTGCATCATGAGTGTCCCCGTATCGAACAAAGCCATAGAAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAATAAGCGAAAGACTGCACGCACTGCACTCGAACAACCAGACATTGATCAAAACAGACACAATAAGGTTAATCATTCTCAATCTAAGCGAACATTCG
++
+CCCCCEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGG7;DGGGGGGG:CEGGGFFGGFFG6BCCB>BEGG#################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1117:17250:9432 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCAAGTGCCAGCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGTGCTCAGCCCCAGAGGTGGAGCCAGAGAAGCGATCAGGGATCCCGTCCCCCTTGCTGTGACTGCCATCACTGTTAACCTTCATCAGATACCGAGGGCCCTTCTGTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCCCACTGC
++
+CCCCCGGGGGGGGGGGGGGGGEFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGEFCGGGGGGGGGGGGGGGGGFGGFGGGFGGGGCGGCGFDFFGEFEC<FCEFGGGGGFFGGFGGGFFGGGFEGGGGGDCGGGGGGGGFDGGG<C@FEFFGCFGFFEFCEEGGDFGFCFEGGDGFG?FFCGDCGGGGCCGFFGGGGCEGGGCCEGG3>DG*1*>FFFGFFFG:C<0AF*9@BC@>@CD5C57CCD575*9:?:?6<4@<:<F4
+@M01873:M01873:000000000-B9G3J:1:2108:14465:19705 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACGTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGGCCCCTAATGAGCTGGCGCAGAAATATACAGATGTCTGGGAGGAGGCAGCAGACTCCAGAGTGAGGGGGAGGTCCTCTGTGTTTGATCTAGAGACACTGTAGCCATCTGAGACTTCTCCTTTGTTAGTGTCTTGAACACCATATGAGTAATGGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATTGTTGTGGTTCCAAGTCTGGTGAC
++
+CCCCCGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFGGFGGGGGGGGGGGGGGGGGFGGGEGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGFGGGGGGG,DGGGGGGFGGGGGGGGGGFGGGCFGGGFGGGDFGGGGGGGGGGGFGFFFGGGGGGE*@*?CGDGGCDBAF7FGE=*7=49<<EG47CFGGG70>EECCFCFFFFFFBFF###
+@M01873:M01873:000000000-B9G3J:1:2111:3554:13238 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTGGAGCTTGGTCCCCTGGCCAGAAGTGTAAGGACAGGGTGTAGTTTGCATGCAGTAATAAATGCCAACATCCTCAGCCCCCACCCTACTGATTTTCAGTGTGAAATCCGTGCCTGTACCACTGCCGCTGAATCTGTCTGGGACCCCAGAGACCAGGTTAGAAACTTTATATATTAGGCGCGTTGGAGATTGGCATGGCCTCTTCTGAAACCAGATCAAGTAGATGTTGACATCACTGTATATGAGGCTTAGAATCGTACTGCGGGAGGT
++
+A@AACGGG?FC,6C@CF@CCEFE@@9CBFGFF,,;C;,6<FFF<6,CFC,,;DEFG9C@CEF<,<6F,86B@FF<E9C9EFCE9E,,C<EEFFFE,6,,9CFFFFFGD,FFGC@FFE8DFFAFC9EFGF?FGGGAF,,,7B=C+:E55?:,:<=,?FDDCEF9FAB5C,,AFFG>++6BFA,3=,3>,373>EF,,3,=DF;CFA,,,,@++5>EEFG##################################################################################
+@M01873:M01873:000000000-B9G3J:1:1112:28236:12457 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCAGAGTAGAGAGTTCACCACACAGAGGTAGGTGGCTGAATCACTGAGCTTGGAGTCTCTGATGAGCAGGGAAATATACTGGCCGGCTCTATTGAGCTGTGCTGTAAACCTTCCATCTTCATTACCACTGGAGTATACGGACATCAGCAACTTAGGTTCTTTCCTGCAATCCTGTCTGTACCAGAAGAAAGACTGAGAAGCACTGTTGCTGTAAGTACAGT
++
+CCCCCGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGG9FFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGGGGEEGGGGGGGGGGGEGGGGGGGFFGGDGGGGGGGGGGGC;DFGGGGGGGFGGFCE6CEGGGGGGFFDFCGFEGGGGGE>FGFFGGG7CFGGGGF8CCFGGF6?6DGFFGGGGGFGFC46AF=<FGF?=+9CFFFF:
+@M01873:M01873:000000000-B9G3J:1:1119:21261:11479 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACTTAGGACGGTGACCCTGGTCCCAGTTCCGAAGACCACAGTGCTGCTGTCCCACACCTGACAGGAATAGTCAGCCTCATCCCCGGCTTGGGCTCTGCTGATAATCAGGGTGGCCGTGTTCCCCGAGTTGGAGCCAGAGAATCGGTCAGGGATCCCAGAGGGCCGGTGGATATCCCTATAGATGATCAGCACAGGGGCCTGGCCTGGCTTCTGCTGGAACCAGTACACACTTTTACTTCCAATGTTGTTTCCCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFEGGGGGGGGFEGFFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGDGGGGCEGFGGGGGGGFCFFECDE5=C4FFGGGG>;FDFGGFCFFGFFGGFFGGGGFGFFFGFFC@57)6FAFF:A<FG
+@M01873:M01873:000000000-B9G3J:1:1106:23126:20933 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAACTTGGTCCCTCCGCCGAAGACCGAACCACTCAGCCTAAAGTCGTAAGACTGGCAGTAATATAGAGCCTCATCGTCAGGCTGGAGTCCAGTGATGGCCAGGGAGGCTGAGGTGCCAGATTTGGAGGCAGAGAATCGGTCAGGAACTCCTGAGGGCCGATCGTCCTTAGTATGGATGAGGACGTTGGGGGCTGTTCCTGGAACGTGTTGGTACCAGACAATTTCATAACCTGCCCCGATGT
++
+CCCCCGGGGGGGGGGGGGCFCFGC<F@6F+++6C:F7CCEGGGGCFG,696:66,+@@FGC<EF<FC<F@6E@::F=+++444+++++9BFD<FEGG8<CAEFFF=8FG@BFCFGG<<@DA9AFFB,=DFGA<=D=D+C<,@CD73,3,DFCGFFC,3,D:<*3:CFF@7DF:2:3@,2@92,,6***6:*,>BF7FC*BFC+CC++5<@;*=:*1CG8*1****<9+2A+:C?++++2C**2*2:5:*/:CFC*2:*<)3)/19C4))9*/:EFC*:D=C>C@?C7/CGF4:FBF0DD:
+@M01873:M01873:000000000-B9G3J:1:2111:10779:3698 1:Y:0:CTATAC
+AGGGGGGGAACACGGTTTTCCCGTCGTCGAACACTGACAGGCGGGAGCCCGGGCCAACCTACCCCGTATCTGTGACCCCTGGCCCCCGTATACCACTGGCCCCGAGGTAGTAAGCTGTCGGGTTCTCTTGGCCCGATGTCACAGTTAGCGGATACAGTGCCTTCTTGTCCCTATCGATGCTGTAGCTGTCTGCTATATCTACATACTGAAAGTCATTTACTATCTGTCAGTAGTAACTAAATCTCAGACCCTGCCCCGGGCCCTTTCGGTACCAGTGCATGGCCCCGTGTTTCTAATTCT
++
+C-6B9FGGGG+EF++:B8+5-5+:-+8-@++,+:FF,3-,+3*@F*C*C7*=F<*8+++?,?,+=1<FF,<:2,,2,8=+2+8E+/*2/:,,<,000,2*/******1<9,<C7C9@<CCCEFD*A+02,+,3;81/*;:7::,<,0A<8>E8E++03++<EFGGG+0A###################################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2112:20595:25092 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACCTAGGACGGTGACCGTGGTCCCAGTTCCGAAGACCCAATAATCACTGGCACTATCCCACACCTGACAGTAATAGTCGGCCTCATCCCCGGCTTCGACCCCGCTGATGGTCAGGGTGGCCGTGTTCCCAGAGTTGGAGCCAGAGAAGCGCTCAGGGATCACTGAGGGCCGGTCTCTATCATAATACATGACCAAAACAGGGGCCGGGCCTGGCGTCTGTTTGTACCAGTGGCCACCCTTTATTCCAATGTTGGCTGCGC
++
+CCCCCGGGCFFCFGGCGGGGGGFGGGEGGGGGGGGGGGGGGFGGGGGGGGGGGFE6FFFGGEGGEFFGGGGGGGGGFF,:::BEFCFGGG=FCECFF8FGGGGGGGCGAF?AAGGFFGGGDCEADGGFG7FF7@FFFCE7FCG>:F@FF9FC;,FFGDE>FFFGF:3@<FDA7=FFGCFGDC,2*42?,4=C<CGEF:*;+?+??8C***:5/**+3<++:9?<3<7?EFG*3<E*8*2;5AEEE#######################################################
+@M01873:M01873:000000000-B9G3J:1:1112:18419:7621 1:N:0:CTATAC
+CGACCTGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTGCCCCACAGGCTCCGCAGGCTGGATCGGCTGCTTCCAACTGAGGCTCCAGGGTCTGGGTCCCCGCTTTGCGGTGCAACCATTGGGCGCAGCAGGCCATGGGCGACCATGGCCAGACCCAGCAGCAGCAGGGGCCAGCGCTGCCTGGGACCAGGGCCCAGCTCCTCAGGGGTCTCACAACCCACTTGGCCTGTCTTGGGTCTCATTGGCCTTCAGGTTCAGGGGCACCTCTGGCCCGACTTGCAGCATGGGC
++
+CCCCCGGGGFEGGGGGEFCEGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGCFFGGGGEGGFEFFF@7CFGGGGFGGGGFGGGGFGGGCFGGGGGGGCFGGGFGGGGE<FFGGGGGGGGGGGFGGF@FFGDF7FGGGGCF7DFGEGGGCFGCF:<FFGGFGGGGDFGF8FD*CF*;EFCC8CGGEG@+;C@F55:E5588CFGC69@CFECGGG9C?FECEGDFGDGGFF5CGGFCFC:75>>EC*7>C?F4C>**6*9FFF55DDFCFC:77>@D)4>D4>??#######
+@M01873:M01873:000000000-B9G3J:1:1101:10014:22200 1:Y:0:CTATAC
+CCAGGGGGAAGACCGATGGGCCCTTGGTGGAAGCGAGGTGGGGGTCTCAGCCCTTCCTGTTGTGGCGAGGTACATGTGGGCAGCCTTGCCCACGCTGTCAGCTGCCATTTGTCTTCCTAGGAAATCACAGCTCGGCCCCCAGGTCCCCAGGGTTGTGAACTCCACGCTGCAAACACTAAGAACAGGATTGAAACTCCCCGTATCGGCTTCCAGTAGGAACAGATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+CCCCC7@F+6CF,CF@@C@<C<@F?@ECDEG,CCFFEEGFG>FFFCECFFGF:FGGCC?<FFF7,C7+@:CDGEFFCFFCFFFGGFF=DAEDFGC7:CF<EG?EE,:<9,B<<F9,F<FFD=A=F9DEF,3,DFCGCFDBFFGF<<DEFC@>F<FF7,@:F9F,<F7*C*D:FFFGGGDCGFFCEC7E,BC9;BC++33=8*3*/==*/8>CFGG++++;AFG7+A##########################################################################
+@M01873:M01873:000000000-B9G3J:1:1109:19388:16328 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAACCATTCAGGCTGTCATCCCATGTAGCACAGTAATAATCAGCCTCATCCTCAGACTGGAGCCCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCTGAGGGCCGCTGAGTATTGCTATGGATGAGGAGCTTGGGGGCCGTTCCGGGGAGTTGCTGGTACCAGTTTACATTATTACTTCCGATGTTGGAGCTGC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGFGGFFGGFGGGGGGGGGGDGGFGFGGGGFGFGCGGGGGFGFFFGGCFFGCECFBGGG78E*CFGGGDEGG*8/;<CG7CEFFGFGGGFGGGCEG6+;CGDDC*::CFCEGGGGG:<D>6:EC=<7*7C7*7?:*::76CFGF6?G#############
+@M01873:M01873:000000000-B9G3J:1:1111:16537:24486 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGCGAGCGGGGGATTGTAAGTCTGGTGACAGAAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAATCTGTCCCAGATCCACTCCCACTGAACCTTGACGGGACGCCACTGTGCAAACTGGATGCAGCATAGATCAGGAGCTTAGGGGATTTCCCTGGCTTCAGCTGATACCAATTTACAGAGCTGATACAGCTCTGGTTTGCCCGGCAAGCGATGGACAATATGGCTAC
++
+CCCCCGFGGGGGGGGGGGAFEEFEGGGGFDGGGGGGFGFFGGGGGGGGFGGGG7CFFGGG:FFCGGFEFGFEEFGGGGGGG9FCFGGGGF<FGDFCGGGGG<AEEFGGGGGGGGEG?EEGGFFGFFCFG<FEFFGFG9FFEAFFFGGGGGFDFGG8DFBFF,3+@CFFGFGGGC<*11:>>FGF,?,>DCF,?<BFFGFFFE,,?,?,<?*=>=:E@G**=9+40=C85@FGG?1>C67C?+>CEC7ED7CFG60*12/**29C4CF)*27>FD*1<CD>>GFB################
+@M01873:M01873:000000000-B9G3J:1:1110:23072:9989 1:N:0:CTATAC
+GACAGAGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGAACTATAATATTGGTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACGCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAAATGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGGAGTTCTCATTGTTGGATCTGTATAAAACACTCTGGCTGGACTTGCAGTTT
++
+CCCCCGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGFFGFGA@FGGGCEGGGGFFGGGGGGGFGGGGGG98FFGGGGGCF=FGDFG9FGFGGGGGGGEGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGGGFFFFGCGECGEDFFGGGEGGGCFFEGGGFEGGGGFGFGGGGDF9@F9EGGF=,AFGGGGGFGG7>BC6AF@FFCEFGGCF63;FFFFFGFGGFF*53*8CFFFFF:CCFCFGFGGGFFEGG(99FB63@F4
+@M01873:M01873:000000000-B9G3J:1:1101:10019:8146 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCATTGTCCCTTGGCCCCACATATCAAAAGCATGCCAGCCACTGCTATATTCTCGAGAACAGTAATACACAGCCGTGTCGTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCTTCACTGAGTCTGCATAGTATATGTAACTTCTACTAGCATCAATGGATGAGACCCACTCCAGCCCCTTCCCTGGAGCCTGGCGGG
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGEGEFGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFFGEGGGGDEGGGGGGGGGGGGGGGGGGEEFGGGFGGDGGGGGGGGGGDFFGGGGG;;FCFFAFDFFGCGGFGGGGGGGGGGGGF;DCD66DFGGFCGGFGGGGD5F:CFGC7CCGF?=CFF7C9FGFGF+AF7E+<CFC:@*:>DFG@:*=FG;<@?3C>B>?FG4497>FG:?F*)07?@??:FF###
+@M01873:M01873:000000000-B9G3J:1:2104:24954:20771 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAATGCCAGTGCCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGCGCTCAGCCCCAGAGCTGGAGCCTGAGAAGCGATCAGGGATCCCGTCCCCCTTGATGTGGCTGCCATCACTCTTAACCGTCATCAAGTAGCGAGGGCCCTTCTCTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCTCACT
++
+CCCCCGGGGGGGGGGGGGGGGGGDGGGGGGGGGGFGDGGGGGGG,FCGGGGGGGGGGGFGFGFGDGGGGGGGGGGGGGDG8FGGGGGGGEFCGGGGGGGFDGGFFGGGG99=FGCFGGGGFF9=FGGGGCFGGGGGG<FCFEFCFCFCEFGGC*F7<FFGGGGGG>FCFGGGFGFGGGCFFC<1F@FG,CGGGGFGFGGGCEGG6CFCG+C=FECFCF?FG7@+2<CFGC:E5*<EEGGGCFC7CEGEGEGC*A>DD6>FDEGGFGC7>C*2<>F65?D3*85::>>C=+/6FGA47<@#
+@M01873:M01873:000000000-B9G3J:1:1111:12286:7157 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATAGGACTTGACTCTCAGAATGGTTCCTGCGCCAAAGACCAGTTTGTTTCCATGCCCATCGGGGCTTGCTGCACAGAAGTAGACAGCCGAGTCTTCAGGTTGGGTCTCTGTGATGTGCAGGGAGAAATGTTTGGCTGTCTTGTTCAATGTAACAGCAATTCGTTGGTCTTTCTTTTCGCCCACATTTGAACGAATGTCTATAATAAGCTGAGGTCTTTTTCCAAGTTCTTGCTTATACCAAGGGAAGTAGTTTGAGGCACTGTCTGAATAAGTACA
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGFGGGGGGGGGGGGEGGGGGEF7DGGGGGGGGGF@?F:FCFGGGDFGGGGGGFGCFCFGGGFFFGFGFGFGGGFGF:FFEFGGGGGFC3AC:FFFFFGBABB7>8A?##
+@M01873:M01873:000000000-B9G3J:1:2116:17140:9378 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCACTGTCCCTTGGCCCCAGACATCAAAAGCAGGAGTGCGACCTGCTATAAAAGCCTCCTTCGCACAGAAATATACAGCCGTGTCTTCAGGTCTCAGGCTGTTCATTTCCAGAAACAGTGTGTTCTTGGAATTGTCTCTGGAGAGGGTGAACCGGCCCTTCACGGAGTCTCCGAAGGATTTGTAACTTCCATCATAGAAGATAACTGACACCCAGTCCCGCCCCTTCCTTGGACCTG
++
+CCCCCGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCCGFGGGGFEEGECDAEEGGGGGGGFFFGGAFGDED>FGF@FFDGGGDGFGGGDFFFCDFGDBEAFF,@<BFFFFGGFGGGGFGGGGBECFAFGCA9D9:BCFCEG9,;D>DE8*=5;1:6C*C:CGEFDFF9CC:CEFCGFC*/=C+A:9+3200<CF9+:<*::*+20+6::7D7774C9:55<C+*)25<5FD###########
+@M01873:M01873:000000000-B9G3J:1:2105:17710:2946 1:N:0:CTATAC
+TGTCTGCACCCTGGCCCCTCCGCCGAAAGTGAAAGGTGAGCTACCATACTGCTGACAGTAATACACTGCAAAATCTTCAGGCTCCAGTCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGTCTGGGATGCCAGTGGCCCTGCTGGATGCAGCAAAGATGAGGAGCCTGGGAGCCTGGCCAGGTTCCTGCTGGTACCAGGCTAAGCCGCTGCTGCTAACACTCTGACTGGCCCTGCAGGAGCGGGTGGCGCTTTGCCCTGGATACAACGACATGAGCACTGG
++
+C-AACFGFFGGGGFFDGGFEEGGGEFGEGGGGGGGCFGCFGGFGGGGGGGGGGFGFAFEFCGGGGGGGGFFCFGGGFFG9FFGGGGGFGGGGGFFGGGDFGGGGFFGDFDFFFDGGGGGGG7,EEGGFGGGFFGDF+EFFFGGGGGDF,?FFGG8B<DG<F<F8EEF89FFD,,6AC9CAG8FF+,@@FGGGGG,DFCDFFE9,,5@7DCCG,:@BFGGF7,<,3*;@E:2:D?,>8,,2?C,;,,;5CF##################################################
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_filterseq_maskqual_test_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCAGCTTGGTCCCCTGGNCAAAAGTGGGNNGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGNTGNTGNNNGTGAAATCTGTCCCAGNCCCGCTGCNNNTGAATCGGTCAGGGACCCCGGATTCCCGGGTANATGCCCAGTAANTGAGCANCTTAGGANNCTGTCCTGGTNNCTNNNNGNNNCAANNNNANNNNNTCTNNTTGTTGNNNCTNTNNNANACACTCTNNNNNNNNNNNCNGTT
++
+CCCCCGFGGGGGGGGGGGFFFFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
+@M01873:M01873:000000000-B9G3J:1:2103:2227:11139 1:N:0:CTATAC
+GGGNGNTGCAGAGGCTCAGCGGGNANACCNTGGGGCTGGTCGGGNNNGCAGNNNANACNGNGACCAGGGTTCCCTGGCNCCNNAAGTCAAANTCCGCNACCTCCGTTGTAGCNNCCANTACAGTCNTCNNATCCCTNGCACAGTNATAAANANNNNTGTNCNNNNNNNNCNNNNCGNTNNNNTNNNGANNAANNNNNNTCNNNNCNTTNNCNCNNGAGATNNTNNNTNNNNNNTTCNNAGNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+B@C<C7FFDGFAFDFGAC@CFGG7F7CFC<FGDFFGCFGGGGGC++8CECF,67C,EG,B6CDFCCEEEF@FGGGG?F,C@:,CEEGFFGC<?CEFE:EFEFC@CGFCEFAC9,BDF8E?F?CEG+BD:+DAFECF<FGGGGDF,BFFFC,C,,:+@@F,@=,,3>,33@9;7<CF*@<,37F,,3FC,,?F,,,,7,@D9,,:C>EC**?;?9;EEFGG+9?99+A+****3BFG+>CF6+5<F#######################################################
+@M01873:M01873:000000000-B9G3J:1:2110:13535:17883 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGCTTGATCTCCACCTTGGNCCCCCCGCCGAAAGTACACCAGTCGCTACGTTGCTGACAGAAATAAACTGCAAAATCTTCAGGCTCTAGGCTGTCGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGANGCCAGTGGCCNNGTTGGACGCATCATAGATGANGAGNCNGGGNNCCTGGCNAGGTTTCTGTTNNTACCAGNCTAAGTAGNTACNNACANNCNNNNNNNNCCTNNNNNNNNNNNTGGCNNNTTCCCCTGN
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGE;EFGGGGGGGGGDGGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGFGFGGGCCGGFCGGGGGGGGGGGGFGGGGGGGGGGEGGGGGFGGDGGGGGGGGGGGGGFGGGGGGCGGGFGGGFGFFGGGGG8FGG@CFFCCF7:DAFFGGE@EGGGGGFFF@CC:?DB7A8@FG,=EGGGGG>CFGGFFGGCGG78C?CFCF>FFFGGGC?9CCF>7DEC*9C+<**:55=FGG41*37*/*18:DDDG*59?FFGFFFF9
+@M01873:M01873:000000000-B9G3J:1:1115:18550:17263 1:N:0:CTATAC
+GNNTGCTNTCTCCTGCCGANANGACCAACGTCAAGGCCGCCTGGGGTAAGGNNGGCGCGNACGNNGNCGAGTATGGTGCGGAGGCCNNNGAGAGGANGNTNCNGTCCNNNNNCACCACCAAGACCTACNNCCNNTAGATCTCCGCTNNNCAAAGACCANNNCNNAAGAGCACACGNNNNAACTCNNGTCACNTANNCANNNNNNNNNNNGNNNTNNNNNNGAANAANNAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+A--A@CG<FFCFFGGGGGD+C+EFGCFE@CCDFGFGFEC@FGGFFDGGFGG,,@B@CGG7CCC7=F7FFECFGGGFGGDFGECD@F7=<FFCAFDF8F8F9F9EF@F9,5,,DACEDBCBDFFGFGGF>,FF8>F@FGGGGGGEE@7>,@@FCCGGGG7:1D7>FDCCEFFFFEE<*,=EFCCF++BCCGF9CF+<CC++3<6==*<19E38*A+++<+0ACE7CG8:EEE#####################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10006:14034 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACCTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATTGCTACACAGTGCATCATGAGTGTCCCCGTATCGAACAAAGCCATAGAAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACANNTCGTATGCNGTCTTCTGCTTGNAAAANAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+CCCCCEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGG7;DGGGGGGG:CEGGGFFGGFFG6BCCB>BEGG#################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1117:17250:9432 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCAAGTGCCAGCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGNGATGGTGAGGTAGTGCTCAGCCCCAGAGGTGGAGCCAGAGAAGCNATCAGGGATCCCGTCCCCCTTGCTGTGACTGCCATCACTGTTAACCTTCATCAGATACCGAGNNCCNNNNTGTGGCTGNTNNTGNNGCCANGCGNTNNCGTNNNNNNTNTNNNCNNNGN
++
+CCCCCGGGGGGGGGGGGGGGGEFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGEFCGGGGGGGGGGGGGGGGGFGGFGGGFGGGGCGGCGFDFFGEFEC<FCEFGGGGGFFGGFGGGFFGGGFEGGGGGDCGGGGGGGGFDGGG<C@FEFFGCFGFFEFCEEGGDFGFCFEGGDGFG?FFCGDCGGGGCCGFFGGGGCEGGGCCEGG3>DG*1*>FFFGFFFG:C<0AF*9@BC@>@CD5C57CCD575*9:?:?6<4@<:<F4
+@M01873:M01873:000000000-B9G3J:1:2108:14465:19705 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACGTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGGCCCCTAATGAGCTGGCGCAGAAATATACAGATGTCTGGGAGGAGGCAGCAGACTCCAGAGTGAGGGGGAGGTCCTCTGTGTTTGATCTAGAGACACTGTAGCCATCTGANACTTCTCCTTTGTTAGTGTCTTGAACACCATATGAGTAATGGATCAGCCTCAGCCCNTNTCCCAGGTCTTNTCGNNNNNNNNACNNATTGTNNNGGTTCCAAGTCTGGTNNN
++
+CCCCCGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFGGFGGGGGGGGGGGGGGGGGFGGGEGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGFGGGGGGG,DGGGGGGFGGGGGGGGGGFGGGCFGGGFGGGDFGGGGGGGGGGGFGFFFGGGGGGE*@*?CGDGGCDBAF7FGE=*7=49<<EG47CFGGG70>EECCFCFFFFFFBFF###
+@M01873:M01873:000000000-B9G3J:1:2111:3554:13238 1:N:0:CTATAC
+GACAGATGGTGNNGCCACAGTTCGTNTGATCTNNNGNNNNGTCNNNTGGNNNGAAGNGTAAGNNNNGNNNGTAGNTNGNATGCNGNNANAAATGCNNNNNTCCTCAGCNCCCACCCTNCTGATTNTCAGTGTGAAANNNNTNCNNGNNCNNNNNNCGCTGAANCTGNCNNGGACNNNNGAGNNNNNNNNNNNAANNNNNTANATTNNNNGNNNNGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+A@AACGGG?FC,6C@CF@CCEFE@@9CBFGFF,,;C;,6<FFF<6,CFC,,;DEFG9C@CEF<,<6F,86B@FF<E9C9EFCE9E,,C<EEFFFE,6,,9CFFFFFGD,FFGC@FFE8DFFAFC9EFGF?FGGGAF,,,7B=C+:E55?:,:<=,?FDDCEF9FAB5C,,AFFG>++6BFA,3=,3>,373>EF,,3,=DF;CFA,,,,@++5>EEFG##################################################################################
+@M01873:M01873:000000000-B9G3J:1:1112:28236:12457 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGNTGCCTTGCAGAACCAGAGTAGAGAGTTCACCACACAGAGGTAGGTGGCTGAATCACTGAGCTTGGAGTCTCTGATGAGCAGGGAAATATACTGGCCGGCTCTATTGAGCTGTGCTGTAAACCTTCCATCTTCATTANCACTGGAGTATACGGNCATCAGCAACTTAGGTTCTTTCNTGCAATCNTGTCTGTNCCAGAANANAGACTGAGAAGCANNGTNNCTGTNNNTACAGN
++
+CCCCCGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGG9FFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGGGGEEGGGGGGGGGGGEGGGGGGGFFGGDGGGGGGGGGGGC;DFGGGGGGGFGGFCE6CEGGGGGGFFDFCGFEGGGGGE>FGFFGGG7CFGGGGF8CCFGGF6?6DGFFGGGGGFGFC46AF=<FGF?=+9CFFFF:
+@M01873:M01873:000000000-B9G3J:1:1119:21261:11479 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACTTAGGACGGTGACCCTGGTCCCAGTTCCGAAGACCACAGTGCTGCTGTCCCACACCTGACAGGAATAGTCAGCCTCATCCCCGGCTTGGGCTCTGCTGATAATCAGGGTGGCCGTGTTCCCCGAGTTGGAGCCAGAGAATCGGTCAGGGATCCCAGAGGGCCGGTGGATATCCCTATAGATGATCAGCACAGGGGCCNNGNCTGGCTNNTGCTGGAACCAGTACACACTTTTACTTCCANNNNTGTTNCNCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFEGGGGGGGGFEGFFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGDGGGGCEGFGGGGGGGFCFFECDE5=C4FFGGGG>;FDFGGFCFFGFFGGFFGGGGFGFFFGFFC@57)6FAFF:A<FG
+@M01873:M01873:000000000-B9G3J:1:1106:23126:20933 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGANCGNGNNNNCNGNCTTGGGCTGANNNNNNNNNGTCAANTTNGTNCCNCCNNCNNNNNNNNNNNNNCTCNGCCTNNAGTCGTNNGACTGGCAGNNATANAGAGNNTCATNNTNANGNNGGANNNNNGTGATGGNNNGNNNNNCTGANGTNNNNGNNTNNNNNNNNNNNNNTCNGTNAGGNACNNNNGNNNNNNGANNNNNNNNNNNANNGANNNNNANNNNNNNNNNNGTTNNNNNNNNNNNTNNNNNNNAGANNANTNCATANNCTGNNCCGNTGN
++
+CCCCCGGGGGGGGGGGGGCFCFGC<F@6F+++6C:F7CCEGGGGCFG,696:66,+@@FGC<EF<FC<F@6E@::F=+++444+++++9BFD<FEGG8<CAEFFF=8FG@BFCFGG<<@DA9AFFB,=DFGA<=D=D+C<,@CD73,3,DFCGFFC,3,D:<*3:CFF@7DF:2:3@,2@92,,6***6:*,>BF7FC*BFC+CC++5<@;*=:*1CG8*1****<9+2A+:C?++++2C**2*2:5:*/:CFC*2:*<)3)/19C4))9*/:EFC*:D=C>C@?C7/CGF4:FBF0DD:
+@M01873:M01873:000000000-B9G3J:1:2111:10779:3698 1:Y:0:CTATAC
+ANNGNGGGAANACNNNTNNNNNNNNNNNGNNNNNTGNNNNNNNGGNGNCNNNGNNNNNNTNCNNNNNATNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNANCNGNCGGGTTNTNNNNNNNNNNNNNNNNNNNNNGNNNANANNNNNNNTTCTTNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+C-6B9FGGGG+EF++:B8+5-5+:-+8-@++,+:FF,3-,+3*@F*C*C7*=F<*8+++?,?,+=1<FF,<:2,,2,8=+2+8E+/*2/:,,<,000,2*/******1<9,<C7C9@<CCCEFD*A+02,+,3;81/*;:7::,<,0A<8>E8E++03++<EFGGG+0A###################################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2112:20595:25092 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACCTAGGACGGTGACNGTGGTCCCAGTTCCGAAGACCCNNNNATCACTGGNACTATCNCACACCTGACAGTAATAGTCGGCCTCATCCCNGGNTTCGACNCCGNNGATGNTCNNGGTGGNCGTGTNNCNAGANNTGGAGCCANNNNNGNNNTNAGGGNNNNCNGANGNNNNNNNNNNNNNNNANNNNATGANNNANNNNNNGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+CCCCCGGGCFFCFGGCGGGGGGFGGGEGGGGGGGGGGGGGGFGGGGGGGGGGGFE6FFFGGEGGEFFGGGGGGGGGFF,:::BEFCFGGG=FCECFF8FGGGGGGGCGAF?AAGGFFGGGDCEADGGFG7FF7@FFFCE7FCG>:F@FF9FC;,FFGDE>FFFGF:3@<FDA7=FFGCFGDC,2*42?,4=C<CGEF:*;+?+??8C***:5/**+3<++:9?<3<7?EFG*3<E*8*2;5AEEE#######################################################
+@M01873:M01873:000000000-B9G3J:1:1112:18419:7621 1:N:0:CTATAC
+CGACCTGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTGCCCCACAGGCTCCGCAGGCTGGATCGNCTGCTTCCAACTGAGGCTCCAGGGTCTGGGTCCCCGCTTTNCGGTGCAACCATTGGGCGCAGCANGCCATGGNCGACCATGGCCANNCCCAGCAGCAGCANGGNCCNNCGCTNCCTGGGNNCAGNNNCNNNNTCCTNNGGGGTCTCNCAACCCACTTGGCCTNTCTTGGGNNNNNTTNNNCTTNANNNNNNGGGNNACCTCTNNNNCGNNNTNNAGNNNNNNN
++
+CCCCCGGGGFEGGGGGEFCEGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGCFFGGGGEGGFEFFF@7CFGGGGFGGGGFGGGGFGGGCFGGGGGGGCFGGGFGGGGE<FFGGGGGGGGGGGFGGF@FFGDF7FGGGGCF7DFGEGGGCFGCF:<FFGGFGGGGDFGF8FD*CF*;EFCC8CGGEG@+;C@F55:E5588CFGC69@CFECGGG9C?FECEGDFGDGGFF5CGGFCFC:75>>EC*7>C?F4C>**6*9FFF55DDFCFC:77>@D)4>D4>??#######
+@M01873:M01873:000000000-B9G3J:1:1101:10014:22200 1:Y:0:CTATAC
+CCAGGNGGNNGANCGATGGNCNCTTGGTGGANGCGAGGTGGNGGTCTCAGCCNTTCCTGNTGTNNCNNGNTACATGTGGGCAGCCTTNCCCACGCNNTCNGCTGCNNNNNGNNTNNCNAGGNANTNACANNNCGGCCCCCAGGTNNCCAGGNTNGTNNANTNCNNGNNGNANACACTAAGAACAGGNTNGANNCTNNNNNNNNNNNNNNNNAGTANNNNNAGANNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+CCCCC7@F+6CF,CF@@C@<C<@F?@ECDEG,CCFFEEGFG>FFFCECFFGF:FGGCC?<FFF7,C7+@:CDGEFFCFFCFFFGGFF=DAEDFGC7:CF<EG?EE,:<9,B<<F9,F<FFD=A=F9DEF,3,DFCGCFDBFFGF<<DEFC@>F<FF7,@:F9F,<F7*C*D:FFFGGGDCGFFCEC7E,BC9;BC++33=8*3*/==*/8>CFGG++++;AFG7+A##########################################################################
+@M01873:M01873:000000000-B9G3J:1:1109:19388:16328 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAACCATTCAGGCTGTCATCCCATGTAGCACAGTAATAATCAGCCTCATCCTCAGACTGGAGCCCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACNNCNGAGGGCCGCNNNNNATNGCTATGGATGAGGAGCNNNGGGGCNNNTCCGGGGAGNNGNNNGTNNNNNTNNNCNNNNNNACTTNCGNNNNNNNNNNNNN
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGFGGFFGGFGGGGGGGGGGDGGFGFGGGGFGFGCGGGGGFGFFFGGCFFGCECFBGGG78E*CFGGGDEGG*8/;<CG7CEFFGFGGGFGGGCEG6+;CGDDC*::CFCEGGGGG:<D>6:EC=<7*7C7*7?:*::76CFGF6?G#############
+@M01873:M01873:000000000-B9G3J:1:1111:16537:24486 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGANAGCGAGNGGGGGATTGTAAGTCTGGTGNCAGAAGTANGTTGCAAAATNTTCAGGTTGCAGACTGCTGATGGTGAGNGTGAAATNTGTCCCAGATCCACTCCNACTGANNNTTGACGGGACNNNNNNNTGCNANNTGGNTNCAGCATAGNNCNGNNGNNNNNGGGNNNNNNNNGNNTTCAGNNGNNACNNATTNACNGAGNNNNNNNNNNTNTGNNNNNCCNNNCANNCGANNNNNNNNNNNNNNNN
++
+CCCCCGFGGGGGGGGGGGAFEEFEGGGGFDGGGGGGFGFFGGGGGGGGFGGGG7CFFGGG:FFCGGFEFGFEEFGGGGGGG9FCFGGGGF<FGDFCGGGGG<AEEFGGGGGGGGEG?EEGGFFGFFCFG<FEFFGFG9FFEAFFFGGGGGFDFGG8DFBFF,3+@CFFGFGGGC<*11:>>FGF,?,>DCF,?<BFFGFFFE,,?,?,<?*=>=:E@G**=9+40=C85@FGG?1>C67C?+>CEC7ED7CFG60*12/**29C4CF)*27>FD*1<CD>>GFB################
+@M01873:M01873:000000000-B9G3J:1:1110:23072:9989 1:N:0:CTATAC
+GACAGAGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGAACTATAATATTGGTGACAGTAATAAACTGCCACATCTTCAGNNTGCAGGCTGNTGATGNTGAGAGTGAAATCTGTCCCAGACGCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAAATGAGCAGCTTNGGNGGCTNNCCTGGTTTCTNNTGNTACCAAGCTAAGNNNTTCTCATTGTTNNNNNTGTATANAACACTCTGGCTGGANNNGCNNTTN
++
+CCCCCGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGFFGFGA@FGGGCEGGGGFFGGGGGGGFGGGGGG98FFGGGGGCF=FGDFG9FGFGGGGGGGEGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGGGFFFFGCGECGEDFFGGGEGGGCFFEGGGFEGGGGFGFGGGGDF9@F9EGGF=,AFGGGGGFGG7>BC6AF@FFCEFGGCF63;FFFFFGFGGFF*53*8CFFFFF:CCFCFGFGGGFFEGG(99FB63@F4
+@M01873:M01873:000000000-B9G3J:1:1101:10019:8146 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCATTGTCCCTTGGCCCCACATATCAAAAGCATGCCAGCCACTGCTATATTCTCGAGAACAGTAATACACAGCCGTGTCGTCGGCTCTCAGGCTGTTCATTTGNNGATACAGTGAGTTCTTGGCGTTGTCTCNGGANNTGGTGAATCGGCCCNTNACTGNGTCTGNATANTNTATGTNACNTNNACTNGNNNCAATNNNTGNNACNCNCNCCANNNNNTTNCCNNNNGCCTNGCNNN
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGEGEFGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFFGEGGGGDEGGGGGGGGGGGGGGGGGGEEFGGGFGGDGGGGGGGGGGDFFGGGGG;;FCFFAFDFFGCGGFGGGGGGGGGGGGF;DCD66DFGGFCGGFGGGGD5F:CFGC7CCGF?=CFF7C9FGFGF+AF7E+<CFC:@*:>DFG@:*=FG;<@?3C>B>?FG4497>FG:?F*)07?@??:FF###
+@M01873:M01873:000000000-B9G3J:1:2101:11039:4739 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCCTGGTCCCTCCGCCGAAAGTGAGAGGCCACTCGCTACGGTGCTGACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATGCCAGTGGCCCTATTNGATGCATCATAGATGAGGANNCTGGGAGCCTNGCCAGGTTTCNGTTGGTANCAGCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGDGGGAFFGGGGGGGGGGDFGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGEGGGGGCGGGGGCFGGGG9EGGGGGGGGGGGGFCECFF5>EGGGGGGGG?8FCCCFGFGGG9BFGFGCC;FFGGF
+@M01873:M01873:000000000-B9G3J:1:2104:24954:20771 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTNGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAANGCCAGTGCCCCAGGTCTGACAGTAATAGNNNGCCTCATCCTNNGACTGGAGGCTGGNGATGGTGAGGTAGCGNTNNGCCCCAGANCTGGAGCCTGAGAAGCNNTCAGNGATCCCGTCCCCCTTNATGTNGNTGCCATCACNCNNNACCGNCNNNAAGTAGCGNGGGCCCTTNTNTGNNTGCTGCTGNNGNNNNGNNATNNNNNNNNTNNNNTGCNNNCN
++
+CCCCCGGGGGGGGGGGGGGGGGGDGGGGGGGGGGFGDGGGGGGG,FCGGGGGGGGGGGFGFGFGDGGGGGGGGGGGGGDG8FGGGGGGGEFCGGGGGGGFDGGFFGGGG99=FGCFGGGGFF9=FGGGGCFGGGGGG<FCFEFCFCFCEFGGC*F7<FFGGGGGG>FCFGGGFGFGGGCFFC<1F@FG,CGGGGFGFGGGCEGG6CFCG+C=FECFCF?FG7@+2<CFGC:E5*<EEGGGCFC7CEGEGEGC*A>DD6>FDEGGFGC7>C*2<>F65?D3*85::>>C=+/6FGA47<@#
+@M01873:M01873:000000000-B9G3J:1:1111:12286:7157 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATAGGACTTGACTCTCAGAATGGTTCCTGCGCCAAAGACCAGTTTGTTTCCATGCCCATCGGGGCTTGCTGCACAGAAGTAGACAGCCGAGTCTTCAGGTTGGGTCTCTGTGATGTGCAGGGAGAAATGTTTGGCTGTCTTGTTCAATGTAACAGCAATTCGTTGGTCTTTCTTTTCGCCCACATTTGANCGAATGTCTATAATNAGCTGAGGTCTTTTTCCAAGTTCTTGCTTATACCAAGGNAAGTAGTTTGANGCNCTGTCTGAATNNNTANN
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGFGGGGGGGGGGGGEGGGGGEF7DGGGGGGGGGF@?F:FCFGGGDFGGGGGGFGCFCFGGGFFFGFGFGFGGGFGF:FFEFGGGGGFC3AC:FFFFFGBABB7>8A?##
+@M01873:M01873:000000000-B9G3J:1:2116:17140:9378 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCACTGTCCCTTGGCCCCAGACATCAAAAGCAGGAGTGCGACCTGCTATAAAAGCCTCCTTCGCACNGAAATATACAGCCGTGTCTTCAGGTCTCAGNCNGTTCATTTCCAGAAACAGTGTGTTCTNGNNATTGTCNNNGNAGNNNNNNNNCNGNCCCTTCANGGNGTCTCCGNNNGNTNNNNNNNNTCNNNNNNNNNNNNNNNNTNNNNCNNNNNCNNNNNNNTTNNNNNNNNNNN
++
+CCCCCGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCCGFGGGGFEEGECDAEEGGGGGGGFFFGGAFGDED>FGF@FFDGGGDGFGGGDFFFCDFGDBEAFF,@<BFFFFGGFGGGGFGGGGBECFAFGCA9D9:BCFCEG9,;D>DE8*=5;1:6C*C:CGEFDFF9CC:CEFCGFC*/=C+A:9+3200<CF9+:<*::*+20+6::7D7774C9:55<C+*)25<5FD###########
+@M01873:M01873:000000000-B9G3J:1:2105:17710:2946 1:N:0:CTATAC
+TNTCTGCACCCTGGCCCCTCCGCCGAAAGTGAAAGGTGAGCTACCATACTGCTGACAGTAATACACTGCAAAATCTTCANGCTCCAGTCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACNNACTGCCACTGAACNTGTCTGGGATGNCAGTGNCNCTNCNGNATGNNGCANNNATNAGGNGCNNGGGAGCCTNGCCAGGTNNNNGNTGGTNNCAGGCTNNNNNNNTGNNNCTNNNNNNCTNNNNNNCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+C-AACFGFFGGGGFFDGGFEEGGGEFGEGGGGGGGCFGCFGGFGGGGGGGGGGFGFAFEFCGGGGGGGGFFCFGGGFFG9FFGGGGGFGGGGGFFGGGDFGGGGFFGDFDFFFDGGGGGGG7,EEGGFGGGFFGDF+EFFFGGGGGDF,?FFGG8B<DG<F<F8EEF89FFD,,6AC9CAG8FF+,@@FGGGGG,DFCDFFE9,,5@7DCCG,:@BFGGF7,<,3*;@E:2:D?,>8,,2?C,;,,;5CF##################################################
+@M01873:M01873:000000000-B9G3J:1:2106:21507:14943 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGANTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACTCCGAAAGTGTAGCTGCCTGCATATGAGAAGCAGTAATAATCAGCCTCATCTTCAGCCT
++
+CCCCCGGGGGGGGGFGGGGG<FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_filterseq_missing_test_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
++
+CCCCCGFGGGGGGGGGGGFFFFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
+@M01873:M01873:000000000-B9G3J:1:2103:2227:11139 1:N:0:CTATAC
+GGGTGCTGCAGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCAGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGAAGTCAAACTCCGCCACCTCCGTTGTAGCTCCCACTACAGTCGTCGTATCCCTCGCACAGTAATAAACAGCCGTGTCCTCTGCTGTCAGGCCGTTCATTTGCAGATAAAGTGAATTCTTGGCGTTGTCTCTGGAGATGCTGAATCGGAACTTCACAGAATCTGCATAGTACTCGGTTGTTCAATTTCTTCTATTGTCTTAAACCCACTCCAGCCCCT
++
+B@C<C7FFDGFAFDFGAC@CFGG7F7CFC<FGDFFGCFGGGGGC++8CECF,67C,EG,B6CDFCCEEEF@FGGGG?F,C@:,CEEGFFGC<?CEFE:EFEFC@CGFCEFAC9,BDF8E?F?CEG+BD:+DAFECF<FGGGGDF,BFFFC,C,,:+@@F,@=,,3>,33@9;7<CF*@<,37F,,3FC,,?F,,,,7,@D9,,:C>EC**?;?9;EEFGG+9?99+A+****3BFG+>CF6+5<F#######################################################
+@M01873:M01873:000000000-B9G3J:1:2110:13535:17883 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGCTTGATCTCCACCTTGGTCCCCCCGCCGAAAGTACACCAGTCGCTACGTTGCTGACAGAAATAAACTGCAAAATCTTCAGGCTCTAGGCTGTCGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGACGCCAGTGGCCCTGTTGGACGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGGCTAAGTAGGTACCAACATCCTGGCTGGCCCTGCAGGAGAGGGTGGCCCTTTCCCCTGG
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGE;EFGGGGGGGGGDGGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGFGFGGGCCGGFCGGGGGGGGGGGGFGGGGGGGGGGEGGGGGFGGDGGGGGGGGGGGGGFGGGGGGCGGGFGGGFGFFGGGGG8FGG@CFFCCF7:DAFFGGE@EGGGGGFFF@CC:?DB7A8@FG,=EGGGGG>CFGGFFGGCGG78C?CFCF>FFFGGGC?9CCF>7DEC*9C+<**:55=FGG41*37*/*18:DDDG*59?FFGFFFF9
+@M01873:M01873:000000000-B9G3J:1:1115:18550:17263 1:N:0:CTATAC
+GGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGTAGATCTCCGCTATCCAAAGACCAGACCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAACGACCAGACTAAGATCGTTAAAAGAAAATGAGTTGATACAGTAGAGCACAGAAGAGTACAAGCACGTGA
++
+A--A@CG<FFCFFGGGGGD+C+EFGCFE@CCDFGFGFEC@FGGFFDGGFGG,,@B@CGG7CCC7=F7FFECFGGGFGGDFGECD@F7=<FFCAFDF8F8F9F9EF@F9,5,,DACEDBCBDFFGFGGF>,FF8>F@FGGGGGGEE@7>,@@FCCGGGG7:1D7>FDCCEFFFFEE<*,=EFCCF++BCCGF9CF+<CC++3<6==*<19E38*A+++<+0ACE7CG8:EEE#####################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10006:14034 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACCTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATTGCTACACAGTGCATCATGAGTGTCCCCGTATCGAACAAAGCCATAGAAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAATAAGCGAAAGACTGCACGCACTGCACTCGAACAACCAGACATTGATCAAAACAGACACAATAAGGTTAATCATTCTCAATCTAAGCGAACATTCG
++
+CCCCCEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGG7;DGGGGGGG:CEGGGFFGGFFG6BCCB>BEGG#################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1117:17250:9432 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCAAGTGCCAGCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGTGCTCAGCCCCAGAGGTGGAGCCAGAGAAGCGATCAGGGATCCCGTCCCCCTTGCTGTGACTGCCATCACTGTTAACCTTCATCAGATACCGAGGGCCCTTCTGTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCCCACTGC
++
+CCCCCGGGGGGGGGGGGGGGGEFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGEFCGGGGGGGGGGGGGGGGGFGGFGGGFGGGGCGGCGFDFFGEFEC<FCEFGGGGGFFGGFGGGFFGGGFEGGGGGDCGGGGGGGGFDGGG<C@FEFFGCFGFFEFCEEGGDFGFCFEGGDGFG?FFCGDCGGGGCCGFFGGGGCEGGGCCEGG3>DG*1*>FFFGFFFG:C<0AF*9@BC@>@CD5C57CCD575*9:?:?6<4@<:<F4
+@M01873:M01873:000000000-B9G3J:1:2108:14465:19705 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACGTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGGCCCCTAATGAGCTGGCGCAGAAATATACAGATGTCTGGGAGGAGGCAGCAGACTCCAGAGTGAGGGGGAGGTCCTCTGTGTTTGATCTAGAGACACTGTAGCCATCTGAGACTTCTCCTTTGTTAGTGTCTTGAACACCATATGAGTAATGGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATTGTTGTGGTTCCAAGTCTGGTGAC
++
+CCCCCGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFGGFGGGGGGGGGGGGGGGGGFGGGEGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGFGGGGGGG,DGGGGGGFGGGGGGGGGGFGGGCFGGGFGGGDFGGGGGGGGGGGFGFFFGGGGGGE*@*?CGDGGCDBAF7FGE=*7=49<<EG47CFGGG70>EECCFCFFFFFFBFF###
+@M01873:M01873:000000000-B9G3J:1:2111:3554:13238 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTGGAGCTTGGTCCCCTGGCCAGAAGTGTAAGGACAGGGTGTAGTTTGCATGCAGTAATAAATGCCAACATCCTCAGCCCCCACCCTACTGATTTTCAGTGTGAAATCCGTGCCTGTACCACTGCCGCTGAATCTGTCTGGGACCCCAGAGACCAGGTTAGAAACTTTATATATTAGGCGCGTTGGAGATTGGCATGGCCTCTTCTGAAACCAGATCAAGTAGATGTTGACATCACTGTATATGAGGCTTAGAATCGTACTGCGGGAGGT
++
+A@AACGGG?FC,6C@CF@CCEFE@@9CBFGFF,,;C;,6<FFF<6,CFC,,;DEFG9C@CEF<,<6F,86B@FF<E9C9EFCE9E,,C<EEFFFE,6,,9CFFFFFGD,FFGC@FFE8DFFAFC9EFGF?FGGGAF,,,7B=C+:E55?:,:<=,?FDDCEF9FAB5C,,AFFG>++6BFA,3=,3>,373>EF,,3,=DF;CFA,,,,@++5>EEFG##################################################################################
+@M01873:M01873:000000000-B9G3J:1:1112:28236:12457 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCAGAGTAGAGAGTTCACCACACAGAGGTAGGTGGCTGAATCACTGAGCTTGGAGTCTCTGATGAGCAGGGAAATATACTGGCCGGCTCTATTGAGCTGTGCTGTAAACCTTCCATCTTCATTACCACTGGAGTATACGGACATCAGCAACTTAGGTTCTTTCCTGCAATCCTGTCTGTACCAGAAGAAAGACTGAGAAGCACTGTTGCTGTAAGTACAGT
++
+CCCCCGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGG9FFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGGGGEEGGGGGGGGGGGEGGGGGGGFFGGDGGGGGGGGGGGC;DFGGGGGGGFGGFCE6CEGGGGGGFFDFCGFEGGGGGE>FGFFGGG7CFGGGGF8CCFGGF6?6DGFFGGGGGFGFC46AF=<FGF?=+9CFFFF:
+@M01873:M01873:000000000-B9G3J:1:1119:21261:11479 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACTTAGGACGGTGACCCTGGTCCCAGTTCCGAAGACCACAGTGCTGCTGTCCCACACCTGACAGGAATAGTCAGCCTCATCCCCGGCTTGGGCTCTGCTGATAATCAGGGTGGCCGTGTTCCCCGAGTTGGAGCCAGAGAATCGGTCAGGGATCCCAGAGGGCCGGTGGATATCCCTATAGATGATCAGCACAGGGGCCTGGCCTGGCTTCTGCTGGAACCAGTACACACTTTTACTTCCAATGTTGTTTCCCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFEGGGGGGGGFEGFFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGDGGGGCEGFGGGGGGGFCFFECDE5=C4FFGGGG>;FDFGGFCFFGFFGGFFGGGGFGFFFGFFC@57)6FAFF:A<FG
+@M01873:M01873:000000000-B9G3J:1:1106:23126:20933 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAACTTGGTCCCTCCGCCGAAGACCGAACCACTCAGCCTAAAGTCGTAAGACTGGCAGTAATATAGAGCCTCATCGTCAGGCTGGAGTCCAGTGATGGCCAGGGAGGCTGAGGTGCCAGATTTGGAGGCAGAGAATCGGTCAGGAACTCCTGAGGGCCGATCGTCCTTAGTATGGATGAGGACGTTGGGGGCTGTTCCTGGAACGTGTTGGTACCAGACAATTTCATAACCTGCCCCGATGT
++
+CCCCCGGGGGGGGGGGGGCFCFGC<F@6F+++6C:F7CCEGGGGCFG,696:66,+@@FGC<EF<FC<F@6E@::F=+++444+++++9BFD<FEGG8<CAEFFF=8FG@BFCFGG<<@DA9AFFB,=DFGA<=D=D+C<,@CD73,3,DFCGFFC,3,D:<*3:CFF@7DF:2:3@,2@92,,6***6:*,>BF7FC*BFC+CC++5<@;*=:*1CG8*1****<9+2A+:C?++++2C**2*2:5:*/:CFC*2:*<)3)/19C4))9*/:EFC*:D=C>C@?C7/CGF4:FBF0DD:
+@M01873:M01873:000000000-B9G3J:1:2111:10779:3698 1:Y:0:CTATAC
+AGGGGGGGAACACGGTTTTCCCGTCGTCGAACACTGACAGGCGGGAGCCCGGGCCAACCTACCCCGTATCTGTGACCCCTGGCCCCCGTATACCACTGGCCCCGAGGTAGTAAGCTGTCGGGTTCTCTTGGCCCGATGTCACAGTTAGCGGATACAGTGCCTTCTTGTCCCTATCGATGCTGTAGCTGTCTGCTATATCTACATACTGAAAGTCATTTACTATCTGTCAGTAGTAACTAAATCTCAGACCCTGCCCCGGGCCCTTTCGGTACCAGTGCATGGCCCCGTGTTTCTAATTCT
++
+C-6B9FGGGG+EF++:B8+5-5+:-+8-@++,+:FF,3-,+3*@F*C*C7*=F<*8+++?,?,+=1<FF,<:2,,2,8=+2+8E+/*2/:,,<,000,2*/******1<9,<C7C9@<CCCEFD*A+02,+,3;81/*;:7::,<,0A<8>E8E++03++<EFGGG+0A###################################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2112:20595:25092 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACCTAGGACGGTGACCGTGGTCCCAGTTCCGAAGACCCAATAATCACTGGCACTATCCCACACCTGACAGTAATAGTCGGCCTCATCCCCGGCTTCGACCCCGCTGATGGTCAGGGTGGCCGTGTTCCCAGAGTTGGAGCCAGAGAAGCGCTCAGGGATCACTGAGGGCCGGTCTCTATCATAATACATGACCAAAACAGGGGCCGGGCCTGGCGTCTGTTTGTACCAGTGGCCACCCTTTATTCCAATGTTGGCTGCGC
++
+CCCCCGGGCFFCFGGCGGGGGGFGGGEGGGGGGGGGGGGGGFGGGGGGGGGGGFE6FFFGGEGGEFFGGGGGGGGGFF,:::BEFCFGGG=FCECFF8FGGGGGGGCGAF?AAGGFFGGGDCEADGGFG7FF7@FFFCE7FCG>:F@FF9FC;,FFGDE>FFFGF:3@<FDA7=FFGCFGDC,2*42?,4=C<CGEF:*;+?+??8C***:5/**+3<++:9?<3<7?EFG*3<E*8*2;5AEEE#######################################################
+@M01873:M01873:000000000-B9G3J:1:1112:18419:7621 1:N:0:CTATAC
+CGACCTGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTGCCCCACAGGCTCCGCAGGCTGGATCGGCTGCTTCCAACTGAGGCTCCAGGGTCTGGGTCCCCGCTTTGCGGTGCAACCATTGGGCGCAGCAGGCCATGGGCGACCATGGCCAGACCCAGCAGCAGCAGGGGCCAGCGCTGCCTGGGACCAGGGCCCAGCTCCTCAGGGGTCTCACAACCCACTTGGCCTGTCTTGGGTCTCATTGGCCTTCAGGTTCAGGGGCACCTCTGGCCCGACTTGCAGCATGGGC
++
+CCCCCGGGGFEGGGGGEFCEGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGCFFGGGGEGGFEFFF@7CFGGGGFGGGGFGGGGFGGGCFGGGGGGGCFGGGFGGGGE<FFGGGGGGGGGGGFGGF@FFGDF7FGGGGCF7DFGEGGGCFGCF:<FFGGFGGGGDFGF8FD*CF*;EFCC8CGGEG@+;C@F55:E5588CFGC69@CFECGGG9C?FECEGDFGDGGFF5CGGFCFC:75>>EC*7>C?F4C>**6*9FFF55DDFCFC:77>@D)4>D4>??#######
+@M01873:M01873:000000000-B9G3J:1:1101:10014:22200 1:Y:0:CTATAC
+CCAGGGGGAAGACCGATGGGCCCTTGGTGGAAGCGAGGTGGGGGTCTCAGCCCTTCCTGTTGTGGCGAGGTACATGTGGGCAGCCTTGCCCACGCTGTCAGCTGCCATTTGTCTTCCTAGGAAATCACAGCTCGGCCCCCAGGTCCCCAGGGTTGTGAACTCCACGCTGCAAACACTAAGAACAGGATTGAAACTCCCCGTATCGGCTTCCAGTAGGAACAGATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+CCCCC7@F+6CF,CF@@C@<C<@F?@ECDEG,CCFFEEGFG>FFFCECFFGF:FGGCC?<FFF7,C7+@:CDGEFFCFFCFFFGGFF=DAEDFGC7:CF<EG?EE,:<9,B<<F9,F<FFD=A=F9DEF,3,DFCGCFDBFFGF<<DEFC@>F<FF7,@:F9F,<F7*C*D:FFFGGGDCGFFCEC7E,BC9;BC++33=8*3*/==*/8>CFGG++++;AFG7+A##########################################################################
+@M01873:M01873:000000000-B9G3J:1:1109:19388:16328 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAACCATTCAGGCTGTCATCCCATGTAGCACAGTAATAATCAGCCTCATCCTCAGACTGGAGCCCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCTGAGGGCCGCTGAGTATTGCTATGGATGAGGAGCTTGGGGGCCGTTCCGGGGAGTTGCTGGTACCAGTTTACATTATTACTTCCGATGTTGGAGCTGC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGFGGFFGGFGGGGGGGGGGDGGFGFGGGGFGFGCGGGGGFGFFFGGCFFGCECFBGGG78E*CFGGGDEGG*8/;<CG7CEFFGFGGGFGGGCEG6+;CGDDC*::CFCEGGGGG:<D>6:EC=<7*7C7*7?:*::76CFGF6?G#############
+@M01873:M01873:000000000-B9G3J:1:1111:16537:24486 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGCGAGCGGGGGATTGTAAGTCTGGTGACAGAAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAATCTGTCCCAGATCCACTCCCACTGAACCTTGACGGGACGCCACTGTGCAAACTGGATGCAGCATAGATCAGGAGCTTAGGGGATTTCCCTGGCTTCAGCTGATACCAATTTACAGAGCTGATACAGCTCTGGTTTGCCCGGCAAGCGATGGACAATATGGCTAC
++
+CCCCCGFGGGGGGGGGGGAFEEFEGGGGFDGGGGGGFGFFGGGGGGGGFGGGG7CFFGGG:FFCGGFEFGFEEFGGGGGGG9FCFGGGGF<FGDFCGGGGG<AEEFGGGGGGGGEG?EEGGFFGFFCFG<FEFFGFG9FFEAFFFGGGGGFDFGG8DFBFF,3+@CFFGFGGGC<*11:>>FGF,?,>DCF,?<BFFGFFFE,,?,?,<?*=>=:E@G**=9+40=C85@FGG?1>C67C?+>CEC7ED7CFG60*12/**29C4CF)*27>FD*1<CD>>GFB################
+@M01873:M01873:000000000-B9G3J:1:1110:23072:9989 1:N:0:CTATAC
+GACAGAGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGAACTATAATATTGGTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACGCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAAATGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGGAGTTCTCATTGTTGGATCTGTATAAAACACTCTGGCTGGACTTGCAGTTT
++
+CCCCCGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGFFGFGA@FGGGCEGGGGFFGGGGGGGFGGGGGG98FFGGGGGCF=FGDFG9FGFGGGGGGGEGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGGGFFFFGCGECGEDFFGGGEGGGCFFEGGGFEGGGGFGFGGGGDF9@F9EGGF=,AFGGGGGFGG7>BC6AF@FFCEFGGCF63;FFFFFGFGGFF*53*8CFFFFF:CCFCFGFGGGFFEGG(99FB63@F4
+@M01873:M01873:000000000-B9G3J:1:1101:10019:8146 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCATTGTCCCTTGGCCCCACATATCAAAAGCATGCCAGCCACTGCTATATTCTCGAGAACAGTAATACACAGCCGTGTCGTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCTTCACTGAGTCTGCATAGTATATGTAACTTCTACTAGCATCAATGGATGAGACCCACTCCAGCCCCTTCCCTGGAGCCTGGCGGG
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGEGEFGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFFGEGGGGDEGGGGGGGGGGGGGGGGGGEEFGGGFGGDGGGGGGGGGGDFFGGGGG;;FCFFAFDFFGCGGFGGGGGGGGGGGGF;DCD66DFGGFCGGFGGGGD5F:CFGC7CCGF?=CFF7C9FGFGF+AF7E+<CFC:@*:>DFG@:*=FG;<@?3C>B>?FG4497>FG:?F*)07?@??:FF###
+@M01873:M01873:000000000-B9G3J:1:2101:11039:4739 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCCTGGTCCCTCCGCCGAAAGTGAGAGGCCACTCGCTACGGTGCTGACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATGCCAGTGGCCCTATTGGATGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGDGGGAFFGGGGGGGGGGDFGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGEGGGGGCGGGGGCFGGGG9EGGGGGGGGGGGGFCECFF5>EGGGGGGGG?8FCCCFGFGGG9BFGFGCC;FFGGF
+@M01873:M01873:000000000-B9G3J:1:2104:24954:20771 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAATGCCAGTGCCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGCGCTCAGCCCCAGAGCTGGAGCCTGAGAAGCGATCAGGGATCCCGTCCCCCTTGATGTGGCTGCCATCACTCTTAACCGTCATCAAGTAGCGAGGGCCCTTCTCTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCTCACT
++
+CCCCCGGGGGGGGGGGGGGGGGGDGGGGGGGGGGFGDGGGGGGG,FCGGGGGGGGGGGFGFGFGDGGGGGGGGGGGGGDG8FGGGGGGGEFCGGGGGGGFDGGFFGGGG99=FGCFGGGGFF9=FGGGGCFGGGGGG<FCFEFCFCFCEFGGC*F7<FFGGGGGG>FCFGGGFGFGGGCFFC<1F@FG,CGGGGFGFGGGCEGG6CFCG+C=FECFCF?FG7@+2<CFGC:E5*<EEGGGCFC7CEGEGEGC*A>DD6>FDEGGFGC7>C*2<>F65?D3*85::>>C=+/6FGA47<@#
+@M01873:M01873:000000000-B9G3J:1:1111:12286:7157 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATAGGACTTGACTCTCAGAATGGTTCCTGCGCCAAAGACCAGTTTGTTTCCATGCCCATCGGGGCTTGCTGCACAGAAGTAGACAGCCGAGTCTTCAGGTTGGGTCTCTGTGATGTGCAGGGAGAAATGTTTGGCTGTCTTGTTCAATGTAACAGCAATTCGTTGGTCTTTCTTTTCGCCCACATTTGAACGAATGTCTATAATAAGCTGAGGTCTTTTTCCAAGTTCTTGCTTATACCAAGGGAAGTAGTTTGAGGCACTGTCTGAATAAGTACA
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGFGGGGGGGGGGGGEGGGGGEF7DGGGGGGGGGF@?F:FCFGGGDFGGGGGGFGCFCFGGGFFFGFGFGFGGGFGF:FFEFGGGGGFC3AC:FFFFFGBABB7>8A?##
+@M01873:M01873:000000000-B9G3J:1:2116:17140:9378 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCACTGTCCCTTGGCCCCAGACATCAAAAGCAGGAGTGCGACCTGCTATAAAAGCCTCCTTCGCACAGAAATATACAGCCGTGTCTTCAGGTCTCAGGCTGTTCATTTCCAGAAACAGTGTGTTCTTGGAATTGTCTCTGGAGAGGGTGAACCGGCCCTTCACGGAGTCTCCGAAGGATTTGTAACTTCCATCATAGAAGATAACTGACACCCAGTCCCGCCCCTTCCTTGGACCTG
++
+CCCCCGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCCGFGGGGFEEGECDAEEGGGGGGGFFFGGAFGDED>FGF@FFDGGGDGFGGGDFFFCDFGDBEAFF,@<BFFFFGGFGGGGFGGGGBECFAFGCA9D9:BCFCEG9,;D>DE8*=5;1:6C*C:CGEFDFF9CC:CEFCGFC*/=C+A:9+3200<CF9+:<*::*+20+6::7D7774C9:55<C+*)25<5FD###########
+@M01873:M01873:000000000-B9G3J:1:2105:17710:2946 1:N:0:CTATAC
+TGTCTGCACCCTGGCCCCTCCGCCGAAAGTGAAAGGTGAGCTACCATACTGCTGACAGTAATACACTGCAAAATCTTCAGGCTCCAGTCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGTCTGGGATGCCAGTGGCCCTGCTGGATGCAGCAAAGATGAGGAGCCTGGGAGCCTGGCCAGGTTCCTGCTGGTACCAGGCTAAGCCGCTGCTGCTAACACTCTGACTGGCCCTGCAGGAGCGGGTGGCGCTTTGCCCTGGATACAACGACATGAGCACTGG
++
+C-AACFGFFGGGGFFDGGFEEGGGEFGEGGGGGGGCFGCFGGFGGGGGGGGGGFGFAFEFCGGGGGGGGFFCFGGGFFG9FFGGGGGFGGGGGFFGGGDFGGGGFFGDFDFFFDGGGGGGG7,EEGGFGGGFFGDF+EFFFGGGGGDF,?FFGG8B<DG<F<F8EEF89FFD,,6AC9CAG8FF+,@@FGGGGG,DFCDFFE9,,5@7DCCG,:@BFGGF7,<,3*;@E:2:D?,>8,,2?C,;,,;5CF##################################################
+@M01873:M01873:000000000-B9G3J:1:2106:21507:14943 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACTCCGAAAGTGTAGCTGCCTGCATATGAGAAGCAGTAATAATCAGCCTCATCTTCAGCCT
++
+CCCCCGGGGGGGGGFGGGGG<FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_filterseq_quality_test_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,64 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
++
+CCCCCGFGGGGGGGGGGGFFFFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
+@M01873:M01873:000000000-B9G3J:1:2110:13535:17883 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGCTTGATCTCCACCTTGGTCCCCCCGCCGAAAGTACACCAGTCGCTACGTTGCTGACAGAAATAAACTGCAAAATCTTCAGGCTCTAGGCTGTCGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGACGCCAGTGGCCCTGTTGGACGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGGCTAAGTAGGTACCAACATCCTGGCTGGCCCTGCAGGAGAGGGTGGCCCTTTCCCCTGG
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGE;EFGGGGGGGGGDGGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGFGFGGGCCGGFCGGGGGGGGGGGGFGGGGGGGGGGEGGGGGFGGDGGGGGGGGGGGGGFGGGGGGCGGGFGGGFGFFGGGGG8FGG@CFFCCF7:DAFFGGE@EGGGGGFFF@CC:?DB7A8@FG,=EGGGGG>CFGGFFGGCGG78C?CFCF>FFFGGGC?9CCF>7DEC*9C+<**:55=FGG41*37*/*18:DDDG*59?FFGFFFF9
+@M01873:M01873:000000000-B9G3J:1:1117:17250:9432 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCAAGTGCCAGCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGTGCTCAGCCCCAGAGGTGGAGCCAGAGAAGCGATCAGGGATCCCGTCCCCCTTGCTGTGACTGCCATCACTGTTAACCTTCATCAGATACCGAGGGCCCTTCTGTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCCCACTGC
++
+CCCCCGGGGGGGGGGGGGGGGEFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGEFCGGGGGGGGGGGGGGGGGFGGFGGGFGGGGCGGCGFDFFGEFEC<FCEFGGGGGFFGGFGGGFFGGGFEGGGGGDCGGGGGGGGFDGGG<C@FEFFGCFGFFEFCEEGGDFGFCFEGGDGFG?FFCGDCGGGGCCGFFGGGGCEGGGCCEGG3>DG*1*>FFFGFFFG:C<0AF*9@BC@>@CD5C57CCD575*9:?:?6<4@<:<F4
+@M01873:M01873:000000000-B9G3J:1:2108:14465:19705 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACGTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGGCCCCTAATGAGCTGGCGCAGAAATATACAGATGTCTGGGAGGAGGCAGCAGACTCCAGAGTGAGGGGGAGGTCCTCTGTGTTTGATCTAGAGACACTGTAGCCATCTGAGACTTCTCCTTTGTTAGTGTCTTGAACACCATATGAGTAATGGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATTGTTGTGGTTCCAAGTCTGGTGAC
++
+CCCCCGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFGGFGGGGGGGGGGGGGGGGGFGGGEGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGFGGGGGGG,DGGGGGGFGGGGGGGGGGFGGGCFGGGFGGGDFGGGGGGGGGGGFGFFFGGGGGGE*@*?CGDGGCDBAF7FGE=*7=49<<EG47CFGGG70>EECCFCFFFFFFBFF###
+@M01873:M01873:000000000-B9G3J:1:1112:28236:12457 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCAGAGTAGAGAGTTCACCACACAGAGGTAGGTGGCTGAATCACTGAGCTTGGAGTCTCTGATGAGCAGGGAAATATACTGGCCGGCTCTATTGAGCTGTGCTGTAAACCTTCCATCTTCATTACCACTGGAGTATACGGACATCAGCAACTTAGGTTCTTTCCTGCAATCCTGTCTGTACCAGAAGAAAGACTGAGAAGCACTGTTGCTGTAAGTACAGT
++
+CCCCCGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGG9FFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGGGGEEGGGGGGGGGGGEGGGGGGGFFGGDGGGGGGGGGGGC;DFGGGGGGGFGGFCE6CEGGGGGGFFDFCGFEGGGGGE>FGFFGGG7CFGGGGF8CCFGGF6?6DGFFGGGGGFGFC46AF=<FGF?=+9CFFFF:
+@M01873:M01873:000000000-B9G3J:1:1119:21261:11479 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACTTAGGACGGTGACCCTGGTCCCAGTTCCGAAGACCACAGTGCTGCTGTCCCACACCTGACAGGAATAGTCAGCCTCATCCCCGGCTTGGGCTCTGCTGATAATCAGGGTGGCCGTGTTCCCCGAGTTGGAGCCAGAGAATCGGTCAGGGATCCCAGAGGGCCGGTGGATATCCCTATAGATGATCAGCACAGGGGCCTGGCCTGGCTTCTGCTGGAACCAGTACACACTTTTACTTCCAATGTTGTTTCCCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFEGGGGGGGGFEGFFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGDGGGGCEGFGGGGGGGFCFFECDE5=C4FFGGGG>;FDFGGFCFFGFFGGFFGGGGFGFFFGFFC@57)6FAFF:A<FG
+@M01873:M01873:000000000-B9G3J:1:1112:18419:7621 1:N:0:CTATAC
+CGACCTGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTGCCCCACAGGCTCCGCAGGCTGGATCGGCTGCTTCCAACTGAGGCTCCAGGGTCTGGGTCCCCGCTTTGCGGTGCAACCATTGGGCGCAGCAGGCCATGGGCGACCATGGCCAGACCCAGCAGCAGCAGGGGCCAGCGCTGCCTGGGACCAGGGCCCAGCTCCTCAGGGGTCTCACAACCCACTTGGCCTGTCTTGGGTCTCATTGGCCTTCAGGTTCAGGGGCACCTCTGGCCCGACTTGCAGCATGGGC
++
+CCCCCGGGGFEGGGGGEFCEGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGCFFGGGGEGGFEFFF@7CFGGGGFGGGGFGGGGFGGGCFGGGGGGGCFGGGFGGGGE<FFGGGGGGGGGGGFGGF@FFGDF7FGGGGCF7DFGEGGGCFGCF:<FFGGFGGGGDFGF8FD*CF*;EFCC8CGGEG@+;C@F55:E5588CFGC69@CFECGGG9C?FECEGDFGDGGFF5CGGFCFC:75>>EC*7>C?F4C>**6*9FFF55DDFCFC:77>@D)4>D4>??#######
+@M01873:M01873:000000000-B9G3J:1:1109:19388:16328 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAACCATTCAGGCTGTCATCCCATGTAGCACAGTAATAATCAGCCTCATCCTCAGACTGGAGCCCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCTGAGGGCCGCTGAGTATTGCTATGGATGAGGAGCTTGGGGGCCGTTCCGGGGAGTTGCTGGTACCAGTTTACATTATTACTTCCGATGTTGGAGCTGC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGFGGFFGGFGGGGGGGGGGDGGFGFGGGGFGFGCGGGGGFGFFFGGCFFGCECFBGGG78E*CFGGGDEGG*8/;<CG7CEFFGFGGGFGGGCEG6+;CGDDC*::CFCEGGGGG:<D>6:EC=<7*7C7*7?:*::76CFGF6?G#############
+@M01873:M01873:000000000-B9G3J:1:1111:16537:24486 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGCGAGCGGGGGATTGTAAGTCTGGTGACAGAAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAATCTGTCCCAGATCCACTCCCACTGAACCTTGACGGGACGCCACTGTGCAAACTGGATGCAGCATAGATCAGGAGCTTAGGGGATTTCCCTGGCTTCAGCTGATACCAATTTACAGAGCTGATACAGCTCTGGTTTGCCCGGCAAGCGATGGACAATATGGCTAC
++
+CCCCCGFGGGGGGGGGGGAFEEFEGGGGFDGGGGGGFGFFGGGGGGGGFGGGG7CFFGGG:FFCGGFEFGFEEFGGGGGGG9FCFGGGGF<FGDFCGGGGG<AEEFGGGGGGGGEG?EEGGFFGFFCFG<FEFFGFG9FFEAFFFGGGGGFDFGG8DFBFF,3+@CFFGFGGGC<*11:>>FGF,?,>DCF,?<BFFGFFFE,,?,?,<?*=>=:E@G**=9+40=C85@FGG?1>C67C?+>CEC7ED7CFG60*12/**29C4CF)*27>FD*1<CD>>GFB################
+@M01873:M01873:000000000-B9G3J:1:1110:23072:9989 1:N:0:CTATAC
+GACAGAGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGAACTATAATATTGGTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACGCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAAATGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGGAGTTCTCATTGTTGGATCTGTATAAAACACTCTGGCTGGACTTGCAGTTT
++
+CCCCCGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGFFGFGA@FGGGCEGGGGFFGGGGGGGFGGGGGG98FFGGGGGCF=FGDFG9FGFGGGGGGGEGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGGGFFFFGCGECGEDFFGGGEGGGCFFEGGGFEGGGGFGFGGGGDF9@F9EGGF=,AFGGGGGFGG7>BC6AF@FFCEFGGCF63;FFFFFGFGGFF*53*8CFFFFF:CCFCFGFGGGFFEGG(99FB63@F4
+@M01873:M01873:000000000-B9G3J:1:1101:10019:8146 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCATTGTCCCTTGGCCCCACATATCAAAAGCATGCCAGCCACTGCTATATTCTCGAGAACAGTAATACACAGCCGTGTCGTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCTTCACTGAGTCTGCATAGTATATGTAACTTCTACTAGCATCAATGGATGAGACCCACTCCAGCCCCTTCCCTGGAGCCTGGCGGG
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGEGEFGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFFGEGGGGDEGGGGGGGGGGGGGGGGGGEEFGGGFGGDGGGGGGGGGGDFFGGGGG;;FCFFAFDFFGCGGFGGGGGGGGGGGGF;DCD66DFGGFCGGFGGGGD5F:CFGC7CCGF?=CFF7C9FGFGF+AF7E+<CFC:@*:>DFG@:*=FG;<@?3C>B>?FG4497>FG:?F*)07?@??:FF###
+@M01873:M01873:000000000-B9G3J:1:2101:11039:4739 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCCTGGTCCCTCCGCCGAAAGTGAGAGGCCACTCGCTACGGTGCTGACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATGCCAGTGGCCCTATTGGATGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGDGGGAFFGGGGGGGGGGDFGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGEGGGGGCGGGGGCFGGGG9EGGGGGGGGGGGGFCECFF5>EGGGGGGGG?8FCCCFGFGGG9BFGFGCC;FFGGF
+@M01873:M01873:000000000-B9G3J:1:2104:24954:20771 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAATGCCAGTGCCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGCGCTCAGCCCCAGAGCTGGAGCCTGAGAAGCGATCAGGGATCCCGTCCCCCTTGATGTGGCTGCCATCACTCTTAACCGTCATCAAGTAGCGAGGGCCCTTCTCTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCTCACT
++
+CCCCCGGGGGGGGGGGGGGGGGGDGGGGGGGGGGFGDGGGGGGG,FCGGGGGGGGGGGFGFGFGDGGGGGGGGGGGGGDG8FGGGGGGGEFCGGGGGGGFDGGFFGGGG99=FGCFGGGGFF9=FGGGGCFGGGGGG<FCFEFCFCFCEFGGC*F7<FFGGGGGG>FCFGGGFGFGGGCFFC<1F@FG,CGGGGFGFGGGCEGG6CFCG+C=FECFCF?FG7@+2<CFGC:E5*<EEGGGCFC7CEGEGEGC*A>DD6>FDEGGFGC7>C*2<>F65?D3*85::>>C=+/6FGA47<@#
+@M01873:M01873:000000000-B9G3J:1:1111:12286:7157 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATAGGACTTGACTCTCAGAATGGTTCCTGCGCCAAAGACCAGTTTGTTTCCATGCCCATCGGGGCTTGCTGCACAGAAGTAGACAGCCGAGTCTTCAGGTTGGGTCTCTGTGATGTGCAGGGAGAAATGTTTGGCTGTCTTGTTCAATGTAACAGCAATTCGTTGGTCTTTCTTTTCGCCCACATTTGAACGAATGTCTATAATAAGCTGAGGTCTTTTTCCAAGTTCTTGCTTATACCAAGGGAAGTAGTTTGAGGCACTGTCTGAATAAGTACA
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGFGGGGGGGGGGGGEGGGGGEF7DGGGGGGGGGF@?F:FCFGGGDFGGGGGGFGCFCFGGGFFFGFGFGFGGGFGF:FFEFGGGGGFC3AC:FFFFFGBABB7>8A?##
+@M01873:M01873:000000000-B9G3J:1:2116:17140:9378 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCACTGTCCCTTGGCCCCAGACATCAAAAGCAGGAGTGCGACCTGCTATAAAAGCCTCCTTCGCACAGAAATATACAGCCGTGTCTTCAGGTCTCAGGCTGTTCATTTCCAGAAACAGTGTGTTCTTGGAATTGTCTCTGGAGAGGGTGAACCGGCCCTTCACGGAGTCTCCGAAGGATTTGTAACTTCCATCATAGAAGATAACTGACACCCAGTCCCGCCCCTTCCTTGGACCTG
++
+CCCCCGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCCGFGGGGFEEGECDAEEGGGGGGGFFFGGAFGDED>FGF@FFDGGGDGFGGGDFFFCDFGDBEAFF,@<BFFFFGGFGGGGFGGGGBECFAFGCA9D9:BCFCEG9,;D>DE8*=5;1:6C*C:CGEFDFF9CC:CEFCGFC*/=C+A:9+3200<CF9+:<*::*+20+6::7D7774C9:55<C+*)25<5FD###########
+@M01873:M01873:000000000-B9G3J:1:2106:21507:14943 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACTCCGAAAGTGTAGCTGCCTGCATATGAGAAGCAGTAATAATCAGCCTCATCTTCAGCCT
++
+CCCCCGGGGGGGGGFGGGGG<FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_filterseq_repeats_test_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,92 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
++
+CCCCCGFGGGGGGGGGGGFFFFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
+@M01873:M01873:000000000-B9G3J:1:2103:2227:11139 1:N:0:CTATAC
+GGGTGCTGCAGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCAGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGAAGTCAAACTCCGCCACCTCCGTTGTAGCTCCCACTACAGTCGTCGTATCCCTCGCACAGTAATAAACAGCCGTGTCCTCTGCTGTCAGGCCGTTCATTTGCAGATAAAGTGAATTCTTGGCGTTGTCTCTGGAGATGCTGAATCGGAACTTCACAGAATCTGCATAGTACTCGGTTGTTCAATTTCTTCTATTGTCTTAAACCCACTCCAGCCCCT
++
+B@C<C7FFDGFAFDFGAC@CFGG7F7CFC<FGDFFGCFGGGGGC++8CECF,67C,EG,B6CDFCCEEEF@FGGGG?F,C@:,CEEGFFGC<?CEFE:EFEFC@CGFCEFAC9,BDF8E?F?CEG+BD:+DAFECF<FGGGGDF,BFFFC,C,,:+@@F,@=,,3>,33@9;7<CF*@<,37F,,3FC,,?F,,,,7,@D9,,:C>EC**?;?9;EEFGG+9?99+A+****3BFG+>CF6+5<F#######################################################
+@M01873:M01873:000000000-B9G3J:1:2110:13535:17883 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGCTTGATCTCCACCTTGGTCCCCCCGCCGAAAGTACACCAGTCGCTACGTTGCTGACAGAAATAAACTGCAAAATCTTCAGGCTCTAGGCTGTCGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGACGCCAGTGGCCCTGTTGGACGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGGCTAAGTAGGTACCAACATCCTGGCTGGCCCTGCAGGAGAGGGTGGCCCTTTCCCCTGG
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGE;EFGGGGGGGGGDGGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGFGFGGGCCGGFCGGGGGGGGGGGGFGGGGGGGGGGEGGGGGFGGDGGGGGGGGGGGGGFGGGGGGCGGGFGGGFGFFGGGGG8FGG@CFFCCF7:DAFFGGE@EGGGGGFFF@CC:?DB7A8@FG,=EGGGGG>CFGGFFGGCGG78C?CFCF>FFFGGGC?9CCF>7DEC*9C+<**:55=FGG41*37*/*18:DDDG*59?FFGFFFF9
+@M01873:M01873:000000000-B9G3J:1:1117:17250:9432 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCAAGTGCCAGCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGTGCTCAGCCCCAGAGGTGGAGCCAGAGAAGCGATCAGGGATCCCGTCCCCCTTGCTGTGACTGCCATCACTGTTAACCTTCATCAGATACCGAGGGCCCTTCTGTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCCCACTGC
++
+CCCCCGGGGGGGGGGGGGGGGEFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGEFCGGGGGGGGGGGGGGGGGFGGFGGGFGGGGCGGCGFDFFGEFEC<FCEFGGGGGFFGGFGGGFFGGGFEGGGGGDCGGGGGGGGFDGGG<C@FEFFGCFGFFEFCEEGGDFGFCFEGGDGFG?FFCGDCGGGGCCGFFGGGGCEGGGCCEGG3>DG*1*>FFFGFFFG:C<0AF*9@BC@>@CD5C57CCD575*9:?:?6<4@<:<F4
+@M01873:M01873:000000000-B9G3J:1:2108:14465:19705 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACGTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGGCCCCTAATGAGCTGGCGCAGAAATATACAGATGTCTGGGAGGAGGCAGCAGACTCCAGAGTGAGGGGGAGGTCCTCTGTGTTTGATCTAGAGACACTGTAGCCATCTGAGACTTCTCCTTTGTTAGTGTCTTGAACACCATATGAGTAATGGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATTGTTGTGGTTCCAAGTCTGGTGAC
++
+CCCCCGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFGGFGGGGGGGGGGGGGGGGGFGGGEGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGFGGGGGGG,DGGGGGGFGGGGGGGGGGFGGGCFGGGFGGGDFGGGGGGGGGGGFGFFFGGGGGGE*@*?CGDGGCDBAF7FGE=*7=49<<EG47CFGGG70>EECCFCFFFFFFBFF###
+@M01873:M01873:000000000-B9G3J:1:2111:3554:13238 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTGGAGCTTGGTCCCCTGGCCAGAAGTGTAAGGACAGGGTGTAGTTTGCATGCAGTAATAAATGCCAACATCCTCAGCCCCCACCCTACTGATTTTCAGTGTGAAATCCGTGCCTGTACCACTGCCGCTGAATCTGTCTGGGACCCCAGAGACCAGGTTAGAAACTTTATATATTAGGCGCGTTGGAGATTGGCATGGCCTCTTCTGAAACCAGATCAAGTAGATGTTGACATCACTGTATATGAGGCTTAGAATCGTACTGCGGGAGGT
++
+A@AACGGG?FC,6C@CF@CCEFE@@9CBFGFF,,;C;,6<FFF<6,CFC,,;DEFG9C@CEF<,<6F,86B@FF<E9C9EFCE9E,,C<EEFFFE,6,,9CFFFFFGD,FFGC@FFE8DFFAFC9EFGF?FGGGAF,,,7B=C+:E55?:,:<=,?FDDCEF9FAB5C,,AFFG>++6BFA,3=,3>,373>EF,,3,=DF;CFA,,,,@++5>EEFG##################################################################################
+@M01873:M01873:000000000-B9G3J:1:1112:28236:12457 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCAGAGTAGAGAGTTCACCACACAGAGGTAGGTGGCTGAATCACTGAGCTTGGAGTCTCTGATGAGCAGGGAAATATACTGGCCGGCTCTATTGAGCTGTGCTGTAAACCTTCCATCTTCATTACCACTGGAGTATACGGACATCAGCAACTTAGGTTCTTTCCTGCAATCCTGTCTGTACCAGAAGAAAGACTGAGAAGCACTGTTGCTGTAAGTACAGT
++
+CCCCCGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGG9FFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGGGGEEGGGGGGGGGGGEGGGGGGGFFGGDGGGGGGGGGGGC;DFGGGGGGGFGGFCE6CEGGGGGGFFDFCGFEGGGGGE>FGFFGGG7CFGGGGF8CCFGGF6?6DGFFGGGGGFGFC46AF=<FGF?=+9CFFFF:
+@M01873:M01873:000000000-B9G3J:1:1119:21261:11479 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACTTAGGACGGTGACCCTGGTCCCAGTTCCGAAGACCACAGTGCTGCTGTCCCACACCTGACAGGAATAGTCAGCCTCATCCCCGGCTTGGGCTCTGCTGATAATCAGGGTGGCCGTGTTCCCCGAGTTGGAGCCAGAGAATCGGTCAGGGATCCCAGAGGGCCGGTGGATATCCCTATAGATGATCAGCACAGGGGCCTGGCCTGGCTTCTGCTGGAACCAGTACACACTTTTACTTCCAATGTTGTTTCCCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFEGGGGGGGGFEGFFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGDGGGGCEGFGGGGGGGFCFFECDE5=C4FFGGGG>;FDFGGFCFFGFFGGFFGGGGFGFFFGFFC@57)6FAFF:A<FG
+@M01873:M01873:000000000-B9G3J:1:1106:23126:20933 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAACTTGGTCCCTCCGCCGAAGACCGAACCACTCAGCCTAAAGTCGTAAGACTGGCAGTAATATAGAGCCTCATCGTCAGGCTGGAGTCCAGTGATGGCCAGGGAGGCTGAGGTGCCAGATTTGGAGGCAGAGAATCGGTCAGGAACTCCTGAGGGCCGATCGTCCTTAGTATGGATGAGGACGTTGGGGGCTGTTCCTGGAACGTGTTGGTACCAGACAATTTCATAACCTGCCCCGATGT
++
+CCCCCGGGGGGGGGGGGGCFCFGC<F@6F+++6C:F7CCEGGGGCFG,696:66,+@@FGC<EF<FC<F@6E@::F=+++444+++++9BFD<FEGG8<CAEFFF=8FG@BFCFGG<<@DA9AFFB,=DFGA<=D=D+C<,@CD73,3,DFCGFFC,3,D:<*3:CFF@7DF:2:3@,2@92,,6***6:*,>BF7FC*BFC+CC++5<@;*=:*1CG8*1****<9+2A+:C?++++2C**2*2:5:*/:CFC*2:*<)3)/19C4))9*/:EFC*:D=C>C@?C7/CGF4:FBF0DD:
+@M01873:M01873:000000000-B9G3J:1:2111:10779:3698 1:Y:0:CTATAC
+AGGGGGGGAACACGGTTTTCCCGTCGTCGAACACTGACAGGCGGGAGCCCGGGCCAACCTACCCCGTATCTGTGACCCCTGGCCCCCGTATACCACTGGCCCCGAGGTAGTAAGCTGTCGGGTTCTCTTGGCCCGATGTCACAGTTAGCGGATACAGTGCCTTCTTGTCCCTATCGATGCTGTAGCTGTCTGCTATATCTACATACTGAAAGTCATTTACTATCTGTCAGTAGTAACTAAATCTCAGACCCTGCCCCGGGCCCTTTCGGTACCAGTGCATGGCCCCGTGTTTCTAATTCT
++
+C-6B9FGGGG+EF++:B8+5-5+:-+8-@++,+:FF,3-,+3*@F*C*C7*=F<*8+++?,?,+=1<FF,<:2,,2,8=+2+8E+/*2/:,,<,000,2*/******1<9,<C7C9@<CCCEFD*A+02,+,3;81/*;:7::,<,0A<8>E8E++03++<EFGGG+0A###################################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2112:20595:25092 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACCTAGGACGGTGACCGTGGTCCCAGTTCCGAAGACCCAATAATCACTGGCACTATCCCACACCTGACAGTAATAGTCGGCCTCATCCCCGGCTTCGACCCCGCTGATGGTCAGGGTGGCCGTGTTCCCAGAGTTGGAGCCAGAGAAGCGCTCAGGGATCACTGAGGGCCGGTCTCTATCATAATACATGACCAAAACAGGGGCCGGGCCTGGCGTCTGTTTGTACCAGTGGCCACCCTTTATTCCAATGTTGGCTGCGC
++
+CCCCCGGGCFFCFGGCGGGGGGFGGGEGGGGGGGGGGGGGGFGGGGGGGGGGGFE6FFFGGEGGEFFGGGGGGGGGFF,:::BEFCFGGG=FCECFF8FGGGGGGGCGAF?AAGGFFGGGDCEADGGFG7FF7@FFFCE7FCG>:F@FF9FC;,FFGDE>FFFGF:3@<FDA7=FFGCFGDC,2*42?,4=C<CGEF:*;+?+??8C***:5/**+3<++:9?<3<7?EFG*3<E*8*2;5AEEE#######################################################
+@M01873:M01873:000000000-B9G3J:1:1112:18419:7621 1:N:0:CTATAC
+CGACCTGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTGCCCCACAGGCTCCGCAGGCTGGATCGGCTGCTTCCAACTGAGGCTCCAGGGTCTGGGTCCCCGCTTTGCGGTGCAACCATTGGGCGCAGCAGGCCATGGGCGACCATGGCCAGACCCAGCAGCAGCAGGGGCCAGCGCTGCCTGGGACCAGGGCCCAGCTCCTCAGGGGTCTCACAACCCACTTGGCCTGTCTTGGGTCTCATTGGCCTTCAGGTTCAGGGGCACCTCTGGCCCGACTTGCAGCATGGGC
++
+CCCCCGGGGFEGGGGGEFCEGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGCFFGGGGEGGFEFFF@7CFGGGGFGGGGFGGGGFGGGCFGGGGGGGCFGGGFGGGGE<FFGGGGGGGGGGGFGGF@FFGDF7FGGGGCF7DFGEGGGCFGCF:<FFGGFGGGGDFGF8FD*CF*;EFCC8CGGEG@+;C@F55:E5588CFGC69@CFECGGG9C?FECEGDFGDGGFF5CGGFCFC:75>>EC*7>C?F4C>**6*9FFF55DDFCFC:77>@D)4>D4>??#######
+@M01873:M01873:000000000-B9G3J:1:1101:10014:22200 1:Y:0:CTATAC
+CCAGGGGGAAGACCGATGGGCCCTTGGTGGAAGCGAGGTGGGGGTCTCAGCCCTTCCTGTTGTGGCGAGGTACATGTGGGCAGCCTTGCCCACGCTGTCAGCTGCCATTTGTCTTCCTAGGAAATCACAGCTCGGCCCCCAGGTCCCCAGGGTTGTGAACTCCACGCTGCAAACACTAAGAACAGGATTGAAACTCCCCGTATCGGCTTCCAGTAGGAACAGATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+CCCCC7@F+6CF,CF@@C@<C<@F?@ECDEG,CCFFEEGFG>FFFCECFFGF:FGGCC?<FFF7,C7+@:CDGEFFCFFCFFFGGFF=DAEDFGC7:CF<EG?EE,:<9,B<<F9,F<FFD=A=F9DEF,3,DFCGCFDBFFGF<<DEFC@>F<FF7,@:F9F,<F7*C*D:FFFGGGDCGFFCEC7E,BC9;BC++33=8*3*/==*/8>CFGG++++;AFG7+A##########################################################################
+@M01873:M01873:000000000-B9G3J:1:1109:19388:16328 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAACCATTCAGGCTGTCATCCCATGTAGCACAGTAATAATCAGCCTCATCCTCAGACTGGAGCCCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCTGAGGGCCGCTGAGTATTGCTATGGATGAGGAGCTTGGGGGCCGTTCCGGGGAGTTGCTGGTACCAGTTTACATTATTACTTCCGATGTTGGAGCTGC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGFGGFFGGFGGGGGGGGGGDGGFGFGGGGFGFGCGGGGGFGFFFGGCFFGCECFBGGG78E*CFGGGDEGG*8/;<CG7CEFFGFGGGFGGGCEG6+;CGDDC*::CFCEGGGGG:<D>6:EC=<7*7C7*7?:*::76CFGF6?G#############
+@M01873:M01873:000000000-B9G3J:1:1111:16537:24486 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGCGAGCGGGGGATTGTAAGTCTGGTGACAGAAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAATCTGTCCCAGATCCACTCCCACTGAACCTTGACGGGACGCCACTGTGCAAACTGGATGCAGCATAGATCAGGAGCTTAGGGGATTTCCCTGGCTTCAGCTGATACCAATTTACAGAGCTGATACAGCTCTGGTTTGCCCGGCAAGCGATGGACAATATGGCTAC
++
+CCCCCGFGGGGGGGGGGGAFEEFEGGGGFDGGGGGGFGFFGGGGGGGGFGGGG7CFFGGG:FFCGGFEFGFEEFGGGGGGG9FCFGGGGF<FGDFCGGGGG<AEEFGGGGGGGGEG?EEGGFFGFFCFG<FEFFGFG9FFEAFFFGGGGGFDFGG8DFBFF,3+@CFFGFGGGC<*11:>>FGF,?,>DCF,?<BFFGFFFE,,?,?,<?*=>=:E@G**=9+40=C85@FGG?1>C67C?+>CEC7ED7CFG60*12/**29C4CF)*27>FD*1<CD>>GFB################
+@M01873:M01873:000000000-B9G3J:1:1110:23072:9989 1:N:0:CTATAC
+GACAGAGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGAACTATAATATTGGTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACGCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAAATGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGGAGTTCTCATTGTTGGATCTGTATAAAACACTCTGGCTGGACTTGCAGTTT
++
+CCCCCGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGFFGFGA@FGGGCEGGGGFFGGGGGGGFGGGGGG98FFGGGGGCF=FGDFG9FGFGGGGGGGEGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGGGFFFFGCGECGEDFFGGGEGGGCFFEGGGFEGGGGFGFGGGGDF9@F9EGGF=,AFGGGGGFGG7>BC6AF@FFCEFGGCF63;FFFFFGFGGFF*53*8CFFFFF:CCFCFGFGGGFFEGG(99FB63@F4
+@M01873:M01873:000000000-B9G3J:1:1101:10019:8146 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCATTGTCCCTTGGCCCCACATATCAAAAGCATGCCAGCCACTGCTATATTCTCGAGAACAGTAATACACAGCCGTGTCGTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCTTCACTGAGTCTGCATAGTATATGTAACTTCTACTAGCATCAATGGATGAGACCCACTCCAGCCCCTTCCCTGGAGCCTGGCGGG
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGEGEFGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFFGEGGGGDEGGGGGGGGGGGGGGGGGGEEFGGGFGGDGGGGGGGGGGDFFGGGGG;;FCFFAFDFFGCGGFGGGGGGGGGGGGF;DCD66DFGGFCGGFGGGGD5F:CFGC7CCGF?=CFF7C9FGFGF+AF7E+<CFC:@*:>DFG@:*=FG;<@?3C>B>?FG4497>FG:?F*)07?@??:FF###
+@M01873:M01873:000000000-B9G3J:1:2101:11039:4739 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCCTGGTCCCTCCGCCGAAAGTGAGAGGCCACTCGCTACGGTGCTGACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATGCCAGTGGCCCTATTGGATGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGDGGGAFFGGGGGGGGGGDFGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGEGGGGGCGGGGGCFGGGG9EGGGGGGGGGGGGFCECFF5>EGGGGGGGG?8FCCCFGFGGG9BFGFGCC;FFGGF
+@M01873:M01873:000000000-B9G3J:1:2104:24954:20771 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAATGCCAGTGCCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGCGCTCAGCCCCAGAGCTGGAGCCTGAGAAGCGATCAGGGATCCCGTCCCCCTTGATGTGGCTGCCATCACTCTTAACCGTCATCAAGTAGCGAGGGCCCTTCTCTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCTCACT
++
+CCCCCGGGGGGGGGGGGGGGGGGDGGGGGGGGGGFGDGGGGGGG,FCGGGGGGGGGGGFGFGFGDGGGGGGGGGGGGGDG8FGGGGGGGEFCGGGGGGGFDGGFFGGGG99=FGCFGGGGFF9=FGGGGCFGGGGGG<FCFEFCFCFCEFGGC*F7<FFGGGGGG>FCFGGGFGFGGGCFFC<1F@FG,CGGGGFGFGGGCEGG6CFCG+C=FECFCF?FG7@+2<CFGC:E5*<EEGGGCFC7CEGEGEGC*A>DD6>FDEGGFGC7>C*2<>F65?D3*85::>>C=+/6FGA47<@#
+@M01873:M01873:000000000-B9G3J:1:1111:12286:7157 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATAGGACTTGACTCTCAGAATGGTTCCTGCGCCAAAGACCAGTTTGTTTCCATGCCCATCGGGGCTTGCTGCACAGAAGTAGACAGCCGAGTCTTCAGGTTGGGTCTCTGTGATGTGCAGGGAGAAATGTTTGGCTGTCTTGTTCAATGTAACAGCAATTCGTTGGTCTTTCTTTTCGCCCACATTTGAACGAATGTCTATAATAAGCTGAGGTCTTTTTCCAAGTTCTTGCTTATACCAAGGGAAGTAGTTTGAGGCACTGTCTGAATAAGTACA
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGFGGGGGGGGGGGGEGGGGGEF7DGGGGGGGGGF@?F:FCFGGGDFGGGGGGFGCFCFGGGFFFGFGFGFGGGFGF:FFEFGGGGGFC3AC:FFFFFGBABB7>8A?##
+@M01873:M01873:000000000-B9G3J:1:2116:17140:9378 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCACTGTCCCTTGGCCCCAGACATCAAAAGCAGGAGTGCGACCTGCTATAAAAGCCTCCTTCGCACAGAAATATACAGCCGTGTCTTCAGGTCTCAGGCTGTTCATTTCCAGAAACAGTGTGTTCTTGGAATTGTCTCTGGAGAGGGTGAACCGGCCCTTCACGGAGTCTCCGAAGGATTTGTAACTTCCATCATAGAAGATAACTGACACCCAGTCCCGCCCCTTCCTTGGACCTG
++
+CCCCCGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCCGFGGGGFEEGECDAEEGGGGGGGFFFGGAFGDED>FGF@FFDGGGDGFGGGDFFFCDFGDBEAFF,@<BFFFFGGFGGGGFGGGGBECFAFGCA9D9:BCFCEG9,;D>DE8*=5;1:6C*C:CGEFDFF9CC:CEFCGFC*/=C+A:9+3200<CF9+:<*::*+20+6::7D7774C9:55<C+*)25<5FD###########
+@M01873:M01873:000000000-B9G3J:1:2105:17710:2946 1:N:0:CTATAC
+TGTCTGCACCCTGGCCCCTCCGCCGAAAGTGAAAGGTGAGCTACCATACTGCTGACAGTAATACACTGCAAAATCTTCAGGCTCCAGTCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGTCTGGGATGCCAGTGGCCCTGCTGGATGCAGCAAAGATGAGGAGCCTGGGAGCCTGGCCAGGTTCCTGCTGGTACCAGGCTAAGCCGCTGCTGCTAACACTCTGACTGGCCCTGCAGGAGCGGGTGGCGCTTTGCCCTGGATACAACGACATGAGCACTGG
++
+C-AACFGFFGGGGFFDGGFEEGGGEFGEGGGGGGGCFGCFGGFGGGGGGGGGGFGFAFEFCGGGGGGGGFFCFGGGFFG9FFGGGGGFGGGGGFFGGGDFGGGGFFGDFDFFFDGGGGGGG7,EEGGFGGGFFGDF+EFFFGGGGGDF,?FFGG8B<DG<F<F8EEF89FFD,,6AC9CAG8FF+,@@FGGGGG,DFCDFFE9,,5@7DCCG,:@BFGGF7,<,3*;@E:2:D?,>8,,2?C,;,,;5CF##################################################
+@M01873:M01873:000000000-B9G3J:1:2106:21507:14943 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACTCCGAAAGTGTAGCTGCCTGCATATGAGAAGCAGTAATAATCAGCCTCATCTTCAGCCT
++
+CCCCCGGGGGGGGGFGGGGG<FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_filterseq_test_in.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
++
+CCCCCGFGGGGGGGGGGGFFFFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
+@M01873:M01873:000000000-B9G3J:1:2103:2227:11139 1:N:0:CTATAC
+GGGTGCTGCAGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCAGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGAAGTCAAACTCCGCCACCTCCGTTGTAGCTCCCACTACAGTCGTCGTATCCCTCGCACAGTAATAAACAGCCGTGTCCTCTGCTGTCAGGCCGTTCATTTGCAGATAAAGTGAATTCTTGGCGTTGTCTCTGGAGATGCTGAATCGGAACTTCACAGAATCTGCATAGTACTCGGTTGTTCAATTTCTTCTATTGTCTTAAACCCACTCCAGCCCCT
++
+B@C<C7FFDGFAFDFGAC@CFGG7F7CFC<FGDFFGCFGGGGGC++8CECF,67C,EG,B6CDFCCEEEF@FGGGG?F,C@:,CEEGFFGC<?CEFE:EFEFC@CGFCEFAC9,BDF8E?F?CEG+BD:+DAFECF<FGGGGDF,BFFFC,C,,:+@@F,@=,,3>,33@9;7<CF*@<,37F,,3FC,,?F,,,,7,@D9,,:C>EC**?;?9;EEFGG+9?99+A+****3BFG+>CF6+5<F#######################################################
+@M01873:M01873:000000000-B9G3J:1:2110:13535:17883 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGCTTGATCTCCACCTTGGTCCCCCCGCCGAAAGTACACCAGTCGCTACGTTGCTGACAGAAATAAACTGCAAAATCTTCAGGCTCTAGGCTGTCGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGACGCCAGTGGCCCTGTTGGACGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGGCTAAGTAGGTACCAACATCCTGGCTGGCCCTGCAGGAGAGGGTGGCCCTTTCCCCTGG
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGE;EFGGGGGGGGGDGGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGFGFGGGCCGGFCGGGGGGGGGGGGFGGGGGGGGGGEGGGGGFGGDGGGGGGGGGGGGGFGGGGGGCGGGFGGGFGFFGGGGG8FGG@CFFCCF7:DAFFGGE@EGGGGGFFF@CC:?DB7A8@FG,=EGGGGG>CFGGFFGGCGG78C?CFCF>FFFGGGC?9CCF>7DEC*9C+<**:55=FGG41*37*/*18:DDDG*59?FFGFFFF9
+@M01873:M01873:000000000-B9G3J:1:1115:18550:17263 1:N:0:CTATAC
+GGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGTAGATCTCCGCTATCCAAAGACCAGACCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAACGACCAGACTAAGATCGTTAAAAGAAAATGAGTTGATACAGTAGAGCACAGAAGAGTACAAGCACGTGA
++
+A--A@CG<FFCFFGGGGGD+C+EFGCFE@CCDFGFGFEC@FGGFFDGGFGG,,@B@CGG7CCC7=F7FFECFGGGFGGDFGECD@F7=<FFCAFDF8F8F9F9EF@F9,5,,DACEDBCBDFFGFGGF>,FF8>F@FGGGGGGEE@7>,@@FCCGGGG7:1D7>FDCCEFFFFEE<*,=EFCCF++BCCGF9CF+<CC++3<6==*<19E38*A+++<+0ACE7CG8:EEE#####################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10006:14034 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACCTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATTGCTACACAGTGCATCATGAGTGTCCCCGTATCGAACAAAGCCATAGAAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAATAAGCGAAAGACTGCACGCACTGCACTCGAACAACCAGACATTGATCAAAACAGACACAATAAGGTTAATCATTCTCAATCTAAGCGAACATTCG
++
+CCCCCEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGG7;DGGGGGGG:CEGGGFFGGFFG6BCCB>BEGG#################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1117:17250:9432 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCAAGTGCCAGCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGTGCTCAGCCCCAGAGGTGGAGCCAGAGAAGCGATCAGGGATCCCGTCCCCCTTGCTGTGACTGCCATCACTGTTAACCTTCATCAGATACCGAGGGCCCTTCTGTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCCCACTGC
++
+CCCCCGGGGGGGGGGGGGGGGEFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGEFCGGGGGGGGGGGGGGGGGFGGFGGGFGGGGCGGCGFDFFGEFEC<FCEFGGGGGFFGGFGGGFFGGGFEGGGGGDCGGGGGGGGFDGGG<C@FEFFGCFGFFEFCEEGGDFGFCFEGGDGFG?FFCGDCGGGGCCGFFGGGGCEGGGCCEGG3>DG*1*>FFFGFFFG:C<0AF*9@BC@>@CD5C57CCD575*9:?:?6<4@<:<F4
+@M01873:M01873:000000000-B9G3J:1:2108:14465:19705 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACGTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGGCCCCTAATGAGCTGGCGCAGAAATATACAGATGTCTGGGAGGAGGCAGCAGACTCCAGAGTGAGGGGGAGGTCCTCTGTGTTTGATCTAGAGACACTGTAGCCATCTGAGACTTCTCCTTTGTTAGTGTCTTGAACACCATATGAGTAATGGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATTGTTGTGGTTCCAAGTCTGGTGAC
++
+CCCCCGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFGGFGGGGGGGGGGGGGGGGGFGGGEGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGFGGGGGGG,DGGGGGGFGGGGGGGGGGFGGGCFGGGFGGGDFGGGGGGGGGGGFGFFFGGGGGGE*@*?CGDGGCDBAF7FGE=*7=49<<EG47CFGGG70>EECCFCFFFFFFBFF###
+@M01873:M01873:000000000-B9G3J:1:2111:3554:13238 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTGGAGCTTGGTCCCCTGGCCAGAAGTGTAAGGACAGGGTGTAGTTTGCATGCAGTAATAAATGCCAACATCCTCAGCCCCCACCCTACTGATTTTCAGTGTGAAATCCGTGCCTGTACCACTGCCGCTGAATCTGTCTGGGACCCCAGAGACCAGGTTAGAAACTTTATATATTAGGCGCGTTGGAGATTGGCATGGCCTCTTCTGAAACCAGATCAAGTAGATGTTGACATCACTGTATATGAGGCTTAGAATCGTACTGCGGGAGGT
++
+A@AACGGG?FC,6C@CF@CCEFE@@9CBFGFF,,;C;,6<FFF<6,CFC,,;DEFG9C@CEF<,<6F,86B@FF<E9C9EFCE9E,,C<EEFFFE,6,,9CFFFFFGD,FFGC@FFE8DFFAFC9EFGF?FGGGAF,,,7B=C+:E55?:,:<=,?FDDCEF9FAB5C,,AFFG>++6BFA,3=,3>,373>EF,,3,=DF;CFA,,,,@++5>EEFG##################################################################################
+@M01873:M01873:000000000-B9G3J:1:1112:28236:12457 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCAGAGTAGAGAGTTCACCACACAGAGGTAGGTGGCTGAATCACTGAGCTTGGAGTCTCTGATGAGCAGGGAAATATACTGGCCGGCTCTATTGAGCTGTGCTGTAAACCTTCCATCTTCATTACCACTGGAGTATACGGACATCAGCAACTTAGGTTCTTTCCTGCAATCCTGTCTGTACCAGAAGAAAGACTGAGAAGCACTGTTGCTGTAAGTACAGT
++
+CCCCCGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGG9FFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGGGGEEGGGGGGGGGGGEGGGGGGGFFGGDGGGGGGGGGGGC;DFGGGGGGGFGGFCE6CEGGGGGGFFDFCGFEGGGGGE>FGFFGGG7CFGGGGF8CCFGGF6?6DGFFGGGGGFGFC46AF=<FGF?=+9CFFFF:
+@M01873:M01873:000000000-B9G3J:1:1119:21261:11479 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACTTAGGACGGTGACCCTGGTCCCAGTTCCGAAGACCACAGTGCTGCTGTCCCACACCTGACAGGAATAGTCAGCCTCATCCCCGGCTTGGGCTCTGCTGATAATCAGGGTGGCCGTGTTCCCCGAGTTGGAGCCAGAGAATCGGTCAGGGATCCCAGAGGGCCGGTGGATATCCCTATAGATGATCAGCACAGGGGCCTGGCCTGGCTTCTGCTGGAACCAGTACACACTTTTACTTCCAATGTTGTTTCCCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFEGGGGGGGGFEGFFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGDGGGGCEGFGGGGGGGFCFFECDE5=C4FFGGGG>;FDFGGFCFFGFFGGFFGGGGFGFFFGFFC@57)6FAFF:A<FG
+@M01873:M01873:000000000-B9G3J:1:1106:23126:20933 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAACTTGGTCCCTCCGCCGAAGACCGAACCACTCAGCCTAAAGTCGTAAGACTGGCAGTAATATAGAGCCTCATCGTCAGGCTGGAGTCCAGTGATGGCCAGGGAGGCTGAGGTGCCAGATTTGGAGGCAGAGAATCGGTCAGGAACTCCTGAGGGCCGATCGTCCTTAGTATGGATGAGGACGTTGGGGGCTGTTCCTGGAACGTGTTGGTACCAGACAATTTCATAACCTGCCCCGATGT
++
+CCCCCGGGGGGGGGGGGGCFCFGC<F@6F+++6C:F7CCEGGGGCFG,696:66,+@@FGC<EF<FC<F@6E@::F=+++444+++++9BFD<FEGG8<CAEFFF=8FG@BFCFGG<<@DA9AFFB,=DFGA<=D=D+C<,@CD73,3,DFCGFFC,3,D:<*3:CFF@7DF:2:3@,2@92,,6***6:*,>BF7FC*BFC+CC++5<@;*=:*1CG8*1****<9+2A+:C?++++2C**2*2:5:*/:CFC*2:*<)3)/19C4))9*/:EFC*:D=C>C@?C7/CGF4:FBF0DD:
+@M01873:M01873:000000000-B9G3J:1:2111:10779:3698 1:Y:0:CTATAC
+AGGGGGGGAACACGGTTTTCCCGTCGTCGAACACTGACAGGCGGGAGCCCGGGCCAACCTACCCCGTATCTGTGACCCCTGGCCCCCGTATACCACTGGCCCCGAGGTAGTAAGCTGTCGGGTTCTCTTGGCCCGATGTCACAGTTAGCGGATACAGTGCCTTCTTGTCCCTATCGATGCTGTAGCTGTCTGCTATATCTACATACTGAAAGTCATTTACTATCTGTCAGTAGTAACTAAATCTCAGACCCTGCCCCGGGCCCTTTCGGTACCAGTGCATGGCCCCGTGTTTCTAATTCT
++
+C-6B9FGGGG+EF++:B8+5-5+:-+8-@++,+:FF,3-,+3*@F*C*C7*=F<*8+++?,?,+=1<FF,<:2,,2,8=+2+8E+/*2/:,,<,000,2*/******1<9,<C7C9@<CCCEFD*A+02,+,3;81/*;:7::,<,0A<8>E8E++03++<EFGGG+0A###################################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2112:20595:25092 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACCTAGGACGGTGACCGTGGTCCCAGTTCCGAAGACCCAATAATCACTGGCACTATCCCACACCTGACAGTAATAGTCGGCCTCATCCCCGGCTTCGACCCCGCTGATGGTCAGGGTGGCCGTGTTCCCAGAGTTGGAGCCAGAGAAGCGCTCAGGGATCACTGAGGGCCGGTCTCTATCATAATACATGACCAAAACAGGGGCCGGGCCTGGCGTCTGTTTGTACCAGTGGCCACCCTTTATTCCAATGTTGGCTGCGC
++
+CCCCCGGGCFFCFGGCGGGGGGFGGGEGGGGGGGGGGGGGGFGGGGGGGGGGGFE6FFFGGEGGEFFGGGGGGGGGFF,:::BEFCFGGG=FCECFF8FGGGGGGGCGAF?AAGGFFGGGDCEADGGFG7FF7@FFFCE7FCG>:F@FF9FC;,FFGDE>FFFGF:3@<FDA7=FFGCFGDC,2*42?,4=C<CGEF:*;+?+??8C***:5/**+3<++:9?<3<7?EFG*3<E*8*2;5AEEE#######################################################
+@M01873:M01873:000000000-B9G3J:1:1112:18419:7621 1:N:0:CTATAC
+CGACCTGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTGCCCCACAGGCTCCGCAGGCTGGATCGGCTGCTTCCAACTGAGGCTCCAGGGTCTGGGTCCCCGCTTTGCGGTGCAACCATTGGGCGCAGCAGGCCATGGGCGACCATGGCCAGACCCAGCAGCAGCAGGGGCCAGCGCTGCCTGGGACCAGGGCCCAGCTCCTCAGGGGTCTCACAACCCACTTGGCCTGTCTTGGGTCTCATTGGCCTTCAGGTTCAGGGGCACCTCTGGCCCGACTTGCAGCATGGGC
++
+CCCCCGGGGFEGGGGGEFCEGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGCFFGGGGEGGFEFFF@7CFGGGGFGGGGFGGGGFGGGCFGGGGGGGCFGGGFGGGGE<FFGGGGGGGGGGGFGGF@FFGDF7FGGGGCF7DFGEGGGCFGCF:<FFGGFGGGGDFGF8FD*CF*;EFCC8CGGEG@+;C@F55:E5588CFGC69@CFECGGG9C?FECEGDFGDGGFF5CGGFCFC:75>>EC*7>C?F4C>**6*9FFF55DDFCFC:77>@D)4>D4>??#######
+@M01873:M01873:000000000-B9G3J:1:1101:10014:22200 1:Y:0:CTATAC
+CCAGGGGGAAGACCGATGGGCCCTTGGTGGAAGCGAGGTGGGGGTCTCAGCCCTTCCTGTTGTGGCGAGGTACATGTGGGCAGCCTTGCCCACGCTGTCAGCTGCCATTTGTCTTCCTAGGAAATCACAGCTCGGCCCCCAGGTCCCCAGGGTTGTGAACTCCACGCTGCAAACACTAAGAACAGGATTGAAACTCCCCGTATCGGCTTCCAGTAGGAACAGATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++
+CCCCC7@F+6CF,CF@@C@<C<@F?@ECDEG,CCFFEEGFG>FFFCECFFGF:FGGCC?<FFF7,C7+@:CDGEFFCFFCFFFGGFF=DAEDFGC7:CF<EG?EE,:<9,B<<F9,F<FFD=A=F9DEF,3,DFCGCFDBFFGF<<DEFC@>F<FF7,@:F9F,<F7*C*D:FFFGGGDCGFFCEC7E,BC9;BC++33=8*3*/==*/8>CFGG++++;AFG7+A##########################################################################
+@M01873:M01873:000000000-B9G3J:1:1109:19388:16328 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAACCATTCAGGCTGTCATCCCATGTAGCACAGTAATAATCAGCCTCATCCTCAGACTGGAGCCCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCTGAGGGCCGCTGAGTATTGCTATGGATGAGGAGCTTGGGGGCCGTTCCGGGGAGTTGCTGGTACCAGTTTACATTATTACTTCCGATGTTGGAGCTGC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGFGGFFGGFGGGGGGGGGGDGGFGFGGGGFGFGCGGGGGFGFFFGGCFFGCECFBGGG78E*CFGGGDEGG*8/;<CG7CEFFGFGGGFGGGCEG6+;CGDDC*::CFCEGGGGG:<D>6:EC=<7*7C7*7?:*::76CFGF6?G#############
+@M01873:M01873:000000000-B9G3J:1:1111:16537:24486 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGCGAGCGGGGGATTGTAAGTCTGGTGACAGAAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAATCTGTCCCAGATCCACTCCCACTGAACCTTGACGGGACGCCACTGTGCAAACTGGATGCAGCATAGATCAGGAGCTTAGGGGATTTCCCTGGCTTCAGCTGATACCAATTTACAGAGCTGATACAGCTCTGGTTTGCCCGGCAAGCGATGGACAATATGGCTAC
++
+CCCCCGFGGGGGGGGGGGAFEEFEGGGGFDGGGGGGFGFFGGGGGGGGFGGGG7CFFGGG:FFCGGFEFGFEEFGGGGGGG9FCFGGGGF<FGDFCGGGGG<AEEFGGGGGGGGEG?EEGGFFGFFCFG<FEFFGFG9FFEAFFFGGGGGFDFGG8DFBFF,3+@CFFGFGGGC<*11:>>FGF,?,>DCF,?<BFFGFFFE,,?,?,<?*=>=:E@G**=9+40=C85@FGG?1>C67C?+>CEC7ED7CFG60*12/**29C4CF)*27>FD*1<CD>>GFB################
+@M01873:M01873:000000000-B9G3J:1:1110:23072:9989 1:N:0:CTATAC
+GACAGAGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGAACTATAATATTGGTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACGCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAAATGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGGAGTTCTCATTGTTGGATCTGTATAAAACACTCTGGCTGGACTTGCAGTTT
++
+CCCCCGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGFFGFGA@FGGGCEGGGGFFGGGGGGGFGGGGGG98FFGGGGGCF=FGDFG9FGFGGGGGGGEGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGGGFFFFGCGECGEDFFGGGEGGGCFFEGGGFEGGGGFGFGGGGDF9@F9EGGF=,AFGGGGGFGG7>BC6AF@FFCEFGGCF63;FFFFFGFGGFF*53*8CFFFFF:CCFCFGFGGGFFEGG(99FB63@F4
+@M01873:M01873:000000000-B9G3J:1:1101:10019:8146 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCATTGTCCCTTGGCCCCACATATCAAAAGCATGCCAGCCACTGCTATATTCTCGAGAACAGTAATACACAGCCGTGTCGTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCTTCACTGAGTCTGCATAGTATATGTAACTTCTACTAGCATCAATGGATGAGACCCACTCCAGCCCCTTCCCTGGAGCCTGGCGGG
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGEGEFGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFFGEGGGGDEGGGGGGGGGGGGGGGGGGEEFGGGFGGDGGGGGGGGGGDFFGGGGG;;FCFFAFDFFGCGGFGGGGGGGGGGGGF;DCD66DFGGFCGGFGGGGD5F:CFGC7CCGF?=CFF7C9FGFGF+AF7E+<CFC:@*:>DFG@:*=FG;<@?3C>B>?FG4497>FG:?F*)07?@??:FF###
+@M01873:M01873:000000000-B9G3J:1:2101:11039:4739 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCCTGGTCCCTCCGCCGAAAGTGAGAGGCCACTCGCTACGGTGCTGACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATGCCAGTGGCCCTATTGGATGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGDGGGAFFGGGGGGGGGGDFGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGEGGGGGCGGGGGCFGGGG9EGGGGGGGGGGGGFCECFF5>EGGGGGGGG?8FCCCFGFGGG9BFGFGCC;FFGGF
+@M01873:M01873:000000000-B9G3J:1:2104:24954:20771 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAATGCCAGTGCCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGCGCTCAGCCCCAGAGCTGGAGCCTGAGAAGCGATCAGGGATCCCGTCCCCCTTGATGTGGCTGCCATCACTCTTAACCGTCATCAAGTAGCGAGGGCCCTTCTCTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCTCACT
++
+CCCCCGGGGGGGGGGGGGGGGGGDGGGGGGGGGGFGDGGGGGGG,FCGGGGGGGGGGGFGFGFGDGGGGGGGGGGGGGDG8FGGGGGGGEFCGGGGGGGFDGGFFGGGG99=FGCFGGGGFF9=FGGGGCFGGGGGG<FCFEFCFCFCEFGGC*F7<FFGGGGGG>FCFGGGFGFGGGCFFC<1F@FG,CGGGGFGFGGGCEGG6CFCG+C=FECFCF?FG7@+2<CFGC:E5*<EEGGGCFC7CEGEGEGC*A>DD6>FDEGGFGC7>C*2<>F65?D3*85::>>C=+/6FGA47<@#
+@M01873:M01873:000000000-B9G3J:1:1111:12286:7157 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATAGGACTTGACTCTCAGAATGGTTCCTGCGCCAAAGACCAGTTTGTTTCCATGCCCATCGGGGCTTGCTGCACAGAAGTAGACAGCCGAGTCTTCAGGTTGGGTCTCTGTGATGTGCAGGGAGAAATGTTTGGCTGTCTTGTTCAATGTAACAGCAATTCGTTGGTCTTTCTTTTCGCCCACATTTGAACGAATGTCTATAATAAGCTGAGGTCTTTTTCCAAGTTCTTGCTTATACCAAGGGAAGTAGTTTGAGGCACTGTCTGAATAAGTACA
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGFGGGGGGGGGGGGEGGGGGEF7DGGGGGGGGGF@?F:FCFGGGDFGGGGGGFGCFCFGGGFFFGFGFGFGGGFGF:FFEFGGGGGFC3AC:FFFFFGBABB7>8A?##
+@M01873:M01873:000000000-B9G3J:1:2116:17140:9378 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCACTGTCCCTTGGCCCCAGACATCAAAAGCAGGAGTGCGACCTGCTATAAAAGCCTCCTTCGCACAGAAATATACAGCCGTGTCTTCAGGTCTCAGGCTGTTCATTTCCAGAAACAGTGTGTTCTTGGAATTGTCTCTGGAGAGGGTGAACCGGCCCTTCACGGAGTCTCCGAAGGATTTGTAACTTCCATCATAGAAGATAACTGACACCCAGTCCCGCCCCTTCCTTGGACCTG
++
+CCCCCGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCCGFGGGGFEEGECDAEEGGGGGGGFFFGGAFGDED>FGF@FFDGGGDGFGGGDFFFCDFGDBEAFF,@<BFFFFGGFGGGGFGGGGBECFAFGCA9D9:BCFCEG9,;D>DE8*=5;1:6C*C:CGEFDFF9CC:CEFCGFC*/=C+A:9+3200<CF9+:<*::*+20+6::7D7774C9:55<C+*)25<5FD###########
+@M01873:M01873:000000000-B9G3J:1:2105:17710:2946 1:N:0:CTATAC
+TGTCTGCACCCTGGCCCCTCCGCCGAAAGTGAAAGGTGAGCTACCATACTGCTGACAGTAATACACTGCAAAATCTTCAGGCTCCAGTCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGTCTGGGATGCCAGTGGCCCTGCTGGATGCAGCAAAGATGAGGAGCCTGGGAGCCTGGCCAGGTTCCTGCTGGTACCAGGCTAAGCCGCTGCTGCTAACACTCTGACTGGCCCTGCAGGAGCGGGTGGCGCTTTGCCCTGGATACAACGACATGAGCACTGG
++
+C-AACFGFFGGGGFFDGGFEEGGGEFGEGGGGGGGCFGCFGGFGGGGGGGGGGFGFAFEFCGGGGGGGGFFCFGGGFFG9FFGGGGGFGGGGGFFGGGDFGGGGFFGDFDFFFDGGGGGGG7,EEGGFGGGFFGDF+EFFFGGGGGDF,?FFGG8B<DG<F<F8EEF89FFD,,6AC9CAG8FF+,@@FGGGGG,DFCDFFE9,,5@7DCCG,:@BFGGF7,<,3*;@E:2:D?,>8,,2?C,;,,;5CF##################################################
+@M01873:M01873:000000000-B9G3J:1:2106:21507:14943 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACTCCGAAAGTGTAGCTGCCTGCATATGAGAAGCAGTAATAATCAGCCTCATCTTCAGCCT
++
+CCCCCGGGGGGGGGFGGGGG<FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_filterseq_trimqual_test_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,92 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCT
++
+CCCCCGFGGGGGGGGGGGFFFFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFF
+@M01873:M01873:000000000-B9G3J:1:2103:2227:11139 1:N:0:CTATAC
+GGGTGCTGCAGAGGCTCAGCGGGAAGACCTTGGGGCTGGT
++
+B@C<C7FFDGFAFDFGAC@CFGG7F7CFC<FGDFFGCFGG
+@M01873:M01873:000000000-B9G3J:1:2110:13535:17883 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGCTTGATCTCCACCTTGGTCCCCCCGCCGAAAGTACACCAGTCGCTACGTTGCTGACAGAAATAAACTGCAAAATCTTCAGGCTCTAGGCTGTCGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGACGCCAGTGGCCCTGTTGGACGCATCATAGA
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGE;EFGGGGGGGGGDGGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGFGFGGGCCGGFCGGGGGGGGGGGGFGGGGGGGGGGEGGGGGFGGDGGGGGGGGGGGGGFGGGGGGCGGGFGGGFGFFGGGGG8FGG@CFFCCF7:DAFFGGE@EGGGGGFFF
+@M01873:M01873:000000000-B9G3J:1:1101:10006:14034 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACCTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATTGCTACACAGTGCATCATGAGTGTCCCCGTATCGAACAAAGCCATAGAAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAA
++
+CCCCCEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGG7;DGGGGGGG:CEGGGFFGGFFG6BCCB>B
+@M01873:M01873:000000000-B9G3J:1:1117:17250:9432 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCAAGTGCCAGCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGTGCTCAGCCCCAGAGGTGGAGCCAGAGAAGCGATCAGGGATCCCGTCCCCCTTGCTGTGACTGCCATCACTGTTAACCTTCATCAGATACC
++
+CCCCCGGGGGGGGGGGGGGGGEFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGEFCGGGGGGGGGGGGGGGGGFGGFGGGFGGGGCGGCGFDFFGEFEC<FCEFGGGGGFFGGFGGGFFGGGFEGGGGGDCGGGGGGGGFDGGG<C@FEFFGCFGFFEFCEEGGDFGFCFEGGDGFG?FFCGDCGGGGCCGFFGGGGCEGGGCC
+@M01873:M01873:000000000-B9G3J:1:2108:14465:19705 1:N:0:CTATAC
+CGACCTCGGGTGGGAACACGTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGGCCCCTAATGAGCTGGCGCAGAAATATACAGATGTCTGGGAGGAGGCAGCAGACTCCAGAGTGAGGGGGAGGTCCTCTGTGTTTGATCTAGAGACACTGTAGCCATCTGAGACTTCTCCTTTGTTAGTGTCTTGAACACCATATGAGTAATGGATCAGCCTCAGCCCATGTCCCAGGTCTTGT
++
+CCCCCGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFGGFGGGGGGGGGGGGGGGGGFGGGEGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGFGGGGGGG,DGGGGGGFGGGGGGGGGGFGGGCFGGGFGGGDFGGGGGGGGGGGFGFFFGGGGGGE*@*?CGDGGCDBAF7F
+@M01873:M01873:000000000-B9G3J:1:2111:3554:13238 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGAT
++
+A@AACGGG?FC,6C@CF@CCEFE@@9CBFG
+@M01873:M01873:000000000-B9G3J:1:1112:28236:12457 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCAGAGTAGAGAGTTCACCACACAGAGGTAGGTGGCTGAATCACTGAGCTTGGAGTCTCTGATGAGCAGGGAAATATACTGGCCGGCTCTATTGAGCTGTGCTGTAAACCTTCCATCTTCATTACCACTGGAGTATACGGACATCAGCAACTTAGGTTCTTTCCTGCAATCCTGTCTGTACCAGAAGAAAGACTGAGAAGCACTGTTGCTG
++
+CCCCCGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGG9FFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGGGGEEGGGGGGGGGGGEGGGGGGGFFGGDGGGGGGGGGGGC;DFGGGGGGGFGGFCE6CEGGGGGGFFDFCGFEGGGGGE>FGFFGGG7CFGGGGF8CCFGGF6?6DGFFGGGGGFGFC46AF=<FGF
+@M01873:M01873:000000000-B9G3J:1:1119:21261:11479 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACTTAGGACGGTGACCCTGGTCCCAGTTCCGAAGACCACAGTGCTGCTGTCCCACACCTGACAGGAATAGTCAGCCTCATCCCCGGCTTGGGCTCTGCTGATAATCAGGGTGGCCGTGTTCCCCGAGTTGGAGCCAGAGAATCGGTCAGGGATCCCAGAGGGCCGGTGGATATCCCTATAGATGATCAGCACAGGGGCCTGGCCTGGCTTCTGCTGGAACCAGTACACACTTTTACTTCCAATGTTGTTTCCCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFEGGGGGGGGFEGFFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGDGGGGCEGFGGGGGGGFCFFECDE5=C4FFGGGG>;FDFGGFCFFGFFGGFFGGGGFGFFFGFFC@57)6FAFF:A<FG
+@M01873:M01873:000000000-B9G3J:1:1106:23126:20933 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACCGAGG
++
+CCCCCGGGGGGGGGGGGGCFCFGC<F@6F+
+@M01873:M01873:000000000-B9G3J:1:2111:10779:3698 1:Y:0:CTATAC
+AGGGGGGGAA
++
+C-6B9FGGGG
+@M01873:M01873:000000000-B9G3J:1:2112:20595:25092 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACCTAGGACGGTGACCGTGGTCCCAGTTCCGAAGACCCAATAATCACTGGCACTATCCCACACCTGACAGTAATAGTCGGCCTCATCCCCGGCTTCGACCCCGCTGATGGTCAGGGTGGCCGTGTTCCCAGAGTTGGAGC
++
+CCCCCGGGCFFCFGGCGGGGGGFGGGEGGGGGGGGGGGGGGFGGGGGGGGGGGFE6FFFGGEGGEFFGGGGGGGGGFF,:::BEFCFGGG=FCECFF8FGGGGGGGCGAF?AAGGFFGGGDCEADGGFG7FF7@FFFCE7FCG>:F@FF9FC;,FFGDE>FFFGF:3@<FDA7=FFGCFG
+@M01873:M01873:000000000-B9G3J:1:1112:18419:7621 1:N:0:CTATAC
+CGACCTGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTGCCCCACAGGCTCCGCAGGCTGGATCGGCTGCTTCCAACTGAGGCTCCAGGGTCTGGGTCCCCGCTTTGCGGTGCAACCATTGGGCGCAGCAGGCCATGGGCGACCATGGCCAGACCCAGCAGCAGCAGGG
++
+CCCCCGGGGFEGGGGGEFCEGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGCFFGGGGEGGFEFFF@7CFGGGGFGGGGFGGGGFGGGCFGGGGGGGCFGGGFGGGGE<FFGGGGGGGGGGGFGGF@FFGDF7FGGGGCF7DFGEGGGCFGCF:<FFGGFGGGGDFGF8FD
+@M01873:M01873:000000000-B9G3J:1:1109:19388:16328 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAACCATTCAGGCTGTCATCCCATGTAGCACAGTAATAATCAGCCTCATCCTCAGACTGGAGCCCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCTGAGGGCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGFGGFFGGFGGGGGGGGGGDGGFGFGGGGFGFGCGGGGGFGFFFGGCFFGCECFBGGG78E*CFGGGDE
+@M01873:M01873:000000000-B9G3J:1:1111:16537:24486 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGCGAGCGGGGGATTGTAAGTCTGGTGACAGAAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAATCTGTCCCAGATCCACTCCCACTG
++
+CCCCCGFGGGGGGGGGGGAFEEFEGGGGFDGGGGGGFGFFGGGGGGGGFGGGG7CFFGGG:FFCGGFEFGFEEFGGGGGGG9FCFGGGGF<FGDFCGGGGG<AEEFGGGGGGGGEG?EEGGFFGFFCFG<FEFFGFG9FFEAFFFGGGGGFDFGG8DFBF
+@M01873:M01873:000000000-B9G3J:1:1110:23072:9989 1:N:0:CTATAC
+GACAGAGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGAACTATAATATTGGTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACGCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAAATGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGGAGTTCTCATT
++
+CCCCCGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGFFGFGA@FGGGCEGGGGFFGGGGGGGFGGGGGG98FFGGGGGCF=FGDFG9FGFGGGGGGGEGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGGGFFFFGCGECGEDFFGGGEGGGCFFEGGGFEGGGGFGFGGGGDF9@F9EGGF=,AFGGGGGFGG7>BC6AF@FFCEFGGCF63;FFFFFGFG
+@M01873:M01873:000000000-B9G3J:1:1101:10019:8146 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCATTGTCCCTTGGCCCCACATATCAAAAGCATGCCAGCCACTGCTATATTCTCGAGAACAGTAATACACAGCCGTGTCGTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCTTCACTGAGTCTGCATAGTATATGT
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGEGEFGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFFGEGGGGDEGGGGGGGGGGGGGGGGGGEEFGGGFGGDGGGGGGGGGGDFFGGGGG;;FCFFAFDFFGCGGFGGGGGGGGGGGGF;DCD66DFGGFCGGFGGGGD5F:CFGC7CCGF?=CFF7C9FGFGF
+@M01873:M01873:000000000-B9G3J:1:2101:11039:4739 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCCTGGTCCCTCCGCCGAAAGTGAGAGGCCACTCGCTACGGTGCTGACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATGCCAGTGGCCCTATTGGATGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGCC
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGDGGGAFFGGGGGGGGGGDFGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGEGGGGGCGGGGGCFGGGG9EGGGGGGGGGGGGFCECFF5>EGGGGGGGG?8FCCCFGFGGG9BFGFGCC;FFGGF
+@M01873:M01873:000000000-B9G3J:1:2104:24954:20771 1:N:0:CTATAC
+AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAATGCCAGTGCCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGCGCTCAGCCCCAGAGCTGGAGCCTGAGAAGCGATCAGGGATCCCGTCCCCCTTGATGTGGCTGCCATCA
++
+CCCCCGGGGGGGGGGGGGGGGGGDGGGGGGGGGGFGDGGGGGGG,FCGGGGGGGGGGGFGFGFGDGGGGGGGGGGGGGDG8FGGGGGGGEFCGGGGGGGFDGGFFGGGG99=FGCFGGGGFF9=FGGGGCFGGGGGG<FCFEFCFCFCEFGGC*F7<FFGGGGGG>FCFGGGFGFGGGCFFC<1F@FG,CGGGGFGFGGGCEGG6CFCG+C=FECFCF?F
+@M01873:M01873:000000000-B9G3J:1:1111:12286:7157 1:N:0:CTATAC
+CACGGCAGGGTCAGGGTTCTGGATATAGGACTTGACTCTCAGAATGGTTCCTGCGCCAAAGACCAGTTTGTTTCCATGCCCATCGGGGCTTGCTGCACAGAAGTAGACAGCCGAGTCTTCAGGTTGGGTCTCTGTGATGTGCAGGGAGAAATGTTTGGCTGTCTTGTTCAATGTAACAGCAATTCGTTGGTCTTTCTTTTCGCCCACATTTGAACGAATGTCTATAATAAGCTGAGGTCTTTTTCCAAGTTCTTGCTTATACCAAGGGAAGTAGTTTGAGGCACTGTCTG
++
+CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGFGGGGGGGGGGGGEGGGGGEF7DGGGGGGGGGF@?F:FCFGGGDFGGGGGGFGCFCFGGGFFFGFGFGFGGGFGF:FFEFGGGGGFC3AC:FFFFFGB
+@M01873:M01873:000000000-B9G3J:1:2116:17140:9378 1:N:0:CTATAC
+GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCACTGTCCCTTGGCCCCAGACATCAAAAGCAGGAGTGCGACCTGCTATAAAAGCCTCCTTCGCACAGAAATATACAGCCGTGTCTTCAGGTCTCAGGCTGTTCATTTCCAGAAACAGTGTGTTCTTGGAATTGTCT
++
+CCCCCGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCCGFGGGGFEEGECDAEEGGGGGGGFFFGGAFGDED>FGF@FFDGGGDGFGGGDFFFCDFGDBEAFF,@<BFFFFGGFGGGGFGGGGBECFAFGCA9D9:BCFCEG9
+@M01873:M01873:000000000-B9G3J:1:2105:17710:2946 1:N:0:CTATAC
+TGTCTGCACCCTGGCCCCTCCGCCGAAAGTGAAAGGTGAGCTACCATACTGCTGACAGTAATACACTGCAAAATCTTCAGGCTCCAGTCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGTCTGGGATGCCAGTGGCCCTGCTGGATGCAG
++
+C-AACFGFFGGGGFFDGGFEEGGGEFGEGGGGGGGCFGCFGGFGGGGGGGGGGFGFAFEFCGGGGGGGGFFCFGGGFFG9FFGGGGGFGGGGGFFGGGDFGGGGFFGDFDFFFDGGGGGGG7,EEGGFGGGFFGDF+EFFFGGGGGDF,?FFGG8B<DG<F<F8EEF89F
+@M01873:M01873:000000000-B9G3J:1:2106:21507:14943 1:N:0:CTATAC
+CGACCTCGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACTCCGAAAGTGTAGCTGCCTGCATATGAGAAGCAGTAATAATCAGCCTCATCTTCAGCCT
++
+CCCCCGGGGGGGGGFGGGGG<FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_maskprimers_with_barcode_test_align_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,4 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=ATCTTTGCGGCTGGTTA
+GGGTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCCACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGCCCCTGACCGATTCAGTGGCCGCGGGTCTGGGACAGAGTTCACTCTCAACATCAGCAGCATGCAGTCGGAAGA
++
+GGGGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFGFEFDG?EFGGCFFFGFF9CFE,E+ABE@EGFEGEFGGCFGGGGEGCGGGGGGDDFGGCFGDF,>D+44,@3DCFGC8CGGGFGC9@CGGGGGD8CGG?C79,1556C*00BC5D*/=EC5C4C<EDEC+:0<*:*19)8>*);7ECF*;>*0:9+<AC#############################
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_maskprimers_with_barcode_test_in.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,4 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 2:N:0:CTATAC
+ATCTTTGCGGCTGGTTACGATACGGGGTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCCACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGCCCCTGACCGATTCAGTGGCCGCGGGTCTGGGACAGAGTTCACTCTCAACATCAGCAGCATGCAGTCGGAAGA
++
+-A@CCFGGCGGGGGGFFGGFGGGGGGGGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFGFEFDG?EFGGCFFFGFF9CFE,E+ABE@EGFEGEFGGCFGGGGEGCGGGGGGDDFGGCFGDF,>D+44,@3DCFGC8CGGGFGC9@CGGGGGD8CGG?C79,1556C*00BC5D*/=EC5C4C<EDEC+:0<*:*19)8>*);7ECF*;>*0:9+<AC#############################
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_maskprimers_with_barcode_test_score_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,4 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=ATCTTTGCGGCTGGTTA
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCCACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGCCCCTGACCGATTCAGTGGCCGCGGGTCTGGGACAGAGTTCACTCTCAACATCAGCAGCATGCAGTCGGAAGA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFGFEFDG?EFGGCFFFGFF9CFE,E+ABE@EGFEGEFGGCFGGGGEGCGGGGGGDDFGGCFGDF,>D+44,@3DCFGC8CGGGFGC9@CGGGGGD8CGG?C79,1556C*00BC5D*/=EC5C4C<EDEC+:0<*:*19)8>*);7ECF*;>*0:9+<AC#############################
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_maskprimers_without_barcode_test_align_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,4 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
++
+FFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_maskprimers_without_barcode_test_in.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,4 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC
+GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
++
+CCCCCGFGGGGGGGGGGGFFFFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_maskprimers_without_barcode_test_score_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,4 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
++
+FFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_pairseq_test1_r1_in.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,400 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
++
+FFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
+@M01873:M01873:000000000-B9G3J:1:2103:2227:11139 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCAGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGAAGTCAAACTCCGCCACCTCCGTTGTAGCTCCCACTACAGTCGTCGTATCCCTCGCACAGTAATAAACAGCCGTGTCCTCTGCTGTCAGGCCGTTCATTTGCAGATAAAGTGAATTCTTGGCGTTGTCTCTGGAGATGCTGAATCGGAACTTCACAGAATCTGCATAGTACTCGGTTGTTCAATTTCTTCTATTGTCTTAAACCCACTCCAGCCCCT
++
+CFGG7F7CFC<FGDFFGCFGGGGGC++8CECF,67C,EG,B6CDFCCEEEF@FGGGG?F,C@:,CEEGFFGC<?CEFE:EFEFC@CGFCEFAC9,BDF8E?F?CEG+BD:+DAFECF<FGGGGDF,BFFFC,C,,:+@@F,@=,,3>,33@9;7<CF*@<,37F,,3FC,,?F,,,,7,@D9,,:C>EC**?;?9;EEFGG+9?99+A+****3BFG+>CF6+5<F#######################################################
+@M01873:M01873:000000000-B9G3J:1:1117:17250:9432 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCAAGTGCCAGCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGTGCTCAGCCCCAGAGGTGGAGCCAGAGAAGCGATCAGGGATCCCGTCCCCCTTGCTGTGACTGCCATCACTGTTAACCTTCATCAGATACCGAGGGCCCTTCTGTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCCCACTGC
++
+GGEFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGEFCGGGGGGGGGGGGGGGGGFGGFGGGFGGGGCGGCGFDFFGEFEC<FCEFGGGGGFFGGFGGGFFGGGFEGGGGGDCGGGGGGGGFDGGG<C@FEFFGCFGFFEFCEEGGDFGFCFEGGDGFG?FFCGDCGGGGCCGFFGGGGCEGGGCCEGG3>DG*1*>FFFGFFFG:C<0AF*9@BC@>@CD5C57CCD575*9:?:?6<4@<:<F4
+@M01873:M01873:000000000-B9G3J:1:1112:28236:12457 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRA
+TGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCAGAGTAGAGAGTTCACCACACAGAGGTAGGTGGCTGAATCACTGAGCTTGGAGTCTCTGATGAGCAGGGAAATATACTGGCCGGCTCTATTGAGCTGTGCTGTAAACCTTCCATCTTCATTACCACTGGAGTATACGGACATCAGCAACTTAGGTTCTTTCCTGCAATCCTGTCTGTACCAGAAGAAAGACTGAGAAGCACTGTTGCTGTAAGTACAGT
++
+GGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGG9FFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGGGGEEGGGGGGGGGGGEGGGGGGGFFGGDGGGGGGGGGGGC;DFGGGGGGGFGGFCE6CEGGGGGGFFDFCGFEGGGGGE>FGFFGGG7CFGGGGF8CCFGGF6?6DGFFGGGGGFGFC46AF=<FGF?=+9CFFFF:
+@M01873:M01873:000000000-B9G3J:1:2110:13535:17883 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGCTTGATCTCCACCTTGGTCCCCCCGCCGAAAGTACACCAGTCGCTACGTTGCTGACAGAAATAAACTGCAAAATCTTCAGGCTCTAGGCTGTCGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGACGCCAGTGGCCCTGTTGGACGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGGCTAAGTAGGTACCAACATCCTGGCTGGCCCTGCAGGAGAGGGTGGCCCTTTCCCCTGG
++
+GGGGGGGGCGGGGGGGGGGGE;EFGGGGGGGGGDGGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGFGFGGGCCGGFCGGGGGGGGGGGGFGGGGGGGGGGEGGGGGFGGDGGGGGGGGGGGGGFGGGGGGCGGGFGGGFGFFGGGGG8FGG@CFFCCF7:DAFFGGE@EGGGGGFFF@CC:?DB7A8@FG,=EGGGGG>CFGGFFGGCGG78C?CFCF>FFFGGGC?9CCF>7DEC*9C+<**:55=FGG41*37*/*18:DDDG*59?FFGFFFF9
+@M01873:M01873:000000000-B9G3J:1:1119:21261:11479 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+AGTGACAGTGGGGTTGGCCTTGGGCTGACTTAGGACGGTGACCCTGGTCCCAGTTCCGAAGACCACAGTGCTGCTGTCCCACACCTGACAGGAATAGTCAGCCTCATCCCCGGCTTGGGCTCTGCTGATAATCAGGGTGGCCGTGTTCCCCGAGTTGGAGCCAGAGAATCGGTCAGGGATCCCAGAGGGCCGGTGGATATCCCTATAGATGATCAGCACAGGGGCCTGGCCTGGCTTCTGCTGGAACCAGTACACACTTTTACTTCCAATGTTGTTTCCCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFEGGGGGGGGFEGFFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGDGGGGCEGFGGGGGGGFCFFECDE5=C4FFGGGG>;FDFGGFCFFGFFGGFFGGGGFGFFFGFFC@57)6FAFF:A<FG
+@M01873:M01873:000000000-B9G3J:1:2108:14465:19705 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGGCCCCTAATGAGCTGGCGCAGAAATATACAGATGTCTGGGAGGAGGCAGCAGACTCCAGAGTGAGGGGGAGGTCCTCTGTGTTTGATCTAGAGACACTGTAGCCATCTGAGACTTCTCCTTTGTTAGTGTCTTGAACACCATATGAGTAATGGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATTGTTGTGGTTCCAAGTCTGGTGAC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFGGFGGGGGGGGGGGGGGGGGFGGGEGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGFGGGGGGG,DGGGGGGFGGGGGGGGGGFGGGCFGGGFGGGDFGGGGGGGGGGGFGFFFGGGGGGE*@*?CGDGGCDBAF7FGE=*7=49<<EG47CFGGG70>EECCFCFFFFFFBFF###
+@M01873:M01873:000000000-B9G3J:1:2112:20595:25092 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+AGTGGGGTTGGCCTTGGGCTGACCTAGGACGGTGACCGTGGTCCCAGTTCCGAAGACCCAATAATCACTGGCACTATCCCACACCTGACAGTAATAGTCGGCCTCATCCCCGGCTTCGACCCCGCTGATGGTCAGGGTGGCCGTGTTCCCAGAGTTGGAGCCAGAGAAGCGCTCAGGGATCACTGAGGGCCGGTCTCTATCATAATACATGACCAAAACAGGGGCCGGGCCTGGCGTCTGTTTGTACCAGTGGCCACCCTTTATTCCAATGTTGGCTGCGC
++
+GGGFGGGEGGGGGGGGGGGGGGFGGGGGGGGGGGFE6FFFGGEGGEFFGGGGGGGGGFF,:::BEFCFGGG=FCECFF8FGGGGGGGCGAF?AAGGFFGGGDCEADGGFG7FF7@FFFCE7FCG>:F@FF9FC;,FFGDE>FFFGF:3@<FDA7=FFGCFGDC,2*42?,4=C<CGEF:*;+?+??8C***:5/**+3<++:9?<3<7?EFG*3<E*8*2;5AEEE#######################################################
+@M01873:M01873:000000000-B9G3J:1:2111:3554:13238 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTGGAGCTTGGTCCCCTGGCCAGAAGTGTAAGGACAGGGTGTAGTTTGCATGCAGTAATAAATGCCAACATCCTCAGCCCCCACCCTACTGATTTTCAGTGTGAAATCCGTGCCTGTACCACTGCCGCTGAATCTGTCTGGGACCCCAGAGACCAGGTTAGAAACTTTATATATTAGGCGCGTTGGAGATTGGCATGGCCTCTTCTGAAACCAGATCAAGTAGATGTTGACATCACTGTATATGAGGCTTAGAATCGTACTGCGGGAGGT
++
+EFE@@9CBFGFF,,;C;,6<FFF<6,CFC,,;DEFG9C@CEF<,<6F,86B@FF<E9C9EFCE9E,,C<EEFFFE,6,,9CFFFFFGD,FFGC@FFE8DFFAFC9EFGF?FGGGAF,,,7B=C+:E55?:,:<=,?FDDCEF9FAB5C,,AFFG>++6BFA,3=,3>,373>EF,,3,=DF;CFA,,,,@++5>EEFG##################################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10006:14034 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+CTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATTGCTACACAGTGCATCATGAGTGTCCCCGTATCGAACAAAGCCATAGAAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAATAAGCGAAAGACTGCACGCACTGCACTCGAACAACCAGACATTGATCAAAACAGACACAATAAGGTTAATCATTCTCAATCTAAGCGAACATTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGG7;DGGGGGGG:CEGGGFFGGFFG6BCCB>BEGG#################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1106:23126:20933 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+AGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAACTTGGTCCCTCCGCCGAAGACCGAACCACTCAGCCTAAAGTCGTAAGACTGGCAGTAATATAGAGCCTCATCGTCAGGCTGGAGTCCAGTGATGGCCAGGGAGGCTGAGGTGCCAGATTTGGAGGCAGAGAATCGGTCAGGAACTCCTGAGGGCCGATCGTCCTTAGTATGGATGAGGACGTTGGGGGCTGTTCCTGGAACGTGTTGGTACCAGACAATTTCATAACCTGCCCCGATGT
++
+FCFGC<F@6F+++6C:F7CCEGGGGCFG,696:66,+@@FGC<EF<FC<F@6E@::F=+++444+++++9BFD<FEGG8<CAEFFF=8FG@BFCFGG<<@DA9AFFB,=DFGA<=D=D+C<,@CD73,3,DFCGFFC,3,D:<*3:CFF@7DF:2:3@,2@92,,6***6:*,>BF7FC*BFC+CC++5<@;*=:*1CG8*1****<9+2A+:C?++++2C**2*2:5:*/:CFC*2:*<)3)/19C4))9*/:EFC*:D=C>C@?C7/CGF4:FBF0DD:
+@M01873:M01873:000000000-B9G3J:1:1111:16537:24486 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGCGAGCGGGGGATTGTAAGTCTGGTGACAGAAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAATCTGTCCCAGATCCACTCCCACTGAACCTTGACGGGACGCCACTGTGCAAACTGGATGCAGCATAGATCAGGAGCTTAGGGGATTTCCCTGGCTTCAGCTGATACCAATTTACAGAGCTGATACAGCTCTGGTTTGCCCGGCAAGCGATGGACAATATGGCTAC
++
+EEFEGGGGFDGGGGGGFGFFGGGGGGGGFGGGG7CFFGGG:FFCGGFEFGFEEFGGGGGGG9FCFGGGGF<FGDFCGGGGG<AEEFGGGGGGGGEG?EEGGFFGFFCFG<FEFFGFG9FFEAFFFGGGGGFDFGG8DFBFF,3+@CFFGFGGGC<*11:>>FGF,?,>DCF,?<BFFGFFFE,,?,?,<?*=>=:E@G**=9+40=C85@FGG?1>C67C?+>CEC7ED7CFG60*12/**29C4CF)*27>FD*1<CD>>GFB################
+@M01873:M01873:000000000-B9G3J:1:1101:10014:22200 1:Y:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHG
+GGCCCTTGGTGGAAGCGAGGTGGGGGTCTCAGCCCTTCCTGTTGTGGCGAGGTACATGTGGGCAGCCTTGCCCACGCTGTCAGCTGCCATTTGTCTTCCTAGGAAATCACAGCTCGGCCCCCAGGTCCCCAGGGTTGTGAACTCCACGCTGCAAACACTAAGAACAGGATTGAAACTCCCCGTATCGGCTTCCAGTAGGAACAGATCGGAAGAGCACACGTCGGAACTCTAGTAACCTATACACCTAGTATGCCGACTTCTGGCTGATAAAAAAAAAATGAA
++
+@<C<@F?@ECDEG,CCFFEEGFG>FFFCECFFGF:FGGCC?<FFF7,C7+@:CDGEFFCFFCFFFGGFF=DAEDFGC7:CF<EG?EE,:<9,B<<F9,F<FFD=A=F9DEF,3,DFCGCFDBFFGF<<DEFC@>F<FF7,@:F9F,<F7*C*D:FFFGGGDCGFFCEC7E,BC9;BC++33=8*3*/==*/8>CFGG++++;AFG7+A##########################################################################
+@M01873:M01873:000000000-B9G3J:1:1109:19388:16328 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAACCATTCAGGCTGTCATCCCATGTAGCACAGTAATAATCAGCCTCATCCTCAGACTGGAGCCCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCTGAGGGCCGCTGAGTATTGCTATGGATGAGGAGCTTGGGGGCCGTTCCGGGGAGTTGCTGGTACCAGTTTACATTATTACTTCCGATGTTGGAGCTGC
++
+GGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGFGGFFGGFGGGGGGGGGGDGGFGFGGGGFGFGCGGGGGFGFFFGGCFFGCECFBGGG78E*CFGGGDEGG*8/;<CG7CEFFGFGGGFGGGCEG6+;CGDDC*::CFCEGGGGG:<D>6:EC=<7*7C7*7?:*::76CFGF6?G#############
+@M01873:M01873:000000000-B9G3J:1:1101:10019:8146 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCATTGTCCCTTGGCCCCACATATCAAAAGCATGCCAGCCACTGCTATATTCTCGAGAACAGTAATACACAGCCGTGTCGTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCTTCACTGAGTCTGCATAGTATATGTAACTTCTACTAGCATCAATGGATGAGACCCACTCCAGCCCCTTCCCTGGAGCCTGGCGGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGDGGEGEFGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFFGEGGGGDEGGGGGGGGGGGGGGGGGGEEFGGGFGGDGGGGGGGGGGDFFGGGGG;;FCFFAFDFFGCGGFGGGGGGGGGGGGF;DCD66DFGGFCGGFGGGGD5F:CFGC7CCGF?=CFF7C9FGFGF+AF7E+<CFC:@*:>DFG@:*=FG;<@?3C>B>?FG4497>FG:?F*)07?@??:FF###
+@M01873:M01873:000000000-B9G3J:1:2101:11039:4739 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTCCACCCTGGTCCCTCCGCCGAAAGTGAGAGGCCACTCGCTACGGTGCTGACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATGCCAGTGGCCCTATTGGATGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGCCTAAGTAGCTGCTAATACTCTGACTGGCCCTGCAGGCGAGGGTGACTCTTTCCCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGDGGGAFFGGGGGGGGGGDFGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGEGGGGGCGGGGGCFGGGG9EGGGGGGGGGGGGFCECFF5>EGGGGGGGG?8FCCCFGFGGG9BFGFGCC;FFGGFGGGGGGGG>74CCGG=C<*2@=FDCFGGCCCCCGC5/:CGGFGFFFFGF?FB4<
+@M01873:M01873:000000000-B9G3J:1:2104:24954:20771 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAATGCCAGTGCCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGCGCTCAGCCCCAGAGCTGGAGCCTGAGAAGCGATCAGGGATCCCGTCCCCCTTGATGTGGCTGCCATCACTCTTAACCGTCATCAAGTAGCGAGGGCCCTTCTCTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCTCACT
++
+GGGGDGGGGGGGGGGFGDGGGGGGG,FCGGGGGGGGGGGFGFGFGDGGGGGGGGGGGGGDG8FGGGGGGGEFCGGGGGGGFDGGFFGGGG99=FGCFGGGGFF9=FGGGGCFGGGGGG<FCFEFCFCFCEFGGC*F7<FFGGGGGG>FCFGGGFGFGGGCFFC<1F@FG,CGGGGFGFGGGCEGG6CFCG+C=FECFCF?FG7@+2<CFGC:E5*<EEGGGCFC7CEGEGEGC*A>DD6>FDEGGFGC7>C*2<>F65?D3*85::>>C=+/6FGA47<@#
+@M01873:M01873:000000000-B9G3J:1:1111:12286:7157 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRA
+TGGATATAGGACTTGACTCTCAGAATGGTTCCTGCGCCAAAGACCAGTTTGTTTCCATGCCCATCGGGGCTTGCTGCACAGAAGTAGACAGCCGAGTCTTCAGGTTGGGTCTCTGTGATGTGCAGGGAGAAATGTTTGGCTGTCTTGTTCAATGTAACAGCAATTCGTTGGTCTTTCTTTTCGCCCACATTTGAACGAATGTCTATAATAAGCTGAGGTCTTTTTCCAAGTTCTTGCTTATACCAAGGGAAGTAGTTTGAGGCACTGTCTGAATAAGTACA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGFGGGGGGGGGGGGEGGGGGEF7DGGGGGGGGGF@?F:FCFGGGDFGGGGGGFGCFCFGGGFFFGFGFGFGGGFGF:FFEFGGGGGFC3AC:FFFFFGBABB7>8A?##
+@M01873:M01873:000000000-B9G3J:1:2116:17140:9378 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCACTGTCCCTTGGCCCCAGACATCAAAAGCAGGAGTGCGACCTGCTATAAAAGCCTCCTTCGCACAGAAATATACAGCCGTGTCTTCAGGTCTCAGGCTGTTCATTTCCAGAAACAGTGTGTTCTTGGAATTGTCTCTGGAGAGGGTGAACCGGCCCTTCACGGAGTCTCCGAAGGATTTGTAACTTCCATCATAGAAGATAACTGACACCCAGTCCCGCCCCTTCCTTGGACCTG
++
+GGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCCGFGGGGFEEGECDAEEGGGGGGGFFFGGAFGDED>FGF@FFDGGGDGFGGGDFFFCDFGDBEAFF,@<BFFFFGGFGGGGFGGGGBECFAFGCA9D9:BCFCEG9,;D>DE8*=5;1:6C*C:CGEFDFF9CC:CEFCGFC*/=C+A:9+3200<CF9+:<*::*+20+6::7D7774C9:55<C+*)25<5FD###########
+@M01873:M01873:000000000-B9G3J:1:2106:21507:14943 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+AGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACTCCGAAAGTGTAGCTGCCTGCATATGAGAAGCAGTAATAATCAGCCTCATCTTCAGCCTGGAGCCCAGAGATGGTCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGATCAGGGACCCCTGAGGGCCGTTTACTGACATCATAAATCATGAGTGTGGGGACTTTGCCTGGGTGTTGTTGGTACCAGGAGACATAGTTATAATTACCAACAT
++
+G<FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFDGGGGGGGGGGGGGGGGFCGFGDGGGGGGGGGGGGGGGGGGGGG>2FBFGGGFECFG>BFG7EEGGGGGFDEGDBE=F7CEFFGGGFCGGGGGG777<EGFGGEGE8CFFFFGFG?F**;=CFGGDFEGFDF4*1;CC4+:CBD-<B+9?<+604;F#
+@M01873:M01873:000000000-B9G3J:1:1110:19157:20344 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCACAGTGTAGCTGCCTGCATATGAGCAGCAGTAATAATCAGCCTCATCCTCAGCCTGGAGCCCAGAGATGGTCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGATCCGGGACCCCTGAGGGCCGCTTACTGACATCATAAATCATGACTTTGGGGGCTTTGCCTGGGTACTGTTGGTACCAGGAGACATAGTTATAACCACCAACATCACTGCTGG
++
+GGGGGEGEGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGBFGGGGGGGGGGGGGGGGGGGGGGGFFGAEGGGFFFFGGGGEFGGGGGGGGGGGGGGGGFGGFFGGGGGGFFGCFGGGGGGGGG7FFFFGGGGGGGGGGFGFAFCFGGFGGDFGCC:CE8:@EEGGGGGGGFFGGGEECGGGGFFGGGGGGGCFGFCFC7FFGGFGEEEG5*7CCECGGGGFFF7FDDGGGGFFG3FDFGFFDD>7*:=>?DGDEFFGF:49?>F?FFF
+@M01873:M01873:000000000-B9G3J:1:2103:19958:12449 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGAAGCGCGCATACCTTGCATACAATAATAAACCCCAACATCCTCAGCCTCCACCCGGGTGATTTTCAGTGTGAAATCTGTCCCTGACCCGCTGCCACTGAACCTTTCTGGCACTCCGGAGACTCGGCTGGAAACGTCATAAATTAGGAGTTCTGGAGACTGGCCTGGCTTCTGCAGGAACCAAAATATGTAGGTCTTTCCATCACTATGTAGGAGGCTCTGGCTAGACTTGCAGGAGAT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGDFGGGGGGGGGFGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFFGGGGFGGGGGGDGEGGGGGGGGGGGGGFGGGGGGGGGGGGGGEGCFBCFFEDGGGGGGGE@BFGGEGGGGFGGGGGGGGGGFGFGFFGFGGGFGGGGGCEGGFF*A:@FF9CGGGGGDEFC73<?*<F>DGFGGG=FDCGDFGGGG:<9CG?FBC2@####
+@M01873:M01873:000000000-B9G3J:1:2101:22394:13872 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCCCCTGCCGGCATCATAAGACTGACAGTAGTAGTCAGCCTCGTCCTCAGTCTTCAGTCCAGAGATGGTGAGGGAGGCAGAGTTGGAGGAGCTGTCGATGGAGCCAGAGAACCGATCAGGGACCCCAGAGGGTCTTTCGTTATCCTCATAGATCACAGTGGTGGGGGCACTGCCCGGGCGCTGCTGGTACCACTGCACATAGTTGCTGGCAATGCTGCCACTGC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGFGFFGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFFEEGGGGGGGGGGGGGFFGECGFFGGFGGGGGGGGFGGGGGGGGGGFE+*8EEGGGEFGGGGGGGGGGGG<6FGGFGGFFFCFGGF7>>DFGGGGFGG4D@4*=4;??FGC
+@M01873:M01873:000000000-B9G3J:1:2104:19897:23367 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAAAACCACAGAACCACTCAGGCTGCTGTCATAGGACTGGCAGTAATAATCAGCCTCATCCTCAGCCTGGAGGCCAGTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAAGCGGTCAGGGCGTCCTGAGGGCCGATTGTTGTTACCAAAGAGGAGGAGTTTGGGGGCTGTTCCTGGTAGCTGCTGGTACCAGTGAACATCATAACCTGCCCCGAGGTTGG
++
+GGDGDGGGGGGGFGGGGG<FGDFGCGGCGGGGGGGGGGG?CGGGGGGGGGGGGGGGGGCG<FFFFG<44AB=CGGGDGC,ED<9B,,EC,EFGGGGCFF9,C??FFGGFGGG@CCDFEFE7BF7:D>>CCBFF<CFB7CFFEGCCFEG><:>:3F7@C97DFCEB32F,,?CC<E:8B:B,*3=7C*;<**B:7:CE7*00@FFGGGG?86<*;FC5*/0*<@CC885:?8C7+002+000<F?FFGFD7+**+9CFC@>*:C##################
+@M01873:M01873:000000000-B9G3J:1:2118:6488:16393 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHG
+GGCTGGTCGGGGATGGTGAGGAGACGGTGACCAGGGTTCCCGGGCTCCAGGGGTCGAACCAGTTGTACTGAAAGTTCCACTCATACTTCTCGACATGTCTCGCACAGTAATAAATAGCCGTGTCTGCGGCGGTCACAGAGTTCAACTTCAGGGAGAATTGGTTCTTGGACGTGTCTACGAATATGGTGACTCGACTCTTGAGAGACGGGTTGTAGTGGGTGTTTCCATTGTAAAAGATACTCCCAATCCACTCCAGGTCCTTCCCTGTGGGGCGTCGGCTCC
++
+GGGEGGGFCGEEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGEFGGGGGGGGGGGGGGGGFGGGGGCFGGGGGGFGGGGGGGGGGFFGGD<FCGGDCEFEGGCFGGGGGGEGGFGGFFDGFFFGCF9FFACFGDGCFGG<<FCFGGFFGDGGGGFGGGFGFGEGF?F+1?EGGGGGF7EE/+A6AEDCE58:<++;8:=E/AFG<9AGF<C7++::CEGFGF6:C5EFG?7**35CC#######################
+@M01873:M01873:000000000-B9G3J:1:1117:6029:5428 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTAACACGGCCCCCGGGTCCAGTACTGGCACAGAGATAGAAAGCTGTCGGGTTCTTTTGGGCCGATGTCACAGTGAGAGGAAAGGATTCCTTCTTCTCCCGAGAGACGCTGTACCCTTCAGCTATATCTCCTTTCTTAAAGTCATTTACTATCTGTGAGTAGTAGAACAATCTCATCCCTTGCCCTGGGTCCTGTCGGTACCAGTACATGGCCTCGTGGTTCAAAT
++
+GGGGGGGGGGGGGGGGGGGFECGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFGGGGCFGGGEGCGGGGCFDGGGFGGGGF?FG<FF=EE@FFGGGGGGGGFCF:C<?BF9@FG+><FFEF>FFFGGCFFG9FFGGFFGFGCE9FGGGGFGGGGG7*>CE>FG@FECGGGGGGGGGFFG?CDGCGCFBF?9,5=2++5+1>EFFFF71<>=77@1AFFG<7+028C8CFG+;:9<C77<*<**1:)9@*007)75D777:>>7D4446)7:F#########
+@M01873:M01873:000000000-B9G3J:1:2106:6159:11549 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CAAGGGGGTGGCCTTGAGCGGACCTGCCCCACAGGCTCCGCAGGCTGGATCGGCTGCTTCCAACTGAGGCTCCAGGGTCTGGGTCCCCGCTTTGCGGTGCAACCATTGGGCGCAGCAGGCCATGGGCGACCATGGCCAGACCCAGCAGCAGCAGGGGCCAGCGCTGCCTGGGACCAGCAGGGCTGTTACAGTACACCCCAGTCCATTGGCTCTGTCCTCTCCCTGGACTGGCTCTGGTCCCTGTCCCTAGCCCAGGCCCTTCCAGGGTCCATGTCTGTCCC
++
+GGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGFGGGGEGGGGGGGGGCFFFGGCGGGGCFGGGGFGGGGGGGGGGGGFGGGGGGGGGGGDFGC:CEFGGGGGGGGGGGGDEDGGCEGGGDFFGGEGGGGGGGGGGGGFGGGGGGFGGFGG7CFGGGCGG@FFGGGGGGGGEGFGG>C5;EGGGFGGGGGGGGFEGDCFF6+0ACFEEFFFCDGGGGGGF@6@ECFGCC:?FGCCFFGF+2<?C7998C?**1:<GGF<?7@488F>CFC########
+@M01873:M01873:000000000-B9G3J:1:2103:16719:17340 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGCCTCCCCCAGGGCTGCTGGCGCAGAAATACACAGATGTCTGGGAGCGGGTAGCTGACTCCAGAGTGAGGGGGAAATTCTCTGTCTTGGATCTGGAGACAACATAGCCATCGGGGACTTCTCCTTTATCTGTAATATCAGCAGCTGCTGAGTAATAGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATAGCTGTGGCTCCAAGTCTGGT
++
+GFGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGCFEFFGDCFGGFGAFFGGGGGGFDGFGGGGGGGFGGGGGGCGFGGGGGGGGEGGGGGGFGCGGF6CGGGGCFGGGGFGGGGDGGGGGG5CG6+<EECCDFGGDF<9D***98CGG;DGF7?7:ECFF+85C7B4?#######
+@M01873:M01873:000000000-B9G3J:1:1108:22114:18127 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCCGAAGAGACGCTGACCAGGGTTCCCTGGCCCCAGCGGAGAGCCCCCTGAAGCATAGCCCCTTTGACACAATAATATAGGGCCGTGTCCTCAGATGTCAGGCTTGACATCTCCATGTAGACTGTGCTCGTTGACGTGTCCCTGGTCAGGGTGACTCTGCCCTGAAACTTCTGTGCGTAGTTTGCGCCACCACTGGTCGGGTTGATCATTCCCATCCACTCAAGCCCTTGCCCAGGGGCCTGTCGCACCCAAT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGFGGFGGGGGGGGGGGGGGGGGGGGGFFGGGGGGFGGGFGFF?FGGGGFGG9<DFFGGGGGGFGGGCFGFGCFGGGGFFGFGGF9FFCDGGGGGGGGGGGFCFGGFGDGGGGGGGGGGGGFFFFEGGGGGGG9FF8CFFGFFGGGFGGDGCE??E77:CACED5CCG*<CEGDGDECC?7C879=7C?767*85F>4C*7CFCFC<4C>DBDDC=:)88>B?F99
+@M01873:M01873:000000000-B9G3J:1:2114:13033:12027 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGGTTGATCTCCAACTTGGTCCCCTGGCCAAAAGTGTACGGAGGCCACTTATGATATTGCTGACAGTAATAAATTGCAAAATCTTCAGACTGCAGGCTGCTGATGGCGAGAGTGAACTCTGTCCCAGACCCACTGCCTCTGAACCTGGCTGGGATACCAGTGGCCCTGGTGGATGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGCTGGTACCAGACTACCTTGGTTCTAACAGTCTCACTGGCCCTGCAGGAGAGGGTGGCTCTGTC
++
+GGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGFCGCG>FAFFGFGFEGEGGFGGGGGG?FEFGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGGCFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF8FFCFCFGFG>FGGDFGGGFGGGGGGFFGG?EFGGGCFCGDGFDFFFCGGGGGGDGGGGCEGGGGGGGGGGGGGCGGGDDFGGGGGFGGFF7FFF*>FCFGCFDCGD5@7C>FF6>6>7
+@M01873:M01873:000000000-B9G3J:1:1101:10044:7123 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+AGTGACAGTGGGGTTGGCCTTGGGCTGACCTAAGACGGTGACCGTGGTCCCAGGTCCGAAGACATAGAGATTGCTGCTGCCTGAAAATGAGCTGCAATAGTAAGTAGCCTCATCCTCGGCCCGGAGCCCAGAGACGGTCAGGGAGGCCGTGTCGCCAGACTTGGAGGCAGAGAAGCGATCAGGGACCCCGGCGGGCCGCGCAGTGACGTGCTAAATGATGAGTTTGGGGGCTTTGCCTGGGTGTGGTTGATACCCAGAGACAGAGTTATAACCCCCAATGT
++
+FFFGGFF?GFGGGGGGGGGGGGGFFGEGGGGGGFGGGD:C,CFGGGEGGGFGFFGGDFFGGGGGGFDEEG9FFGGFCFFFFCDCFGGFG<,FFCF855E9,C9DFGE9EGGGAEFBFC>@CFC7FFGDEDGGFAFGG:+>FDFD+3>++@+@FFFGGCGFFCFC78BEE5*>2,8CBEG5*2,4BCE*:CE*=*::EED*:*8*<97:?3*22CE?CE:<+22<C?*C=GG)767*:*7>3C)C*.95BG###############################
+@M01873:M01873:000000000-B9G3J:1:1101:10044:7141 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+AGTGACAGTGGGGTTGGCCTTGGGCTGACCTAAGACGGTGACCGTGGTCCCAGGTCCGAAGACATAGAGATTGCTGCTGCCTGAAAATGAGCTGCAATAGTAAGTAGCCTCATCCTCGGCCCGGAGCCCAGAGACGGTCAGGGAGGCCGTGTCGCCAGACTTGGAGGCAGAGAAGCGATCAGGGACCCCGGAGGGCCGCTCAGTGACGTGATAAATGATGAGTTTGGGGGCTTTGCCTGGGTGTTGTTGATACCAAGAGACAGAGTTATAACCACCAATGT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGEGGGGGFDGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGDDFGGGGGGGEGGGGGGGGGGGGGGGGGGGGCDFFGGGGGF+AEGFGGFDGGGGDGF72:?F>F*719@G:FFFF???GGGGGFFFCFFFFFFFA4<6(04@F:
+@M01873:M01873:000000000-B9G3J:1:2107:25942:4834 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+AGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCACGGTGCTGCTTGTATATGAGCTGCAGTAATAATCAGCCTCGTCCTCAGCCTGGAGCCCAGAGATGGTCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGATTAGAAACCCCTGAGGGCCGCTTACTGACATCATAAATCATGAGTTTGGGGGCTTTGCCTGGGTGCTGTTGGTACCAGGAGCCATAGTTATAACCACCAACGTCACTGC
++
+GGGGFEFF7CFFGGG@FGGGGGFGGFGGGGFFFFEGDGGGCFFGGGCGGGGFGEGGGGGGGGGGFGGGGGGGGGGGFFGGGGGGGC?EFGGGGGGGGGGGGFFGGGGGGGGGFCGFDFGGGCGGGGGFFFDFFGFCEGGGEFEGEGFFFFCF:FCEFGCEFGFGGFCGGGGGGGGGG9EGG>*8<E8*=EE5B7=5:FFG?6CG7@C?:CFGFG:++<AC>CEGGGFCCFF?GGFFEDCCCG7:E:<7+0**1***097++3?>@C??57*7D3C1<>DF#
+@M01873:M01873:000000000-B9G3J:1:2116:7821:15323 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+AGTGGGGTTGGCCTTGGGCTGACCTAGGACGGTGACCTTGGTCCCAGTTCCGAAGACATAAGTGCTACTGCCTCCATACGAGCTGCAATAATAATCAGCCTCATCTTCAGCCTGGAGCCCAGAGACGGTCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGAGCAGGGACCCCGGAGGGCCGCTTACTGACCTGAAACATTATGAGTTTGGGGGCTTCGCCTGGGTGGTGTTGATACCAGGAGACATAATTATAACCACCAACGTCACTGCTGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGFGG,FFFEGGGGCFGGGGGGGGGGEE>EGDGGGGGGGGGFFGGGGGDFFCCFCGGGCF7:FCEGGGGCGGDEGGGGGGGGF<DG>GGGFFGDGGGGGGGGGGFCDFFFGGDFFC>FGF3<FFFGG
+@M01873:M01873:000000000-B9G3J:1:1101:10051:12996 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHG
+GGCCCTTGGTGGAGGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGCCCTGGCCAGCCAGTGATTTGGGGGGTGCACAGTAATACAGACCCGTGTCTTCGGCTCTCAGGCTGTTCATTTGCAGAGACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCCTCACAGAGTCCACATAATTTGTCTCACTTCCATCTTGCTTTATGTTGGCCACCCACTCCAGCCCCTTCCCTGGAGCCTGGCTGACCCAGCTCATCCAATAGTGAC
++
+GGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGEGGGGGGGGGGGGGGGGCGGGGGGGGGGGEFGGGGGGFFGGGGGGGGFFGGGFGGGGGGGGGGGGGGGGDGGGGGGGGGGCFCFF6+AEGCFGGG;8EF?FGDCF?@FGGGCG7CFGCFCE?:+<CFCF9@FGG7CFGGGG+:C?CDEF=GGD<*7D47FDFE3@5FF>4)5*8>;FFC*1>7?475>7F@############
+@M01873:M01873:000000000-B9G3J:1:1107:13066:21126 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+CTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATGTTGCCCCTGGCTGCTGGCACAGAAGTACACAGCTGAGTCCCTGGGTTCTGAGGGCTGGATCTTCAGAGTGGAGAATGATGCATTAGGCATCTTAGCTGAGAATCGATCCTCGGGCATCCCTGAATCATCTATCGGAACGTTGTTGTTAAAGTAAATGAGCAACTCCAGTCCCCGCATCATGGTCTGTCTGTACCAGAAAAGGTAGTCATGTCCTGAAATTG
++
+GGDGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGGGGGGGGFGGGGGFFGGGGGGGFGGGGDFCGFFGGGGGGGFGGGGGGGGGGFG>GFDEGDGGGGGGGGGGGGGGGGGCEDEGGGFGGGGG8EGGCF;CFGGGGFGGGGGFGG64<CFCEGGGGCGAGFGGG?FFDCCFDGDC67CF5=FFF4FFF@6684/49@FF
+@M01873:M01873:000000000-B9G3J:1:1117:12403:4599 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTCCCCTGCCACCTAGCACTGCAGATGTAGAAGCTGCTGTCTTCAGGATGGGCACTGGTCACTGTCAGAGTGGACAAGGTCAGGCTTGCATGGTTGATGAGAAACTTGTCCTTCTCGACGCCTTGCTCGTATGTGGCCTTGGAGCCCTCATTGGAAGTTGCCATCAGCATGAGACTCTGTTTCGGGAACTGACGATACCAAAACATAGTTGTGGCCTGAAAGT
++
+GFGGGGGGGGGGGGGGCCCEG8FGGGGGGDGGGGGGGG<@FGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGFFGGGGFGGGGGFFGEFEDFFFFFGGFFFGGGFFGDEGGGGGGGFCEGGGCFGGGGGFGGGGFFGGGGFFGGGFGGGGGFCFGFGGGGGGGGGFGGFFGGE>EEFEGFGFGEC@GGGGCFGFFG?9@5?CFCF@FGG78FFFGCCFGGCFG7CGGDFGFFGFFGFGGGDEF4A4*.5>CCF6?CGF@:66976BBD>7?F.82C:
+@M01873:M01873:000000000-B9G3J:1:1117:22437:4121 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTCACAGCCTGGAGGCCCAGGACAAAAACCGGTGCTGCCCGCTCTGCTGTCCCAGACTCAGCTCGGGTCCTTCCCACCGCTGAGAGCCCCATCGCTCTCCCAGCACCCAGAACCAGGAGTCCTCCGCCCAGACTCCCAGCAGCGCCTCTCAGCACAGCCCCTCTCAGAGTCACCCGTATTCTTGTCAATCAGTCTCAGATCGGAAGCGCATACCTCCGAA
++
+GFGGGGGGGGGGGGGCF7BFG@FGFGGGGGDGGGGGGGGGGG@FGGGGGGGG7,BFGGGGGFFFFG@FGGGGGFGGG78,9F=FF@FGFEG++@=>EFGFCFGGGG<EGG<CFCGGGD8FGCG?FEGEGGFC<B>DF@C+<BF7<=<C<FF*@B<CCCEGFD8,,6>BF*>:7C>,C5B>::EEFFECC5**=*+=CC*<:C==*/=878C+:+02*0:7C=:C72:30*00*:DD<.5C@FG77@D##################################
+@M01873:M01873:000000000-B9G3J:1:1114:14006:15367 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCCAGCACTGAGAGCCGGGTCCCGGCGCCGAAGTACTGAATGTTTTTGGCTCACAGCCCCGAGACGCGGCACAGAAACTGCCCCGTAGATCATTTCTGCAGTTAATAGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAACAAACAATACAAACACACATCACAACACGAGAATGACATCAGGCAAGAGATAAACACACCAGTCGAGCGATTCTGTGACCTCGAA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGFGFGGCGGGGGGGGGGGGGGGGGGGFGGGGGGGGGEGG######################################################################################
+@M01873:M01873:000000000-B9G3J:1:1109:25889:19697 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGTCGAAAAAGCGGAATCGCTCTCTCGCACAGTAATAGGTAGCCGTGTCCTCGGCTGTCAGGCTGCTCATGTCCAGATACAGTGTGTTCTTAGAATTGTCTCTGGAAATGGTGAATCGGCCCTTCAGGGAGTCCGCATAGATTTTATCATTCCCATCAAACCAAATATCTGCCACCCACTCCAGCCCCTTGCCTGGAGCCTGGCGGACCCAGTGCA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGFGGGGGGGGGGGGFGGGGFFGGGGGGGFGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGCFG?CC=FGFFFGGGGGGGG<FFGGGFFGFGGGFGGGGDFDGGGGGGGGGGGD656>EGEGGFGDFCFGEE9CCE7EEGGCFGGEFFGGGGCCFFF?FGGGGGF7?FGFFG*7CDB3A5??F@DFDC>FFG4CF>D5F5?FG?GBBE@>BF:?G:
+@M01873:M01873:000000000-B9G3J:1:1112:3818:19684 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGGGGTCGATCCTCGTATACCAGTCACTACTATACGCTCTCGCACACTAATAGACGGCCGTGTCCGCAGCGGTCACAGAGTTCAACCTCAGGAAAAACTGATTCTTCGACGTGTCTATTGATATGGAGACTCGATTCTTGAAGGAGGGGTTGTAATTGGTGGCCCCAGTGTGTTAGATATAGCCAATGGATTCCAGTCCCTTCCCGAGGGGCTGCCGGG
++
+GEC@CGGG9@ECEGGGDEGGGGDEGEGGDFFGCFGGGGGGEGGF8F@FDGGFGGFGF7,C,4C==:CFDCCC=CCFFFFFF<FFFEGFFFDGDGAGGGCCCFEC@:@F,B=FDGGFG:>F:>::,@>:E@E<B<<C<:FFGGGGGACFG@::,55,2>BFFFCCFDDCCFGG8:8CFF<+>EFCFE9E?998?E5=@BF+<9>9:+CCCC5CDCEFGGGGG:EDF0*15*29C?*7:7:6*7:C7:C4)6C*/>D777=6:67=?5F##############
+@M01873:M01873:000000000-B9G3J:1:1114:10168:21472 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACAGTGACCAGGGTGCCACGGCCCCAGAAATCGATGTAGTAACACCACTTCCCAGTACAAGAGGCTAGAGTACTTGCACAATAATAGACAGCCGTGTCCTCGGCTCTCAGACTGTCCATTTGCAAATACAGCGTGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCACTTCACGGAGTCCGCGTAGTTTGTGGTACTCCCATCACTATTAAGACGTGAGATCCACACCAGCTCCTTCTCTG
++
+GGGGGGGGGGGGGGGGDGEGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGFFFFGFGDGFBFGGFEFFBFFGGGDEFFGGGDFGGGGFGEFFGG<ECC?=FFGGGFF9EGDE=EFGFAFFFGGGGFGDE@<DGFE>F@FEGGGGGG7D>FGAFFGAFGFEBF9FECCBEE@FBBDGCC18BCGG,1;6?EC?CFFGGFCCF*?/:@FF7=ECEGGCCCGDCC5*:+97><E**:6*/9BFG=*<*/1:6:@@FD*.9:6=FG4<7C45:9?F9@####
+@M01873:M01873:000000000-B9G3J:1:1114:16929:21025 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGATTAGGGTTCCCTGGCCCCAGGAGTCAAATCTAAACGTACCAGCTGCTCCTGTACCCGCCCTTCTCGCACAGTAATACACGGCCGTGTCCTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTTATGGAGGTGTTCCTGGTCATGGTGACTCTGCCCTGGAACTTCTGTGCATAGCCTGTGTTGCCACTGTTAGGGTACATCCATCCCATCCACTCAAGCCCTTGTCCAGTGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFEGGFGBFGGFGGFFFGGGGGGGGGGGCGCDE=FFGG9FFCFGFFGGFFGGEFEG8FF,<A@FGGGGGEGGGGGGGGG7D5ADGFEGGECEGGGDGGGGGGFCG<<FGGGGGFG@EFGGGG7FGDEGGCFFFGGGGG9BFDGGECFGGGF,=C<CFGGGGGG?9FCCF+;8F*<*0?CC?CFC?DG++;+;:;EGCCF+:*>FDDFFFGGF67@7CFFFFFC>@FC)*0CF463>?.<942*4:<?
+@M01873:M01873:000000000-B9G3J:1:1101:10064:16602 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCTCCAGGCACTGTCCTCAGGATGTTTTTCCCCGTAGATCACTTGCACGACCAGAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAACAGAGAAATAGACAAGTCAGCACAACACACGCGCAAGTAGACACAAACTACGTAGCGAGCATAGGACTCATTGAACTGGATGCTAACAATTAAACGGAGGGAAGCGAGAAGGGAGAGAAGAGACATAACAAT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEFGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGG###########################################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1106:24704:16447 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCCAGTACGGTCAGCCTAGAGCCTTCTCCAAAAAACAGCTCCCCGGTGTTCTCTATCCCCGGGAAGCTGCTGGCGCAAAGATAAAGGGCCGAGTCCCCCAGCTCCAAGGTGCTCACATTCATCTCAGAGCGAGAGTTAGAGAACTGGCGCCCTGAGAATCGACCAGGGAAGTTTCCTTTGTTTCTCTGTGTCTCACTGAAGTATTCAAAGAGGAACTGAAGGCCCTGTCCTGGGGTCTGTTGGTACCCGGATACACTCCTATTCCCAG
++
+GEFGGG?DFGGGGGGGGGGGGEGGGGGGGGGGGGCFGGGGFGGGGGGGGGGGGGGGDGGEFGGGGGGFGGGGGEGGFFDGGGGGGGGGGEGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGFFCFGGGGGGGGGGGGGGGGGGGGGGGGGD9FGFGGGGGFCGDGEGFGCFEECFEGG>CE>C884BFFGGFGGGGGGGGGGGGC?FGGFGCF7E+3@GGGFGDGC**;CG69:<CC*9FFFGFG7*5CEFG:FG?ECGGC/CDC>5CFF**0=?F######
+@M01873:M01873:000000000-B9G3J:1:1101:10065:3493 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+CTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATTGCTCCCCCCTCCTGGTCTGCTGGCACAGAGATACACGGCCGAGTCCTCCTGCTGTGTGCGCTGGATCGTCAGAGTGGAGACGGATCCCCCAGTCCTCTCTGCAGAGAAGCGATCACTGGGCAGCCCTGATTTGTCTGGTGCACTGTTGCCTTGGAAGTAAATTAAAAACTCCAGGCCCTGCCCCAGGCTCTGTCGGTACCAGTAAAGGGCAGCTTGACCTG
++
+GGGGGGGGGGGGGGGGGGGGGGG8FGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGCGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGFGGGGGGGGGGGGGGGGG8FDFFCGGEGGGGFFGGGGGFGGGGGGG@FFFGGGGGGC8DFGGGGE8BFGGDF>FG5CEEGGGGGCE@FGF76>6;?FF?EFFGFGF6+=<97++=C@C+9EG*>67DGGFFF@GFC35<35<C?B/8C<CDD49=D*=?67B>B#########
+@M01873:M01873:000000000-B9G3J:1:2111:9741:23838 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCTGTGACCGTGAGCCTGGTGCCCGGCCCGAAGTACTGCTCGTAGGTGAGGAGCCTGTCCCCCCTGCTGGCACAGAAGTACATGGCTGAGTCCTCCAGCTTTGTGGACCGGATCTTCAGAGTGAAATTTGATCCATCAGGCCTTTCAACTGAGAATTGATCATCGAATATTTCAGACTTCTCTGAGATTTCATTATTATAAAAGAAAACCAGAAACTCGACTTTATGCCCCAAGATTTGTCTGTACACATAGAAGTATAAGTGATTTG
++
+GGGGC9<9EF@FGGGGGGGFCGGGGGGGFGGGFGFEEG:CCG@FGGGGF,C9FFFFGGDFCDFFEGGDFGAFGGGCCFCF8FCCFGDFBD,<CEGDE@FF7FEFGGGEEEFDFGGGGFGGFGDGFFFFGDGGGF=D3@=CFGFF99FDGDFGFFGGFG9AFFF?FDF=D>F;EGFGFGGGGCFGFGGGFCC9DF?C,;C>9B=@C,1?C,1?8;BF7*,04,*=*3*<AE?*/*=D7+4++22=57CGFEGDCC?##########################
+@M01873:M01873:000000000-B9G3J:1:1101:10067:5517 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATGTCCAGCTTGGTCCCCTGGCAAAAAGTCCCAGGCCAGCGTGTAACTTGCATGCAGTAATAAACCCAAACATCCTCCGCCTCCACCCTGCTGATTATCAGTGTGAACTCAGTGCCTGACCCACTGCCGCTGAATCTGACTGGGACCCCAGAGTCCCGATAAGACACCTAATAAATTAGGCGCCTTGGAGATTGGCCTGGCCTCTGGTTAATCCTACTCAAGTAAGTGTCGCCCTCACAGTCTTCGCGCGTTTGACTAGACCTGCAGGAGAT
++
+DFGGFE9FDF,CFFDGG8FF;ECF;CAFD@<EEFC@@FFGEFCFGGG?FGFCF9<FDFGGDFGGFEAF9ECE,9B,6EC<,C,,<,@C6??CFC8=C,<BE,,:,5EFGGE,?E9F,5,:<,,5E,A<FDCCDCFE++++8AAE,@,9,C:8DD76FE+=:6,F8+8@+@BG,3@886,73@D>;,@DC*C*@@?F5<7,,,9,5=EGG#######################################################################
+@M01873:M01873:000000000-B9G3J:1:1114:20934:3692 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTCAACCTTGGTCCCGCCGCCGAAAGGCCCAGGTGAGGTATCATATTGGTGACAGTAATACATTACAAAATCGTCAGGCTCCAGGCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGTCGGGGATGCCAGCGGCCCTATTGGATGCACCATAGATGAGGAGCCTGGGAGGCTGGCCAGGTTTCTGCTGAAACCAGACTAAGGAGGTACTGCTGACACTCTGACTGGCCCTGCAGGAGAGGGTGGCTCTGTC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGDGGGGGGFDGGGGGGGGGGGGGGGGGGGGGGGGFCGFGGGGGFGGGGGG?FGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG:@,;?FC?EF;?FFGGGGGGGFG=CDCCGGGGGFDFCGFF+@CFCFGGGGF8CFGCC*6CD5*=CCCFGGFFC674CFFFFF*93<CFF@#################
+@M01873:M01873:000000000-B9G3J:1:2107:3490:8582 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAAAACGACAAGATCAGTACTATGATCCCACACCTGACAGTAATAGTCGGCCGCATCCCCGGCTTCGACCCCGTTGATGGTCAGGGTGGCCGTGTCCCCAGAGTTGGAGCCAGAGAATCGCTCAGGGATCCCTGAGGGCCGGTCCCTATCATAAAACATGACCAGCATAGGGGCCTGGCCTGGCCTCTGGCGGTACCAGTGCACAATTGTGCTCCACATGTCGGCTGCCC
++
+GGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGFGFGGGGGGGGGGGGGGGGGGGGGGGEFGGCDEFGGGGGGGFGEGAFFGGGGGGGGEFFEGFAA=BFGGGGGGGDGGGGGGGGGGGGGGGF@DGGFFGGGGGFGFGGGGGGGGGDGG:FFGGFGCFFGGGFGGGGFCFFGGGGGGGFGGGGGGGCGG5?EEFFG+AFGG7C@FGDFD6CCF>*<:FFGD5EGCDDGG8:F4AFFFGGCE?9ADCC:+<EEC6?79CCDGGG+)<?GFGFGBFB79C
+@M01873:M01873:000000000-B9G3J:1:2115:10908:20804 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTCCAGCTTGGTCCCCGGGCCAAAAGTGTATAGCCAGAAACCATTATACTGTAGGCAGTAATAAGTTGCAAAATCATCAGGCTGCAGGCTGCTGATGGTAAGAGTGAATTCTGTCCCAGATCCACTGCCGCCGAACCTTGATGGGACCCCACTTTCTAAACTAGATGCCTTACTGATCAGGAGCTTAGGGGCTTTCCCTGGTTTCTGCTGATACCAGGCCAATAAGTAACCAATACTCTCACTTGCCCGGCAAGTGATGGTTACTCTGTC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGDGGGFGGFGG?DGBFGGGGGGFGFGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGG=FGGGGGGGGGGGGGGGGGFGGGGC8DFGGGFFCGGGCF,DFGG?FFGFCGGF7,,5=FCDEGFFFGAFFGGG=<<?46D4@FFGG7CGGGC5DDGGFFFF=637-7>C:FF#
+@M01873:M01873:000000000-B9G3J:1:2110:7628:11014 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTACTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAGAATTCTTTGACGTTATCCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGCAAAAAAAAAACAATAGAAGTGAGCCGTGATGAGTACAATGCACTGTT
++
+9CFFCGGFGFGFGGGGGGGGGGFFFCAFGGFFFGGGGGGCEEFGGGGGGGGE@GGEGGGGGEFGF@AFGGFCFGGGGCFFGFGFGGGGGGGEFFGGGDGGGGG7F,,E,BF<EFGGGGGG9EGGGGGCCGGGGGGGGE7FGEF8<FGECGGGGFGGFFGGGGGGGGA>DCFCFCF+@@EFFGGGGGGFGGGFGGF>DGGGG?FFFG7@:@28CFFGFDGCC:8=59<C?FGG*21:*31)9CC#####################################
+@M01873:M01873:000000000-B9G3J:1:2105:10953:6580 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHD
+AATGGTATACTAAATCACATGGTTTGCTTGTTCAGCAAGCTTTACCAAAAGCTAAACTTAAAGAAATTGTGGCAGAATCTGACGTTATGCTCAAAGAAGGATATGAGAATTTCTTTGATAAGCTCCAACAACATAGCATCCCCGTAGATCCCCATTGTCACACAGCTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCCATCTCGTATGCCGTCTTCTGCCTGACAAAAAAAAAATAATTTTCAGGAACAGAAGACAACAAAACATAATT
++
+<,CFE-;CEFGA<CF<FGAE<FCFE@,EFEEFGCFAF86C@FFECCFF@CFCE@FFGGDEGCF9C<EF<FCDGF@D@FF<E9CF6@FGGGGFG9F,E=<=9E?EBAFE?FGG9E?@<FEFFAFGF@E<<=,BAFFGGGGG<,?=CFGGG,:EFFG:D@ABFEDEF8FGGGGG7+3@>,AB=F@EG8D8+,@DFG,,<ECFA<EFF,,7@,,@7@:DE,@CE8D8,D?###################################################
+@M01873:M01873:000000000-B9G3J:1:2103:6418:17742 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTCACAGCCTGGAGGCCCAGGACAAAAACCGGTGCTGCCCGCTCTGCTGTCCCAGACTCAGCTCGGGTCCTTCCCACCGCTGAGAGCCCCATCGCTCTCCCAGCACCCAGAACCAGGAGTCCTCCGCCCAGACGCCCAGCAGCGCCTCTCAGCCCCCGTATGCTCGAATACATAAAGTAGATCGGAAGAGCACACGTCTGAACCCGTATGAGCCAAGACA
++
+GECGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGFGGFGGGGGGGG>FGFGGGGGGGGGGGGGFCGCGGGGGGGGGFDFFGGGGGGGGGGD@CFGFEGGGGGGGGDCGGEGDGCEEG8CF6=F88CEE?FFCGGGEECC:@C+9<8E8<@C+<?CC*3*2+@7C<E5<FFC7FCGGGFGGG+C<C8.9C**19A?#####
+@M01873:M01873:000000000-B9G3J:1:1110:22639:11539 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACACCGGAGGCCCTTCGCTACGCTGCTGACAGTAATAAACTGCAAAATCTTCTGGCTCTAGGTTGGTGATGGTGAGAGTGAAGTCTTTCCCAGACCAACTGCCACTGAACCTGGCTGGGATGTCAGTGGCCCTGTTGGTTGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTCTCTGTTGATACCAGGCTAAGTAGCTACTAATACTCTGACTGGCCCTGCAGGAGAGGGTGGCTCT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFDGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGEFGGG<CGGGG=FGGGGGGGGD7CGFGGGGGGGGGDFGFFGGGGGCGFGGFGG4CFGGGG4DFD><FF?F3D<6>3<0B?FF@
+@M01873:M01873:000000000-B9G3J:1:1113:10584:15580 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGTCAATCCCTTCCCCGAACCACGCCCCTCCCTCGTCTCTCGCACAATAATAGACGGCCGTGTCGTCAGATTTTAGGCTGGTCAGCTCCATGTAGCCCGTCCTCGTGGATCTGTCCGCGGTAATCGTGAGTCTGCCCTGAAACTTCTCTGCGTCGTTTGTTCTATCAAGGGAAGTGACGACCCTTCCCATCCACTCAAGCCCGTGTCCCGGGGACT
++
+9FGDGGGG9FGGGGGDFG>EGGGGGEGGGGGGGFGGGGGGGE7<FFGGDGGGGGGGGGFGGFGGCGFGGGGGFAEGEEEFGGGGGGGFGGGD=<F:FEFGFCGGC<=C+BC<3DDBFFADC+@>+@@D@C<CFF>;,=FC,<FFFEFCFGG?:FG;>F;,,<:*<EGCFBFFE@FFB+BCCCGGG>8E;1AG5+:FGG:FGGGGF8C++*<<*099*/1:2*2><8+2+*2:7075/;D9=?F<*0))8?GFGF?FGF?77?*0=)5;>5>?4*(7:F1>7
+@M01873:M01873:000000000-B9G3J:1:2109:27379:20759 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCTCCAGGCACTGTCCTCCGGATGTTTTGAGCTACTTAGAGCTGGATGTCTTTGTAAGGCTGTTTGGCGAAGGGGCTGGTCTTCTCCAGTACCCACCCCTCTCCCCCCGTAGAAACAGAATGTAACTAAAAGATCTGAAGAGCACAAGACTGAACTCCGATCACCTATACATCTCGTACTCCGTCTTCTTCTTGCAAAAAAAATAAAAACCATTGAAAAGGTTAAGCAGATATCGCACCATTAGAACCAAGATGTTAACACTGTTCTG
++
+GGE8;FDCDFGCFFF-6;<EEE<FEFGCDEGEFCEEEFGFG8BFGG,@CFAD<,,,6,CFFE9@EA,,<<<6CFCACFF7=FGE@CBFGGGG=<,CEEFGCFFGGG9<F@CBFE,BFCFEF7FE7CGG8FDFD,FFDCAFFFFFC7C<,,,73=<FFCF,3,,,7DG,=,3**33*DB9DFC;F#################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1109:21161:8210 1:Y:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHG
+GGCCCTTGGTGGAGGCTGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAGACGTCCATAGCCCGCGCATACAATAAGTAAGATGAGCGTCTCGCACAGTAATACACGGCCGTGACCTCAGATCTCAGTCTGCTCAGCTCCATGTAGGCTGTTTCCGTGGCTTCGTACGCGGTAATGGAGACTCTGCCCTGGCACCTCTGTGCGTAGGTTGGTGTGCCAAACCTAGGGATGCTTCCTCCCATCCACTCCAACCCTTGTCCAGGGGGCTGTCGCAACCAGTTGA
++
+,F--+C<E96CF8F@F?F<FD<6C@B,,:,668FF7CFF<9<CD<,C@EC8@=FG:FF,EEGGEECG+B=9E9<9EF@FEE99BE@D+@CFFFDG@:E,@BF<?,DE=CGGFC+8,,B,,>@A=,:=,,73,@D,5DF,@FFFG9EGG:C>:F@=72:F*,,,>:F77:B7:ECFGCCC6=@F?99+:2****>/=*?+>;FEE*2;CC6):CCC:C:E***0+<FFGGG6*0*0<*27*:CFF######################################
+@M01873:M01873:000000000-B9G3J:1:1113:6140:4661 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACGTAGGACGGTCAGTTTGGTCCCTCCGCCGAATAACAGGAGAGTGGGGGTGCTTGTATATGAGCTGCAGTAATAGTCAGCCTCGTCCTCAGCCTGGAGCCCAGAGATGGCCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGATCAGAAACCCCTGAGGCCCGATTAGTGACAACATAAATCATGAGTTTGGGGGCCTTGCCTGGGTGTTGTTGGTAACAGGAGACAAAGTTATAACCCCCAACGTCACGGC
++
+FFCCEC>EG@F:FFGGEGGFGGFGF@CFCFGG:FCE<,CECCDFFFEFFGGGGGEGFFGGCFEFFEEEGGDBFC9FF>FFGFGGGGGGGGG<FECFGFFBFBF8,FF>CFFFGEFGGGFGFEGAFGGF@F@>3CGGGGGG:CFFCFFFFGGGGGGCFGGGFGEFFGGGGGGGCFGGGGFG*?EFCFGGF*AGG*:EFCF7+<+;C*<CFD+<::?C9<+<EEEDD25C6*>*:CCFGE*8C5DGCF###################################
+@M01873:M01873:000000000-B9G3J:1:1114:9970:8638 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRA
+TGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCCGTCGACGGCTGAAACACTTGGTCCTTGCTTTCTGCAACCTTCCAGAGAGAGTTGAGGAGAAGCCCTAGCCACACCGCCCCCAGAGTGCTCTGCAAAGCCATGGCCAAAATGCAGTTGGTCTCACCAGAATGCTTCCCCGTAGATACGATCTCTTAACCGGAGATCGGAAGAGCACACGTCTGAACTCCAGTAACCTATACATCCCGTATGCCGTCTTT
++
+GGGGGGGGGGGGGGGGGGGGCGFGGGGGGGFGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGCEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGFC<FFGGFGGGGGGGGGGGFGGGGDF@EGGGGDEGGADGGGGGGGGG9FGFGGFGGGCFGGGGGGGGFFFGGGGGGGGGGGGGGFGGGGFGGGGGDGDGC*=*=,=CCCDFG5CEGCDEE35C*28C5<>CFFCCF9)*/99<F**2>FFFFFF*6*)17>::BF######
+@M01873:M01873:000000000-B9G3J:1:1107:8981:22378 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGCTTCATCTCCACTTTGGTCCCAGGGCCGAAAGTGAGTGGCCAGTGTGTACTTTGCATGCAGAAGTAAACGCCAACATCCTCAGCCTCCACTCTTCTAATTCTCAGTGTGAAATCAGTGCCTGACCCACTGCCGCTGAATCTGTCGGGGACCCCAGAGTCCCGGTTAGAAACCTTATAAATCAGGCGCCTTGGAGATTGGCCTGGCCTCTGTTGAAACCAACTCAAGTACGTGTCTCCATTTCCGTGCACGAGACTTTGACTAGACCTACAAGAAAT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGGGGGGGGGGGGG=CEGGGGGGGGGGCGGFCG6CFGGGDDGFFGGFGGGDFFFGGGGGBGG3>CFGGDGGFFFG=>49FGFF@FFFFFF##
+@M01873:M01873:000000000-B9G3J:1:1101:10099:23047 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATTTCCACCTTAGTCCCTTGGCCGAACGTCTTCCAGTTATGATACTGCTGACAGTAATAAACTGCAAAATCTTCAGAATGCAGGCTGCTGATGGTGAGAGTGAACTCTGTCCCAGACCCACTGCCACTGAAGCTGGCTGGGACACCAGTGAACCTAGCGGATGCACCATAGAGTAGGAGTATGGGAGCCTGGCCAGGTATCTGCTGGTACCAGGCTAAGTTCCTCATAACACTCTGACTGGCCCTGCCGGGGAGGGTGGATCTTTCCCCTCG
++
+EC@FFE@;EC<EFGGGGGGG9ED@<ECF8F?FGCEEGFGEEEEFFGGG9,C,EE9<9A9FGGC,CE9EFGGCCFFGGD<FG<FFF,<EFFF,F=FBA8EEFEFEFCFGF?FFD<EFGGC@FEDFF<=8CFD@<BF8,,<,,AEGDC:?68A+6ADFFGFDD@D8D,>>@C@8BFCC,,7@,,,,5<:<,3:7,,+4*@AD>C,;;,@@7,2::C?1<@7,>***2*<=2C+BDCD7+08;F)8+=+18?5A#############################
+@M01873:M01873:000000000-B9G3J:1:2107:8132:17450 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTCACAGCCTGGAGGCCCAGGACAAAAACCGGTGCTGCCCGCTCTGCTGTCCCAGACTCAGCTCGGGTCCTTCCCACCGCTGAGAGCCCCATCGCTCTCCCAGCACCCAGAACCAGGAGTCCTCCGCCCAGACGCCCAGCAGCGCCTCTCAGCACAGCCCCTCTCCCCCGTATGAACCACAGGCTGACAAAGATCGGAAGAGCCCACGTCTGAACTCCAG
++
+GFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDEGGFGGGGGGGGGGGGFGGGGGGDGFGGGFGEGCFGGGGGGGGGGGGGGGGGGG>:<CEGG8CGGGFD?FDECFGGCGFGCCEE*21:CDC7E7FCCGG4@*:9+:000;F5D5::740/:@=87@FFGF>FGC0
+@M01873:M01873:000000000-B9G3J:1:2119:20248:11282 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGTACAGAGGAGGCTGTTTGCCTTGCTTACAGTAATAGACCCCAGCATCCTCAGCCTCCACCCGGCTGATTTTCAGTGTGAAATCTGTCCCAGACCCGCTGCCACTGAACCTATCTGGCACTCCAGAGAACCGGTTGGAGACTTCATAGATCAGGAGCTGTGGAGACTGGCCTGGCTTTTGCAGGTACCAATACAAATAGGTCTTTCCATCACTATGTAGGAGGCTCTGACTAGACTTGCAGGG
++
+GGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGFFEGGGGGGGGGGGGGGEGGGG@FFFGGGGGFGGGGGGGGGGGGGGGGGGGDFEEGGGGGEGEFGGFD;AFGGGGGCFGGGGCG6CFFGFFFGFECFGGG,9C>FGGFGFG6?FGGGGGCCFF7FECCEGAC7+@CCCFC<C>=5CCFFGFF###########
+@M01873:M01873:000000000-B9G3J:1:1101:10100:15992 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+CTTGTTCAGGTCCTCTACAACTGTGAGTCTGGTGCCTTGTCCAAAGAAAGCTTCAGTGTTCATAAAGTTGAAGCTGCTGGCACAGAGATACACGGCCGAGTCCTCCTGCTGTGTGCGCTGGATCGTCAGAGTGGAGACGGATCCCCCAGTCCTCTCTGCAGAGAAGCGATCACTGGGCAGCCCTGATTTGTCTGGTGCACTGTTGCCTTGGAAGTAAATTAAAAACTCCAGGCCCTGCCCCAGGCTCTGTCGGTACCAGTAAAGGGCAGTATGACCTGAAA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGFFFDGGGGGGGCGGGGGGGGGGGGGGDGGGGGGGGGFFGGGCGGGGGGGFGF?EFGGGGGGGGGGGG<FCCCF*;CFFGBGGFGF*;FFBD>DGGGGFF@CFFFF:)8AF<AFF?FGF
+@M01873:M01873:000000000-B9G3J:1:2106:2176:11695 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGGCCAGTCTTTATACTGCTGACAGTAATAAACTGCAAAATCTTCAGACTGCAGGCTGCTGATGGTGAGAGTGAACTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATACCAGTGGCCCTGGTGGATGCACCATAGATGAGGAGCCTGGGCGACTGGCCAGCTTTCTGCTGGTACCAGGCTACGTAGCTGCTAACACTCTGACTGGCCCTTCCGGGGAGGGTGGCTCTTTC
++
+EFGEFCFGGGGGGGGGGGEECAFDDFGGFGGDFGGGGGGGGGGGGEGGGGGGGGGGFGGGDG,EFFGGGGGGGCAFGGGGGGGGGGGGGEGEGGGGCDGGFGGFGGGGGFGGGDG,CEFGGGFGAFGDFFGGGGGGCFE@FF8EGGGCCCFGGGG8A6DDDFFF8CEEGBFDFEFGCEE,>FFFF,ECFFEGE8;<8*@5CEGG5DFG,*>6<?CF?EFFGGECCCC5/=C*7A6CFGFE6<CFFFC#################################
+@M01873:M01873:000000000-B9G3J:1:2115:23638:16692 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRA
+TGGATATTTGGAAAGACTTGTAATCTGGTCCCAGTCCCAAAGATGAGCTTGTCGGTGTTATAAGTCCTATAAGCACAGAAATACATCGCGGCAATCCCCCAGCTGTGAGTCTGAGATCTTGAGACTGAAGGATTTGGCTGCTTTCTGGAAGTTCACAGAGAAACGATTCTCTGTTGCATTCTGTTGCTTATAAGATTTTTGGCGAATAACGAGAATAATCTGCCTGCTGGGAGGCTGCTTGTACAAGAAGAAATAATAATCACACTCACTGGTGTCATATG
++
+GGGGEEFFGFFGGGFGGGGGGGFFDGGGFGGGGGEFGGFFGG<C9FF9FFFEGGGGGGGGGGGDFGFGGDFGACFFEGGGGGGGFF9?FGGCEGGGGGCFG+,<<FFFGGFGABCEG9<9FGCEFGDFGGGGGGGGG,,FF?AC<CFGFG,D9FD9FCFD8F8>DGGGBD9FD;CDFEC;FCCFAEFE9ECFFF,E>,5@8:@*3114,4;>C;C9,,15BCC,AEFGGGD;ED*;C3F+;<9C+2<<<*>6;7?FFFF######################
+@M01873:M01873:000000000-B9G3J:1:2118:8705:16266 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCCAGGACGGTCACCTTGGTCCCTCCGCCGAAAATTACAACGTCATCATTGCTTAGGGAGCAACAGTAATAATCAGCCTCATCGTCAGCCTGGAGTCCAGAAATTGTCAGGGAGGCCGTGTTGCCAGACTTGGAACCAGAGAAGCGCCGAGAAGCCCCTGAGGGCCGCTTAGTGACCGAATGAATGATGAGTTTGGGGGGTTTGCCTGGGACTTGCTGGAACCAGGAGACACGGTTATAAGTCCCAAAATCACCACTGC
++
+GGGGGDGGGGGGGGGGGGGGGGGGGGGGGGFG7FEEAFGGGFFGGEGGGGGGGGGGGGGFGGFFFFGGGFGGGAAFGGCGGGGGGGFFFFGGGGGGGGGGGGGGGGGGGGDFGGFFGGGCGFGGFGGGGFGGGGGGGGGGGGG>FFGGGGG7;FGGFEFGGGGGGGGGGGGGEGEEFGFGGFGGGGCFEE5;CG<EF7CEGGCAEG+AFC99>:0CFCEEGGEGGG?9FGFD*2*+;CCFFFGDGGGCFGDFCGGGGEDFFFB+:>>F:C@>@?:5@####
+@M01873:M01873:000000000-B9G3J:1:1101:10107:18394 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGTTTGTAGACCTTGCATGCAGTAATACACCCCAACATCCTCAGCCTCCACTCTGCTGATTTTCAGTGTAAAATCTGTGCCTGATCCACTGCCACTGAACCTGTCAGGGACCCCGGAGGCCCGATTAGAACCCAAATAGATCAGGACCTGTGGAGACTGCCCTGGTTTCTGCAGGTACCAATCCAAATAGTTGTCTCCATTACTGTGCAGGAGGCTCTGACTAGACCTGCAGGCGAT
++
+GGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDDDGGGFFFGGGFFGGFGGFGFCGGGFDGGGGGGGGGGDFFGGGGGGGGGGGGFGGGGGGFGGGGGCG<DEFGGGGGFGGEFFG57>DEC?CCGGG7EFECCCGFGDDFGGG47E87CCFGFFFFFFFAFFFGFFGF+7CF3DCG4;AFG=FF4?@###########
+@M01873:M01873:000000000-B9G3J:1:1101:10111:8693 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGTAATTGGAGGCCAGTTATCATACTGCTGACAGTAATAAACTGCAAAATCTTCAGACTGCAGGCTGCTGATGGTGAGAGTGAACTCTGTCCCAAACCCACTGCCACTGAACCTGGCTGGGATACCAGTGGCCCTGGTGGACGCACCATAGAGGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGCTGGTACCAGGCTAAGGAGGCGCTAATAGTCTGACTGGCCCTGCAGGAGAGGGTGGCTCTTTC
++
+GGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGEFGGGGGGGGGGGGGFFFFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFFGGGGGGGGGGGGGGGCFGGGEGGGGGGGGGGGGGGGGGGGGGGCFGGGGFFGGGAEGGGGFGGGGD6BEGGDECDFGG>ECGGGGGGC5@EFGGGGGC5CF:=CFGGGG?CDGGDECFGCFC=CFGFFDEDFFGFFFFFFFFGC9CGFF4CF3@FEFFFFF0?F(?##
+@M01873:M01873:000000000-B9G3J:1:2111:7262:22830 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCTGTGACTGTGAGCCTGGTGCCCGGCCCGAAGTACTGCTCGTAGACGATTACTGACGAACTGCTGGCACAGAGGTACATAGATGTCTGGTTGGTGCTGGCGGACTCCAGAATCAGGGAGAAGCGCTCCTTCTTCTCTCTAGAGACACTGTACCCCTCAGGAATATCTCCTTTTTCTTTCATTTTAACATCATATGAGAAATAGATCAGCCGTAGCCCCATACCTGGGTCTTGTCGATACCAGAACATATTTTCATGGTCCATCTCCT
++
+GGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGFGGGFGEFFEG7FGGGGG<FGGGGD,CEFGGGGGGGGGGG9FFCFGGF@EAFG<FFG744FFG8FFGDGGGGGGGGGGGAFGGGGGGDFFGEEGGGGGFFFGFFGGFFEGGGGFGGGFGGFGCCCF@FG@,2DCFFCGFGGEFF9CFGG,<GCFGGGGGC9+<C>B+>F7AECCECCE5=7<5:*97CC9FGGFFG>9C)1C7DF+C7809*<>CC################
+@M01873:M01873:000000000-B9G3J:1:1113:11846:1631 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAACTTGGTCCCTCCGCCGAACACCCAAGTATCACTACGACTCTCCCACACCTGACAGTAATAGTCGGCCTCATCCCCGGCTTCGACCCTGCTGATGGTCAGGGTGGCCATGTTCCCAGAGTTGGAGCCACTTAATCGCTCAGGGATCCTAGAGGGCCGGTCACCATCATCAGAGAGGACCAGCACAGGGGCCCGGCCTGGCTGCTGCTGATACCAGTATCCATCTTTACTTTGAATGTTGTTTCCCC
++
+GGGGGGGGGGGCGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGFGGGGGGFFFCEGGGDF83BBF>FGBDFEAF7FGGGGGFGGGGEEEGGGGDCEGGDGG@FFCGGGGGGGGGG>CFGFGGFFGGFGGGGDGGGGGFG9ECGGFGGGGDCFGGFGGG7EFGGGGEGGGEGGFCF6CFC++<858EGGGGGGG*0CEDD5*9EGGGG5CFG>*?G:FGG?C7@?F**/097DBG:*0946*6*9@FFF:075645
+@M01873:M01873:000000000-B9G3J:1:1113:28641:15469 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTACTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAGATCTCATACGCAACGTGTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAATCAAAAACTCAATAACACACAATCTAAGCCACATCAC
++
+GGGGGGGGGFFGGGGGGGGGGGGGGGGGGFFFGGGGGGGGGGGGGGGFGGGGGGGGGEGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFFGGGFGEFGGGGGGGGGGFFGGGCFGGGGGGGGGGGFGGGFGEGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGBEGGGDDGGCGGGG:8DFFGGCGGCEGGGGGGFGGGGGCFDFGGGGGGGGEDGGGDDFGCFECFF############################################
+@M01873:M01873:000000000-B9G3J:1:1106:7472:17358 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACTTAGGACGGTCAGTTTGGTCCCCCCGCCGAACATTCGATGATGACGGCTGCTGTCCCGGGAAGCACAAAAATACTCAGCCTCATCTTCCGCCTGAGCCCCAGTGATGGTCAAGGAAGCTGTGTTTCCTGACCTGGAGGTAGAGAATCGGTCTGGGATCCCTGAGGGCCGAGTGTCTTTATCAAACATGAGAACTGTAGGGGCCTTCCCTGGCTTCTGTTGGTAACAGCTTGCCAAAAAACTATTGAGGTTGTATCCTT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGFFEGGGGGGFGG8F@FEFGGGGGGGGDGGGGGGGGGGGFFFGGGGGCGGG7FF<EGFCFGGFGFFFGDFCGFGGFGFFFGGGGGGEGFE<,F@FG@BCGG,F<E7B;<EGFCFGGGGGCCFFGCCE**2@C99C7<:FGFFG=FGGGGG+<C?CFGGGGE5+<?CF65FC52::@GFFD**9@99??F=+*2*95/CGFFGCFGC##########
+@M01873:M01873:000000000-B9G3J:1:1101:10117:24419 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCCAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAAGTGAAAGTGTCACTGTCCCAGGTCTCACAGTAATAATCAGCGTCATCGTCAGACTGGAGATTGGAGATGATGAGGTAGCGGTCAGCCCCAGAGATGGAGCCTGAGAAGCGATCAGGAACTCCGCTAGCCTTGTTGTAACTTCCACTACCTTCAATCTTCATCAAGTCCTGAGGGGCCTTCCCTGGCTGTTGCTGATGCACTGCGCTGTATGTACTATGTT
++
+GGGECEEEGG:FGGGGFGGGGGFEFGGFFFEFGGGGGGGFDFFGGGF:CDGGGGGD8CFGGGEFCFC<<A@FGFFFED8C<EDFFFGGGFGGCFFGFFGFD@FEGFGGFFFFEGFGGFGCCFBCGDC>FBC=@;FFFCAEFGGGDFCBE7<BAA<FC722:4B72:F9EGD8CCCFFGGGFC9C5?*:30<:<:<88@@C9C+AFCE##########################################################################
+@M01873:M01873:000000000-B9G3J:1:1107:11849:2638 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAATAACTATTATACTGTTGGCAGTAATAAGTTGCAAAATCATCAGGCTGCAGGCTGCTGATGGTGAGAGTGAATTCTGTCCCAGATCCACTGCCGCTGAACCTTGATGGGACCCCACTTTTTAAACTAGACGCCTTATAGATCAGGACCTTAGGGGCTTTCCCTGGTTTCTGCTGATACCAGGCCAACCAGATATTAATATTCTGACTGGCCCGGCAAGTGATGGTGACTCTGTCTCCTACAGATGC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFGGG9=EGGGC8CFGGGGGFGG8FDFGCFFFGEEGGGFGGGGGGGGGGGGF6AEFGGG6@*=EGGEG9@CGGDCFGGGG@CFGFFFF47CD3)/9>++=CC2+++2+2++;;CC=F*A;3CFF4
+@M01873:M01873:000000000-B9G3J:1:1117:12944:14016 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+CTTGTTCAGGTCCTCTACAACGGTTAACCTGGTCCCCGAACCGAAGGTGTAGCCCAGAGCCTCCTGTCCGGCGCTGCAGAGATATATGCTGCTGTCTTCAGGGCTCATGTTGCTCACAGTCAGAGTTGAGAATGTTAGGTTTGGGCGGCTGATGGGAAACTTGTCAATGACAAATCCACTCTCATATGTGGCATCAGAGCCCTGATTTGCAGTTGAGATCAGTGTCAGGCTCTGTCCAGGTTGCTGACGGTACCAGAACATCATGGGGACTTGGCTATCGC
++
+FGGGFFGGGFGGCEFFGGGCGFGEECFFEFGFCFF?GG+FFCFGGGGGFAFA<CF@E<FGGGFGGGFFF7=@:FECFDF,BFEEAFFGF9?FCFGEGGGCG9DGGFFCBF@E,AB<FGGGBFF9FFAFCFDFGGF,55@CFCF+@=3553FEC,<FGF,5DCFGDCC;DFFCBCCCFFFFCGFCC>99=,<5,4<CG6FGFC8*2+4;<C?+;CF+0:9CF?C?C7CG*>5*2**:9??*)2**<*2.5)9>DFGF*:>0:CFC#################
+@M01873:M01873:000000000-B9G3J:1:1111:27451:7271 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCTGTGACCGTGAGCCTGGTGCCCGGCCCGAAGTACTGCTCGTGGACCCCGATCTCACTGCTGGCACAGAAGTACACAGATGTCTGGGAGGGAGCAGCCGACTCCAGCCTGAGCGAGAACTCCCGTTTGTTTAATCTGGAGACATTGTAGCCATTGGGGACTTCTCCTTTGTCAGTGGTACCCTCAGAAGCTGAGTAATAAATCAGCCTCAGTCCCATGCCTGGGTCTTGTCGATACCAGTACATGGAGTTATGGTTCATATCCTGGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAEGGGGGGGDGGGGGGGGGGGGGGGGFGGG7FGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGDGGGGFGCGGGGGGGGGGGFGGGCFGEGFGFGGGFGFFGGGGGGGGFGGGGGGGGGGGGGGGGGGGEGEDFFGGGGGGGFFGGGGGGGGGGGGG@FFE?FGGGGGFGGGFFFGGGG=GGGGDG@DGFDGGCDF974:FFG35>FDFF6CCCF**97)9594:497=<F=FBF<FFF
+@M01873:M01873:000000000-B9G3J:1:1116:19939:2288 1:Y:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCCGTAGAACACAAAATAAGGACGGACAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCTTATGCCGTCTTCTGCTTGAAAAAAAAAAAAACATCAGGAGAGAAGGACAGTGACACACTGATGTTTTCCGTCTGGTCTTTAAGGTTTCAGAGCAAACTCAGCGCCCGTAGCTGCTTAGCATGTGGATCGATACAATAACTAATGTGAGCGC
++
+GGGC++C+@F@FGGGGGGGG:<FFFGG<EEFGGG@FFFGE@FEDGGGEGEEGD:FGGGGGGCEFGFGDFFGFFFDFGGFFGG:E@BFGDD7=FEGGGGG<<FFCD*@FCFGFD:FFCFGC@C:FCAAFF,@CC,7F7<<A<,@?;FEECCFGGC###############################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2108:15031:12741 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+CTTGTTCAGGTCCTCTCCAGGCACTGTCCTCAGGATGTTTTGAGCTCCTTAGAGCTGGATGTCTTTGTAAGGCTGTTTGGCGAAGGGGCTGGTCTTCTCCAGTACCCACCCCTCTCCCCCGTATAGAGTTTTATGAAAACCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAACATGATCCGCGTAAGGCTGATACGAAGAGCAAAAGGCAGCAACACCACGCACATAGACTCAAC
++
+GGGGGGDFGFFGGGGGGGGGGGFGGGFFFFGFGGG@FGGGFGGCFGGGGGGGGGGDFGFGGGGGFGGGGGGFGGGGGGGGGGEGGCGGGFG7FDFDFGGGG8<EGGFFGGGGGGFFGFEGGBCFF<?,EEFGGDGCFDFGD8FDFGGGGGGGCCFD8D>BCBF9FFF9<CFGCDFGGGGGGC@;=>@C<3:?C8:CGG9:@C>;CFD7ECECE5E##################################################################
+@M01873:M01873:000000000-B9G3J:1:2117:19601:12685 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACTCAGGACGGTCAGCGTGGTCCCTCCGCCGAATACCACATGGGCGTCGAGGCTGTCATCCCAAGATGCACAGTAATATTGGGCCTCATCGTCAGGCTGAAGACCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCGGAGGGCCGCTGATCATTACTATAGATGACGACTTTGGGGGCCATTCCCGGGACCTTCTGGTACCAACTTACAGTATTTCTTCCCCCGTAGAGCT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGEEGGGGGGEFGGGGGGGGGGGGGGGFGGGECFGGGGGG=EGFFFGGDGGCDFGC9D97CFEG6CFGGGGD?CGGGFFCB9:FFFDFFFFG?
+@M01873:M01873:000000000-B9G3J:1:2109:17364:9116 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCCTGACTTCTGCAAGTACCAGTCCAAAGAACTGTATCCATTAATATGTAGGAGGCTCTGATTATACCTGCAGGAAATGGAGGCCGGCTCTCCAGGGGTGACGGGCAGGGAGAGTGGAAACTGAGTCAGCACAACATCACCACTGGATCCAGAGACCCAGAGCATTAGCAGCCCCAGGAGCTGAGCAGGGAGCCTCATTGTGCGGAGAGGAACTGAGGGGTGCTGATCCCCGTATCTCCGCCTAACTATATTGCAGATCGGAAGAGCACACGTCTGAAC
++
+GGEGEC-CA-@F<FC<FEEFF9FG<CCF<<CFC@EGDEDEF9FGF@E<FF9CA@C:C@EDFC<FG,FCC<FFDC<,C<CC,6:CFCFDE:F<FD<E@F>BCEGGG7>+B+4?F??5CFCF98?<5FEE?<,5A=A486A,7D,DC8A8DDECE,AFG?:36:@DFCD,@AD9D:+38@C3+@4>,6:D,**35::D,6?@,2,,6*B8**6:C6,9,<83*=*3939CF9C*3/2AF+++:/2C300:7*<CG###########################
+@M01873:M01873:000000000-B9G3J:1:2105:12905:4671 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCAGGCTGACTAGTCCCACGGGGTTCAACGCTGCAGAGATATATGCTGCTGTCTTCAGGGCTCATGTTGCTCACAGTCAGAGTTGAGAATGTTAGGTTTGGGCGGCTGATGGGAAACTTGTCAATGACAAATCCACCCTCATATGTGGCCTCAGAGCCCTGATTTGCAGTTGCGATCAGTGTCAGGCTCTGTCCAGGTTGCTGACGGTACCAGAACATCATGGTGACTT
++
+GGGFGGF<FFGGGGGGGGGGGGGGGGFGGGGEGGFGFGGEE@FCCGGGGGGGCECEFGGGFFFGGGGGEFFGGFCGEFDGGEEGCEGG9ECEDFGGGGDF9BFDFEGGGGFGDG7FCGGGGFGGFCFG9FDD9FFAFGFAA<FFG,DFDFGGGGFEEGGGGCEGF7CCCG9DF<D@EFFG9FCFF@CFF**=EGGGGGGGGCF:88EGGCFGG*9CCG?CFCCF?EEGGG9CCFF*AC*0=FFCC6+6:FCGFFGGCDGGD3+:+8C@FB68>A6<F6<@=
+@M01873:M01873:000000000-B9G3J:1:2116:7856:19893 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+CCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAATATTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACTGTGATATATAAACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTACTCATTTTCCTAATTACCATACTAATCTTAGTTACCGCTAACAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAGGCATTATATCCTTCTTGCTCATCAGTTGATGATACGCCCGTAGAACTGC
++
+GGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGGCGGGGFFGGGEFFGGGGCFFCEFGGGGGGGGGFGGGGGGGGGGFFDAFFGFGGGGGGGFFGGFEFFGFCGG;FFGGGGGFGC,EFGGGFGFGGFGCE8>EGFFGEFF=FCFGGGGDFGGGFGFGGE6F?F<C:E>C5EG,<>EGDFGGCFF;CF>FC7,=C74B:8+4877:F4DDBB5>71CFFF4
+@M01873:M01873:000000000-B9G3J:1:1111:13857:12993 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGTCCGTAGTCGCCGTTGGGCCTCTCGCACAGTAATACACGGCCGTGTCCGCGGCAGTCACAGAGTTCAGCCTCAGGGAGAACTGGTTCTTAGACGTGTCTAACGATATGGTAACTCGACTCCCGAGGGACGGGTTGTATTGGGTTCTCCCACTGTTATACATGTACCCAATCCACTCCAGGCCCTTCCCTGGGTGCTGGAGGATCCAGTTCCAGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFGGGGFCFGGGGGGEGGFGFGGGGGGFEG@FFGGGGGEEGGGGGFGGGGD9FEG9<<FFGGGGGGGFCFFFCFGGGGGFGGGE7CGGGGDG>EGGGGGG@EEGGDG+:CEGGG=;EGGGGGC:?EFFE=CCCGCFGE8ECC+?7EGFGGGCGG<57?96<7C*C?<>BFG4?CGGF3D*..7@)09@>*7:?@=A6AFFF
+@M01873:M01873:000000000-B9G3J:1:2106:17308:17099 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCCTTGTCCCTTGGCCCCAGATATCAAAAGCATCACCCCAAGTCACCGCAGTCCCCTGACCTCTCGCACAGTAATAGACCGCCGTGTCATCGGCTCTCAGGCTGTCCATTTGAAGATATAGCGTGTTCTTGGAATTGTCTCTGGAGATGGTGAATCTGCCCTTCACGGAGTCTGCGTAGAATGTCCTACCACCGCTATAAAGAAATGAGACCCACTCCAGTCCCTTCCCTGGAGCCT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGFGFGG?FGGGGGGCFDGGGGGGFGFFGGGG:FFGGGGGGFGGDFFGGGGGGGGGGEAFGGGFFGGGFFGGEGGGGGGGGG7CCGFF@E99E:EG28<EGGGGG9BCF6*5:*?CFECCEEFF+*=*8CC?ECFFFGGFFGCDE3CG?C+*+**29C9:9*AFED?FCFG=F?+8:)>9:(2.AD?
+@M01873:M01873:000000000-B9G3J:1:1108:14300:19094 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACTTAGGACGGTCAGTTTGGTCCCTCCGCCGAACACCCCAGCAATCAGGCTGTTATCCCAGGTTCCGCAGTAATAATCGGCCTCGTCCCCAGTCTGGAGTCCGGTGATGCCCAGGGTGGCTGACGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGAATCCCTGAGGGTCGCTTATTACTGTCATAAATGAGGACTTTGGGGGCTGTTCCTGGGAGCTGCTGGTACCAGAATACATAATTGGTCCCAATGTTGGAAGAGT
++
+GGGGGCEEGEGGFDFGGGGGGGDGGGCFGGGGGGGGGGGGGGG8FGGGGGGGGGGGGEGGGGGGGGGGGDDFGGGGGGE?FFEFFGGGGGGCDGGGGGFGGGGGGEGGGFDFGGGGGFGGGGGGG>CFGGGFGGGGCGEGGGGGGGGGGGGGDGGGEFGDBFC:FFGFGEFGGGG7F7C89EF8A6C;EBFEGCFEGGGGGGF9CCCFEGGGGFFGGGCFGGEGE5CFF7:9CC5<<>GF:DG+79:77<CGFG*9CFDF>>6097F>:5:@#########
+@M01873:M01873:000000000-B9G3J:1:1101:10137:13722 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGGAGAAATAACCACTACTATCGTAATAGTGGCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCACCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGCGTTACCATTGCCAGTGTTGATCCATCCCATCAACTCAAGACTTTGTCCGGGGGCCTGGCGCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGDDGFGGFGAE<DFGGGGGFCGGGGGGGGGGGGFFGGGGGGGGGFGGGGFGFCFDGGGGGGGGG@C@EFCFGGFBF8FF?FDGGFGGFGG?FGCFGFFGGFGGGGFEFCC7CGGGGGG5CC=>EGGGGCGDC=:DFGFB:6:DFF6*9CFFB**7*029@B>BF45:)8(07??#####
+@M01873:M01873:000000000-B9G3J:1:2107:6181:15590 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+AGTGGGGTTGGCCTTGGGCTGACCTAAGACGGTGACTTTGGTCCCAATTCCGAAGACCCTAGTGGTGGTACTTGTATATGAGCTGCAGTAATAATCACCCTCGTCCTCAGCCTGAAGCCCAGAGATGGTCAGGGAGGCCGTGTTGCCAGCCTTGGAGCCAGAGAAGCGATTAGAAACCCCTGAGGGCCGCTTATTGACATCATAAATCATGAGTTTGGGGGCTTGGCCTGGGTGATGTTGGTACCACGAGACATAGTTATAACCACCAACGTCCCTGCTGG
++
+GGGGGGGCFGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGFGGGGGGGGGGGGGGFEGGGGFGGGGGGGFFGFFGFGGGFFGGFFGGGGGGGFGFFGGGGG?CFGGGFCGGGGGGGDGFGGGGGGGGGGFCE@FGGGGFGGDCFGGGGGFDFFFGGEDGGGGGGCF<:>CCFCGG7B8C<CC7;EGGE5EEGGGFFGC9,><ECFGGGC1+27CFGD=E5*:EEG+:EFFFGEGGGGGGGGGCG8DG=*/*AEFG?D7FFGCGGDFFBC>5>DFFF<CF
+@M01873:M01873:000000000-B9G3J:1:1115:12252:7158 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCTTGGACGGTCAGCTTGGTCCCTCCGCCAAAAATTGCAGTTCCGCTGTCCCACGCCTGACAGAAATAGTCAGCCTCATCCACAGTCTGGGCCCCGCTGATGGTCAGAGTGGCCGTGTTGCCAAAATTGGAGCCAAAGAATCGGTCAGGGATCTCTGAGGGGCGCTTGTTATTTTCATAAATGACCATCATAGGGGACTGGCCTGCCCTCTGCAGATACCAGGCAACATAATTGGCCCCCACATCATCTGCAGAGCAGG
++
+GGFGGGGGGGGGGGGGGGGGGGGGG<FFGGGGGGGFGCGCGGGFGG@FGFGGDGGFFGGGGGGGGGGGGGGGGFGGGGGGGFGGG8DDCECGGGGGGGGGGDFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGG:FGGGGDGGFEGGGGGGGGGGGGGGDG>EGDFGFGGGGCDGGGGGGGGDFGGGGFGGCCFG?CFF?FFGGEFGGG+<ECEGFGGGDC*;7CF4+7:48?*:CFCC)9>>FF4:>F:60)9DD>)>DFF#############
+@M01873:M01873:000000000-B9G3J:1:1116:7180:16322 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL
+CGAGGGGGCAGCCTTGGGCTGACCCAGGACGGTCAGCTTGGTCCCTCCGCCGAATATCCAAATATCATGATTGGTAGTATCCCACACCTGACAGTAATAGTCGGCCTCATCGCCGGCTTCGACCCTGCTGATGGTCAGGGTGGCCGTGTTCCCAGAGTTGGAGCCAGAGAATCGTTCAGGGATCCCTAAGAGCCGGCCGCTGTCATCATAGATGACCAGGACAGGGGCCTGGCCTGGCTTCTGCTGGTACCACTGCACACTGCTACCTCGAATGTCGTGCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGDGFGGGGGGGGGDGGGGGGGF7D>FGGGCGGGGGGGGGGGECGGGFGGFFGCFCFFGGGGGGG7<CGGGGGGGGGGFGGGGGGGFGGGGGD>E=CGEGCCCCFGGGGGGDFGGGFEFCD?CDEGGGGGG@E4)9FF7*:?70:9CACF?GFFFGGGFFGFF4F3?<@34:903BF
+@M01873:M01873:000000000-B9G3J:1:1111:16714:18923 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATCTCCAGTCGGGTCCCTCCGCCGAAAGAAAGCCAGTTGCGACGTTGTTGACAGTAATAAACCGCAAAATCTTCAGGCTCTAGGCTGCTGATGGCGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATGCCAGTGGCCCTCTTGGATGCACCATAAATGAGGAGCCTGGGAGGCTGGCCAGGTTTCAGTTGGTACCAGGCGAAGTAGGTATCAATACTCTCACTGGCCCTGCAAAAGAGGGTGGCTCTTTCCCCTGG
++
+GGGGGGGGFGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGFFFFEFFGGFGGGGFGGGGGGGGGGGGGGGGGGGDGGGFGGGGG,A8FGGGGGGFGGGGEGGGGGGGGGGGGCEGGGGGFGGGGGGGDGGGGGGGGGGGGGGDGGFDEGBCEFG9FFGGGGGGCCFG9EGGGGGGGGGEGGGGG?CG5CFF58CGGGFG=CFGGG?9EGCGGFFGEFE09CCC)=*5:C777C?DFF*07>C79=C@6><@@CCDC>D*75<55>G34C4?9B#######
+@M01873:M01873:000000000-B9G3J:1:1113:7318:10138 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGCTATCAAAGAGGGTTGCAGAAGAAGTGAATCTCACACAGTAATAAAGGGCCGTGTCCTCGACTCTCAGGCTGTTCATTTGCAGAAACAGCGAGTTCTGGGCGTTGTCCCTGGAGATGGCGAATCGGCCCTTCACAGAGTCCACATAGTATTTGTCCCTTCCATCTGGCCTTATATTGGCCACCCACTCCAGCCCTTTCCCTGGAGCCTGGCTGACCC
++
+GGDGFGGFGGGGGGGGGGGGGGGGGGGGGFGGGGGEGGGGGGGGGGGCC7FGGGGGGFGGGGGGGGGGGGD<FGGGGCFGGGGGGGGGGGGFGGGGGGGGGGGFCFGFFGGAGGDDFFFFFGCEFFGGGGFGGGGGGGGGGGEGFGGGFFFCFFGGGGGGGGGGGGGEGGC9>EGF8ECFFGGG7:EEFGGGEGGGG6@C8FFGGGGGGG+=F?FGGE;+<FGCF9EGG>D<CFGFGBC@7?F<*7*<FBG:CF)<*7?2C?GF=F###############
+@M01873:M01873:000000000-B9G3J:1:2113:2232:15700 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTTCCCCGAAGCAAAATGTCTAGCACAGTAGTATACGGCCGTGTCCTCGGTTTTCAGGCTGTTCATTTGCAGATACGCCGTGTTCTTTGAATCATCTCTGGAGATGGTGAACCTGCCTTTCACCGACGCAGCATATGCTGTCGAGTAACTGTCAGATATGCTTCTAATAAGGCCAACCCACTCCAACCCTTTCCCGGAAGCCTGGCGAACCCAGTGCA
++
+CFGCFGCE@FEFGGFFGGGCF,CFC7BE@FGGGGGG@DGGEGFFGGGGGCFF8FEGEFF<FFB@EFGGGGG+CFGGG8FG9E<EGGGEGG8FFGFGGGGGGGDCFEGGGFG:>CFEGG9C,@DE<FCC<<DGGGFGGGGC7C7FEF,@;@CGGGCFEBFGFGGGF@FGG@2,DFDG:,,4?99FGFFE8:*?8:E62ACCFCEC6CC=C=FCC739<<FFEFC7+<+AEDGFC+<*:<FF57CD*55<*2:5*9C*<=D3CD)7CF75C.5)97<?72?=6
+@M01873:M01873:000000000-B9G3J:1:2104:5522:14323 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+CTTGTTCAGGTCCTCTCCAGGCACTGTCCTCAGGATGTTTTGAGCTCCTTAGAGCTGGATGTCTTTGTAAGGCTGTTTGGCGAAGGGGCTGGTCTTCTCCAGTACCCACCCCTCTCCAAGCTCCCCGTATCGTAATAAGTATCTCGAGAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAACAAAATAACACTACAACATCTAAGAGAACAAAATACTAACGCTAAATAAGTAA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGDEGGGGGGGG?FGGGGGGGGGGGGGFGFEGGGGGGGGGGFFGGCFFGGGCGGGGGGGGFGGGG9FGGGGGGGGGGGGGFGGGGGGG7FGFFGGGGGGGFG,>DGFGGGGGGEEC,5CCFGGGC,CFG58?=E###########################################################
+@M01873:M01873:000000000-B9G3J:1:2113:7529:7186 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCAGGGAGGCCAGTGTGTTCCTTGCATGCAGTAGTAAATTCCAACATCCTCAGCCTCCACCCTGCTGATTTTCAGTGTGAAATCAGTGCCTGACCCACTGCCGCTGAATCTGTCTGGGACCCCAGAGTCTCGATTAGAAACCTCATAAATCAGGCGCCTTGGAGATTGGCCTGGCCTCTGGTGAAACCAACTCAAGTAGGTGTCTCCATCCCGGGATACGAGGCTTTGACTAGACCTGCAGGA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGCFFGGFGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEEGGGGGGGGGGGGGGFGGGFFFGGCFGGGGFGDFGGGGF@FFGGGFGFFGGFFGGGFCF9DFEEGGGGG8@B?FCFGGGGCFFGGG?EFBDGGGGGGGGGGGGGFGFD6F47C9:C+*/:>C<CGFGFGGGGFCFFFFFFFF?),C?@##
+@M01873:M01873:000000000-B9G3J:1:2113:12102:20879 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRA
+TGGATATTGGGTTTGACCATTAACCTTGTTCCCCCTCCAAAGGTGAGCATGTCGCCTGCATTATTAAAGGCTCTCCCAGCACAGAGGTACGAGGCGGAGATTTGCGTTTGGGGCTCCTTCAAAAGGAGGGAACTGTCCCCTTTCGACCGTCCAAGGAAAGAAGAAAAACGACCTTTCACCTCCAAACCATCCAGAACATTGTAAGAGAGAAACTGAGGTGCTTGGCCGGCAGGTTGCAGGTACCAGAAGAGCCCGTCGGACCCAGAAGATGAGTACGTGCA
++
+GGGGGGG-EFGGGGGGGC@@FFGG<,,CFGGGG,+@FGCFFG@FAFFG9F,6,6CF:CC<CFGG9<F9FGGE,,,,666,96C<,C,CE,B,B+>++88+,,<,,+4+++B+@:@+=,EGG9?BFGG<F+C,+@,:,,@,,@<,+<<35***6,,*6,,,6>7:>22:**41C7FGC,@C,6;4,,48=6:520+<88E7+A?E+1+3=FGA#####################################################################
+@M01873:M01873:000000000-B9G3J:1:2116:5234:16363 1:Y:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGCTTGATATCCACTTTGGTCCCAGGGCCGAAATAACCATTATACCGTTGGAAGGAATAAGTTGCAAAATCATCAGGATGCAGGCTGCTGATGGTGAGAGTGAATTCTGTCCCAGACCCACTGCCGCTGAACAGTGATGGGAACCCACTTGCCAAACTAGACGCCTTATAGATCAGGAGCTTAGGGGCTCTGCCTGGTTTCTGCTGATACCAGGCCAACCAGTTATTAATACTCTGACTGGCACGGCAAGTGATGGTGACTCTGTCTCCTACAGATGC
++
+EA@BC;FFGGG,-CF8@CFEF,,CC<EDCC@:CCEFFFE@@,,C,C,CC<:C8@C,,,6,CFF6,<6CCFCFF@EFF98,F<CF9CEGC@FGF<<DF9?,CE=,?F,,?5AE<59E,B+BFGC8,CF7@>+:<E,,:?FFFFGC,A<:FFCC,C8B,A+,CD9:FGC87E,D,E9,7EF@7D,,@>>8**5*7,3,@;*,,,,>DDG?ECD28D7788,=8:E504?,=,>7<=@6:CGFFG*8.;*C)=CEF###########################
+@M01873:M01873:000000000-B9G3J:1:2115:11727:15140 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB
+GTTTTTCAGGTCCTCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTCACAGCCTGGAGGCCCAGGACAAAAACCGGTGCTGCCCGCTCTGCTGTCCCAGACTCAGCTCGGGTCCTTCCCACCGCTGAGAGCCCCATCGCTCTCCCAGCACCCAGAACCAGGAGTCCTCCGCCCAGACGCCCAGCAGCGCCTCTCAGCACCCCCGTATGTACCATGTGGAAGTGCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATAC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGG7EGFGGEGEGGGGCGGGGFGGGGGDEGGFFGDF7:CGGGFGFGGGGGGFGFDDDE>FFGGGGEFG4DGC?CFCFCBGFGFGFFG#
+@M01873:M01873:000000000-B9G3J:1:2106:24340:3314 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+TTCGTTTGATATCCAGCTTGGTCCCCTGGCCAAAAGTGTACGGAAGCTGTAAGGTTTGCATGCAGTAATAAACCCCAACATCCTCAGCCTCCACCCGGCTGATCTTCAGCGTGAAATCTGTCCCGGACCCGCTGCCACTGAACCTATCTGGCACTCCAGAGAACCGCTTGGAAAGTTCATAGATCAGGAGCTGTGGAGACCGGCCTGGCTTCTGCAGGTACCATTGGAATAATGTCCTTCCATCACTATGCAGGAGGCTCTGACTGGACCTGCAGGACAT
++
+GGGGFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEFGGGGGGGGFGGGGGGGGG8ADCEGDGFGFGAFGFGGDFBCFGEE7FFAFEGFGDFGGFADFGFGGFGGGGGG?*DEEGDGGGGCEGFCFGGFCC;EGGGG??7+><++;CG?:=;+=>*5@7@+0<CGDEDC5EGGDFF###############
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_pairseq_test1_r1_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,348 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=ATCTTTGCGGCTGGTTA
+TTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
++
+FFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC
+@M01873:M01873:000000000-B9G3J:1:1112:28236:12457 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRA|BARCODE=CGGTTTGGTGCATCTAG
+TGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCAGAGTAGAGAGTTCACCACACAGAGGTAGGTGGCTGAATCACTGAGCTTGGAGTCTCTGATGAGCAGGGAAATATACTGGCCGGCTCTATTGAGCTGTGCTGTAAACCTTCCATCTTCATTACCACTGGAGTATACGGACATCAGCAACTTAGGTTCTTTCCTGCAATCCTGTCTGTACCAGAAGAAAGACTGAGAAGCACTGTTGCTGTAAGTACAGT
++
+GGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGG9FFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGGGGGGGGEEGGGGGGGGGGGEGGGGGGGFFGGDGGGGGGGGGGGC;DFGGGGGGGFGGFCE6CEGGGGGGFFDFCGFEGGGGGE>FGFFGGG7CFGGGGF8CCFGGF6?6DGFFGGGGGFGFC46AF=<FGF?=+9CFFFF:
+@M01873:M01873:000000000-B9G3J:1:2110:13535:17883 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=TTTCTTTAGTGAAATGC
+TTCGCTTGATCTCCACCTTGGTCCCCCCGCCGAAAGTACACCAGTCGCTACGTTGCTGACAGAAATAAACTGCAAAATCTTCAGGCTCTAGGCTGTCGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGACGCCAGTGGCCCTGTTGGACGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGGCTAAGTAGGTACCAACATCCTGGCTGGCCCTGCAGGAGAGGGTGGCCCTTTCCCCTGG
++
+GGGGGGGGCGGGGGGGGGGGE;EFGGGGGGGGGDGGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGFGFGGGCCGGFCGGGGGGGGGGGGFGGGGGGGGGGEGGGGGFGGDGGGGGGGGGGGGGFGGGGGGCGGGFGGGFGFFGGGGG8FGG@CFFCCF7:DAFFGGE@EGGGGGFFF@CC:?DB7A8@FG,=EGGGGG>CFGGFFGGCGG78C?CFCF>FFFGGGC?9CCF>7DEC*9C+<**:55=FGG41*37*/*18:DDDG*59?FFGFFFF9
+@M01873:M01873:000000000-B9G3J:1:1119:21261:11479 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=CTTGATAGGAATGAATA
+AGTGACAGTGGGGTTGGCCTTGGGCTGACTTAGGACGGTGACCCTGGTCCCAGTTCCGAAGACCACAGTGCTGCTGTCCCACACCTGACAGGAATAGTCAGCCTCATCCCCGGCTTGGGCTCTGCTGATAATCAGGGTGGCCGTGTTCCCCGAGTTGGAGCCAGAGAATCGGTCAGGGATCCCAGAGGGCCGGTGGATATCCCTATAGATGATCAGCACAGGGGCCTGGCCTGGCTTCTGCTGGAACCAGTACACACTTTTACTTCCAATGTTGTTTCCCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFEGGGGGGGGFEGFFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGDGGGGCEGFGGGGGGGFCFFECDE5=C4FFGGGG>;FDFGGFCFFGFFGGFFGGGGFGFFFGFFC@57)6FAFF:A<FG
+@M01873:M01873:000000000-B9G3J:1:1101:10006:14034 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=ATTTCTATGGCTTTGTT
+CTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATTGCTACACAGTGCATCATGAGTGTCCCCGTATCGAACAAAGCCATAGAAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAATAAGCGAAAGACTGCACGCACTGCACTCGAACAACCAGACATTGATCAAAACAGACACAATAAGGTTAATCATTCTCAATCTAAGCGAACATTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGG7;DGGGGGGG:CEGGGFFGGFFG6BCCB>BEGG#################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1117:17250:9432 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=CTTGCTTATGATTCCAG
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCAAGTGCCAGCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGTGCTCAGCCCCAGAGGTGGAGCCAGAGAAGCGATCAGGGATCCCGTCCCCCTTGCTGTGACTGCCATCACTGTTAACCTTCATCAGATACCGAGGGCCCTTCTGTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCCCACTGC
++
+GGEFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGEFCGGGGGGGGGGGGGGGGGFGGFGGGFGGGGCGGCGFDFFGEFEC<FCEFGGGGGFFGGFGGGFFGGGFEGGGGGDCGGGGGGGGFDGGG<C@FEFFGCFGFFEFCEEGGDFGFCFEGGDGFG?FFCGDCGGGGCCGFFGGGGCEGGGCCEGG3>DG*1*>FFFGFFFG:C<0AF*9@BC@>@CD5C57CCD575*9:?:?6<4@<:<F4
+@M01873:M01873:000000000-B9G3J:1:2108:14465:19705 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=ACTTAACGGCCAATTAA
+GTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGGCCCCTAATGAGCTGGCGCAGAAATATACAGATGTCTGGGAGGAGGCAGCAGACTCCAGAGTGAGGGGGAGGTCCTCTGTGTTTGATCTAGAGACACTGTAGCCATCTGAGACTTCTCCTTTGTTAGTGTCTTGAACACCATATGAGTAATGGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATTGTTGTGGTTCCAAGTCTGGTGAC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFGGFGGGGGGGGGGGGGGGGGFGGGEGFFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGFGGGGGGG,DGGGGGGFGGGGGGGGGGFGGGCFGGGFGGGDFGGGGGGGGGGGFGFFFGGGGGGE*@*?CGDGGCDBAF7FGE=*7=49<<EG47CFGGG70>EECCFCFFFFFFBFF###
+@M01873:M01873:000000000-B9G3J:1:2111:3554:13238 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=TTAGCTACATGTAATTG
+TTCGTTTGATCTGGAGCTTGGTCCCCTGGCCAGAAGTGTAAGGACAGGGTGTAGTTTGCATGCAGTAATAAATGCCAACATCCTCAGCCCCCACCCTACTGATTTTCAGTGTGAAATCCGTGCCTGTACCACTGCCGCTGAATCTGTCTGGGACCCCAGAGACCAGGTTAGAAACTTTATATATTAGGCGCGTTGGAGATTGGCATGGCCTCTTCTGAAACCAGATCAAGTAGATGTTGACATCACTGTATATGAGGCTTAGAATCGTACTGCGGGAGGT
++
+EFE@@9CBFGFF,,;C;,6<FFF<6,CFC,,;DEFG9C@CEF<,<6F,86B@FF<E9C9EFCE9E,,C<EEFFFE,6,,9CFFFFFGD,FFGC@FFE8DFFAFC9EFGF?FGGGAF,,,7B=C+:E55?:,:<=,?FDDCEF9FAB5C,,AFFG>++6BFA,3=,3>,373>EF,,3,=DF;CFA,,,,@++5>EEFG##################################################################################
+@M01873:M01873:000000000-B9G3J:1:1109:19388:16328 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=GGGACTCCAAAATTAAT
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAACCATTCAGGCTGTCATCCCATGTAGCACAGTAATAATCAGCCTCATCCTCAGACTGGAGCCCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCTGAGGGCCGCTGAGTATTGCTATGGATGAGGAGCTTGGGGGCCGTTCCGGGGAGTTGCTGGTACCAGTTTACATTATTACTTCCGATGTTGGAGCTGC
++
+GGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGFGGFFGGFGGGGGGGGGGDGGFGFGGGGFGFGCGGGGGFGFFFGGCFFGCECFBGGG78E*CFGGGDEGG*8/;<CG7CEFFGFGGGFGGGCEG6+;CGDDC*::CFCEGGGGG:<D>6:EC=<7*7C7*7?:*::76CFGF6?G#############
+@M01873:M01873:000000000-B9G3J:1:1111:16537:24486 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=CCTTGTCCGAGATGTCT
+TTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGCGAGCGGGGGATTGTAAGTCTGGTGACAGAAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAATCTGTCCCAGATCCACTCCCACTGAACCTTGACGGGACGCCACTGTGCAAACTGGATGCAGCATAGATCAGGAGCTTAGGGGATTTCCCTGGCTTCAGCTGATACCAATTTACAGAGCTGATACAGCTCTGGTTTGCCCGGCAAGCGATGGACAATATGGCTAC
++
+EEFEGGGGFDGGGGGGFGFFGGGGGGGGFGGGG7CFFGGG:FFCGGFEFGFEEFGGGGGGG9FCFGGGGF<FGDFCGGGGG<AEEFGGGGGGGGEG?EEGGFFGFFCFG<FEFFGFG9FFEAFFFGGGGGFDFGG8DFBFF,3+@CFFGFGGGC<*11:>>FGF,?,>DCF,?<BFFGFFFE,,?,?,<?*=>=:E@G**=9+40=C85@FGG?1>C67C?+>CEC7ED7CFG60*12/**29C4CF)*27>FD*1<CD>>GFB################
+@M01873:M01873:000000000-B9G3J:1:1101:10019:8146 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA|BARCODE=CGCATATATCTGCAAAA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCATTGTCCCTTGGCCCCACATATCAAAAGCATGCCAGCCACTGCTATATTCTCGAGAACAGTAATACACAGCCGTGTCGTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCTTCACTGAGTCTGCATAGTATATGTAACTTCTACTAGCATCAATGGATGAGACCCACTCCAGCCCCTTCCCTGGAGCCTGGCGGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGDGGEGEFGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFFGEGGGGDEGGGGGGGGGGGGGGGGGGEEFGGGFGGDGGGGGGGGGGDFFGGGGG;;FCFFAFDFFGCGGFGGGGGGGGGGGGF;DCD66DFGGFCGGFGGGGD5F:CFGC7CCGF?=CFF7C9FGFGF+AF7E+<CFC:@*:>DFG@:*=FG;<@?3C>B>?FG4497>FG:?F*)07?@??:FF###
+@M01873:M01873:000000000-B9G3J:1:2101:11039:4739 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=ATTAGTTCATAAATTCC
+TTCGTTTGATCTCCACCCTGGTCCCTCCGCCGAAAGTGAGAGGCCACTCGCTACGGTGCTGACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATGCCAGTGGCCCTATTGGATGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGCCTAAGTAGCTGCTAATACTCTGACTGGCCCTGCAGGCGAGGGTGACTCTTTCCCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGDGGGAFFGGGGGGGGGGDFGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGEGGGGGCGGGGGCFGGGG9EGGGGGGGGGGGGFCECFF5>EGGGGGGGG?8FCCCFGFGGG9BFGFGCC;FFGGFGGGGGGGG>74CCGG=C<*2@=FDCFGGCCCCCGC5/:CGGFGFFFFGF?FB4<
+@M01873:M01873:000000000-B9G3J:1:2104:24954:20771 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=CGATGTAATCTTAGCTG
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAATGCCAGTGCCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGCGCTCAGCCCCAGAGCTGGAGCCTGAGAAGCGATCAGGGATCCCGTCCCCCTTGATGTGGCTGCCATCACTCTTAACCGTCATCAAGTAGCGAGGGCCCTTCTCTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCTCACT
++
+GGGGDGGGGGGGGGGFGDGGGGGGG,FCGGGGGGGGGGGFGFGFGDGGGGGGGGGGGGGDG8FGGGGGGGEFCGGGGGGGFDGGFFGGGG99=FGCFGGGGFF9=FGGGGCFGGGGGG<FCFEFCFCFCEFGGC*F7<FFGGGGGG>FCFGGGFGFGGGCFFC<1F@FG,CGGGGFGFGGGCEGG6CFCG+C=FECFCF?FG7@+2<CFGC:E5*<EEGGGCFC7CEGEGEGC*A>DD6>FDEGGFGC7>C*2<>F65?D3*85::>>C=+/6FGA47<@#
+@M01873:M01873:000000000-B9G3J:1:1111:12286:7157 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRA|BARCODE=TCCAGATTCGGATTACA
+TGGATATAGGACTTGACTCTCAGAATGGTTCCTGCGCCAAAGACCAGTTTGTTTCCATGCCCATCGGGGCTTGCTGCACAGAAGTAGACAGCCGAGTCTTCAGGTTGGGTCTCTGTGATGTGCAGGGAGAAATGTTTGGCTGTCTTGTTCAATGTAACAGCAATTCGTTGGTCTTTCTTTTCGCCCACATTTGAACGAATGTCTATAATAAGCTGAGGTCTTTTTCCAAGTTCTTGCTTATACCAAGGGAAGTAGTTTGAGGCACTGTCTGAATAAGTACA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGFGGGGGGGGGGGGEGGGGGEF7DGGGGGGGGGF@?F:FCFGGGDFGGGGGGFGCFCFGGGFFFGFGFGFGGGFGF:FFEFGGGGGFC3AC:FFFFFGBABB7>8A?##
+@M01873:M01873:000000000-B9G3J:1:2103:2227:11139 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA|BARCODE=TAGTCAGAAGATTATCT
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCAGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGAAGTCAAACTCCGCCACCTCCGTTGTAGCTCCCACTACAGTCGTCGTATCCCTCGCACAGTAATAAACAGCCGTGTCCTCTGCTGTCAGGCCGTTCATTTGCAGATAAAGTGAATTCTTGGCGTTGTCTCTGGAGATGCTGAATCGGAACTTCACAGAATCTGCATAGTACTCGGTTGTTCAATTTCTTCTATTGTCTTAAACCCACTCCAGCCCCT
++
+CFGG7F7CFC<FGDFFGCFGGGGGC++8CECF,67C,EG,B6CDFCCEEEF@FGGGG?F,C@:,CEEGFFGC<?CEFE:EFEFC@CGFCEFAC9,BDF8E?F?CEG+BD:+DAFECF<FGGGGDF,BFFFC,C,,:+@@F,@=,,3>,33@9;7<CF*@<,37F,,3FC,,?F,,,,7,@D9,,:C>EC**?;?9;EEFGG+9?99+A+****3BFG+>CF6+5<F#######################################################
+@M01873:M01873:000000000-B9G3J:1:2116:17140:9378 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA|BARCODE=CGGAATACTCACAAATT
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCACTGTCCCTTGGCCCCAGACATCAAAAGCAGGAGTGCGACCTGCTATAAAAGCCTCCTTCGCACAGAAATATACAGCCGTGTCTTCAGGTCTCAGGCTGTTCATTTCCAGAAACAGTGTGTTCTTGGAATTGTCTCTGGAGAGGGTGAACCGGCCCTTCACGGAGTCTCCGAAGGATTTGTAACTTCCATCATAGAAGATAACTGACACCCAGTCCCGCCCCTTCCTTGGACCTG
++
+GGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCCGFGGGGFEEGECDAEEGGGGGGGFFFGGAFGDED>FGF@FFDGGGDGFGGGDFFFCDFGDBEAFF,@<BFFFFGGFGGGGFGGGGBECFAFGCA9D9:BCFCEG9,;D>DE8*=5;1:6C*C:CGEFDFF9CC:CEFCGFC*/=C+A:9+3200<CF9+:<*::*+20+6::7D7774C9:55<C+*)25<5FD###########
+@M01873:M01873:000000000-B9G3J:1:2106:21507:14943 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCGGGTCGCCTTCTTTT
+AGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACTCCGAAAGTGTAGCTGCCTGCATATGAGAAGCAGTAATAATCAGCCTCATCTTCAGCCTGGAGCCCAGAGATGGTCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGATCAGGGACCCCTGAGGGCCGTTTACTGACATCATAAATCATGAGTGTGGGGACTTTGCCTGGGTGTTGTTGGTACCAGGAGACATAGTTATAATTACCAACAT
++
+G<FGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFDGGGGGGGGGGGGGGGGFCGFGDGGGGGGGGGGGGGGGGGGGGG>2FBFGGGFECFG>BFG7EEGGGGGFDEGDBE=F7CEFFGGGFCGGGGGG777<EGFGGEGE8CFFFFGFG?F**;=CFGGDFEGFDF4*1;CC4+:CBD-<B+9?<+604;F#
+@M01873:M01873:000000000-B9G3J:1:2101:22394:13872 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=ACTCGTGCTAATCCTTC
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCCCCTGCCGGCATCATAAGACTGACAGTAGTAGTCAGCCTCGTCCTCAGTCTTCAGTCCAGAGATGGTGAGGGAGGCAGAGTTGGAGGAGCTGTCGATGGAGCCAGAGAACCGATCAGGGACCCCAGAGGGTCTTTCGTTATCCTCATAGATCACAGTGGTGGGGGCACTGCCCGGGCGCTGCTGGTACCACTGCACATAGTTGCTGGCAATGCTGCCACTGC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGFGFFGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFFEEGGGGGGGGGGGGGFFGECGFFGGFGGGGGGGGFGGGGGGGGGGFE+*8EEGGGEFGGGGGGGGGGGG<6FGGFGGFFFCFGGF7>>DFGGGGFGG4D@4*=4;??FGC
+@M01873:M01873:000000000-B9G3J:1:1110:19157:20344 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=GAAGAATTGTAACAATC
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCACAGTGTAGCTGCCTGCATATGAGCAGCAGTAATAATCAGCCTCATCCTCAGCCTGGAGCCCAGAGATGGTCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGATCCGGGACCCCTGAGGGCCGCTTACTGACATCATAAATCATGACTTTGGGGGCTTTGCCTGGGTACTGTTGGTACCAGGAGACATAGTTATAACCACCAACATCACTGCTGG
++
+GGGGGEGEGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGBFGGGGGGGGGGGGGGGGGGGGGGGFFGAEGGGFFFFGGGGEFGGGGGGGGGGGGGGGGFGGFFGGGGGGFFGCFGGGGGGGGG7FFFFGGGGGGGGGGFGFAFCFGGFGGDFGCC:CE8:@EEGGGGGGGFFGGGEECGGGGFFGGGGGGGCFGFCFC7FFGGFGEEEG5*7CCECGGGGFFF7FDDGGGGFFG3FDFGFFDD>7*:=>?DGDEFFGF:49?>F?FFF
+@M01873:M01873:000000000-B9G3J:1:2103:19958:12449 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=TAGCCTTCACTTTAGTT
+TTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGAAGCGCGCATACCTTGCATACAATAATAAACCCCAACATCCTCAGCCTCCACCCGGGTGATTTTCAGTGTGAAATCTGTCCCTGACCCGCTGCCACTGAACCTTTCTGGCACTCCGGAGACTCGGCTGGAAACGTCATAAATTAGGAGTTCTGGAGACTGGCCTGGCTTCTGCAGGAACCAAAATATGTAGGTCTTTCCATCACTATGTAGGAGGCTCTGGCTAGACTTGCAGGAGAT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGDFGGGGGGGGGFGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFFGGGGFGGGGGGDGEGGGGGGGGGGGGGFGGGGGGGGGGGGGGEGCFBCFFEDGGGGGGGE@BFGGEGGGGFGGGGGGGGGGFGFGFFGFGGGFGGGGGCEGGFF*A:@FF9CGGGGGDEFC73<?*<F>DGFGGG=FDCGDFGGGG:<9CG?FBC2@####
+@M01873:M01873:000000000-B9G3J:1:2104:19897:23367 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=AATTAATGGTGTTGAGA
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAAAACCACAGAACCACTCAGGCTGCTGTCATAGGACTGGCAGTAATAATCAGCCTCATCCTCAGCCTGGAGGCCAGTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAAGCGGTCAGGGCGTCCTGAGGGCCGATTGTTGTTACCAAAGAGGAGGAGTTTGGGGGCTGTTCCTGGTAGCTGCTGGTACCAGTGAACATCATAACCTGCCCCGAGGTTGG
++
+GGDGDGGGGGGGFGGGGG<FGDFGCGGCGGGGGGGGGGG?CGGGGGGGGGGGGGGGGGCG<FFFFG<44AB=CGGGDGC,ED<9B,,EC,EFGGGGCFF9,C??FFGGFGGG@CCDFEFE7BF7:D>>CCBFF<CFB7CFFEGCCFEG><:>:3F7@C97DFCEB32F,,?CC<E:8B:B,*3=7C*;<**B:7:CE7*00@FFGGGG?86<*;FC5*/0*<@CC885:?8C7+002+000<F?FFGFD7+**+9CFC@>*:C##################
+@M01873:M01873:000000000-B9G3J:1:2118:6488:16393 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHG|BARCODE=GAAAGACTTACATTTTT
+GGCTGGTCGGGGATGGTGAGGAGACGGTGACCAGGGTTCCCGGGCTCCAGGGGTCGAACCAGTTGTACTGAAAGTTCCACTCATACTTCTCGACATGTCTCGCACAGTAATAAATAGCCGTGTCTGCGGCGGTCACAGAGTTCAACTTCAGGGAGAATTGGTTCTTGGACGTGTCTACGAATATGGTGACTCGACTCTTGAGAGACGGGTTGTAGTGGGTGTTTCCATTGTAAAAGATACTCCCAATCCACTCCAGGTCCTTCCCTGTGGGGCGTCGGCTCC
++
+GGGEGGGFCGEEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGEFGGGGGGGGGGGGGGGGFGGGGGCFGGGGGGFGGGGGGGGGGFFGGD<FCGGDCEFEGGCFGGGGGGEGGFGGFFDGFFFGCF9FFACFGDGCFGG<<FCFGGFFGDGGGGFGGGFGFGEGF?F+1?EGGGGGF7EE/+A6AEDCE58:<++;8:=E/AFG<9AGF<C7++::CEGFGF6:C5EFG?7**35CC#######################
+@M01873:M01873:000000000-B9G3J:1:1117:6029:5428 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=GAGACTTTGCTTGTACA
+GTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTAACACGGCCCCCGGGTCCAGTACTGGCACAGAGATAGAAAGCTGTCGGGTTCTTTTGGGCCGATGTCACAGTGAGAGGAAAGGATTCCTTCTTCTCCCGAGAGACGCTGTACCCTTCAGCTATATCTCCTTTCTTAAAGTCATTTACTATCTGTGAGTAGTAGAACAATCTCATCCCTTGCCCTGGGTCCTGTCGGTACCAGTACATGGCCTCGTGGTTCAAAT
++
+GGGGGGGGGGGGGGGGGGGFECGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGFGGGGCFGGGEGCGGGGCFDGGGFGGGGF?FG<FF=EE@FFGGGGGGGGFCF:C<?BF9@FG+><FFEF>FFFGGCFFG9FFGGFFGFGCE9FGGGGFGGGGG7*>CE>FG@FECGGGGGGGGGFFG?CDGCGCFBF?9,5=2++5+1>EFFFF71<>=77@1AFFG<7+028C8CFG+;:9<C77<*<**1:)9@*007)75D777:>>7D4446)7:F#########
+@M01873:M01873:000000000-B9G3J:1:2106:6159:11549 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=GTTCGTACTCTAATAGA
+CAAGGGGGTGGCCTTGAGCGGACCTGCCCCACAGGCTCCGCAGGCTGGATCGGCTGCTTCCAACTGAGGCTCCAGGGTCTGGGTCCCCGCTTTGCGGTGCAACCATTGGGCGCAGCAGGCCATGGGCGACCATGGCCAGACCCAGCAGCAGCAGGGGCCAGCGCTGCCTGGGACCAGCAGGGCTGTTACAGTACACCCCAGTCCATTGGCTCTGTCCTCTCCCTGGACTGGCTCTGGTCCCTGTCCCTAGCCCAGGCCCTTCCAGGGTCCATGTCTGTCCC
++
+GGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGFGGGGEGGGGGGGGGCFFFGGCGGGGCFGGGGFGGGGGGGGGGGGFGGGGGGGGGGGDFGC:CEFGGGGGGGGGGGGDEDGGCEGGGDFFGGEGGGGGGGGGGGGFGGGGGGFGGFGG7CFGGGCGG@FFGGGGGGGGEGFGG>C5;EGGGFGGGGGGGGFEGDCFF6+0ACFEEFFFCDGGGGGGF@6@ECFGCC:?FGCCFFGF+2<?C7998C?**1:<GGF<?7@488F>CFC########
+@M01873:M01873:000000000-B9G3J:1:2103:16719:17340 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=ATGCATATGAGTGTGGC
+GTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGCCTCCCCCAGGGCTGCTGGCGCAGAAATACACAGATGTCTGGGAGCGGGTAGCTGACTCCAGAGTGAGGGGGAAATTCTCTGTCTTGGATCTGGAGACAACATAGCCATCGGGGACTTCTCCTTTATCTGTAATATCAGCAGCTGCTGAGTAATAGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATAGCTGTGGCTCCAAGTCTGGT
++
+GFGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGCFEFFGDCFGGFGAFFGGGGGGFDGFGGGGGGGFGGGGGGCGFGGGGGGGGEGGGGGGFGCGGF6CGGGGCFGGGGFGGGGDGGGGGG5CG6+<EECCDFGGDF<9D***98CGG;DGF7?7:ECFF+85C7B4?#######
+@M01873:M01873:000000000-B9G3J:1:2114:13033:12027 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=TTAAGATACTAACAGGT
+TTCGGTTGATCTCCAACTTGGTCCCCTGGCCAAAAGTGTACGGAGGCCACTTATGATATTGCTGACAGTAATAAATTGCAAAATCTTCAGACTGCAGGCTGCTGATGGCGAGAGTGAACTCTGTCCCAGACCCACTGCCTCTGAACCTGGCTGGGATACCAGTGGCCCTGGTGGATGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGCTGGTACCAGACTACCTTGGTTCTAACAGTCTCACTGGCCCTGCAGGAGAGGGTGGCTCTGTC
++
+GGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGFCGCG>FAFFGFGFEGEGGFGGGGGG?FEFGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGGCFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF8FFCFCFGFG>FGGDFGGGFGGGGGGFFGG?EFGGGCFCGDGFDFFFCGGGGGGDGGGGCEGGGGGGGGGGGGGCGGGDDFGGGGGFGGFF7FFF*>FCFGCFDCGD5@7C>FF6>6>7
+@M01873:M01873:000000000-B9G3J:1:2107:25942:4834 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=GGGCCTCTTTATTTGTC
+AGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCACGGTGCTGCTTGTATATGAGCTGCAGTAATAATCAGCCTCGTCCTCAGCCTGGAGCCCAGAGATGGTCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGATTAGAAACCCCTGAGGGCCGCTTACTGACATCATAAATCATGAGTTTGGGGGCTTTGCCTGGGTGCTGTTGGTACCAGGAGCCATAGTTATAACCACCAACGTCACTGC
++
+GGGGFEFF7CFFGGG@FGGGGGFGGFGGGGFFFFEGDGGGCFFGGGCGGGGFGEGGGGGGGGGGFGGGGGGGGGGGFFGGGGGGGC?EFGGGGGGGGGGGGFFGGGGGGGGGFCGFDFGGGCGGGGGFFFDFFGFCEGGGEFEGEGFFFFCF:FCEFGCEFGFGGFCGGGGGGGGGG9EGG>*8<E8*=EE5B7=5:FFG?6CG7@C?:CFGFG:++<AC>CEGGGFCCFF?GGFFEDCCCG7:E:<7+0**1***097++3?>@C??57*7D3C1<>DF#
+@M01873:M01873:000000000-B9G3J:1:1101:10044:7123 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=GTACTATGAACACAACT
+AGTGACAGTGGGGTTGGCCTTGGGCTGACCTAAGACGGTGACCGTGGTCCCAGGTCCGAAGACATAGAGATTGCTGCTGCCTGAAAATGAGCTGCAATAGTAAGTAGCCTCATCCTCGGCCCGGAGCCCAGAGACGGTCAGGGAGGCCGTGTCGCCAGACTTGGAGGCAGAGAAGCGATCAGGGACCCCGGCGGGCCGCGCAGTGACGTGCTAAATGATGAGTTTGGGGGCTTTGCCTGGGTGTGGTTGATACCCAGAGACAGAGTTATAACCCCCAATGT
++
+FFFGGFF?GFGGGGGGGGGGGGGFFGEGGGGGGFGGGD:C,CFGGGEGGGFGFFGGDFFGGGGGGFDEEG9FFGGFCFFFFCDCFGGFG<,FFCF855E9,C9DFGE9EGGGAEFBFC>@CFC7FFGDEDGGFAFGG:+>FDFD+3>++@+@FFFGGCGFFCFC78BEE5*>2,8CBEG5*2,4BCE*:CE*=*::EED*:*8*<97:?3*22CE?CE:<+22<C?*C=GG)767*:*7>3C)C*.95BG###############################
+@M01873:M01873:000000000-B9G3J:1:1101:10044:7141 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=GTACTATGAACACAACT
+AGTGACAGTGGGGTTGGCCTTGGGCTGACCTAAGACGGTGACCGTGGTCCCAGGTCCGAAGACATAGAGATTGCTGCTGCCTGAAAATGAGCTGCAATAGTAAGTAGCCTCATCCTCGGCCCGGAGCCCAGAGACGGTCAGGGAGGCCGTGTCGCCAGACTTGGAGGCAGAGAAGCGATCAGGGACCCCGGAGGGCCGCTCAGTGACGTGATAAATGATGAGTTTGGGGGCTTTGCCTGGGTGTTGTTGATACCAAGAGACAGAGTTATAACCACCAATGT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGEGGGGGFDGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGDDFGGGGGGGEGGGGGGGGGGGGGGGGGGGGCDFFGGGGGF+AEGFGGFDGGGGDGF72:?F>F*719@G:FFFF???GGGGGFFFCFFFFFFFA4<6(04@F:
+@M01873:M01873:000000000-B9G3J:1:2116:7821:15323 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=CTATTTACCAGAATTAC
+AGTGGGGTTGGCCTTGGGCTGACCTAGGACGGTGACCTTGGTCCCAGTTCCGAAGACATAAGTGCTACTGCCTCCATACGAGCTGCAATAATAATCAGCCTCATCTTCAGCCTGGAGCCCAGAGACGGTCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGAGCAGGGACCCCGGAGGGCCGCTTACTGACCTGAAACATTATGAGTTTGGGGGCTTCGCCTGGGTGGTGTTGATACCAGGAGACATAATTATAACCACCAACGTCACTGCTGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGFGG,FFFEGGGGCFGGGGGGGGGGEE>EGDGGGGGGGGGFFGGGGGDFFCCFCGGGCF7:FCEGGGGCGGDEGGGGGGGGF<DG>GGGFFGDGGGGGGGGGGFCDFFFGGDFFC>FGF3<FFFGG
+@M01873:M01873:000000000-B9G3J:1:1101:10051:12996 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHG|BARCODE=TATTCAGTATAACATTA
+GGCCCTTGGTGGAGGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGCCCTGGCCAGCCAGTGATTTGGGGGGTGCACAGTAATACAGACCCGTGTCTTCGGCTCTCAGGCTGTTCATTTGCAGAGACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCCTCACAGAGTCCACATAATTTGTCTCACTTCCATCTTGCTTTATGTTGGCCACCCACTCCAGCCCCTTCCCTGGAGCCTGGCTGACCCAGCTCATCCAATAGTGAC
++
+GGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGEGGGGGGGGGGGGGGGGCGGGGGGGGGGGEFGGGGGGFFGGGGGGGGFFGGGFGGGGGGGGGGGGGGGGDGGGGGGGGGGCFCFF6+AEGCFGGG;8EF?FGDCF?@FGGGCG7CFGCFCE?:+<CFCF9@FGG7CFGGGG+:C?CDEF=GGD<*7D47FDFE3@5FF>4)5*8>;FFC*1>7?475>7F@############
+@M01873:M01873:000000000-B9G3J:1:1107:13066:21126 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=GCTGCAGTAGAAGATAT
+CTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATGTTGCCCCTGGCTGCTGGCACAGAAGTACACAGCTGAGTCCCTGGGTTCTGAGGGCTGGATCTTCAGAGTGGAGAATGATGCATTAGGCATCTTAGCTGAGAATCGATCCTCGGGCATCCCTGAATCATCTATCGGAACGTTGTTGTTAAAGTAAATGAGCAACTCCAGTCCCCGCATCATGGTCTGTCTGTACCAGAAAAGGTAGTCATGTCCTGAAATTG
++
+GGDGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGGGGGGGGFGGGGGFFGGGGGGGFGGGGDFCGFFGGGGGGGFGGGGGGGGGGFG>GFDEGDGGGGGGGGGGGGGGGGGCEDEGGGFGGGGG8EGGCF;CFGGGGFGGGGGFGG64<CFCEGGGGCGAGFGGG?FFDCCFDGDC67CF5=FFF4FFF@6684/49@FF
+@M01873:M01873:000000000-B9G3J:1:1117:12403:4599 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=ACGACAAATGTTCTTTC
+GTTTTTCAGGTCCTCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTCCCCTGCCACCTAGCACTGCAGATGTAGAAGCTGCTGTCTTCAGGATGGGCACTGGTCACTGTCAGAGTGGACAAGGTCAGGCTTGCATGGTTGATGAGAAACTTGTCCTTCTCGACGCCTTGCTCGTATGTGGCCTTGGAGCCCTCATTGGAAGTTGCCATCAGCATGAGACTCTGTTTCGGGAACTGACGATACCAAAACATAGTTGTGGCCTGAAAGT
++
+GFGGGGGGGGGGGGGGCCCEG8FGGGGGGDGGGGGGGG<@FGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGFFGGGGFGGGGGFFGEFEDFFFFFGGFFFGGGFFGDEGGGGGGGFCEGGGCFGGGGGFGGGGFFGGGGFFGGGFGGGGGFCFGFGGGGGGGGGFGGFFGGE>EEFEGFGFGEC@GGGGCFGFFG?9@5?CFCF@FGG78FFFGCCFGGCFG7CGGDFGFFGFFGFGGGDEF4A4*.5>CCF6?CGF@:66976BBD>7?F.82C:
+@M01873:M01873:000000000-B9G3J:1:1117:22437:4121 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=CAGACTGATTGACAAGA
+GTTTTTCAGGTCCTCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTCACAGCCTGGAGGCCCAGGACAAAAACCGGTGCTGCCCGCTCTGCTGTCCCAGACTCAGCTCGGGTCCTTCCCACCGCTGAGAGCCCCATCGCTCTCCCAGCACCCAGAACCAGGAGTCCTCCGCCCAGACTCCCAGCAGCGCCTCTCAGCACAGCCCCTCTCAGAGTCACCCGTATTCTTGTCAATCAGTCTCAGATCGGAAGCGCATACCTCCGAA
++
+GFGGGGGGGGGGGGGCF7BFG@FGFGGGGGDGGGGGGGGGGG@FGGGGGGGG7,BFGGGGGFFFFG@FGGGGGFGGG78,9F=FF@FGFEG++@=>EFGFCFGGGG<EGG<CFCGGGD8FGCG?FEGEGGFC<B>DF@C+<BF7<=<C<FF*@B<CCCEGFD8,,6>BF*>:7C>,C5B>::EEFFECC5**=*+=CC*<:C==*/=878C+:+02*0:7C=:C72:30*00*:DD<.5C@FG77@D##################################
+@M01873:M01873:000000000-B9G3J:1:1114:14006:15367 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=CTATTAACTGCAGAAAT
+GTTTTTCAGGTCCTCCAGCACTGAGAGCCGGGTCCCGGCGCCGAAGTACTGAATGTTTTTGGCTCACAGCCCCGAGACGCGGCACAGAAACTGCCCCGTAGATCATTTCTGCAGTTAATAGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAACAAACAATACAAACACACATCACAACACGAGAATGACATCAGGCAAGAGATAAACACACCAGTCGAGCGATTCTGTGACCTCGAA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGFGFGGCGGGGGGGGGGGGGGGGGGGFGGGGGGGGGEGG######################################################################################
+@M01873:M01873:000000000-B9G3J:1:1114:10168:21472 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA|BARCODE=CCATGTCTTATTTTATA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACAGTGACCAGGGTGCCACGGCCCCAGAAATCGATGTAGTAACACCACTTCCCAGTACAAGAGGCTAGAGTACTTGCACAATAATAGACAGCCGTGTCCTCGGCTCTCAGACTGTCCATTTGCAAATACAGCGTGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCACTTCACGGAGTCCGCGTAGTTTGTGGTACTCCCATCACTATTAAGACGTGAGATCCACACCAGCTCCTTCTCTG
++
+GGGGGGGGGGGGGGGGDGEGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGFFFFGFGDGFBFGGFEFFBFFGGGDEFFGGGDFGGGGFGEFFGG<ECC?=FFGGGFF9EGDE=EFGFAFFFGGGGFGDE@<DGFE>F@FEGGGGGG7D>FGAFFGAFGFEBF9FECCBEE@FBBDGCC18BCGG,1;6?EC?CFFGGFCCF*?/:@FF7=ECEGGCCCGDCC5*:+97><E**:6*/9BFG=*<*/1:6:@@FD*.9:6=FG4<7C45:9?F9@####
+@M01873:M01873:000000000-B9G3J:1:1114:16929:21025 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA|BARCODE=CGATAAGCGTATTTAGT
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGATTAGGGTTCCCTGGCCCCAGGAGTCAAATCTAAACGTACCAGCTGCTCCTGTACCCGCCCTTCTCGCACAGTAATACACGGCCGTGTCCTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTTATGGAGGTGTTCCTGGTCATGGTGACTCTGCCCTGGAACTTCTGTGCATAGCCTGTGTTGCCACTGTTAGGGTACATCCATCCCATCCACTCAAGCCCTTGTCCAGTGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFEGGFGBFGGFGGFFFGGGGGGGGGGGCGCDE=FFGG9FFCFGFFGGFFGGEFEG8FF,<A@FGGGGGEGGGGGGGGG7D5ADGFEGGECEGGGDGGGGGGFCG<<FGGGGGFG@EFGGGG7FGDEGGCFFFGGGGG9BFDGGECFGGGF,=C<CFGGGGGG?9FCCF+;8F*<*0?CC?CFC?DG++;+;:;EGCCF+:*>FDDFFFGGF67@7CFFFFFC>@FC)*0CF463>?.<942*4:<?
+@M01873:M01873:000000000-B9G3J:1:1101:10064:16602 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCTGGTCGTGCAAGTGA
+GTTTTTCAGGTCCTCTCCAGGCACTGTCCTCAGGATGTTTTTCCCCGTAGATCACTTGCACGACCAGAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAACAGAGAAATAGACAAGTCAGCACAACACACGCGCAAGTAGACACAAACTACGTAGCGAGCATAGGACTCATTGAACTGGATGCTAACAATTAAACGGAGGGAAGCGAGAAGGGAGAGAAGAGACATAACAAT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEFGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGG###########################################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10065:3493 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TAGCTACGCAGTTATTG
+CTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATTGCTCCCCCCTCCTGGTCTGCTGGCACAGAGATACACGGCCGAGTCCTCCTGCTGTGTGCGCTGGATCGTCAGAGTGGAGACGGATCCCCCAGTCCTCTCTGCAGAGAAGCGATCACTGGGCAGCCCTGATTTGTCTGGTGCACTGTTGCCTTGGAAGTAAATTAAAAACTCCAGGCCCTGCCCCAGGCTCTGTCGGTACCAGTAAAGGGCAGCTTGACCTG
++
+GGGGGGGGGGGGGGGGGGGGGGG8FGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGCGGGGGGGGFGGGGGGGGGGGGGGGGFGGGGFGGGGGGGGGGGGGGGGG8FDFFCGGEGGGGFFGGGGGFGGGGGGG@FFFGGGGGGC8DFGGGGE8BFGGDF>FG5CEEGGGGGCE@FGF76>6;?FF?EFFGFGF6+=<97++=C@C+9EG*>67DGGFFF@GFC35<35<C?B/8C<CDD49=D*=?67B>B#########
+@M01873:M01873:000000000-B9G3J:1:1106:24704:16447 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TGTAGAGACTAACATCA
+GTTTTTCAGGTCCTCCAGTACGGTCAGCCTAGAGCCTTCTCCAAAAAACAGCTCCCCGGTGTTCTCTATCCCCGGGAAGCTGCTGGCGCAAAGATAAAGGGCCGAGTCCCCCAGCTCCAAGGTGCTCACATTCATCTCAGAGCGAGAGTTAGAGAACTGGCGCCCTGAGAATCGACCAGGGAAGTTTCCTTTGTTTCTCTGTGTCTCACTGAAGTATTCAAAGAGGAACTGAAGGCCCTGTCCTGGGGTCTGTTGGTACCCGGATACACTCCTATTCCCAG
++
+GEFGGG?DFGGGGGGGGGGGGEGGGGGGGGGGGGCFGGGGFGGGGGGGGGGGGGGGDGGEFGGGGGGFGGGGGEGGFFDGGGGGGGGGGEGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGFFCFGGGGGGGGGGGGGGGGGGGGGGGGGD9FGFGGGGGFCGDGEGFGCFEECFEGG>CE>C884BFFGGFGGGGGGGGGGGGC?FGGFGCF7E+3@GGGFGDGC**;CG69:<CC*9FFFGFG7*5CEFG:FG?ECGGC/CDC>5CFF**0=?F######
+@M01873:M01873:000000000-B9G3J:1:2111:9741:23838 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCTCTTCAATCTATTCG
+GTTTTTCAGGTCCTCTGTGACCGTGAGCCTGGTGCCCGGCCCGAAGTACTGCTCGTAGGTGAGGAGCCTGTCCCCCCTGCTGGCACAGAAGTACATGGCTGAGTCCTCCAGCTTTGTGGACCGGATCTTCAGAGTGAAATTTGATCCATCAGGCCTTTCAACTGAGAATTGATCATCGAATATTTCAGACTTCTCTGAGATTTCATTATTATAAAAGAAAACCAGAAACTCGACTTTATGCCCCAAGATTTGTCTGTACACATAGAAGTATAAGTGATTTG
++
+GGGGC9<9EF@FGGGGGGGFCGGGGGGGFGGGFGFEEG:CCG@FGGGGF,C9FFFFGGDFCDFFEGGDFGAFGGGCCFCF8FCCFGDFBD,<CEGDE@FF7FEFGGGEEEFDFGGGGFGGFGDGFFFFGDGGGF=D3@=CFGFF99FDGDFGFFGGFG9AFFF?FDF=D>F;EGFGFGGGGCFGFGGGFCC9DF?C,;C>9B=@C,1?C,1?8;BF7*,04,*=*3*<AE?*/*=D7+4++22=57CGFEGDCC?##########################
+@M01873:M01873:000000000-B9G3J:1:1101:10067:5517 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=GCAACAAAAGTTCGATA
+TTCGTTTGATGTCCAGCTTGGTCCCCTGGCAAAAAGTCCCAGGCCAGCGTGTAACTTGCATGCAGTAATAAACCCAAACATCCTCCGCCTCCACCCTGCTGATTATCAGTGTGAACTCAGTGCCTGACCCACTGCCGCTGAATCTGACTGGGACCCCAGAGTCCCGATAAGACACCTAATAAATTAGGCGCCTTGGAGATTGGCCTGGCCTCTGGTTAATCCTACTCAAGTAAGTGTCGCCCTCACAGTCTTCGCGCGTTTGACTAGACCTGCAGGAGAT
++
+DFGGFE9FDF,CFFDGG8FF;ECF;CAFD@<EEFC@@FFGEFCFGGG?FGFCF9<FDFGGDFGGFEAF9ECE,9B,6EC<,C,,<,@C6??CFC8=C,<BE,,:,5EFGGE,?E9F,5,:<,,5E,A<FDCCDCFE++++8AAE,@,9,C:8DD76FE+=:6,F8+8@+@BG,3@886,73@D>;,@DC*C*@@?F5<7,,,9,5=EGG#######################################################################
+@M01873:M01873:000000000-B9G3J:1:1114:20934:3692 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=TGATAAATCCGACATGA
+TTCGTTTGATCTCAACCTTGGTCCCGCCGCCGAAAGGCCCAGGTGAGGTATCATATTGGTGACAGTAATACATTACAAAATCGTCAGGCTCCAGGCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGTCGGGGATGCCAGCGGCCCTATTGGATGCACCATAGATGAGGAGCCTGGGAGGCTGGCCAGGTTTCTGCTGAAACCAGACTAAGGAGGTACTGCTGACACTCTGACTGGCCCTGCAGGAGAGGGTGGCTCTGTC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGDGGGGGGFDGGGGGGGGGGGGGGGGGGGGGGGGFCGFGGGGGFGGGGGG?FGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG:@,;?FC?EF;?FFGGGGGGGFG=CDCCGGGGGFDFCGFF+@CFCFGGGGF8CFGCC*6CD5*=CCCFGGFFC674CFFFFF*93<CFF@#################
+@M01873:M01873:000000000-B9G3J:1:2107:3490:8582 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=TAATTTAGGTTATTTCC
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAAAACGACAAGATCAGTACTATGATCCCACACCTGACAGTAATAGTCGGCCGCATCCCCGGCTTCGACCCCGTTGATGGTCAGGGTGGCCGTGTCCCCAGAGTTGGAGCCAGAGAATCGCTCAGGGATCCCTGAGGGCCGGTCCCTATCATAAAACATGACCAGCATAGGGGCCTGGCCTGGCCTCTGGCGGTACCAGTGCACAATTGTGCTCCACATGTCGGCTGCCC
++
+GGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGFGFGGGGGGGGGGGGGGGGGGGGGGGEFGGCDEFGGGGGGGFGEGAFFGGGGGGGGEFFEGFAA=BFGGGGGGGDGGGGGGGGGGGGGGGF@DGGFFGGGGGFGFGGGGGGGGGDGG:FFGGFGCFFGGGFGGGGFCFFGGGGGGGFGGGGGGGCGG5?EEFFG+AFGG7C@FGDFD6CCF>*<:FFGD5EGCDDGG8:F4AFFFGGCE?9ADCC:+<EEC6?79CCDGGG+)<?GFGFGBFB79C
+@M01873:M01873:000000000-B9G3J:1:2115:10908:20804 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=GATCATTTTGTTGATGT
+TTCGTTTGATCTCCAGCTTGGTCCCCGGGCCAAAAGTGTATAGCCAGAAACCATTATACTGTAGGCAGTAATAAGTTGCAAAATCATCAGGCTGCAGGCTGCTGATGGTAAGAGTGAATTCTGTCCCAGATCCACTGCCGCCGAACCTTGATGGGACCCCACTTTCTAAACTAGATGCCTTACTGATCAGGAGCTTAGGGGCTTTCCCTGGTTTCTGCTGATACCAGGCCAATAAGTAACCAATACTCTCACTTGCCCGGCAAGTGATGGTTACTCTGTC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGDGGGFGGFGG?DGBFGGGGGGFGFGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGG=FGGGGGGGGGGGGGGGGGFGGGGC8DFGGGFFCGGGCF,DFGG?FFGFCGGF7,,5=FCDEGFFFGAFFGGG=<<?46D4@FFGG7CGGGC5DDGGFFFF=637-7>C:FF#
+@M01873:M01873:000000000-B9G3J:1:2110:7628:11014 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=GGATAACGTCAAAGAAT
+TTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTACTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAGAATTCTTTGACGTTATCCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGCAAAAAAAAAACAATAGAAGTGAGCCGTGATGAGTACAATGCACTGTT
++
+9CFFCGGFGFGFGGGGGGGGGGFFFCAFGGFFFGGGGGGCEEFGGGGGGGGE@GGEGGGGGEFGF@AFGGFCFGGGGCFFGFGFGGGGGGGEFFGGGDGGGGG7F,,E,BF<EFGGGGGG9EGGGGGCCGGGGGGGGE7FGEF8<FGECGGGGFGGFFGGGGGGGGA>DCFCFCF+@@EFFGGGGGGFGGGFGGF>DGGGG?FFFG7@:@28CFFGFDGCC:8=59<C?FGG*21:*31)9CC#####################################
+@M01873:M01873:000000000-B9G3J:1:2105:10953:6580 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHD|BARCODE=AGCTGTGTGACAATGGG
+AATGGTATACTAAATCACATGGTTTGCTTGTTCAGCAAGCTTTACCAAAAGCTAAACTTAAAGAAATTGTGGCAGAATCTGACGTTATGCTCAAAGAAGGATATGAGAATTTCTTTGATAAGCTCCAACAACATAGCATCCCCGTAGATCCCCATTGTCACACAGCTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCCATCTCGTATGCCGTCTTCTGCCTGACAAAAAAAAAATAATTTTCAGGAACAGAAGACAACAAAACATAATT
++
+<,CFE-;CEFGA<CF<FGAE<FCFE@,EFEEFGCFAF86C@FFECCFF@CFCE@FFGGDEGCF9C<EF<FCDGF@D@FF<E9CF6@FGGGGFG9F,E=<=9E?EBAFE?FGG9E?@<FEFFAFGF@E<<=,BAFFGGGGG<,?=CFGGG,:EFFG:D@ABFEDEF8FGGGGG7+3@>,AB=F@EG8D8+,@DFG,,<ECFA<EFF,,7@,,@7@:DE,@CE8D8,D?###################################################
+@M01873:M01873:000000000-B9G3J:1:2103:6418:17742 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=ACAACTTGTCTTGGCTC
+GTTTTTCAGGTCCTCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTCACAGCCTGGAGGCCCAGGACAAAAACCGGTGCTGCCCGCTCTGCTGTCCCAGACTCAGCTCGGGTCCTTCCCACCGCTGAGAGCCCCATCGCTCTCCCAGCACCCAGAACCAGGAGTCCTCCGCCCAGACGCCCAGCAGCGCCTCTCAGCCCCCGTATGCTCGAATACATAAAGTAGATCGGAAGAGCACACGTCTGAACCCGTATGAGCCAAGACA
++
+GECGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGFGGFGGGGGGGG>FGFGGGGGGGGGGGGGFCGCGGGGGGGGGFDFFGGGGGGGGGGD@CFGFEGGGGGGGGDCGGEGDGCEEG8CF6=F88CEE?FFCGGGEECC:@C+9<8E8<@C+<?CC*3*2+@7C<E5<FFC7FCGGGFGGG+C<C8.9C**19A?#####
+@M01873:M01873:000000000-B9G3J:1:1110:22639:11539 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=CAGCTACACACAGTAGA
+TTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACACCGGAGGCCCTTCGCTACGCTGCTGACAGTAATAAACTGCAAAATCTTCTGGCTCTAGGTTGGTGATGGTGAGAGTGAAGTCTTTCCCAGACCAACTGCCACTGAACCTGGCTGGGATGTCAGTGGCCCTGTTGGTTGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTCTCTGTTGATACCAGGCTAAGTAGCTACTAATACTCTGACTGGCCCTGCAGGAGAGGGTGGCTCT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFDGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGEFGGG<CGGGG=FGGGGGGGGD7CGFGGGGGGGGGDFGFFGGGGGCGFGGFGG4CFGGGG4DFD><FF?F3D<6>3<0B?FF@
+@M01873:M01873:000000000-B9G3J:1:1113:6140:4661 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=AACCCTTCAGCAGTACC
+CGAGGGGGCAGCCTTGGGCTGACGTAGGACGGTCAGTTTGGTCCCTCCGCCGAATAACAGGAGAGTGGGGGTGCTTGTATATGAGCTGCAGTAATAGTCAGCCTCGTCCTCAGCCTGGAGCCCAGAGATGGCCAGGGAGGCCGTGTTGCCAGACTTGGAGCCAGAGAAGCGATCAGAAACCCCTGAGGCCCGATTAGTGACAACATAAATCATGAGTTTGGGGGCCTTGCCTGGGTGTTGTTGGTAACAGGAGACAAAGTTATAACCCCCAACGTCACGGC
++
+FFCCEC>EG@F:FFGGEGGFGGFGF@CFCFGG:FCE<,CECCDFFFEFFGGGGGEGFFGGCFEFFEEEGGDBFC9FF>FFGFGGGGGGGGG<FECFGFFBFBF8,FF>CFFFGEFGGGFGFEGAFGGF@F@>3CGGGGGG:CFFCFFFFGGGGGGCFGGGFGEFFGGGGGGGCFGGGGFG*?EFCFGGF*AGG*:EFCF7+<+;C*<CFD+<::?C9<+<EEEDD25C6*>*:CCFGE*8C5DGCF###################################
+@M01873:M01873:000000000-B9G3J:1:1114:9970:8638 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRA|BARCODE=CCGGTTAAGATATCGTA
+TGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCCGTCGACGGCTGAAACACTTGGTCCTTGCTTTCTGCAACCTTCCAGAGAGAGTTGAGGAGAAGCCCTAGCCACACCGCCCCCAGAGTGCTCTGCAAAGCCATGGCCAAAATGCAGTTGGTCTCACCAGAATGCTTCCCCGTAGATACGATCTCTTAACCGGAGATCGGAAGAGCACACGTCTGAACTCCAGTAACCTATACATCCCGTATGCCGTCTTT
++
+GGGGGGGGGGGGGGGGGGGGCGFGGGGGGGFGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGCEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGFC<FFGGFGGGGGGGGGGGFGGGGDF@EGGGGDEGGADGGGGGGGGG9FGFGGFGGGCFGGGGGGGGFFFGGGGGGGGGGGGGGFGGGGFGGGGGDGDGC*=*=,=CCCDFG5CEGCDEE35C*28C5<>CFFCCF9)*/99<F**2>FFFFFF*6*)17>::BF######
+@M01873:M01873:000000000-B9G3J:1:1107:8981:22378 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=GGATATCGAAGAATCGC
+TTCGCTTCATCTCCACTTTGGTCCCAGGGCCGAAAGTGAGTGGCCAGTGTGTACTTTGCATGCAGAAGTAAACGCCAACATCCTCAGCCTCCACTCTTCTAATTCTCAGTGTGAAATCAGTGCCTGACCCACTGCCGCTGAATCTGTCGGGGACCCCAGAGTCCCGGTTAGAAACCTTATAAATCAGGCGCCTTGGAGATTGGCCTGGCCTCTGTTGAAACCAACTCAAGTACGTGTCTCCATTTCCGTGCACGAGACTTTGACTAGACCTACAAGAAAT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGGGGGGGGGGGGG=CEGGGGGGGGGGCGGFCG6CFGGGDDGFFGGFGGGDFFFGGGGGBGG3>CFGGDGGFFFG=>49FGFF@FFFFFF##
+@M01873:M01873:000000000-B9G3J:1:1101:10099:23047 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=CTGCCACACTTTGAAGA
+TTCGTTTGATTTCCACCTTAGTCCCTTGGCCGAACGTCTTCCAGTTATGATACTGCTGACAGTAATAAACTGCAAAATCTTCAGAATGCAGGCTGCTGATGGTGAGAGTGAACTCTGTCCCAGACCCACTGCCACTGAAGCTGGCTGGGACACCAGTGAACCTAGCGGATGCACCATAGAGTAGGAGTATGGGAGCCTGGCCAGGTATCTGCTGGTACCAGGCTAAGTTCCTCATAACACTCTGACTGGCCCTGCCGGGGAGGGTGGATCTTTCCCCTCG
++
+EC@FFE@;EC<EFGGGGGGG9ED@<ECF8F?FGCEEGFGEEEEFFGGG9,C,EE9<9A9FGGC,CE9EFGGCCFFGGD<FG<FFF,<EFFF,F=FBA8EEFEFEFCFGF?FFD<EFGGC@FEDFF<=8CFD@<BF8,,<,,AEGDC:?68A+6ADFFGFDD@D8D,>>@C@8BFCC,,7@,,,,5<:<,3:7,,+4*@AD>C,;;,@@7,2::C?1<@7,>***2*<=2C+BDCD7+08;F)8+=+18?5A#############################
+@M01873:M01873:000000000-B9G3J:1:1101:10100:15992 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=CCAAATGCTAAATATTC
+CTTGTTCAGGTCCTCTACAACTGTGAGTCTGGTGCCTTGTCCAAAGAAAGCTTCAGTGTTCATAAAGTTGAAGCTGCTGGCACAGAGATACACGGCCGAGTCCTCCTGCTGTGTGCGCTGGATCGTCAGAGTGGAGACGGATCCCCCAGTCCTCTCTGCAGAGAAGCGATCACTGGGCAGCCCTGATTTGTCTGGTGCACTGTTGCCTTGGAAGTAAATTAAAAACTCCAGGCCCTGCCCCAGGCTCTGTCGGTACCAGTAAAGGGCAGTATGACCTGAAA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGFFFDGGGGGGGCGGGGGGGGGGGGGGDGGGGGGGGGFFGGGCGGGGGGGFGF?EFGGGGGGGGGGGG<FCCCF*;CFFGBGGFGF*;FFBD>DGGGGFF@CFFFF:)8AF<AFF?FGF
+@M01873:M01873:000000000-B9G3J:1:2107:8132:17450 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TTGTCAGCCTGTGGTTC
+GTTTTTCAGGTCCTCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTCACAGCCTGGAGGCCCAGGACAAAAACCGGTGCTGCCCGCTCTGCTGTCCCAGACTCAGCTCGGGTCCTTCCCACCGCTGAGAGCCCCATCGCTCTCCCAGCACCCAGAACCAGGAGTCCTCCGCCCAGACGCCCAGCAGCGCCTCTCAGCACAGCCCCTCTCCCCCGTATGAACCACAGGCTGACAAAGATCGGAAGAGCCCACGTCTGAACTCCAG
++
+GFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDEGGFGGGGGGGGGGGGFGGGGGGDGFGGGFGEGCFGGGGGGGGGGGGGGGGGGG>:<CEGG8CGGGFD?FDECFGGCGFGCCEE*21:CDC7E7FCCGG4@*:9+:000;F5D5::740/:@=87@FFGF>FGC0
+@M01873:M01873:000000000-B9G3J:1:2119:20248:11282 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=TAATGTACGGAAATAGA
+TTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGTACAGAGGAGGCTGTTTGCCTTGCTTACAGTAATAGACCCCAGCATCCTCAGCCTCCACCCGGCTGATTTTCAGTGTGAAATCTGTCCCAGACCCGCTGCCACTGAACCTATCTGGCACTCCAGAGAACCGGTTGGAGACTTCATAGATCAGGAGCTGTGGAGACTGGCCTGGCTTTTGCAGGTACCAATACAAATAGGTCTTTCCATCACTATGTAGGAGGCTCTGACTAGACTTGCAGGG
++
+GGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGFFEGGGGGGGGGGGGGGEGGGG@FFFGGGGGFGGGGGGGGGGGGGGGGGGGDFEEGGGGGEGEFGGFD;AFGGGGGCFGGGGCG6CFFGFFFGFECFGGG,9C>FGGFGFG6?FGGGGGCCFF7FECCEGAC7+@CCCFC<C>=5CCFFGFF###########
+@M01873:M01873:000000000-B9G3J:1:2115:23638:16692 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRA|BARCODE=CACACAAGGAGACACGT
+TGGATATTTGGAAAGACTTGTAATCTGGTCCCAGTCCCAAAGATGAGCTTGTCGGTGTTATAAGTCCTATAAGCACAGAAATACATCGCGGCAATCCCCCAGCTGTGAGTCTGAGATCTTGAGACTGAAGGATTTGGCTGCTTTCTGGAAGTTCACAGAGAAACGATTCTCTGTTGCATTCTGTTGCTTATAAGATTTTTGGCGAATAACGAGAATAATCTGCCTGCTGGGAGGCTGCTTGTACAAGAAGAAATAATAATCACACTCACTGGTGTCATATG
++
+GGGGEEFFGFFGGGFGGGGGGGFFDGGGFGGGGGEFGGFFGG<C9FF9FFFEGGGGGGGGGGGDFGFGGDFGACFFEGGGGGGGFF9?FGGCEGGGGGCFG+,<<FFFGGFGABCEG9<9FGCEFGDFGGGGGGGGG,,FF?AC<CFGFG,D9FD9FCFD8F8>DGGGBD9FD;CDFEC;FCCFAEFE9ECFFF,E>,5@8:@*3114,4;>C;C9,,15BCC,AEFGGGD;ED*;C3F+;<9C+2<<<*>6;7?FFFF######################
+@M01873:M01873:000000000-B9G3J:1:2106:2176:11695 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=TGTAAATAGTTTGCCTA
+TTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGGCCAGTCTTTATACTGCTGACAGTAATAAACTGCAAAATCTTCAGACTGCAGGCTGCTGATGGTGAGAGTGAACTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATACCAGTGGCCCTGGTGGATGCACCATAGATGAGGAGCCTGGGCGACTGGCCAGCTTTCTGCTGGTACCAGGCTACGTAGCTGCTAACACTCTGACTGGCCCTTCCGGGGAGGGTGGCTCTTTC
++
+EFGEFCFGGGGGGGGGGGEECAFDDFGGFGGDFGGGGGGGGGGGGEGGGGGGGGGGFGGGDG,EFFGGGGGGGCAFGGGGGGGGGGGGGEGEGGGGCDGGFGGFGGGGGFGGGDG,CEFGGGFGAFGDFFGGGGGGCFE@FF8EGGGCCCFGGGG8A6DDDFFF8CEEGBFDFEFGCEE,>FFFF,ECFFEGE8;<8*@5CEGG5DFG,*>6<?CF?EFFGGECCCC5/=C*7A6CFGFE6<CFFFC#################################
+@M01873:M01873:000000000-B9G3J:1:2118:8705:16266 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=TGTGAACAAGATATCAT
+CGAGGGGGCAGCCTTGGGCTGACCCAGGACGGTCACCTTGGTCCCTCCGCCGAAAATTACAACGTCATCATTGCTTAGGGAGCAACAGTAATAATCAGCCTCATCGTCAGCCTGGAGTCCAGAAATTGTCAGGGAGGCCGTGTTGCCAGACTTGGAACCAGAGAAGCGCCGAGAAGCCCCTGAGGGCCGCTTAGTGACCGAATGAATGATGAGTTTGGGGGGTTTGCCTGGGACTTGCTGGAACCAGGAGACACGGTTATAAGTCCCAAAATCACCACTGC
++
+GGGGGDGGGGGGGGGGGGGGGGGGGGGGGGFG7FEEAFGGGFFGGEGGGGGGGGGGGGGFGGFFFFGGGFGGGAAFGGCGGGGGGGFFFFGGGGGGGGGGGGGGGGGGGGDFGGFFGGGCGFGGFGGGGFGGGGGGGGGGGGG>FFGGGGG7;FGGFEFGGGGGGGGGGGGGEGEEFGFGGFGGGGCFEE5;CG<EF7CEGGCAEG+AFC99>:0CFCEEGGEGGG?9FGFD*2*+;CCFFFGDGGGCFGDFCGGGGEDFFFB+:>>F:C@>@?:5@####
+@M01873:M01873:000000000-B9G3J:1:1101:10107:18394 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=TGTGTATGGGCACACTT
+TTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGTTTGTAGACCTTGCATGCAGTAATACACCCCAACATCCTCAGCCTCCACTCTGCTGATTTTCAGTGTAAAATCTGTGCCTGATCCACTGCCACTGAACCTGTCAGGGACCCCGGAGGCCCGATTAGAACCCAAATAGATCAGGACCTGTGGAGACTGCCCTGGTTTCTGCAGGTACCAATCCAAATAGTTGTCTCCATTACTGTGCAGGAGGCTCTGACTAGACCTGCAGGCGAT
++
+GGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDDDGGGFFFGGGFFGGFGGFGFCGGGFDGGGGGGGGGGDFFGGGGGGGGGGGGFGGGGGGFGGGGGCG<DEFGGGGGFGGEFFG57>DEC?CCGGG7EFECCCGFGDDFGGG47E87CCFGFFFFFFFAFFFGFFGF+7CF3DCG4;AFG=FF4?@###########
+@M01873:M01873:000000000-B9G3J:1:1101:10111:8693 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=GCGACTCTTTCATTTAG
+TTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGTAATTGGAGGCCAGTTATCATACTGCTGACAGTAATAAACTGCAAAATCTTCAGACTGCAGGCTGCTGATGGTGAGAGTGAACTCTGTCCCAAACCCACTGCCACTGAACCTGGCTGGGATACCAGTGGCCCTGGTGGACGCACCATAGAGGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGCTGGTACCAGGCTAAGGAGGCGCTAATAGTCTGACTGGCCCTGCAGGAGAGGGTGGCTCTTTC
++
+GGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGEFGGGGGGGGGGGGGFFFFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFFGGGGGGGGGGGGGGGCFGGGEGGGGGGGGGGGGGGGGGGGGGGCFGGGGFFGGGAEGGGGFGGGGD6BEGGDECDFGG>ECGGGGGGC5@EFGGGGGC5CF:=CFGGGG?CDGGDECFGCFC=CFGFFDEDFFGFFFFFFFFGC9CGFF4CF3@FEFFFFF0?F(?##
+@M01873:M01873:000000000-B9G3J:1:1106:7472:17358 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=GTCATTTGCTGTAGGCA
+CGAGGGGGCAGCCTTGGGCTGACTTAGGACGGTCAGTTTGGTCCCCCCGCCGAACATTCGATGATGACGGCTGCTGTCCCGGGAAGCACAAAAATACTCAGCCTCATCTTCCGCCTGAGCCCCAGTGATGGTCAAGGAAGCTGTGTTTCCTGACCTGGAGGTAGAGAATCGGTCTGGGATCCCTGAGGGCCGAGTGTCTTTATCAAACATGAGAACTGTAGGGGCCTTCCCTGGCTTCTGTTGGTAACAGCTTGCCAAAAAACTATTGAGGTTGTATCCTT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGFFEGGGGGGFGG8F@FEFGGGGGGGGDGGGGGGGGGGGFFFGGGGGCGGG7FF<EGFCFGGFGFFFGDFCGFGGFGFFFGGGGGGEGFE<,F@FG@BCGG,F<E7B;<EGFCFGGGGGCCFFGCCE**2@C99C7<:FGFFG=FGGGGG+<C?CFGGGGE5+<?CF65FC52::@GFFD**9@99??F=+*2*95/CGFFGCFGC##########
+@M01873:M01873:000000000-B9G3J:1:1113:11846:1631 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=TTTACAGTTCCTTTCTG
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAACTTGGTCCCTCCGCCGAACACCCAAGTATCACTACGACTCTCCCACACCTGACAGTAATAGTCGGCCTCATCCCCGGCTTCGACCCTGCTGATGGTCAGGGTGGCCATGTTCCCAGAGTTGGAGCCACTTAATCGCTCAGGGATCCTAGAGGGCCGGTCACCATCATCAGAGAGGACCAGCACAGGGGCCCGGCCTGGCTGCTGCTGATACCAGTATCCATCTTTACTTTGAATGTTGTTTCCCC
++
+GGGGGGGGGGGCGGGGGGGGGGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGFGGGGGGFFFCEGGGDF83BBF>FGBDFEAF7FGGGGGFGGGGEEEGGGGDCEGGDGG@FFCGGGGGGGGGG>CFGFGGFFGGFGGGGDGGGGGFG9ECGGFGGGGDCFGGFGGG7EFGGGGEGGGEGGFCF6CFC++<858EGGGGGGG*0CEDD5*9EGGGG5CFG>*?G:FGG?C7@?F**/097DBG:*0946*6*9@FFF:075645
+@M01873:M01873:000000000-B9G3J:1:1113:28641:15469 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=ACACGTTGCGTATGAGA
+TTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTACTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAGATCTCATACGCAACGTGTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAATCAAAAACTCAATAACACACAATCTAAGCCACATCAC
++
+GGGGGGGGGFFGGGGGGGGGGGGGGGGGGFFFGGGGGGGGGGGGGGGFGGGGGGGGGEGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFFGGGFGEFGGGGGGGGGGFFGGGCFGGGGGGGGGGGFGGGFGEGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGBEGGGDDGGCGGGG:8DFFGGCGGCEGGGGGGFGGGGGCFDFGGGGGGGGEDGGGDDFGCFECFF############################################
+@M01873:M01873:000000000-B9G3J:1:1101:10117:24419 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=TAAGCTGCACAATGAAT
+CGAGGGGGCAGCCTTGGGCTGACCCAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAAGTGAAAGTGTCACTGTCCCAGGTCTCACAGTAATAATCAGCGTCATCGTCAGACTGGAGATTGGAGATGATGAGGTAGCGGTCAGCCCCAGAGATGGAGCCTGAGAAGCGATCAGGAACTCCGCTAGCCTTGTTGTAACTTCCACTACCTTCAATCTTCATCAAGTCCTGAGGGGCCTTCCCTGGCTGTTGCTGATGCACTGCGCTGTATGTACTATGTT
++
+GGGECEEEGG:FGGGGFGGGGGFEFGGFFFEFGGGGGGGFDFFGGGF:CDGGGGGD8CFGGGEFCFC<<A@FGFFFED8C<EDFFFGGGFGGCFFGFFGFD@FEGFGGFFFFEGFGGFGCCFBCGDC>FBC=@;FFFCAEFGGGDFCBE7<BAA<FC722:4B72:F9EGD8CCCFFGGGFC9C5?*:30<:<:<88@@C9C+AFCE##########################################################################
+@M01873:M01873:000000000-B9G3J:1:1117:12944:14016 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=AGCCCATTTCATAATTA
+CTTGTTCAGGTCCTCTACAACGGTTAACCTGGTCCCCGAACCGAAGGTGTAGCCCAGAGCCTCCTGTCCGGCGCTGCAGAGATATATGCTGCTGTCTTCAGGGCTCATGTTGCTCACAGTCAGAGTTGAGAATGTTAGGTTTGGGCGGCTGATGGGAAACTTGTCAATGACAAATCCACTCTCATATGTGGCATCAGAGCCCTGATTTGCAGTTGAGATCAGTGTCAGGCTCTGTCCAGGTTGCTGACGGTACCAGAACATCATGGGGACTTGGCTATCGC
++
+FGGGFFGGGFGGCEFFGGGCGFGEECFFEFGFCFF?GG+FFCFGGGGGFAFA<CF@E<FGGGFGGGFFF7=@:FECFDF,BFEEAFFGF9?FCFGEGGGCG9DGGFFCBF@E,AB<FGGGBFF9FFAFCFDFGGF,55@CFCF+@=3553FEC,<FGF,5DCFGDCC;DFFCBCCCFFFFCGFCC>99=,<5,4<CG6FGFC8*2+4;<C?+;CF+0:9CF?C?C7CG*>5*2**:9??*)2**<*2.5)9>DFGF*:>0:CFC#################
+@M01873:M01873:000000000-B9G3J:1:1111:27451:7271 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=GCATTTCTTGCAACTAC
+GTTTTTCAGGTCCTCTGTGACCGTGAGCCTGGTGCCCGGCCCGAAGTACTGCTCGTGGACCCCGATCTCACTGCTGGCACAGAAGTACACAGATGTCTGGGAGGGAGCAGCCGACTCCAGCCTGAGCGAGAACTCCCGTTTGTTTAATCTGGAGACATTGTAGCCATTGGGGACTTCTCCTTTGTCAGTGGTACCCTCAGAAGCTGAGTAATAAATCAGCCTCAGTCCCATGCCTGGGTCTTGTCGATACCAGTACATGGAGTTATGGTTCATATCCTGGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAEGGGGGGGDGGGGGGGGGGGGGGGGFGGG7FGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGDGGGGFGCGGGGGGGGGGGFGGGCFGEGFGFGGGFGFFGGGGGGGGFGGGGGGGGGGGGGGGGGGGEGEDFFGGGGGGGFFGGGGGGGGGGGGG@FFE?FGGGGGFGGGFFFGGGG=GGGGDG@DGFDGGCDF974:FFG35>FDFF6CCCF**97)9594:497=<F=FBF<FFF
+@M01873:M01873:000000000-B9G3J:1:1116:19939:2288 1:Y:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=GTCCGTCCTTATTTTGT
+CGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCCGTAGAACACAAAATAAGGACGGACAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCTTATGCCGTCTTCTGCTTGAAAAAAAAAAAAACATCAGGAGAGAAGGACAGTGACACACTGATGTTTTCCGTCTGGTCTTTAAGGTTTCAGAGCAAACTCAGCGCCCGTAGCTGCTTAGCATGTGGATCGATACAATAACTAATGTGAGCGC
++
+GGGC++C+@F@FGGGGGGGG:<FFFGG<EEFGGG@FFFGE@FEDGGGEGEEGD:FGGGGGGCEFGFGDFFGFFFDFGGFFGG:E@BFGDD7=FEGGGGG<<FFCD*@FCFGFD:FFCFGC@C:FCAAFF,@CC,7F7<<A<,@?;FEECCFGGC###############################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2108:15031:12741 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=GGTTTTCATAAAACTCT
+CTTGTTCAGGTCCTCTCCAGGCACTGTCCTCAGGATGTTTTGAGCTCCTTAGAGCTGGATGTCTTTGTAAGGCTGTTTGGCGAAGGGGCTGGTCTTCTCCAGTACCCACCCCTCTCCCCCGTATAGAGTTTTATGAAAACCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAACATGATCCGCGTAAGGCTGATACGAAGAGCAAAAGGCAGCAACACCACGCACATAGACTCAAC
++
+GGGGGGDFGFFGGGGGGGGGGGFGGGFFFFGFGGG@FGGGFGGCFGGGGGGGGGGDFGFGGGGGFGGGGGGFGGGGGGGGGGEGGCGGGFG7FDFDFGGGG8<EGGFFGGGGGGFFGFEGGBCFF<?,EEFGGDGCFDFGD8FDFGGGGGGGCCFD8D>BCBF9FFF9<CFGCDFGGGGGGC@;=>@C<3:?C8:CGG9:@C>;CFD7ECECE5E##################################################################
+@M01873:M01873:000000000-B9G3J:1:2117:19601:12685 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=CAGAAATTCTGTACAGC
+CGAGGGGGCAGCCTTGGGCTGACTCAGGACGGTCAGCGTGGTCCCTCCGCCGAATACCACATGGGCGTCGAGGCTGTCATCCCAAGATGCACAGTAATATTGGGCCTCATCGTCAGGCTGAAGACCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCGGAGGGCCGCTGATCATTACTATAGATGACGACTTTGGGGGCCATTCCCGGGACCTTCTGGTACCAACTTACAGTATTTCTTCCCCCGTAGAGCT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGEEGGGGGGEFGGGGGGGGGGGGGGGFGGGECFGGGGGG=EGFFFGGDGGCDFGC9D97CFEG6CFGGGGD?CGGGFFCB9:FFFDFFFFG?
+@M01873:M01873:000000000-B9G3J:1:2109:17364:9116 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=GCAATATATTTAGGCTT
+TTCCTGACTTCTGCAAGTACCAGTCCAAAGAACTGTATCCATTAATATGTAGGAGGCTCTGATTATACCTGCAGGAAATGGAGGCCGGCTCTCCAGGGGTGACGGGCAGGGAGAGTGGAAACTGAGTCAGCACAACATCACCACTGGATCCAGAGACCCAGAGCATTAGCAGCCCCAGGAGCTGAGCAGGGAGCCTCATTGTGCGGAGAGGAACTGAGGGGTGCTGATCCCCGTATCTCCGCCTAACTATATTGCAGATCGGAAGAGCACACGTCTGAAC
++
+GGEGEC-CA-@F<FC<FEEFF9FG<CCF<<CFC@EGDEDEF9FGF@E<FF9CA@C:C@EDFC<FG,FCC<FFDC<,C<CC,6:CFCFDE:F<FD<E@F>BCEGGG7>+B+4?F??5CFCF98?<5FEE?<,5A=A486A,7D,DC8A8DDECE,AFG?:36:@DFCD,@AD9D:+38@C3+@4>,6:D,**35::D,6?@,2,,6*B8**6:C6,9,<83*=*3939CF9C*3/2AF+++:/2C300:7*<CG###########################
+@M01873:M01873:000000000-B9G3J:1:2105:12905:4671 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=ACATTAAGACCAGAATT
+GTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCAGGCTGACTAGTCCCACGGGGTTCAACGCTGCAGAGATATATGCTGCTGTCTTCAGGGCTCATGTTGCTCACAGTCAGAGTTGAGAATGTTAGGTTTGGGCGGCTGATGGGAAACTTGTCAATGACAAATCCACCCTCATATGTGGCCTCAGAGCCCTGATTTGCAGTTGCGATCAGTGTCAGGCTCTGTCCAGGTTGCTGACGGTACCAGAACATCATGGTGACTT
++
+GGGFGGF<FFGGGGGGGGGGGGGGGGFGGGGEGGFGFGGEE@FCCGGGGGGGCECEFGGGFFFGGGGGEFFGGFCGEFDGGEEGCEGG9ECEDFGGGGDF9BFDFEGGGGFGDG7FCGGGGFGGFCFG9FDD9FFAFGFAA<FFG,DFDFGGGGFEEGGGGCEGF7CCCG9DF<D@EFFG9FCFF@CFF**=EGGGGGGGGCF:88EGGCFGG*9CCG?CFCCF?EEGGG9CCFF*AC*0=FFCC6+6:FCGFFGGCDGGD3+:+8C@FB68>A6<F6<@=
+@M01873:M01873:000000000-B9G3J:1:2116:7856:19893 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=TTTGAACTGGGTGCAGT
+CCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAATATTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACTGTGATATATAAACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTACTCATTTTCCTAATTACCATACTAATCTTAGTTACCGCTAACAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAGGCATTATATCCTTCTTGCTCATCAGTTGATGATACGCCCGTAGAACTGC
++
+GGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGGCGGGGFFGGGEFFGGGGCFFCEFGGGGGGGGGFGGGGGGGGGGFFDAFFGFGGGGGGGFFGGFEFFGFCGG;FFGGGGGFGC,EFGGGFGFGGFGCE8>EGFFGEFF=FCFGGGGDFGGGFGFGGE6F?F<C:E>C5EG,<>EGDFGGCFF;CF>FC7,=C74B:8+4877:F4DDBB5>71CFFF4
+@M01873:M01873:000000000-B9G3J:1:2106:17308:17099 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA|BARCODE=GTGAGCACCGTTTTGTA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCCTTGTCCCTTGGCCCCAGATATCAAAAGCATCACCCCAAGTCACCGCAGTCCCCTGACCTCTCGCACAGTAATAGACCGCCGTGTCATCGGCTCTCAGGCTGTCCATTTGAAGATATAGCGTGTTCTTGGAATTGTCTCTGGAGATGGTGAATCTGCCCTTCACGGAGTCTGCGTAGAATGTCCTACCACCGCTATAAAGAAATGAGACCCACTCCAGTCCCTTCCCTGGAGCCT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGFGFGG?FGGGGGGCFDGGGGGGFGFFGGGG:FFGGGGGGFGGDFFGGGGGGGGGGEAFGGGFFGGGFFGGEGGGGGGGGG7CCGFF@E99E:EG28<EGGGGG9BCF6*5:*?CFECCEEFF+*=*8CC?ECFFFGGFFGCDE3CG?C+*+**29C9:9*AFED?FCFG=F?+8:)>9:(2.AD?
+@M01873:M01873:000000000-B9G3J:1:1101:10137:13722 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA|BARCODE=GAGAGTTGTCTAAAATC
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGGAGAAATAACCACTACTATCGTAATAGTGGCTCGCACAGTAATACACAGCCGTGTCTTCAGATCTCAGGCTGCTCACCTCCATGTAGGCTGTGCTCGCGGATGTGTCCCTGGTAATGGTGACTCTGCCCTGGAACTTCTGTGAATATTTTGCGTTACCATTGCCAGTGTTGATCCATCCCATCAACTCAAGACTTTGTCCGGGGGCCTGGCGCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGDDGFGGFGAE<DFGGGGGFCGGGGGGGGGGGGFFGGGGGGGGGFGGGGFGFCFDGGGGGGGGG@C@EFCFGGFBF8FF?FDGGFGGFGG?FGCFGFFGGFGGGGFEFCC7CGGGGGG5CC=>EGGGGCGDC=:DFGFB:6:DFF6*9CFFB**7*029@B>BF45:)8(07??#####
+@M01873:M01873:000000000-B9G3J:1:1111:13857:12993 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA|BARCODE=TGGATAGAAAGACTAGT
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGTCCGTAGTCGCCGTTGGGCCTCTCGCACAGTAATACACGGCCGTGTCCGCGGCAGTCACAGAGTTCAGCCTCAGGGAGAACTGGTTCTTAGACGTGTCTAACGATATGGTAACTCGACTCCCGAGGGACGGGTTGTATTGGGTTCTCCCACTGTTATACATGTACCCAATCCACTCCAGGCCCTTCCCTGGGTGCTGGAGGATCCAGTTCCAGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGFGGGGFCFGGGGGGEGGFGFGGGGGGFEG@FFGGGGGEEGGGGGFGGGGD9FEG9<<FFGGGGGGGFCFFFCFGGGGGFGGGE7CGGGGDG>EGGGGGG@EEGGDG+:CEGGG=;EGGGGGC:?EFFE=CCCGCFGE8ECC+?7EGFGGGCGG<57?96<7C*C?<>BFG4?CGGF3D*..7@)09@>*7:?@=A6AFFF
+@M01873:M01873:000000000-B9G3J:1:1108:14300:19094 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=AAAGAAGGTGTAACTTC
+CGAGGGGGCAGCCTTGGGCTGACTTAGGACGGTCAGTTTGGTCCCTCCGCCGAACACCCCAGCAATCAGGCTGTTATCCCAGGTTCCGCAGTAATAATCGGCCTCGTCCCCAGTCTGGAGTCCGGTGATGCCCAGGGTGGCTGACGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGAATCCCTGAGGGTCGCTTATTACTGTCATAAATGAGGACTTTGGGGGCTGTTCCTGGGAGCTGCTGGTACCAGAATACATAATTGGTCCCAATGTTGGAAGAGT
++
+GGGGGCEEGEGGFDFGGGGGGGDGGGCFGGGGGGGGGGGGGGG8FGGGGGGGGGGGGEGGGGGGGGGGGDDFGGGGGGE?FFEFFGGGGGGCDGGGGGFGGGGGGEGGGFDFGGGGGFGGGGGGG>CFGGGFGGGGCGEGGGGGGGGGGGGGDGGGEFGDBFC:FFGFGEFGGGG7F7C89EF8A6C;EBFEGCFEGGGGGGF9CCCFEGGGGFFGGGCFGGEGE5CFF7:9CC5<<>GF:DG+79:77<CGFG*9CFDF>>6097F>:5:@#########
+@M01873:M01873:000000000-B9G3J:1:2107:6181:15590 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=GCGCTATTCTAAATGGG
+AGTGGGGTTGGCCTTGGGCTGACCTAAGACGGTGACTTTGGTCCCAATTCCGAAGACCCTAGTGGTGGTACTTGTATATGAGCTGCAGTAATAATCACCCTCGTCCTCAGCCTGAAGCCCAGAGATGGTCAGGGAGGCCGTGTTGCCAGCCTTGGAGCCAGAGAAGCGATTAGAAACCCCTGAGGGCCGCTTATTGACATCATAAATCATGAGTTTGGGGGCTTGGCCTGGGTGATGTTGGTACCACGAGACATAGTTATAACCACCAACGTCCCTGCTGG
++
+GGGGGGGCFGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGFGGGGGGGGGGGGGGFEGGGGFGGGGGGGFFGFFGFGGGFFGGFFGGGGGGGFGFFGGGGG?CFGGGFCGGGGGGGDGFGGGGGGGGGGFCE@FGGGGFGGDCFGGGGGFDFFFGGEDGGGGGGCF<:>CCFCGG7B8C<CC7;EGGE5EEGGGFFGC9,><ECFGGGC1+27CFGD=E5*:EEG+:EFFFGEGGGGGGGGGCG8DG=*/*AEFG?D7FFGCGGDFFBC>5>DFFF<CF
+@M01873:M01873:000000000-B9G3J:1:1115:12252:7158 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=TTCATAGAATCTTCTCA
+CGAGGGGGCAGCCTTGGGCTGACCTTGGACGGTCAGCTTGGTCCCTCCGCCAAAAATTGCAGTTCCGCTGTCCCACGCCTGACAGAAATAGTCAGCCTCATCCACAGTCTGGGCCCCGCTGATGGTCAGAGTGGCCGTGTTGCCAAAATTGGAGCCAAAGAATCGGTCAGGGATCTCTGAGGGGCGCTTGTTATTTTCATAAATGACCATCATAGGGGACTGGCCTGCCCTCTGCAGATACCAGGCAACATAATTGGCCCCCACATCATCTGCAGAGCAGG
++
+GGFGGGGGGGGGGGGGGGGGGGGGG<FFGGGGGGGFGCGCGGGFGG@FGFGGDGGFFGGGGGGGGGGGGGGGGFGGGGGGGFGGG8DDCECGGGGGGGGGGDFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGG:FGGGGDGGFEGGGGGGGGGGGGGGDG>EGDFGFGGGGCDGGGGGGGGDFGGGGFGGCCFG?CFF?FFGGEFGGG+<ECEGFGGGDC*;7CF4+7:48?*:CFCC)9>>FF4:>F:60)9DD>)>DFF#############
+@M01873:M01873:000000000-B9G3J:1:1116:7180:16322 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGL|BARCODE=CGGACAGACCTAGGTAG
+CGAGGGGGCAGCCTTGGGCTGACCCAGGACGGTCAGCTTGGTCCCTCCGCCGAATATCCAAATATCATGATTGGTAGTATCCCACACCTGACAGTAATAGTCGGCCTCATCGCCGGCTTCGACCCTGCTGATGGTCAGGGTGGCCGTGTTCCCAGAGTTGGAGCCAGAGAATCGTTCAGGGATCCCTAAGAGCCGGCCGCTGTCATCATAGATGACCAGGACAGGGGCCTGGCCTGGCTTCTGCTGGTACCACTGCACACTGCTACCTCGAATGTCGTGCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGDGFGGGGGGGGGDGGGGGGGF7D>FGGGCGGGGGGGGGGGECGGGFGGFFGCFCFFGGGGGGG7<CGGGGGGGGGGFGGGGGGGFGGGGGD>E=CGEGCCCCFGGGGGGDFGGGFEFCD?CDEGGGGGG@E4)9FF7*:?70:9CACF?GFFFGGGFFGFF4F3?<@34:903BF
+@M01873:M01873:000000000-B9G3J:1:1111:16714:18923 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=CTTGCTAGGTTACTTTT
+TTCGTTTGATCTCCAGTCGGGTCCCTCCGCCGAAAGAAAGCCAGTTGCGACGTTGTTGACAGTAATAAACCGCAAAATCTTCAGGCTCTAGGCTGCTGATGGCGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATGCCAGTGGCCCTCTTGGATGCACCATAAATGAGGAGCCTGGGAGGCTGGCCAGGTTTCAGTTGGTACCAGGCGAAGTAGGTATCAATACTCTCACTGGCCCTGCAAAAGAGGGTGGCTCTTTCCCCTGG
++
+GGGGGGGGFGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGFFFFEFFGGFGGGGFGGGGGGGGGGGGGGGGGGGDGGGFGGGGG,A8FGGGGGGFGGGGEGGGGGGGGGGGGCEGGGGGFGGGGGGGDGGGGGGGGGGGGGGDGGFDEGBCEFG9FFGGGGGGCCFG9EGGGGGGGGGEGGGGG?CG5CFF58CGGGFG=CFGGG?9EGCGGFFGEFE09CCC)=*5:C777C?DFF*07>C79=C@6><@@CCDC>D*75<55>G34C4?9B#######
+@M01873:M01873:000000000-B9G3J:1:2104:5522:14323 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=TCTCGAGATACTTATTA
+CTTGTTCAGGTCCTCTCCAGGCACTGTCCTCAGGATGTTTTGAGCTCCTTAGAGCTGGATGTCTTTGTAAGGCTGTTTGGCGAAGGGGCTGGTCTTCTCCAGTACCCACCCCTCTCCAAGCTCCCCGTATCGTAATAAGTATCTCGAGAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAACAAAATAACACTACAACATCTAAGAGAACAAAATACTAACGCTAAATAAGTAA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGDEGGGGGGGG?FGGGGGGGGGGGGGFGFEGGGGGGGGGGFFGGCFFGGGCGGGGGGGGFGGGG9FGGGGGGGGGGGGGFGGGGGGG7FGFFGGGGGGGFG,>DGFGGGGGGEEC,5CCFGGGC,CFG58?=E###########################################################
+@M01873:M01873:000000000-B9G3J:1:1113:7318:10138 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGHA|BARCODE=ATTTCTTTCCAACGTTA
+CGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGCTATCAAAGAGGGTTGCAGAAGAAGTGAATCTCACACAGTAATAAAGGGCCGTGTCCTCGACTCTCAGGCTGTTCATTTGCAGAAACAGCGAGTTCTGGGCGTTGTCCCTGGAGATGGCGAATCGGCCCTTCACAGAGTCCACATAGTATTTGTCCCTTCCATCTGGCCTTATATTGGCCACCCACTCCAGCCCTTTCCCTGGAGCCTGGCTGACCC
++
+GGDGFGGFGGGGGGGGGGGGGGGGGGGGGFGGGGGEGGGGGGGGGGGCC7FGGGGGGFGGGGGGGGGGGGD<FGGGGCFGGGGGGGGGGGGFGGGGGGGGGGGFCFGFFGGAGGDDFFFFFGCEFFGGGGFGGGGGGGGGGGEGFGGGFFFCFFGGGGGGGGGGGGGEGGC9>EGF8ECFFGGG7:EEFGGGEGGGG6@C8FFGGGGGGG+=F?FGGE;+<FGCF9EGG>D<CFGFGBC@7?F<*7*<FBG:CF)<*7?2C?GF=F###############
+@M01873:M01873:000000000-B9G3J:1:2113:7529:7186 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=GAAATTCTCGAACTCAA
+TTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCAGGGAGGCCAGTGTGTTCCTTGCATGCAGTAGTAAATTCCAACATCCTCAGCCTCCACCCTGCTGATTTTCAGTGTGAAATCAGTGCCTGACCCACTGCCGCTGAATCTGTCTGGGACCCCAGAGTCTCGATTAGAAACCTCATAAATCAGGCGCCTTGGAGATTGGCCTGGCCTCTGGTGAAACCAACTCAAGTAGGTGTCTCCATCCCGGGATACGAGGCTTTGACTAGACCTGCAGGA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGCFFGGFGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEEGGGGGGGGGGGGGGFGGGFFFGGCFGGGGFGDFGGGGF@FFGGGFGFFGGFFGGGFCF9DFEEGGGGG8@B?FCFGGGGCFFGGG?EFBDGGGGGGGGGGGGGFGFD6F47C9:C+*/:>C<CGFGFGGGGFCFFFFFFFF?),C?@##
+@M01873:M01873:000000000-B9G3J:1:2115:11727:15140 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-TRB|BARCODE=GCACTTCCACATGGTAC
+GTTTTTCAGGTCCTCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTCACAGCCTGGAGGCCCAGGACAAAAACCGGTGCTGCCCGCTCTGCTGTCCCAGACTCAGCTCGGGTCCTTCCCACCGCTGAGAGCCCCATCGCTCTCCCAGCACCCAGAACCAGGAGTCCTCCGCCCAGACGCCCAGCAGCGCCTCTCAGCACCCCCGTATGTACCATGTGGAAGTGCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATAC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGG7EGFGGEGEGGGGCGGGGFGGGGGDEGGFFGDF7:CGGGFGFGGGGGGFGFDDDE>FFGGGGEFG4DGC?CFCFCBGFGFGFFG#
+@M01873:M01873:000000000-B9G3J:1:2116:5234:16363 1:Y:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=CGGTCAGATAATCTTCT
+TTCGCTTGATATCCACTTTGGTCCCAGGGCCGAAATAACCATTATACCGTTGGAAGGAATAAGTTGCAAAATCATCAGGATGCAGGCTGCTGATGGTGAGAGTGAATTCTGTCCCAGACCCACTGCCGCTGAACAGTGATGGGAACCCACTTGCCAAACTAGACGCCTTATAGATCAGGAGCTTAGGGGCTCTGCCTGGTTTCTGCTGATACCAGGCCAACCAGTTATTAATACTCTGACTGGCACGGCAAGTGATGGTGACTCTGTCTCCTACAGATGC
++
+EA@BC;FFGGG,-CF8@CFEF,,CC<EDCC@:CCEFFFE@@,,C,C,CC<:C8@C,,,6,CFF6,<6CCFCFF@EFF98,F<CF9CEGC@FGF<<DF9?,CE=,?F,,?5AE<59E,B+BFGC8,CF7@>+:<E,,:?FFFFGC,A<:FFCC,C8B,A+,CD9:FGC87E,D,E9,7EF@7D,,@>>8**5*7,3,@;*,,,,>DDG?ECD28D7788,=8:E504?,=,>7<=@6:CGFFG*8.;*C)=CEF###########################
+@M01873:M01873:000000000-B9G3J:1:2106:24340:3314 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK|BARCODE=GCGGCATTAGTATTGCA
+TTCGTTTGATATCCAGCTTGGTCCCCTGGCCAAAAGTGTACGGAAGCTGTAAGGTTTGCATGCAGTAATAAACCCCAACATCCTCAGCCTCCACCCGGCTGATCTTCAGCGTGAAATCTGTCCCGGACCCGCTGCCACTGAACCTATCTGGCACTCCAGAGAACCGCTTGGAAAGTTCATAGATCAGGAGCTGTGGAGACCGGCCTGGCTTCTGCAGGTACCATTGGAATAATGTCCTTCCATCACTATGCAGGAGGCTCTGACTGGACCTGCAGGACAT
++
+GGGGFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEFGGGGGGGGFGGGGGGGGG8ADCEGDGFGFGAFGFGGDFBCFGEE7FFAFEGFGDFGGFADFGFGGFGGGGGG?*DEEGDGGGGCEGFCFGGFCC;EGGGG??7+><++;CG?:=;+=>*5@7@+0<CGDEDC5EGGDFF###############
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_pairseq_test1_r2_in.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,400 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=ATCTTTGCGGCTGGTTA
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCCACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGCCCCTGACCGATTCAGTGGCCGCGGGTCTGGGACAGAGTTCACTCTCAACATCAGCAGCATGCAGTCGGAAGA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFGFEFDG?EFGGCFFFGFF9CFE,E+ABE@EGFEGEFGGCFGGGGEGCGGGGGGDDFGGCFGDF,>D+44,@3DCFGC8CGGGFGC9@CGGGGGD8CGG?C79,1556C*00BC5D*/=EC5C4C<EDEC+:0<*:*19)8>*);7ECF*;>*0:9+<AC#############################
+@M01873:M01873:000000000-B9G3J:1:1112:28236:12457 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=CGGTTTGGTGCATCTAG
+GTGAGTGAACCAGGGCAGAAAAGAATGATGATATCCTTGAGAGTTTTACTGGTGATCCTGTGGCTTCAGTTAAGCTGGGTTTGGAGCCAACGGAAGGAGGTGGAGCAGGATCCTGGACCCTTCAATGTTCCAGAGGGAGCCACTGTCGCTTTCAACTGTACTTACAGCAACAGTGCTTCTCAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTGCTGATGTCCGTATACTCCCGTGGTAATGAAAATGGAAGGTTTACA
++
+GEGFGGGGGGGGFGGGGGGGGGGGDGGGGGGGFGGGGGGCGEFFCFDGGGGGGGGGGGGFGF8BFGGGGGFFDFCFGGGGEGGGGGGD=FFGGGGDDGCGGCFFGGCFGGG8FGGCGFGGGGGGCCF;FFGGFGGGGEE7FFFFGGGG6CFDFFG8==EA,,;CFGGGGGGC6CFF7;DCGGGFCG9B,;CCF6DFCGGGGGFFF4FFCFFFGE,AF6EFGGGFGFGFFF,:9BFCFF:.2AB+>)*:/989?C9@FF,29>+;98*??>C@7
+@M01873:M01873:000000000-B9G3J:1:2110:13535:17883 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TTTCTTTAGTGAAATGC
+AGGAACTGTTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCACAGATATCAACGGAGCAATTGTGTTGACACAGTTTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGGGCCACCCTCTCCTGCAGGGCCAGCCAGGCTGTTGGTACCTACTTAGCCTGTTACCAACAGAAACCTGGCCCGGCTCCCAGCCCCCTCCTCTATTATGCTTCCAACAGGGCCCCTGGCGTCCCCGCCCGG
++
+GGGDEFGGGGGDGGFGGFGFGEGGGGGGECDFGGGFC9FFGCFCEGCG<FDFFGGFGGAEECGGGCF,CFGGGFFFG,EFEDF?FG,?=C>FG+B,CFFEEFG=,CE,,EEFFGFFFFFCGGGGGEGAFFFFDEGGAFGEEG7,A?6+++3>@BF?EGGDFGGF6CGGG88,D8FFG?>,8C@;,,5DFC33E?>D,5?BFF?*4D6,;=C################################################################
+@M01873:M01873:000000000-B9G3J:1:1119:21261:11479 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=CTTGATAGGAATGAATA
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCCCCGGCCCCCTGGGTTCCCTTA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77FEEGEGGDGGGGGGGF:@CGGFFGGFECF5E7F7C:?CD7:494CF;C6FF3C3>FGGGFDGDF4CF*+9*2<7:4<7>F6)2(;F?):CG*?C###############
+@M01873:M01873:000000000-B9G3J:1:1101:10006:14034 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=ATTTCTATGGCTTTGTT
+GACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAGAGAAATACATGAGACTCTCATATACCTGCAAAAGTGAGCTATATCTCGATCACGTATTACAAGTCAGTACAGCCAGAAAAGAGGAATGTCGAAGATACTCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGFFFGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGDCGGGGGFFGGGFGGGGGGGEGGGGGF:AFE=FFEGGGGG=BFCC3DFEG@EFGFG@FEFF9CDFCFGGGC8DEGEE>7CFGCECFFFD:CE5E#######################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1117:17250:9432 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=CTTGCTTATGATTCCAG
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGATCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGAAGGGCCCTCGGTCTCTGGTTAAGGTTAACAGTGATGGCAGACGAAGCAAGGGGGAAGGGGTCCCGGATC
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9,2,,7,;,;6CF>>,8:8;<DE7**4*:7?DC5,,486DD:FC#############################################################################
+@M01873:M01873:000000000-B9G3J:1:2108:14465:19705 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=ACTTAACGGCCAATTAA
+GAGTCTGCCCACAGCAGGGCTGGGAGACACAAGATCCTGCCCTGGAGCTGAAATGGGCACGAGGCTCTTCTTCTATGTGGCCCTTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGAAATCACCCAGAGCCCAAGACACAAGATCACAGAGACAGGAAGGCAGGTGACCTTGGCGTGTCACCCGACTTGGAACCACAACAATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCCATTACTCATATGGTGTTCAAGACACT
++
+FGGGGGGGFGGGGGGG@FDEEEGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGCGGGFGECFGGGGGFGGGEE7+EFFGFGFCCEGFGFGAAFGGG7FFAFFGGGF88DEG+>AD,;DGE?FFGGGF,DBEC>EG,4DCGG9786CCCGFDDC,=:CEC,<,=?FGGGCEFGC71+>>@FCC79EGDGDDC8**AC=F::8@CGD8FF=;73=>F5C:>7<+A?F7+0<++CGCC?#########
+@M01873:M01873:000000000-B9G3J:1:1115:18550:17263 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=GGTCTTTGGATAGCGGA
+AAGTAGGTCTTGGTGGTGGGGAAGGACAGGAACATCCTCTCCAGGGCCTCCGCACCATACTCGCCAGCGTGCGCGCCGACCTTACCCCAGGCGGCCTTGACGTTGGTCTTGTCGGCAGGAGACAGCACCCAGATCGGAAGAGCGTGGTGTAGGGAAAGAGTGTAGAGCTCGGTGGTGGGCGTAGCATTAAAAAAAAAAAGTAGAGAACTGCAACGTGGTAATGGATGAGCCACAAATTACAAAGATAGAGACTGAACAGGTACTCACCGTGAC
++
+GGGGGGGGGFGGGGGGGGGGGGEE>EFGGGGGGFGGGGGGGDFG8F7@FE<FFCC@<FAF<<FGGGGG@BCCC77FEDDEGDFEGFFGEEGC@E>EDG8@FF<@DE@FGGGA=FEEGC:@E7*6DFFG7*@DD@FFD8C*8F,***3=EC219A?55CEC@7><:C++233CCEE##################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2111:3554:13238 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TTAGCTACATGTAATTG
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCATCATATACAGTGATGGAACCAACTACTTGCGCTGGTTTCAGCAGCGGCCCGGCCAATATCACAGGCGGCTAATTGATAAGGAGTTTAACAGGGGCT
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDEF9=FFGGFGF6D@9ECGG7,@DF,@7,,@,,7:;C,53@,,3*@AFE695=9@,9@CGGF8F##########################################################
+@M01873:M01873:000000000-B9G3J:1:1112:18419:7621 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=CACACTGACAATATTCT
+GAGTTGAGCCCTGGATTGTGACTGCTTCAGGGCAGTTGGTAGATGCCCCTCTGGGAGAGATCCCCAGGGGTGACAGCCATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGCGAGAGGGACCAGGGCACCGTCCTCCAGGGAGCGCATGCTGCAAGTCGGGCCAGGGGTGCCACTGAACCTGACGGCAAGTGAGACCCAGACAAGGCC
++
+G@CBDFFGG8DFGGF9,CFG9<<ACFGGGGGFEDGC6CFC,C9<@@:FDCGGG,@@,CEFFF@<FGCFCEEG<,5==FFCFBFC=FFE?<<=:4:@FGCCG8F@AD8:D7@=DFCFFFGGGGGGGGGGFCFCE+B8>DFF8F@D8>,>E6FG?D65@CE,E9,5=<89CEGFFGGC7:D###############################################################################################
+@M01873:M01873:000000000-B9G3J:1:1109:19388:16328 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=GGGACTCCAAAATTAAT
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAACCTCCTCATCCATCGCAATACCCAGCGGCCC
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>48=CDGEG,BEC++,4=C+18>?:CCGGFFFFG6F8C55*1C5>73)1)<*:1:7?C##########################
+@M01873:M01873:000000000-B9G3J:1:1111:16537:24486 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CCTTGTCCGAGATGTCT
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTAGCAGCTCTGTAAATGGGTATCAGCTGAAGCCAGGGAAATCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGGCTTTCCGTCAAGGGTT
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGG93@8BGFC>9E,>9D8@ADF8CGECE>*;EFGGD7<8;CE=3=CC9F?FDFE@C@,<C#################################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10019:8146 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift0|BARCODE=CGCATATATCTGCAAAA
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGGCTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTATCGCAGGACCTGGGTCCGCCAGGCTCCGGGGAAGGGGCTGGAGTGGGTTGT
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C*2577:*2*7271*2?CC>/;ECEEEE*;:@######
+@M01873:M01873:000000000-B9G3J:1:1110:23072:9989 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=ATGGTACTCTATCAGGG
+AGCTACAACAGGCAGGCAGGGGCAGCAAGATGGTGTTGCAGACCCAGGTCTTCATTTCTCTGTTGCTCTGGATCTCTGGTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACACTGAGACCTCCTTAGCTTGGTACCTGCAGAAACCAGGACACCCTCCTAACCTGCTCATTTACTGGGCATCTACCCGGGAAC
++
+GGGGGGGFGGGGGABFGGE+7FFEGGGFGCEGDE@FGFGFFGGGGGGGFFDFGGGGCFFFCA9BFGGFGGGGCCFGGGEFGGFGGGGGGGGGFFGGGG8E,<EFGFGGDFEGFDAFE8?FFGGGGCFEGFGGGGF86=>BCEEGEDGC88BFDFGFGGG,,@;F7@@5,:6CCFEEGG,;D;:9DFFCDFF>*>0AFC,*4CC,<,4,,2,/+=+0+=E8@+C+:C75*/***/:=FGG=<*;<8@CD@########################
+@M01873:M01873:000000000-B9G3J:1:2101:11039:4739 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=ATTAGTTCATAAATTCC
+AGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTTCCAACAGAAACCTGGCCAGGCTCCCCGGCTCCTCATCTATGATGCATCCAAAAGGGCCACGGGCATCCCCGCCAGG
++
+GGGGGGFGGGFGGGGGGGGGFGGDGGGGDGGGFGFGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDFGGGGGGGGGCGGEGCGGGGFFEFEDEGFGGGGGGGGGGGGGFEGFGGGGGGGGFCFCEFGCEEFFGGGGGGG??DFFGGGGGFFCEGC:DFFGF9<D:C:9ECFFFCFE,>EEE6FG*4,,1>7?8,1C7=E8DGGG,:?=2BED###################################################
+@M01873:M01873:000000000-B9G3J:1:2104:24954:20771 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CGATGTAATCTTAGCTG
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCTGCAGCAGCCAGACAAGGGCCCTCGCTACTTGATGACGGTTAAGCGTGATGGCAGCCCCATCAAGGGGGACGGGG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF78D6DDC:8,:D8D>7@CEE>EG755**C6,6*0,,4<1B686CG5=*7C***=***;:8**3;@C799CCCC9:D4C3*/*/:CD8*:*;***2*0<<??*??#####
+@M01873:M01873:000000000-B9G3J:1:1111:12286:7157 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TCCAGATTCGGATTACA
+AGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTTATATTCCTGTGGCTGCAGCTGGACTTGGTGAATGGAGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCAAACTACTTCCCTTGGTATAAGCAAGAACTTGGAAAAAGACCTCAGCTTATTATAGACATTCGTT
++
+GGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG88FFGGGGGGGGGGGGGFGFFGGGG?E8CGGFGGGGGGGGGGDFGGGGGG9D>EGFCCFGGGGFGGCGEGGGGGGGGGGGGGGGGGCG6CFFFFGGGGGGGCCCFDFGG+:CD7CGGGGGGGGGGG44C@9CCC7CF4?FFFGFEGFG6A*8D<7*<6:FG;EC+7<CF91;CFDFF
+@M01873:M01873:000000000-B9G3J:1:2103:2227:11139 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=TAGTCAGAAGATTATCT
+TCTCAGAGAGGTGCCTTAGCCCTGGATTCCAAGGCATCTCCACTTGGTGATCAGCACTGCACACAGAGGACTCACCATGGAGTTGGGGCTGTGTTGGGTTTTCCTTGTTGCTATGTTAGAAGGTGTCCAGTGTGAGGTTCAGTTGGTGGCGTCTGGGGTAGGCTTGGTACAGCATGGAGGGTCCCTGCGACTCTCCTGTGTAAGCTCAGGATTCGCCTCAAGTCGTCATGAAATGAATGGGGGCCGCCAGCCCCCCGGGACGGGGTCGGGTGG
++
+CFEGCDAFGGDAF8E9<CGGFG?88<C<FAFECF@,C@FFFDG9<<EE7F,,9C@,BFE,:BC<7@FGF8B8F<BA9EF8,AB?,98:F7C,B,BF8FG+CDADE<<5CFE,,9?9@,@FGG?E@FC?C8=E,9;F,E,,,C=;EC@+@,+6@+3>,@+63+98F8+3E;C9,,,3,,6++58::C:,*@CEEFAFGF###########################################################################
+@M01873:M01873:000000000-B9G3J:1:2116:17140:9378 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CGGAATACTCACAAATT
+GTCTGGGAGAGGAGCCCAGCACTAGAAGTCGGCGGTGTTTCCATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGTCCAGTGTCAGGTGGAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCAGCGTCAGTGCCTATGGCATGCACTGGGTCCGCCCGGCTCCAGGCAAGGGGCGGGCCGGGG
++
+CFGGGGGGGGGGGGGGGGGGGGGGGGGFFGFGGGGEGGGGGGGGGGGGBFGGGGGGGGGGGGGGGGGDFFGGGGGGGGFGGFGGGCFGGFGEFGGGGGGGGGGGGGGGGGGDDFGGGGGGGGGGDFGGGGGDFFFGGGGGGFGGGGFGGGFDGGFGGGGGCCEGEGGGFG?CFGGB=EF:AGE7AECFC8+?9?FGGC7+;9+568=8C8<9+<;1++)3***207C3*+::*2>FGGFGFF>20ADDD)9E88EE@CFC################
+@M01873:M01873:000000000-B9G3J:1:2105:17710:2946 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CTGCCATCAGCTTCATT
+AGAGCTGCTCAGTTAGGACCCAGAGGGAACCATGGAAACCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGAAATTGTGTTGACGCAGTCTCCAGGCACACTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCGTAGTGTTAGCAGCAGCTTCTTCGCCTGGTACCAGCAGAACCATGGCCAGGCGCCAAGGCTCCGCCTCTTTGCTGCATCCCGCCGGGCCACTGGCGTCCCCGACAG
++
+GGGGGGGGGGGGGG9F?FFGGGGDGGEGGGG<FGGG9EG8CBFFFE>7FEGEGCFAFCAEGGEGGGGGCGFFGGGGCECFGCFGGGGCFCFGEG?FEFFGGGFGGGGFGCDFFF9FGGCF,A?FGAFFFGGGFD?ADGFGDG8>6=<BEGGGFF7?FFEF,@,>EGE>E9*5,::8@D,,@FCFF8,1<EFF,::CE5:6+15,*,54,4,;*++02@3:CB*=***3=86<8*2*8?CF*22CFF##############################
+@M01873:M01873:000000000-B9G3J:1:2106:21507:14943 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TCGGGTCGCCTTCTTTT
+GCTGGGGTCTCAGGAGGCAGCACTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTCCTCCTCAGCCTCCTCACTCAGGGCACAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCGCTCAGTGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAGCCAGCAGTGATGTTGGTAATTATAACTATGTCTCCTGGTACCAACAACACCCAGGCAAAGTCCCCACACTCATTATTTATGATGTCAGTAAACGGCCCTCAGGG
++
+:CFGDGGGEGGGD8FEGGGGGGGGGFGED77FEGGGGGGGGGGGGGGGD@CG8FFFFCFGGGGGGGCGGFCGGG9FEFGCFFGGG8EFFGGGGCGGGGGGGFDGFFGFGFGGGGGGGGGG@E7FGFGGGGGG@CEEAFFFGF7E@F>FFCFCCB9FAFCGGFGFGGGG>GEC88DFG6DGCCGGGGGGF9CF9EFGGGGC?CGCGGF,0;CFG?67*;B**=575*AF=69CFC853::D***0++3<CFGF?EGG7F+C<C?7*1:5:8@####
+@M01873:M01873:000000000-B9G3J:1:2101:22394:13872 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=ACTCGTGCTAATCCTTC
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGGGGTACCAGCAGCCCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCCCTGGGGTCCCTGC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG>FGGGGD5@ECGCGG84A,<:,BFGFGE+**/AEGGF+:C*=*=CEG5*::*2<CFGGC5E#############################################
+@M01873:M01873:000000000-B9G3J:1:1110:19157:20344 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GAAGAATTGTAACAATC
+GGCTGGGGTCTCAGGAGGCAGCACTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTCCTCCTCAGCCTCCTCACTCAGGGCACAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCGCTCAGTGTCCGGGTCTCCTGGCCAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGTACCCAGGCAAAGCCCCCAAATTCATGATTTATGATGTCAGTCACCGGCCCTCCGG
++
+GGGFGGGGGGGGGGFGGGGGGGGGGFFGGGGGGGCFCEFGGGGGGGGGGGGGGFGEFGGGFFGGFGGGFGGGGGGGGFGGG,=?FCFF<EFGGGGCDGGGGC<EFGGGGG,AD9FGGGG:FEE6@FD;FFGFFGGGEGGGFGC,@8DFG,;,5EEFCCFFFGGGGFGGG78:FGGGF?C?CFGG9CCFCG58AEF7@FG>:1=FC@CC7FC>F?GCEGCC++<=C57C/;76CGFGGCD4**<+<E77DF7+++<@E##################
+@M01873:M01873:000000000-B9G3J:1:2103:19958:12449 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=TAGCCTTCACTTTAGTT
+GGATCAGGACTTCTCAGTTCATCTTCTCACCATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATCCCTGGATCCAATGCGGATATTGTGATGACCCAAACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGCCAGAGCCTCCTACATAGTGATGGAAAGACCTACATATTTTGGTTCCTGCAGAAGCCAGGCCAGTCTCCAGAACACCTAATTTATGACGTTTCCCGCCGAGTCTCCGG
++
+GGGGGGGCGGGGGGGGGGGGFGGGGAEGGGFGFGGGGGGGGGFGFGGFGGGFGGFFGDGGFGGGGGGGFGGGGGGGGGGGGCFFGFFCFFGG+F:DGGGFGGGFGGGG7FFGCGGGGGGGFGGGGCFGFGGGFGGGGG8BEFCFGGGGGFFGGGFGGGGG?3BFGGCFFGGF:FGGFGFGGG8DDCFF@DFG6DC5?EEC,51=CF@FGGEFCGF+,55++?BF=9*/:8CC5++4+?3;5C*;EFE6@9C*02A7CE5FG<+58/>**;@FGGG5
+@M01873:M01873:000000000-B9G3J:1:2104:19897:23367 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=AATTAATGGTGTTGAGA
+AGGCTCTGCTTCAGCTGTGGGCACAAGAGGCAGCACTCAGGACAATCTCCAGCATGGCCTGCTCTCCTCTCCTCCTCACTCTCCTCGCTCACTGCACAGGGTCCTGGGCCCAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCCCTGGGAACAGCTCCAACATGGGGGCAGGTCATATTGTTCACTGGTACCAGCAGCCTCCACCTACAGCCCCCAACCTCCTCTTCTTTTTTAACCCCACTC
++
+@CEGGGGGGGGGGGGGGGFGGE8@FAEFCFGFE,EF@F,EFFGFGFGG9FF?FCFE<FGGF,EFA@FGGGGGFFGGGAFEAEC8FF,=FFGGGFFCA<BFGDEEFA=B<?FFGF@EFF?,E,9A+?BFCG+F:F@@FFEGF=FD8FC+3+8BE78@8@D8:C:@FCCF7D;FF9,8@2?EF8,,*DFFDFG#####################################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10031:4758 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=GTTTATGTTTGACTAGC
+GAGGCTGACCGTACTGGGTAAGGAGGCGGTTGGGGCTCCGGAGAGCTCCGAGAGGGCGGGATGGGCAGAGAGGACCTGAAAAACGTGTTCCCGCCCTAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAAATAGGTAGAACACGAGATCTAGGACTGTATGTAAAACGAAAAATTAAGAAGATAAGTACATGCGCGGACGAGGTGAACCGCGGACGTGACTGCCAATCACACTGTA
++
+GGGGGGGGGGGGGGGGGGGGGGFFFGGGGGGGDGGGGGGGGGGGGGFFGGGGCGGGGGGGGEFCGCFGFGFGGG@FFGGFFGGEFFFDCGFGGGGGGGGFCFFD7FG7F,>1BF8F::FFGFFGGFGEFGFGFBFGFGGC*=;+*31::8@BE7CFC0<?CCEE#############################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2118:6488:16393 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=GAAAGACTTACATTTTT
+GCTTTCTGAGAGTCATGGATCTCATGTGCAAGAAAATGAAGCACCTGTGGTTCTTCCTCCTGCTGGTGGCGGCTCCCAGATGGGTCCTGTCCCTGCCGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGCAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGATGGCATCATCAGCACTAGTGGTTACTACTGGGGCTGGATCCGCCGGCCCCCAGGGAAGGACCTGGAGTGGATTGGGAGTTGTTTTTCCAATGGAAAAACCCACTACA
++
+GGEFGGGGGGGGGGGGGGGFGGGGGGGGGFCF8FGGGGGGGGGGGGGGGGEGGGGGGGGGGEGGFGGGGGGGGGGGGC8BFEFGGGFGGGGGGG?F8FGC@EFFFGGGGGGGGGGGGGGEGGGFFGG8EGGGGGGGGGCE@D+FC<FF?GGGBCF@EG6FGFGGCFEA9DFFCC@FFFGGFFFFG69;9DEF9?9CFF?:<5CEGG5C+2ACGGE8>CGC=CFE5CED*ACC*C482;*09+9*C*7/*+/*2;E+<<?9>D:C<*:EEG######
+@M01873:M01873:000000000-B9G3J:1:1117:6029:5428 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GAGACTTTGCTTGTACA
+GATTCCAGCCTCTGACAAACTCTGCACATTAGGCCAGGAGAAGCCCCCGAGCCAAGTCTCTTTTCTCATTCTCTTCCAACAAGTGCTTGGAGCTCCAAGAAGGCCCCCTTTGCACTATGAGCAACCAGGTGCTCTGCTGTGTGGTCCTTTGTCTCCTGGGAGCAAACACCGTGGATGGTGGAATCACTCAGTCCCCTAAGTACCTTTTCAGAACGACAGGACAGAATGTGACCCTGATGTGTGACCAGAATTTGAAACCCGAGGCCATGTACTGG
++
+GGGGCFGAFFCEGGGGGGGGFFGGGGGAEGF<<EFFGGGGGC<FFGGGE::C@FGGFFFFDFGGGGFFGF9FFGGCFFFGGGFGGGGC,:=FCEFEGFCFGGFGGDG7FFEFGFGDFFCEFCGGGGCECGF,4EEDFGG;=FFEGGGGGGGGGGD=EF,=DC>FFGGGFGGGFDD6D7EC>C::9CFGF7,@:??E*/97D:C7C######################################################################
+@M01873:M01873:000000000-B9G3J:1:2106:6159:11549 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GTTCGTACTCTAATAGA
+AGTTGGTAGATGCCCCTCTGGGAGAGATCCCCAGGGGTGACAGCCATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGTCCCAGGCAGCGCTGGCCCCTGCTGCTGCTGGGTCTGGCCATGGTCGCCCATGGCCTGCTGCGCCCAATGGTTGCACCCCAAAGCGGGGACCCCGACCCCGGGGCCCCCGGTGGAAGCAGCCGACCCCGCC
++
+GGGGGGGGGGGGGGGGGGGGGDFGDGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGCG8@FFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGDGGGGGGGGGFGGGFCFGGGGGGGGGFFGCFCDDFGGFD@GCGGGGGFGGEGCECFG++:CEEDGEFGFBFGCFCGGGGC:><8:FFFFGDGGGG=:E8=9CFGEGFC+9*2AC:5*<FCFGG6<8*1/*;9@5:C=*:ECE5<EEG################################
+@M01873:M01873:000000000-B9G3J:1:2103:16719:17340 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=ATGCATATGAGTGTGGC
+ACAAGATCCTGCCCTGGAGCTGAAATGGGCACCAGGCTCTTCTTCTATGTGGCCCTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGGAATCACCCAGAGCCCAAGATACAAGATCACAGAGACAGGAAGGCAGGTGACCTTGATGTGTCACCAGACTTGGAGCCACAGCTATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCTATTCCTCATCAGCGTCTGATATTACAGATAAAGGAGAAGTCCCCGATGGCTATTT
++
+DGCEFGFFGGFGCFGGFGGGGGGGGGGGGCGGGFFDFFGGGGGGGGGGGDFGGFGGGGGGGGGGGGFFFEFFGGDGGGGG?F7FFDFGGGFGGGGGGGGFGGFGGFCEFFCFFGFFCF8?EFFCG8FGGGG>D@@CC,,:F;FC=DFF;FGGFGGCGGGFG8@==EF8,3=F=>@CFGGGCC7ECD;C@*AE68:,8,9D1:C*,6:;D5*1:**:,,,5,?,5,>,,,4=<C**3**1++1:++++1A9@CB+:8<EGGFGFC8?*/:CC####
+@M01873:M01873:000000000-B9G3J:1:2114:13033:12027 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TTAAGATACTAACAGGT
+TGGAGGAACTGCTCAGTTAGGACCCAGACGGGACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCTGCCACCCTGTCTCTGTCTCCAGGGGACAGAGCCACCCTCTCCTGCAGGGCCAGTGAGACTGTTAGAACCAAGGTAGTCTGGTACCAGCAGAAACCTGGCCAGCCTCCCAGGCTCCTCCTCTATGATGCATCCACCAGGCCCACTGGTATCCCGGC
++
+CGGDFEGFFFFGEEEFGGGGGGGGGGGGGG>EFBFGDFGGGG?EFEGGGGG@FFFGAEFFGGGGGGGFGGCGFGGGGGFGCF,AEECEF<EFE@EGFFEFGGGFFGGGGGGCGEGFE9:8@FGGDFDFGGAE;7EF9,FFGGCGGGGGF86FGDGGGGGGCC8C,@6EGGGG@D??,>;8CEGFGCFFCF7>*CFC=>CBF?FFGCC8?FF@C=ACFFGE=*2=AFDF)3*+*3<+)=;CGG979EGC=C?#######################
+@M01873:M01873:000000000-B9G3J:1:2107:25942:4834 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=GGGCCTCTTTATTTGTC
+GGGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCCCTGGAACCAGCCGTTACGTTGGTGGTTATAACTCTGTCTCCTGGTCACAAACGCACCCAGGCAAAGCCCCCAAACTAATGATTTATGATGTCCGTTAGAGGCCCTACGGG
++
+GGGGGGG8:CFG8CC<F8EEEGG8C+85*?CE?FF?EGGGGFG58CC58:8EGCFFCCFGGGGGGGF5;CFD71<F?F6/;8AF>>D8@FF76@CGGECCFG7:+AC>FGGEF+<8AFFE:@8C8EGC@C*:*;87@+:?>6C*3<88CF58?@:CFGF96@88FFFDFEC;855*A**/;*;F8=FG>C7A9CFGF99CFGF9CC+0++3++**1**18CCCFG*C6CF###########################################
+@M01873:M01873:000000000-B9G3J:1:1101:10044:7123 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GTACTATGAACACAACT
+GGGGGTCTCAGGAGGCAGCGCTCTCAGGACGTCACCACCATGGCCTGGGCTCTGCTCCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGTCTCCCTCCGCGTCCGGGTCTCCTGGACAGTCAGTCCCCATCTCCTGCACTGGCACCAGCACTGACATTGGATGTTCTCACTCTGTCTCTTGGCTTCAACAACACCACGGCCAAGCCCCACAACCCCTCATTTATCCCTGCATTGCTCGGCCCTCCGGGGC
++
+7:FGGGGGGGGGGGGGGGGGGGECGGGG,8:ECEE@FGGGGGGDCFFCCFGGGGFFCFC8A,;EGGGCEGGGDFGFCFC>CC8;;CGEFF?CFCGGD88CFEFFFFFGCCFG?C+32<FF8CE**1*/?:CEGECCFF6C688E:E7FCE+8EGGG79<+<E6<9C*78<C**2*206+C+9?<+++332+2*2:7CFCEC??########################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10044:7141 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GTACTATGAACACAACT
+GGGGGTCTCAGGAGGCAGCGCTCTCAGGACGTCACCACCATGGCCTGGGCTCTGCTCCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTCCCTCCGCGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGCACCAGCACTGACATTGGTGGTTATAACTCTGTCTCTTGGTATCAACAACACCCAGGCAAAGCCCCCAAACTCATCTTTTATAACGTCACTGACCGCCCCTCCGGGTC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGDGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFFGGFGGGFGFGGG?AGGGEGCEFGGGGGFGGGGFCGGGGGGGGFGGGGFGGFGGGGGGGGGE5CEGG5C6@FGGFCEEFCFG7CFCFGGGFDFF?8?0<CF6CCF=*:C6:60+<+<?:?<AECFCFGGC>*:*2+0++:ECD70:FGGF*75EG5=F*1*19*96:E5DG#######################################
+@M01873:M01873:000000000-B9G3J:1:2102:22537:8542 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CAAACTTGCGCTACTGA
+AAGACTTTGGGGAAGTAACTAGTGGGATCTTATGGATGGTTATGAAATGTGAAAAGGACATGAAATTTTGGAGGGGTCAGGGGTGGAATTACATGGATTGGCTCTGTGTCTCCACCCAAATCTCTTCTTGAATTGTAATTCCCATGTGTTGAGGGAGGGACCTGGTGGGAGGTGATTGGATCATAGGGGTGGTTTTCCCCATGCTGTTCTCGTGATAGTGAGTGAGTTCTAATGAGATCTGGTGGTTTAAAAAGTGTTTGGGAGATGTGTTCCCA
++
+GGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEFGGGGGGGGGGGGGGFGGGFGGGGGGFGGGFGGGDDGGGGDF@EGGGDGEGGGFGGGGGGGFFGGGFGFGGGGDFGFGG@FGFGGFGGGGGGFBDFEGGGG;DFFG@DFGFFGGGGGGDEECGGGGGGFGGG>,>*@EGGGGCFCF>CCDGGC8?ED5,C:,,4=CDF>?ECFECCFG;6:C<@9CG72CCFC@<;AF7@CC=77??G53=C###########################
+@M01873:M01873:000000000-B9G3J:1:2116:7821:15323 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=CTATTTACCAGAATTAC
+GGGGTCTCAGGAGGCAGCGCTCTCAGGACGTCACCACCATGGCCTGGGCTCTGCTCCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTCCCTCCGCGTCCGGCTCTCCTGGACAGTCAGTCACCATTTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAATTATGTCTCCTGGTATCAACACCACCCAGGCGAAGCCCCCAAACTCATAATGTTTCAGGTCAGTAAGCGGCCCTCCGGGG
++
+GGGGGGGGGGGGGGDGGGGGGGGGGFFGGGGGGGGGGGFGECFFFGFGFGFGGGGCFGGGGGFGGGGGGGGGGGGGFGFGFGGGFGGGFGGGGGGGGC@CFGGCGGGGGGGG?<FGGGGFGGGGD>EGEEGGGEGGGGFCFGGGGFGCGGGGCFFGGGG?FDGG6CGFGG@=F6;FFCGGGDF*1:CEFCGFFDFD@7CCCF++<6DCCFGFGGGD**;1/*1753*)*<C<E*5CCCF?9@@DCDFF72<E<++*0<CFEE*:C*/78<CGG
+@M01873:M01873:000000000-B9G3J:1:1101:10051:12996 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TATTCAGTATAACATTA
+GTCTCAGAGAGGAGCCTTAGCCCTGGACTCCAAGGCCTTTCCACTTGGTGATCAGCACTGAGCACAGAGGACTCACCATGGAATTGGGGCTGAGCTGGGTTTTCATTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGTGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGGTCACTATTGGATGCGCTGGGTCCGCCGGGCCGCCGGGGAGGGGCGGGGGGG
++
+GGGGGGGGGGGGC@FGGGGGGGGGFGGGGGGGGFGGGFGGGGGAFFGGFGAFGGGGGGGGGGGGGGG8@DFGGGGGGGGGGGGGCGGGFGGGGGF9EFCEE>EF,A<FFFGGGCFGGGGGGGGGCCBF;F?@EEAEFGGFGFGFGGGFFGCFFFFFD8E>@CE+@,@CFC,2DF77C5*@E=CCFECG+<?**2:><7C90<07+77<*9>*CCFD7:?6AC+9D*6>*:CF##########################################
+@M01873:M01873:000000000-B9G3J:1:1107:13066:21126 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=GCTGCAGTAGAAGATAT
+GCTCATGTTCACAGAGGGCCTGGTCTGGAATATTCCACATCTGCTCTCACTCTGCCATGGGCTCCTGGACCCTCTGCTGTGTGTCCCTTTGCATCCTGGTAGCAAAGCACACAGATGCTGGAGTTATCCAGTCACCCCGGCACGAGGTGACAGAGATGGGACAAGAAGTGACTCTGAGATGTAAACCAATTTCAGGACATGACTACCTTTTCTGGTACAGACAGACCATGATGCGGGGACTGGAGTTGCTCATTTACTTTAACAACAACGTTCCGA
++
+CGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGFFFGGGGGGGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFFFGGGF8FGFGFGGGGGGFGGGFGEFGGGGGF9EEEGGGGGGGGGGGGEGGGGGGGGFGFFD?DEFGGGFFDEDCGECFG,,@EGFCFGGFC:AEFCC7F8CFGDDF*7CFC+=:7,9+2,+1;AFG*?*BCC<=?DDGGD*;CFFC5CCG7:7:0<C7F?EFGG7*78CE=CDC##
+@M01873:M01873:000000000-B9G3J:1:1117:12403:4599 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=ACGACAAATGTTCTTTC
+GAGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCTGCTTCTGGGGCCAGGCTCCGGGCTTGGTGCTGTCGTCTCTCAACATCCGAGCTGGGTTATCTGTAAGAGTGGAACCTCTGTGAAGATCGAGTGCCGTTCCCTGGACTTTCAGGCCACAACTATGTTTTGGTATCGTCAGTTCCCGAACCAGAGTCTCATCCTGCTGGCAACTTCCAATGAGGGCTCCAAGCCCACATACGAG
++
+GGGGGGGGGGGGGGGCGGGGGGGFGGGGGGGGFCFGGGGGGGGGGGGGGCFFGGGGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGG>FFF8EFGGGGGGGGGGGGGFF?FGGGEF?AD@GGFE>EGGGGC8C79EGGGEC9DFGAF=E>FGD?CDFC7CFGGFEFGGGGCCGCCFG>CCFGECCFFGFG5:,:DG*=D8FFFFCG7CGBGG5>11::DGG)))*/*;:;AF7>+;CG#######################################
+@M01873:M01873:000000000-B9G3J:1:1117:22437:4121 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CAGACTGATTGACAAGA
+TGACTCTGAGAGGGGCTGTGCTGAGAGGCGCTGCTGGGCGTCTGGGCGGAGGACTCCTGGGTCTGGGTGCTGGGAGAGCGATGGGGCTCTCAGCGGTGGGAAGGACCCGAGCTGAGGCTGGGACAGCAGAGCGGGCAGCACCGGTGTTTGTCCTGGGCCTCCAGGCTGTGAGCACAGATACGCAGTGTATTTGCACAGGGACCCGGCGTCCAGTGCTCGATGACCTGAAAAACGTGTTTCCAACCGGGGTCGGTGTCGGGAGCGGGTGTGGGTGGG
++
+GGGCFGFE@,CCEE7F:EFGG9FFE<E@FGGCC+CEGDDGFEECFF<7C>C@E,EFF9F,+4?EFGGFD@BE<:=++=FECFF@AFC++AEEBEC:>+8CFCE+@FGCF@:CCF9D++8:EF,<D7,@83*2BE8CCC7C@BE7:1*3<*3?;E7<EC5*::*+7=6*=<2A?FC6>@CFFC##############################################################################################
+@M01873:M01873:000000000-B9G3J:1:1114:14006:15367 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=CTATTAACTGCAGAAAT
+GCAGTTTCTGTGCCGCGTCTCGGGGCTGTGAGCCAAAAACATTCAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGCTGGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAAAAGAAGAAACTGCGAGCTCACGACCCGTACTCTAGAAAATAGTGACATGAGATAGCAGACCACAAGCAGTATAAGAGGCTCAAGTAGAGA
++
+GGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG7FGFC;CGDGGEGGGGC0>EEGEDFECFGFGGGGGGGDG############################################################################################
+@M01873:M01873:000000000-B9G3J:1:1114:10168:21472 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=CCATGTCTTATTTTATA
+GCCCCAGCCCTGGGATTCCCAGGTGTTTCTGCTGGCTGATCAGGACTGCACACAGAGAACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGTCCAGTGTGACGTGCAACTGGTGGAGTCCGGGGGAGGCTTAGTTCAGCCTGGGGGGTCCCTGAGACTCTCTTGTGTAGGCTCTGGACTCGCCTTCAGCAGAGACTGGATGCACTGGGTCCGCCAAGCTCCCGGGAATCAGATGGTGTGGCTACGCCGTCT
++
+GGGGGEGDFGGFGGGG8EFGGCCFGGGGCG9DECCEGGGGGFGGDFEDGGGGGGGGGDFGGGGGEGGGGGGGGGG7:FGGGGGFFGGCCEFGGG,FFF8EF9FGFEDFFGCEFGGGFGC;>,>EFEGG@CCFFGGGFED,6DCCEEC:BEGE5D7@C:F@E<;,@EF8CGE555FG48>FCC9877>07C*A7668@F4+<+.879>=F47<*0);<C*85*/07;BF?5C?@7>EDG####################################
+@M01873:M01873:000000000-B9G3J:1:1114:16929:21025 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=CGATAAGCGTATTTAGT
+GAACCACATCTGTCCTCTAGAGAAAACCCTGTGAGCACAGCTCCTCACCATGGACGGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCTACAAGTGCCCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCAGCTATGATATCAACTGGGGTCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGAGGGACCCTAACAGTGGC
++
+GGGGGGCFGG,CCEFGGFEEGGGGGGFGGGFGGGGGFGGGGGD<CFGGGGGFEEGGGGGEF8FGGGDDGFEGGCFGDFFCFFEGC7BEGGGGGG9AFGGGGFGF8AFDGGGF@FFGFAE@8=8=E,@9,8>C8CEBD@DD,=BFGGE8FE6CEED8?FAFFGFCFCG74EG6CCDCFFDFGFFD7<C;>79,;C4,;9C<87?,+4BCC86<*<)*)2):1=A;<7F84;<*)*;*=DFC)7:6*:12.05*7?E*0***09<A*;;C?CCF##
+@M01873:M01873:000000000-B9G3J:1:1101:10064:16602 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TCTGGTCGTGCAAGTGA
+GAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAAGATAAATCCTGTGAGTCGTCCAAGTAGACAACAAAATCAGCGTCGGGAAATGGCATGGATAAAGACATTTATCGTGTAATGTACCGACCAGAACAGACATCACTGTCAGTCTGCGCTATATAAACGGAACAACTCGTACAGCT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGFFGGGGGGGEGGGFGDFGGGDGGGGGFGGGGGGGEGGGGGGGCCGGGFGGGFGCFEBE@E#################################################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10065:3493 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TAGCTACGCAGTTATTG
+ACAGTGATCCTGATCTGGTAAAGCTCCCATCCTGCCCTGACCCTGCCATGGGCACCAGGCTCCTCTTCTGGGTGGCCTTCTGTCTCCTGGGGGCAGATCACACAGGAGCTGGAGTCTCCCAGTCCCCCAGTAACAAGGTCACAGAGAAGGGAAAGGATGTAGAGCTCAGGTGTGATCCAATTTCAGGTCATACTGCCCTTTACTGGTACCGACAGAGCCTGGGGCAGGGCCTGGAGTTTTTAATTTTCTGCCAAGGAAAAGGGGGACCAGCAAAA
++
+GGGGGGGGGGGFGGGGGGGGGGGGGDGFGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGGGGGGGDFFGGGGDFGCGGGGFFGFFGG@DGGCEE>EGGCCFFGFG9EGFEDCEAFGFGGGEFGGGCEG?BFGGF==>DGCGGG:@CFGGCFGCFGE7E:B?DCA:@F:,7@EFEFCFFFGGGG9:,+4=F9+C*9CDG4C6,4AFEDCDGD*5=FG*;+0;C7*2<CE#############################
+@M01873:M01873:000000000-B9G3J:1:2106:19562:4616 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TAAAAACGTCGAAAATA
+GCTTTCTTCAAAGCAGCCATGGGAATCAGGCTCCTCTGTCGTGTGGCCTTTTGTTTCCTGGCTGTAGGCCTCGTAGATGTGAAAGTAACCCAGAGCTCGAGATATCTAGTCAAAAGGACGGGAGAGAAAGTTTTTCTGGAATGTGTTCAGGATATGGACCATGAAAATATGTTCTGGTATCGACAAGACCCAGGTCTGGGGCTACGGCTGATCTATTTCTCATATGATGTTAAAATGAAAGAAAAAGGAGAATTTCCTGAGGGGGAAAGTGTAC
++
+GGGGGGGGGGGGGGGFG@FGGGGGGGGGGGGGGGGGGGGGGG@FGEGFGGGGFGGGGGGGGGGGGGGGFFFGGGGFEFDFGFGFFFGGGGGGGGGGFGGGG8AFFFGGGG9FGGGGDGGGGGCE+=DFDDDDFGGCFCGFEFCGAD,@,@DFFCFDAACF?,=EFEGFC,3@3,@;C9,,78@*@*1,1<5DGC,,,19E=*:5,=E=4E4++97EFF@9?;9;C++52;+>79+29+;9+5AGGC############################
+@M01873:M01873:000000000-B9G3J:1:1106:24704:16447 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=TGTAGAGACTAACATCA
+AGACACAGTGCTGCCTGCCCCTTTGTGCCATGGGCTCCAGGCTGCTCTGTTGGGTGCTGCTTTGTCTCCTGGGAGCAGGCCCAGTAAAGGCTGGAGTCACTCAAACTCCAAGATATCTGATCAAAACGAGAGGACAGCAAGTGACACTGAGCTGCTCCCCTATCTCTGGGCATAGGAGTGTATCCTGGTACCAACAGACCCCAGGACAGGGCATTCAGTTCCTCTTTGAATACTTCAGGTAGACACAGAGTAACAAAGGAAACTTCCCTGGGCGAT
++
+GGGGGGGGGGGGFGGGFGGGGDFGGGFGGGGFCF@FDFGCFGGFCEFGAFGG8FG7@FDGFGGGGGEFGGCEG8FGGG7FE:FF@FCEEGFFGGGGGGGFEFGFFFFFGGGG8FGGE;FF=FFGFGGC7EDEGGGGFFEFFGDGGGGFCGFFGGGGCGDCGG?FGGDGGGGGG,,2<CDFGG:=C,@7@C79:,@CECGF>EEC57*97>*441214=<CCF;CFGF=7::C<BC7+,*++0>+1=F5D<+<+9+@***=*0C9ECF?98C57=*?
+@M01873:M01873:000000000-B9G3J:1:2111:9741:23838 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TCTCTTCAATCTATTCG
+GCCCTCCTTTCCTCCACAGGACCAGATGCCTGAGCTAGGAAAGGCCTCATTCCTGCTGTGATCCTGCCATGGATACCTGGCTCCTATGCTGGGCAATTTTTATTCTCTTGAAAGCAGGACTCTCAGAACCTGAAGTCACCCAGACTCCCCTCCATCAGGTCACACAGATGGGACAGGAAGTGATCTTGCGCTGTGTCCCCATCTCTAATCACTTATACTTCTATTGTTCCAGACAAATCTTGGGGCAGCAAGACGAGTTTCTGGGTTCCTTTTTT
++
+GDECF,FFGGGGGGGFFF<,FDFF88CCFEGGGFFFE9EFG@,9CFFFCGEGA9,CFBC,<EFGG,AE,9,4,,,BEFG8,FE,AFFFFF<=?,,,,:AFF,,99E9D9FE=FC?F,A7:E@,9AEF,E@=E,,FFCF=F8=,@7DGG8+,6@>;EFD833,8=DCDDFF88?DDF6E7DF:,,7;EC9+@C5D6;,;3*3CCFGBD7;@#################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10067:5517 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GCAACAAAAGTTCGATA
+GGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGCCCCAGGATCCAGTGGGGATATTGTGATGACTCAGTCTCCACTCTCCCTGTCCGTCACACTTGGACAGCCGGCCTCCATCCCCTGCAGGTCTAGTCAAACCGTCGAAGACGGTGATGGAGACACCTACTTGATTTGGTTTCACCAGAGGCCAGGCCAATCTCCCAGGCGCATCATTTATGAGGTTTCTAGTCGGGACTCTG
++
+CGC@<<E,@CAAFEFGGGGFGDAAFFGGGGGGGGGF8@C,69FFC<DFEFCCCFEF7+=FCGGG9?FGFGGDFF,9>>CFF+B=A=?,EEBE++:@FGGG9BGFGGG8F;,C@AF?CFF,A@FF888>@E88,88,E=8,,@>==CEEE,D3<A,3::>>,@>:?9BEGGF,599*44;*4**=CCE5CFGG48097*C6EFGFF731;:F837@CC##########################################################
+@M01873:M01873:000000000-B9G3J:1:1114:20934:3692 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TGATAAATCCGACATGA
+GCTCAGTTAGGACCCAGAGGGAACCATGGAAACCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGAAATTGTGTTGACGCAGTCTCCAGGCACCCTGTCTTTGTCTCCAGGGGACAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTCAGCAGTACCTCCTTAGTCTGGTTTCAGCAGAAACCTGGCCAGCCTCCCAGGCTCCTCATCTATGGTGCATCCCATAGGGCCGCTGGCATCCCCGACAGGTTCA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEEGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGC<FGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGFGGGGGGGCEFGGGGGGCGGGFGGGGGG8DCB?,<8EGGGGGGFGGG@FGGGGCGFGGGGGF7>:<FGGCC8CG4;=FG,?6;6*8A:5D:C*2:9FDG>4:>9>5)<6AF91@########################################
+@M01873:M01873:000000000-B9G3J:1:2107:3490:8582 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=TAATTTAGGTTATTTCC
+AGTCTGGGCCTAAGGAAGCAGCACTGGTGGTGCCTCAGCCATGGCCTGGACCGTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGTCTATGTGACCTCCTATGTATTGACTCAGCCACCCTCAGTGTCAGTGGCCCCAGGAACGACGGCCAGGCTTACCTGTGGGGCAGCCGACATTGGGAGCACAAGTGTGCACTGGTACCGCCAGAGGCCAGGCCGGGCCCACAGGCTGGTCATGTTTTATGATCGGGACCGCCCCTCCTGGACCCCTTA
++
+EGGFGFCEFGGGG8FD?FFGGGGGGF8F8CCFGGFGGFFGGGGFCFGGFDGGGGGGFGGGGG@EF@FGGGFGFFG<FEF<EGEGFGGF?FC<FFGGFAFG<=F9CF<C,;F;EFGFFFEFFCFCCE,4=;9,,8FGFE+388=A+8CE++@E66DFGGGGCA>,<EE>CEEEGGGG*5?F,@:EGF>C8=FC,>,<EG<+A>?5C####################################################################
+@M01873:M01873:000000000-B9G3J:1:2115:10908:20804 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=GATCATTTTGTTGATGT
+AGTCAGACCCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCCGAGTGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTGAGAGTATTGGTTACTTATTGGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCAGTAAGGCAACTAGTTTAGAAAGTGGGGTCCCATCAAGGT
++
+GGGGGGGGGGGGGGGDGGGGGGGGDAFFGGGGGGCEEGGGGGGGGGGFGFFGGDFFGGGGDFGGGGGGFGGGGGGCFGGFFFGGGGGGGGGGFFFFGCFFEFGGGD<FFGGGFGGGGGGGGGGGFFGGG9FGFGCEGGGGGG8DEFGGFFFGDEFFCECDEEGGD6;@DCF9CFGG7,@E>,,273,>CFFGGGG,2=EDF@EFFGGG<CFGC*ACF,8*:8CE+A7*0>8+:CCCFGFFFF6**++;:FGFF+<FDGCF=EGDF>@<D#####
+@M01873:M01873:000000000-B9G3J:1:2110:7628:11014 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GGATAACGTCAAAGAAT
+GGAAGGCGCTTTGTGAAGTAGGCCTTATTTCTCTTGTCCTTTCGTACAGGGAGGAATTTGAAGTAGATAGAAACCGACCTGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACGAACCTTTAATAGTGGCTGCACCATCTGTCAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGAGGTGGACGTATCATTAAAAACAAAAGAAGAGGAATGTATTGACAGAGAAAGGATGAAAGAGGACGATAG
++
+GGGGDGGGGEGGGGGGGAGGGFDEDGGGGFEGFGGFGGGGGGGGGGGGFACEGG@FCFFGGB9?FFFDFFFGGG8FCFECGG,A,B,9CFEE@F7FFGGGFGGGF8A:@FFF:,=A,;FGFC+AFF<ADAFFFG:C7>=,DFB@FF=,>+,@EF,,<;,,@@DCGF94@@CCECC8CCEE?E486,*5=BC8=<;+=E#############################################################################
+@M01873:M01873:000000000-B9G3J:1:2105:10953:6580 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=AGCTGTGTGACAATGGG
+GATGCTATGTTGTTGGAGCTTATCAAAGAAATTCTCATATCCTTCTTTGAGCATAACGTCAGATTCTGCCACAATTTCTTTAAGTTTAGCTTTTGGTAAAGCTTGCTGAACAAGCAAACCATGTGATTTAGTATACCATTCCATCATATCAGGGTGCAGACAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTGGCAGGATCATTAAAAAAAAAAATAATAAAAAACAGTACAAGTAGAACTATTTACACATAGATAA
++
+GGGFD9<FFEFGGGFEGGFGFFGGGGGGDFFGDFGGGGDGGGGGGGGGGGGFFGGGGFGGFGFGG9@FAFGGGFECGFCEFCEBEFGGGF9D<EFGEE??FGFGGGGGGGGGFECFFFGDFFGGGGGFFFGGGFFA9EFGGG;E,,EEEG9EF8FE+=EED8DGG9EEEE88DEF6@C>CGDFFGEFFEFGCCEGGG7CECFFC9ED***211*462,,65BGD?==DE############################################
+@M01873:M01873:000000000-B9G3J:1:2103:6418:17742 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=ACAACTTGTCTTGGCTC
+TTCAGACGTGTGCTCTTCCGATCTACTTTATGTATTCGATCATACGGGGGCTGAGAGGCGCTGCTGGGCGTCTGGGCGGAGGACTCCTGGTTCTGGGTGCTGGGAGAGCGATGGGGCTCTCAGCGGTGGGAAGGACCCGAGCTGAGTCTGGGACAGCAGAGCGGGCAGCACCGGGTTTTGTCCTGGGCCTCCAGGCTGTGAGCACAGATACGCAGTATTTTGGCCCCGGCACCCGGCTGCCCATGCTCGAGGACCTGAAAAACGTGTTCCCACCCC
++
+GGFFGGFEGGGGGGGGGGGDGGGGFGGGGGGFFFGGGGGGGGGGG8FCGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGDCFGGGGGGGGGGGGGGFGGGFBFGGGGGGGGGGFGGGFGGG>7C*B>FFGGGGGFF7BFGC6*?EGC5EG*0;EEE*:EGGGG?FG7FGGF8EF*CFGD=8C+<0<<8:6::?CE5**3AF?C+?FCC*:C8*>GEG**:C*9*+2;E9<5/:)*;C602<FCC852:263<C#####
+@M01873:M01873:000000000-B9G3J:1:1110:22639:11539 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CAGCTACACACAGTAGA
+GGAGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATAACACCGGAGAGATTGTATTGACACAGTCTCCAGCCATCGTGTCTTTGTCTCCAGGCGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGTAGCTACTTAGCCTGGTTTCACACGAGACCTGGCCAGGCTCCCAGGCTCCTCTTCTCTGATCACACCACCCGGGCCACCGACATCCCACCCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG9FGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGCFGFFFGGFGGFFGCGGG?FGGBFCEFGDFGGFF787EGGFDGFFGEGFDGG,@D:D>8>5CCEGGGGFE?D@CACC@FC;CFFFFGFFF5A,4:C#######################################################################
+@M01873:M01873:000000000-B9G3J:1:2119:26638:5460 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CCTCAACAACTTGCAAT
+TCTTCCGATCTTACCAAACGTTAGGGGTGATCTACGGGGGGAGAGGGGTGGGTACTGGATAAACCCATCCCCTTCTCCCCCCCTCCTTCCCCCTCCCTCCCTCTCTCCTTCTCTCCCCCCCTCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGAGATCGGACGAGCTTCGTGTAGGGAAATAATTTACATCTCGTTGGTCGCCGTATCATTACACCCTCTCACTCTCCTCTCTACCTCTTTTCTCTCTTCCTC
++
+GDGGGGGGGGGGGFFGGFG7EEEFFF:FGEFFGGFGGGGG7+87F@>CGG7@F,DFGG?,,8,:@CF8FCC7>FFEFEFGFEECFGFGFFFFG<FG7BFGG+=:F:FG:F:,?FGGAFGEE8C88FF?FCED8C?FEGFGGG:EGGFG68;@EC6A5CEG*9:<:FGCE5C==EGC55*9C=C############################################################################################
+@M01873:M01873:000000000-B9G3J:1:1113:6140:4661 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=AACCCTTCAGCAGTACC
+GGCTGGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTATTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCACCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCGCTGGAACCAGCCGTGACGTTGGGGGTTATAACTTTGTCTCCTGGTACCAACAACACCCAGTCCAGGCCCACACACTCATGATTTATGGTGTCACTAATCGGGCCCCA
++
+GDGDCFFGECCFFF@FECCFEDGG:FFGGGGGDGGC=<FEGGFGFGG8FECCCCFGGGFG9FFFGGGGGGGGGGFGGGFGGFFEGGGGFGGGGGCFFGGGGGGGGGGFFGGGGGGG,@D>FFGFDDC8DCFGGCE8,,79CCGFGG>@DC8CD*=CFCG?CC;,>C5*=CFF?CC<C***//CC8C84:>E>*9E4C70:E7C47797**00<*+7EG85=D*>35+/*2+7*>;<<B<BD<8?7=CF#########################
+@M01873:M01873:000000000-B9G3J:1:1114:9970:8638 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CCGGTTAAGATATCGTA
+GAAGCATTCTGGTGAGACCAACTGCATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAGGGCTTCTCCTCAACTCTCTCTGGAAGGTTGCAGAAAGCAAGGACCAAGTGTTTCAGCCGTCGACGGGTTCTGCAAGGCAACTGACCTTTGGATCTGGGACACAATTGACTGTTTTACCTGATATCCAGAACCCTGACCCTGCCGTGAGATCGGAAGAGCGTCGTGTCGGGAAAGAGTGTAGATCTCGGTGGTCGCGGTATCGTT
++
+GGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGCGGGGGGGGFGFGGGGGGGCGBFGGGGGDGGGFGGGGGFGDGGGDGCEEGGGGGGGDCFGGG>FCFCGGGGGDCGGGFGCCFGCF5:,05=FFECCFF>GFCGGFG6B@=:B<5=F<<FC*;FGG5>8*7CCGGEEDGF64>9*09<*)9>GF)5;99<GAF?<6+<3*:EE>52?D#########
+@M01873:M01873:000000000-B9G3J:1:2117:24875:22401 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=ATACCTTCACTTTAGTA
+GTCTCAGAGAGGTGCCTTAGCCCTGGATTCCAAGGCATTTCCACTTGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTGGGGCTGTGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCTGTGTGAGATGGAGGTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGAGGGTCCCTGAGACTCTCCGGTGCAGTCTCTGGTTTCACTTTTAGTAGTTATGACATGAACTGGGTCCGCCGGGCTCCAGGGCAGGGGGTGGAGG
++
+FEGGGGGGGFGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGFGGGFGDGG9D@EFGDCFGFGGGG8F7A<EFGGGDEF,?E,=?CFCC7FGF,9EFGFEEE,F<,FFCFGGGGGCGGGG,=@FGGGGGG;EGGGF9,>:EDGEF?8+BFFGGGG88C+>8EDGFG>>AE######################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1107:8981:22378 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GGATATCGAAGAATCGC
+GTCTCCACGTTCCCTGCCCGTCACCGTTGGACAGCCGGCCTCCATTTCTTGTAGGTCTAGTCAAAGTCTCGTGCACGGAAATGGAGACACGTACTTGAGTTGGTTTCAACAGAGGCCAGGCCAATCTCCAAGGCGCCTGATTTATAAGGTTTCTAACCGGGACTCTGGGGTCCCCGACAGATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAGAATTAGAAGAGTGGAGGCTGAGGATGTTGGCGTTTGCTTTTGCATGCAAAGTACAA
++
+GGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGEGGFGGGGGGGGGFGGGGGGGGGFGGGFGGGGGGGDEFGGF8?FFGGGGDGGGGFGGFGFGFGGGGGFFFGGGGCGGGFFFFGGGGGGGGDEGG@FGGGFEGG9;ECFGFGGCEGGGGG6;99<>8CFGGGDGGGFGGG7?757EG529<CEC768CD*767+;>CFCFGG*2<>GGGC6CC:*7DF5**9*7:9CCA6CFCCC67?C=*+3C2+09+<FDFGG?92+A#
+@M01873:M01873:000000000-B9G3J:1:1101:10099:23047 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CTGCCACACTTTGAAGA
+AGGAACTGCTCAGTTAGGACCCAGACGGCACCATGGAGGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACTTCTGGGAAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCAAGGGGAAAGAGCCACCTACTCCTGCAGTGCCAGTCAGAGTGGTATTATGAACTTAGCCTGGTACCAGCAGATACCTGGCGAGGAGCCCAGACTCCTCATCTATGGTGCATCCGCGAGGTTCACGGGTGTCCCAGCCAGT
++
+@+F@<FGGGGGD,@@DDGGCGG8FFCF,8@C<CFC,:,B@<:F7FFGE7EC<6CFDGFCEF,6EEFG9AFGGG8FE<F@,?BF,AFGFGGGF,A<<EFG9FA?FF,@7:>?=>99FGFGECEEFFGEAEDFFG,D,6E,7>8E8FCFCF,383,66CGGEGGG,,2@EG6,,7,,,,*@,@,7@CF:@B,3,57:C4;+@:=,10,**1+042CF*8C***2=/CF***0A?F+CFFC7@4:CF?CGG3=**:*2*0<<*1CEC*+<CG4:F###
+@M01873:M01873:000000000-B9G3J:1:1101:10100:15992 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=CCAAATGCTAAATATTC
+GATCCTGCCCTGACCCTGCCATGGGCACCAGGCTCCTCTTCTGGGTGGCCTTCTGTCTCCTGGGGGCAGATCACACAGGAGCTGGAGTCTCCCAGTCCCCCAGTAACAAGGTCACAGAGAAGGGAAAGGATGTAGAGCTCAGGTGTGATCCAATTTCAGGTCATACTGCCCTTTACTGGTACCGACAGAGCCTGGGGCAGGGCCTGGAGTTTTTAATTTACTTCCAAGGCAACAGTGCACCAGACAAATCAGGGCTGCCCAGTGATCGTTTCTC
++
+GGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGFGGF?@FGFFGGGGGGGGGGGGGGGGAFGCEAFGGGGGGGFFE8FFGFGCFGDE9EFFGGGFGGEE9DGDGGGGGD7C9EGGGCFGGGGGGGGEGAC6DAFDGDGDGGGGFFFGGGGEC5:ED*CFF;6CCFGGCC9E?+=<:>F+69FGFGGGFF+:C5>8**29C0+<<6CEGCEF56*0000+128@:<9
+@M01873:M01873:000000000-B9G3J:1:2107:8132:17450 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=TTGTCAGCCTGTGGTTC
+GGAGAGGGGCTGTGCTGAGAGGCGCTGCTGGGCGTCTGGGCGGAGGACTCCTGGTTCTGGGTGCTGGGAGAGCGATGGGGCTCTCAGCGGTGGGAAGGACCCGAGCTGAGTCTGGGACAGCAGAGCGGGCAGCACCGGTTTTTGTCCTGGGCCTCCAGGCTGTGAGCACAGATACGCCGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGTAAGAG
++
+GGGGCFEDCFGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGGDDFGGFGGGGGGGGGGGGGGGGGGGGFGGGGGEGGGGGGGGGGGGGGG7@CGFCFEFGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGDBFGGGEGGFGCFFCF;?FGGGGFGGGG6C;@<E<EFEFFGGGFC*:CGGGFG7*<0CEE=5EGGGECEG5;CF?9:FDFGGGG*:CF66@7E@***/<CEC++2:EC<EG**C*1A*9@EC######################
+@M01873:M01873:000000000-B9G3J:1:2119:20248:11282 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TAATGTACGGAAATAGA
+GACTGATCAGGACTTCTCAGTTCTTCTTCTCACCATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATCCCTGGATCCAGTGCGGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGTCAGAGCCTCCTACATAGTGATGGAAAGACCTATTTGTATTGGTACCTGCAAAAGCCAGGCCAGTCTCCACAGCTCCTGTTCTTTGAAGTCCCCAACCGGTTCC
++
+GGGGGGGGGGGGGGGGGDGGGGGGGFFEGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGDGGGGGGGGGGGGGFFFFECFGFGGGGGGGGGGGGGGGGGGGGGGGGCCDGGGGGGCGGGFGGGGGGGGGGGFGFGGGGGCC9EFGGGGGGGGGF=F,D7;6DFF?FGGGGGFFFGGFFGGCCCFDGF;DFCFEGGGGGAF0+1C:1;<:C6><?)++4A+=BCF+<++=84*1CC*CE##
+@M01873:M01873:000000000-B9G3J:1:2115:23638:16692 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CACACAAGGAGACACGT
+GAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGCATGCCCTGGCTTCCTGTGGGCACTTGTGATCTCCACCTGTCTTGAATTTAGCATGGCTCAGACAGTCACTCAGTCTCAACCAGAGATGTCTGTGCAGGCGGCAGAGACCGTGACCCTGAGCTGCACATATGACACCAGTGAGAGTGATTATTATTTATTCTGGTTCAAGCAGCCTCCCAGCAGGCAGATGATTCTCGTTATTCTCCAATAAGCTTATAAGCAAA
++
+GCGGGFGGGGGGGFFFDEGGGFC9CAFFDFFEEE8DCFDFGGG<FGCGFGGCFGCFCFFGCGFGGGGGGGFCCEEGCGGGGGGGCECBGFGCCGAGEGGG<EFGGGCFGD:F@EF@AEEFD;9:FGG99=9:FF8E8EEFEAFBDFFGGG++@8@EFFGG6>CF5*3@FFFCCD,6,<AF?F?F7?FD5F962=CF:C>9,1=CFF7@=CGFEE80,,4>C+*58:CECCG+**25=F8=;+3C<FF+*79C@C9+3CC++<?+<A9+3+:97CC#
+@M01873:M01873:000000000-B9G3J:1:2106:2176:11695 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TGTAAATAGTTTGCCTA
+AGGAACTGCTCAGTTAGGACCCAGACGGAACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGGGCTGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCTACTTAGCCTGGTACCAGCAGCACGCGGGCCAGTCTCCCAGGCTCCCCATCTATTGTGCATCCACCAGGCCCACTGGTCCCCCCGCCAG
++
+GGGGGGGGGGGGGGGGGCACFGGGGGEGGGGGGGF8EGGGFFGE:FCFG@FCEGGGFEGGGG8,6,6,B<E9FEFEFGGF==FFGGG8FB,,:FGAEF<,,,9@=FG+F74??F9A@F7,A:+FFFC9<BCADAF,7D8F7:6@:D8DFGGF:6@:8@,,@:?6:CEEDDCCE<E,5<C,,5;9@,9DG?CED,=>5<DFC#########################################################################
+@M01873:M01873:000000000-B9G3J:1:2118:8705:16266 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=TGTGAACAAGATATCAT
+GGGGGTCACAAGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTGCTCCTCACTCTCCTAACTCAGGACACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGAAAGCAGTGGTGATTTTGGGACTTATAACCGTGTCTCCTGGTTCCAGCAAGTCCCAGGCAAACCCCCCAAACTCATCATTCATTCGGTCACTAAGCGGCCCTCAGGGGCT
++
+GGGGGGEFGGGGGGGGGGGGECGGEECGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGC,AEFGF,<ECFGGGGGGFGFFGGG>GGGGGGGGGGGGGEFGGGGGGGGG6@FGF6CC*?C@8FGFGGGGGFFDGGGGGGGGG*:@CFGDGGGGGGGGGGGGGGCC6<*<CC?E+9CFC?EGGGF+<+<CCFCGFGG?CCGGGCFF?C7C609<C9++8***:7CGG8:?C57FC?*<CF7EF<>F8<6?G#####################
+@M01873:M01873:000000000-B9G3J:1:1101:10107:18394 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TGTGTATGGGCACACTT
+GGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCTCTGGATCCAGTGGGTATATTGTGATGACTCAGTCTCCACTGTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCGCCTGCAGGTCTAGTCAGAGCCTCCTGCACAGTAATGGAGACAACTAGTTGGATTGGTACCTGCAGAAACCAGGGCAGTCTCCACCAGTCCTGATCTTTTTGGGTTCTAATCGGGCCTCC
++
+FGGGGGGCGGGGGGGGGGGGGGGGGGGGFGGFGGFFFGGGGGGGGGGFGFFGGGGGGGGGGGGGGGGGFGGGGFGGGGGGFFGGGGFFGCFE9FFGGCEFGGC9F,CEFGAE4==EFGGFEEC8EGGGCCEGG8EGFFGGGDGGGGG:>FGGFGDEEGFGGG>FFGGFGGDG,<CF?:DFGGFE,CGEFG,C4CCFDF=F,,48CG*;FG;D7:=CFG?6C6CCC#################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10111:8693 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=GCGACTCTTTCATTTAG
+AGGAACTGCTCAGTTAGGACCCAGACGGAACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGACTATTAGCGCCTCCTTAGCCTGGTCCCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCCTCTATTGTGCGTCCCCCAGGGCCACTGGTATCCCAGCCCG
++
+EGGGGGGGGDGGGGGGGGGGGGG,CFG7FGGGGGGGGGGGGGGDGGGGGGGGFGGGGGGGFGGGGGGGFGGGAEFGGGGGGDGGGGGGGGGGGCGGGGGDEGFGGGGGGGG@;@=EFGGG?FGGGGC;,39DFEGF9DFGDEEFGGGF>E?FGFGC?FFFGF9?EGG5DEG7EFC,@EG7=CGGGDGG>99778CF4C,AFDFG,**2*2CFEC5F##########################################################
+@M01873:M01873:000000000-B9G3J:1:1106:7472:17358 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=GTCATTTGCTGTAGGCA
+AGCTGTGGGCTCAGAAGCAGAGTTCTGGGGTGTCTCCACCATGGCCTGGACCCCTCTCTGGCTCACTCTCTTCACTCTTTGCAGAGGTTCTGTGGTTTCTTCTGAGCTGACTCAGGACCCTGCTGTGTCTGTGGCCTTGGGAGAGACAGTCCGGCTCACATGCCAAGGAGACAGCCTCAATAGTTTTTTTGCAAGCTGGTACCAACAGAAGCCAGGGCAGGCCCCTACAGTTCTCATGTTTGATAAAGACAATCGTACCTCAGGGAACCCATAC
++
+F:CFGG8F:FGGGGFEGFGGFGFGGGGGGGGGGGGGGFFGGFE@GGGGGGGGGGFDCFGGGFGBFFGGGGFFGGGGGGCFGGGGGCGFGG9EFFGFGGGGGGGFGGC?FGGGGGGGGGGGGGGGGFGGGFGGCFGGGGGGGCECEGGDGGGGGC+==FFGGGG8<7DFF6@FFGGCGG6CFAGG7CEF8C5EF=FCFDFGF<C,<9CAFF6CFC6C=8**?EE5C>CFCFF+=C>@:+;AFEFGFGF###########################
+@M01873:M01873:000000000-B9G3J:1:1113:11846:1631 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=TTTACAGTTCCTTTCTG
+GGTCTGGGCCTAAGGAAGCAGCACTGGTGGTGCCTCAGCCATGGCCTGGACCGTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGGCTCTTTGACCTCCTATGTACTCACTCAGGCACCCTCGGTGTCAGTGGCCCCAGGAGAGACGTCCAGGATTACCTGTGGGGGAGACAACATTCAAAATGAAGATGTGTACGGGTATCAGCAGCAGCCAAGCCTGGCCACTATGCTGGTCCTCCCTGATGCTGGTGACCGGCCCCCCAGGCTCCGTGTGGG
++
+GGGGGGGGFCGG,FFFFGFG<FGGGGGECEFCDGGGGGGGGGG8FGGCCFGGEEGGDEFG<<FEECG7=FFEFDGFGGGGGGGGFGDDEFF,C<FGGGCF8FGGFEFDG9==E@EFC,A:=DE+>BEGC;F;D=BEDCEG?>+33+,433@3@:::99F99AFC,:5**1?CCB:4=7+91?,4,1,5:,+1:+;+7*8598@CFF6<;*9<F###############################################################
+@M01873:M01873:000000000-B9G3J:1:1113:28641:15469 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=ACACGTTGCGTATGAGA
+GGAAGGCGCTTTGTGAAGTAGGCCTTATTTCTCTTGTCCTTTCGTACAGGGAGGAATTTGAAGTAGATAGAAACCGACCTGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACGAACCTTTAATAGCGGCTGCACCATCTGTCAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAACATATATCTCGATGGTGAGATAAGTCGAGAAACACAAATGTC
++
+GGGGGGGGFGGGGGGGGGGGGGGGGGGGFGGGGGEFGGGGGGGGGGGGGFGFFGGFGFGGGEGFEFGGGGFGGGGGGGGGGGFFGGGGGGGGGGGGFGDFGGGGGFEFGGGGGGGGGGGGGGGGFGGGGF@FGGGGECFFCGGGGGFEE>EGEGGGFEGFGGEFFGGFFEDGGGCFGGGG47=*>EE4CCC<FFCF7AGF7CF4EBCDE*8C;9:DCD7*<0AFCG#################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10117:6605 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=TTCAGTGGGTCTTCTTT
+GGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCTGCTTCTGGGGCCAGGCTCCGGGCTTGGTGCTGTCGTCTCTCAACATCCGAGCTGGGTTATCTGTAAGAGTGGAACCTCTGTGAAGATCGAGTGCCGTTCCCTGGACTTTCAGGCCACAACTATGTTTTGGTATCGTCAGTTCCCGAAACAGAGTCTCATGCTGATGGCAACTTCCAATGAGGCCTCCAAGGCCACATCCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEFGGGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFEDFD7FGCGGGDGFGGGEGGFGGGG7FEFFGGGEGCFFFGGCGGGGEFGGGGGGGCFF@EFGGGF?EGG?+A9<97<FGGDFF5@@EGGGFFGFFGGGFF+::9CCFGG47C<FGCFFF7DCFFG3*//::ACGCGCGE=*79*:D<C7??7E+70***00:@>>CFFFG:C###################
+@M01873:M01873:000000000-B9G3J:1:1101:10117:24419 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=TAAGCTGCACAATGAAT
+AGAGCTCTGGGGTGTCTGCACCATGGACTGGACCCCACTCCTCCTCCTCTTTCCCTCTCCTCCTACACGGCACAGGGTCTCTCTCCCAGACTGTGCTGACTCAATCATAGTATGACTCTGCTTCCCTGGGATCCTCGGTCAACCTCACCTGCACTCTTGCCAGTGGACACAGTACATACATCGCATGGCATAAGCAGGAGCCAGGGAAGGACCATAGGTACTTGAGGAGGGTGGAAGGGAGTGGAAGGTACACCAAGGTGAACTGCGTTCGTG
++
+@CGDDD,ECEG7+88FFGAFF8@EEGCE,CE8,;B@CFF,@FGGEFFCCEC6C6C,B6,,@,BF,,B=,8+@=EFFGD=,5@FG,B845,:A5FFEGG,9A<<FFGGF;,4,,9,49,4;9,@,8EF=DBE>F?FAEEE>BF,76@@,,,68D=,,@=9,8A86EG,87@CFF7FC,@AFGD7>;CEFGFG5C2:7;*97;*01@D###################################################################
+@M01873:M01873:000000000-B9G3J:1:1117:12944:14016 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=AGCCCATTTCATAATTA
+GCTTTTCTCAGGGGAGAGGCCATCACTTGAAGATGCTGAGTCTTCTGCTCCTTCTCCTGGGACTAGGCTCTGTGTTCAGTGCTGTCATCTCTCAAAAGCCAAGCAGGGATATCTGTCAACGTGGAACCTCCCTGACGATCAAGTGTCAAGTCGATAGCCAAGTCACCATGATGTTCTGGTCCCGTCAGCAACATGGACAGAGCCTGACACTGATCGCAACTGCAAATCAGGGCTCTGAGGCCACATATGAAAGTGGATTTGTCATTTCAAAGTTT
++
+GGGGGGGFEE@F8FC:CCGFD@DC,6ECA<<AFGFDEF9F<A9EEG<,<9@CEFGF9<@8DFGFFDF8FF<EFFFGG9A<<<EFA9FEGGGFF,9FEC8A<FEFFGFC78FFG=FFFGGDEF7>C9F7EF,=44>8EGD8+@?>E;=D;=6@>CEGGGGGFGFEDCADAD3EF=C9DD,@,+47,;++@FGG*;C,;*<F>FCCDFF4*;<*4=@4;;99**,*4++*;BCGC##########################################
+@M01873:M01873:000000000-B9G3J:1:1111:27451:7271 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GCATTTCTTGCAACTAC
+GACCCAGAAGACCCCTCCATCCTGTAGCACCTGCCATGAGCATCGGGCTCCTGTGCTGTGTGGCCTTTTCTCTCCTGTGGGCAAGTCCAGTGAATGCTGGTGTCACTCAGACCCCAAAATTCCAGGTCCTGAAGACAGGACAGAGCATGACACTGCAGTGTGCCCAGGATATGAACCATAACTCCATGTACTAGTATCGACAAGACCCAGGCATGGGACTGAGGCCGATTTTTTAATCCGCTTCTGCGGGTACCACTGACAAAGGAGAAGTCCCC
++
+GGEGGGGGG@EFFGGGGGGGFGGCCGGFCFDCFGGGGGGFDGGGGC@FGGEGED@EE@A8,6,FFFGFGFBAFFFGEF8FCGA,BFFFFEG=EFFFFG9EFGFC@ED,FDFGFCFF+E8?F=FFFFEED9>F8FEF?8+@DEGFFFFG,>FCF==9,==8D8EGG?C6=F88DF7CF6,@6,3EF,7E39EC,+?BA@7A9D50,A79DC4C>F49C*8D?F#####################################################
+@M01873:M01873:000000000-B9G3J:1:1116:19939:2288 2:Y:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=GTCCGTCCTTATTTTGT
+GTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAATTCATATGATACTAGTAAAACGCACCGTGTGCCAAGTCAATGCGACGTCACTTATAGTAGTACATCGTAGGAGGCATGATACTATGTATTCGTATCTGCCAACTGCTCTGACGCAACAGGTGCTTATT
++
+GGGGGGFGGGGGGGGGGCGGGGGGFFDGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGEGGFGGGGGGGGGGGGGFGGGGGGGGGFGGG:FE+CFFGGGGGGGCFAEGFDDFGGFGGGGG@EE8*@>777,,5>?FGGGEDGE#################################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2108:15031:12741 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=GGTTTTCATAAAACTCT
+GGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAAGAAAGAACAAAAGAAGTCCCGACAGAACCGAAATCACAGAATAATGAAGATCACATAATGTGCTACTGGG
++
+GGGGGDFGGGGGGGGGGGGGFGGGGGFGGFFGGGGGGGGGGGFGFEFGGGGGGGGGGGG<ECGFGGGGGDF<EDFGGGFGGGGGFGGDFGCGGGGGGGGFGGGGDGGGFGGGGGGFEGFFGGGFGGGGGGCGGE@:@CCF:FGEEG::CG>CEEGFGF7E?,=@BFGGGFFF97;BCFCCGGFG>EE***=+9+<9CF*CC=C#########################################################################
+@M01873:M01873:000000000-B9G3J:1:2117:19601:12685 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CAGAAATTCTGTACAGC
+GGAAGAAATACTGTAAGTTGGTACCAGAAGGTCCCGGGAATGGCCCCCAAAGTCGTCATCTATAGTAATGATCAGCGGCCCTCCGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGTCTTCAGCCTGACGATGAGGCCCAATATTACTGTGCATCTTGGGATGACAGCCTCGACGCCCATGTGGTATTCGGCGGAGGGACCACGCTGACCGTCCTGAGTCAGCCCAAGGCTGCCCCCCCGGTCCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGFGGGGGGGGGGCFGGGGEGGGGGGGGGGGGGGGGGGGCEDGGGGGGGGGCGGGGGGGGGGG>CGGGG?FGFDGCFGG7EDFGGFEF6:7EFECGGCEFGGGGF66BGGGG?C?FFFFGGGGGFGCCFFGGGGFGGGGDGDGF?FC>FFGGCF>5CDDGE)99CF=@?<E3*9D>DEE7+)39<D6CCFEG*1+*1;EGG########
+@M01873:M01873:000000000-B9G3J:1:2109:17364:9116 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=GCAATATATTTAGGCTT
+GATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTTCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCTCTGGATCCAGTGGGGATGTTGTGCTGACTCAGTTTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATTTCCTGCAGGTCTAATCAGAGCCTCCTACATCTTAATGGTTACAGTTCTTTGGACTTGTACTTTCAGAAGTCAGGAACTGTGGCTGCACCATCGTACAGAGCGGAAGAGGGTCGGGTGGGGG
++
+@@CCFCEFGFE,,<FF<CFG9FGFGGCEG8FF@,6EFG,C;EEFD6<CFGFF<@,@::CF>EFEAFF<FFG8<=F8,?BFAEFCBFDFFGGCCF?FEE@EE,:A?A8=,FFGG@?A=FE,AEGC,ACCFFG9EBDD=,,8>EGEE7>6D68;FG8EF9E6D?D8DDDGF9;A9?,,,>:9,,3,@,,3<;E,+;67?F:,=ECE7<2C,>92=7<19C,=>8;C##################################################
+@M01873:M01873:000000000-B9G3J:1:2105:12905:4671 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=ACATTAAGACCAGAATT
+ACTTCTTAGTGCCTTTTCTCAGGGGAGAGGCCATCACTTGAAGATGCTGAGTCTCCTGCTCCTTCTCCTGGGACTAGGCTCTGTGTTCAGTGCTGTCATCTCTCAAAAGCCAAGCAGGGGTATCTGTCAACGTGGAACCTCCCTGACGATCCAGTGTCAAGTCGATAGCCAAGTCACCATGGTGTTCTGGTACCGTCAGCAACCTGGACAGAGCCTGACCCTGATCGCAACTGCAAATCAGGGCTCTAAGGCCACCTATGAGGGTTGATTTGT
++
+GECFGGGGGCEFGGDCF@<,6CFCCCFECEGGGGGGDEFAAEAEFFFAEA,EFG,<FFGGGGGC<FGFGDGGEFFGCCF<FFA?FFFGFGGGFDCGGG9FEFCF?FE<<BEEEEGFGDE+64E?FG;,,C,6@8@?FGGFFECB@@8=CEGCE=>=,@EDG=,8AE889,93DEACFFGGA,7ECE7DFGFGGC58@C>8ADF,,=C=,,1<8E684,,,60:CFCCD5CEG+B++<@=DFFFE*8A##########################
+@M01873:M01873:000000000-B9G3J:1:1119:16240:10507 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=TTTAATGCTGGTCATGG
+GGCTGGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTATGCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAAAGACACCCAGGCAAAGCCCCCAAAATCTTGATTTTTGATTTCATTCATCGACCCTCC
++
+GGGGGGGGGGFFGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGFGFGGGGGGGGGGGGFGGGGGGGGG?FGGGGGGG<FFDGGGFGGGGGGGGFGGFFFGEGGGGGGGGGGDGAFFFGGGGGGGGGGGFFCDCCFFFCEGGGGGGGGGECECGGGGGCD<FFCEF?EG?6:FGGGGG68CCGEDEFGG8C>DFCC+C@FFG=FFGA*0=D<>F:DFA*0>FGG##################################################
+@M01873:M01873:000000000-B9G3J:1:2116:7856:19893 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TTTGAACTGGGTGCAGT
+CGTATCATCAACTGATGAGCAAGAAGGATATAATTCCTACGCCCTCTCAGCCGATGAACAGTTGGAATAGGTTGTTAGCGGTAACTAAGATTAGTATGGTAATTAGGAAAATGAGTAGATATTTGAAGAACTGATTAATGTTTGGGTCTGAGTTTATATATCACAGTGAGAATTCTATGATGGACCATGTAACGAACAATGCTACAGGGATGAATATTATGGAGAAGTAGTCTAGTTTGAAGCTTAGGGAGAGCGGGGTTGTTGGGGTTGTGGCT
++
+GGGGCFFADGFEGGGGGGGGGGGFGFF@CC9FE<FECFAFGGCEGG@CEFGGFFEGGGFC@,CFDBEGFGGGGGFFFGCFEGEEGF<BF9<,5E9A?EGGGCFGFFGGGGFEGF9,CBE9FFA9FFGGEG8,8,A9EF9EFFCFEC+@FFG;=D;E8E=8EFGFDEBF98>=E9ECEGGFG8,@@C?6EFFCFAE9C73939,2;9@ADF>C65>@C@F@D6;7C>6=986=,+,,1=2:CF?,>:,;CF=5A5*/CE?################
+@M01873:M01873:000000000-B9G3J:1:2106:17308:17099 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GTGAGCACCGTTTTGTA
+GCAGCACTGGGATTCCGAGGTGTTTCCATTCAGTGATCTGCACTGAACACAGAGGACTCGCCATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATGTTAAAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCTTCATCAGTAGTAACTACATTAATTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGGGTGGGTCTTCGTTCTTTCT
++
+GGEGGGGGGGGCFFGFG7FGGGFGGGFFEFGGGFGGGFGGGGGGFGGGGGGGGGGF@FGGGEEFGG8FGGGFGGC@CFF8AFGGGGGGGFCFEGGGFFFAFFGFF9FE7EEG8C,=FEFFCF8FG8?,FFGFFG7@CF:;DFGG>>BEG8DGCGGFCG8;D8FG8B=EGGFFGFGGFG8@8808FF#########################################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10137:13722 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=GAGAGTTGTCTAAAATC
+AACCACATCCCTCCTCAGAAGCCCCCAGAGCACAACTCCTTACCATGGACTGGACCTGGAGGATCCTCTTTTTGGTGGCAGCAGCCACAGGTGCCCACTCCCAGGTCCAGCTTGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACTGATTATGCTATACAGTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTTGATGGGATGGATCAACACTGGCAATGGTAACGCAA
++
+EGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGCGGGGGGGEGCGGGFCGGGGFGGGGGGGGGGGGFEF@CFFFFGGGGGGGGGGGGGGGFDFGGGEGG?@CFFGGGGGGCFGGG7E@=8E?ECFCFD>DFCGFGGGGGGGG8EGGGFFEGFFF:AC;<DFDF6899EFFCGGGGGGGGGFC:CCCGGGGFF,:::FGCFG44)497CG=:CEGG)/:5;DFF5C<)37@F?CFF6E:49C*3<*+*<C0<F5*08CCCCGGG*:C
+@M01873:M01873:000000000-B9G3J:1:1111:13857:12993 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TGGATAGAAAGACTAGT
+ATACTTTCTGAGAGTCCTGGACCTCCTGTGCAAGAACATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCAGTGTCTCTGGTGGCTCCATCGGCAGCGGTGATTACTCCTGGAACTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATGTTTAACAGTGGGGGAACCCAAA
++
+GGGGGGGGGGGGGGGGFFGGGGGGEFGGGGGGGGFGGGGGGGGGGGEGGGFDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF8FFCFFGGGGFFGGCFGFGGGGGGFGGGGGGGGGGEGFFFGGGFGDFGGGGCFGGGFGGG8DEFFGGGGGGGGFGGGFGGGCDFFDCFGGDGGGGGGGG*@CGE9CCFGGGGCFGGGF>6?FGF>*;CCGDDF49CCCFDFG*A##############################################
+@M01873:M01873:000000000-B9G3J:1:1108:14300:19094 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=AAAGAAGGTGTAACTTC
+GAAGCTCTGCTTCAGCTGTGAGCGCAGAAGGCAGGACTCGGGACAATCTTCATCATGACCTGCTCCCCTCTCCTCCTCACCCTTCTCATTCACTGCACAGGGTCCTGGGCCCAGTCTGTGTTGACACAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGTTCACCATCTCCTGCTCTGGAAGCTCTTCCAACCTTGGTACCAATTATGTCTTCTGGTACCAGCAGCTCCCAGGCACAGCCCCCAAAGTCCTCATTTTTGACAGTAATAAGCC
++
+GGGGGGGGGGGGGGGGGGFCCGGGGGGGDFGGGDGGGFGGGGGGGGGGGGGGGGCGFGGGGGGGGGGGGEFFCFFFGGGGGGGGGGGGGGGGGGGGGGGGDEGGFGG?FGGGG?FFGCFGGFCEGGG?EFF+@E7CG8FGFGGGGGGEDGGGGDF*DDF?C6,@:FGF6ED>DGGCECC?96,<8:,,4<C?979/?8BE,,,01,;EGG7:+;9<FC+A+13+355*>FFGFG*7**284CGGG5**97<C7CC?FG#################
+@M01873:M01873:000000000-B9G3J:1:2107:6181:15590 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GCGCTATTCTAAATGGG
+GGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGGGACGTTGGTGGTTATAACTATGTCTCGTGGGACCCACATCACCCAGGCCAAGCCCCCCAACTCATGCTTTATGATGTCAATAACCGGCCCTCAGGGGTT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGG@EGFGGGGGGGFGDGGGFGGGGGGGGGFGGGFGGFF>FGGFFGFFGEGG<FGGGGGGGFGFF6<FGGGGGGFGCGCCEGCGD8@CFFFFGGDGFEG5EGGDGFCCGGGGGC66EGGGGGF>6C**2C8;ECEF55:CEGECEF@FC0@C7:++27E5*2>C#################################################################
+@M01873:M01873:000000000-B9G3J:1:1115:12252:7158 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TTCATAGAATCTTCTCA
+GGGGCCTCAGGAAGCAGCATCGGAGGTGCCTCAGCCATGGCATGGATCCCTCTCTTCCTCGGCGTCCTTGCTTACTGCACAGGGTCCGTGGCCTCCTATGACTTGACTCAGACACCCTCAGTGTCCGTGTCCGCAGGTCAAACAGCCACCATTTCCTGCTCTGCAGATGATTTGGGGGCCAATTATGTTGCCTGGTATCTGCAGAGGGCAGGCCAGTCCCCTATGATGGTCATTTATGAAAATAACAAGCGCCCCTCAGAGATCCCTGACCGCT
++
+GGGDGGGGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGCCFGDCGFEG6FGCGGFFGGGGCGGCFEFGGGGCGGGCFGF?FGGGGGGGGGECCEFGGFC88CFGGCDGGGGGGGFGGG?C+?FGGGGGGFFA<5:EGGGGDGGGG7C+:>3?>>++00*9CC3CDG35D<CG<7DGG67DFGF7FC>97CF9C*17=*A:**9*))*:)2//2*32<9@FFDFF######
+@M01873:M01873:000000000-B9G3J:1:1116:7180:16322 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CGGACAGACCTAGGTAG
+GTGGGCCTAAGGAAGCAGCACTGGTGGTGCCTCAGCCATGGCCTGGACCGTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGGCTCTGTGACCTCCTATGAGGTGACTCAGCCACCCTCGGTGTCGGTGGCCCCAGGACAGACGGCCAAGATTACTTGTGGGGGGCACGACATTCGAGGTAGCAGTGTGCAGTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTCCTGGTCATCTATGATGACAGCGGCCGGCCCTTAGGGATCCCTGAACGAT
++
+GGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGFGGGGGGGGGGGGGGGGFFGGGGGGGGFFDGGDGGGGGGFGGGGGGGFBDFDGGGGGGGGGGDGCFEGG78DE7EEGFFCE>CGGFDB8DECEEGGFGGFGGFGGEFG5CEGDEGGCEEG??FFGGGGD87C?DGGGGGGGGGFCFGDGGGD9*9C4*9FC*9<FEGC*:F<7:*94**:7>:CDC4-*<7**/995EE5)2*09CEGCFGGGGG)<FF##
+@M01873:M01873:000000000-B9G3J:1:1112:10448:18448 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift0|BARCODE=CGACGTTCACATTGTAA
+ACCCAAAAACCACACCCCTCCTTGGGAGACTCCCCTAGATCACAGCTCCTCACCATGGACTGGACCTGGAGCATCCTTTTCCTGGTGGCAGCAGCAACAGGTGTCCACTCCCAGGTTCAACTGGTGCAGTCTGGACCTGAGGTGAAGCAGCCTGGGGCCTCACTGAGGGTCTCCTGCAAGGCCACAGGTTACACCTTTAACATGTACAGCATTGTCTGGCTTCGACCCGCCCCTGGACGAGGTCTTGAGTAAATGGGTTGGATCAATAATTACATTT
++
+;FCGGGGGGGGFFGGGGFCFFEGGC8FECFGGGCFGGGGG9FFFEG8EGFGGFFCGEC,C@E<FFGGF?FGFGGGGGGFGGGGGGG8,BBCEEE<AFGGGGGGGGGGGFGGGGGC8EGCGFG@=?EGFCEFF?89EFFG?8EFGGGGFG,BDFGGG6@>6DGDFFCGGDDD:DAAF?7F>D;@CGGFGFCG7<C8A,9,BC7DDE########################################################################
+@M01873:M01873:000000000-B9G3J:1:1111:16714:18923 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CTTGCTAGGTTACTTTT
+GAGAGCCCTGGGGAGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCCTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGAAATTGTTTTGACACAGTCTCCAGTCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTTTTGCAGGGCCAGTGAGAGTATTGATACCTACTTAGCCTGGTACCAACTGAAACCTGGCCAGCCTCCCAGGCTCCTCATTTCTGGTTCATCCAAGAGGGCCCCTGGC
++
+GGGGGFGFGGFDFGGGGGGGFFFFFGGGFGFGF<@FGFFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFEEGGG8,EDGFGGGFCCGGGG8,E<F<FGGE7=7:=AFFGDFGF8@F;EG8FGGGDFGGGGGG?FGDGGFGGGGGGGC?FGG68DGFGG6D6CCCGGFGGGGDE,*@EG:2,:EGGGFG,,5=C@7FDFCFGD?FC<:?+2+48?*;CFGCF*>A4;65D588C5**1=5C=CFFG+<+;>7:+<<CC################
+@M01873:M01873:000000000-B9G3J:1:2104:5522:14323 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TCTCGAGATACTTATTA
+GAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAAAGAATAACAGAAGAGACACTCGAATCAATAAAAATCAAAGTATAAAATTAAATGAATACAAA
++
+GGGGGGGGGGGGGDGGGEGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFG9FFCFGGFGFGGEGGGGGFGGGGGGGGGGCCGGGGGGFFFGGGG8FGGGGGFFGGFGGGFGGGAFDEFGGGEGGFGGEGGGGGGGGGGGGG7*>4:=>FDECCCGFG7ECECCBBFFGG5CGG9C*AC5*69@<FG+=F97CECD################################################################
+@M01873:M01873:000000000-B9G3J:1:1113:7318:10138 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=ATTTCTTTCCAACGTTA
+GAGATCTCAGAGAGGAGCCTTAGCCCTGGACTCCAAGGCCTTTCCACTTGGTGATCAGCACTGAGCACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTGGCCATATTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCGGGGGGAGGCGTGGTCGAGCCTGGGGGGGCCCTGGGACTGTCCGGTGTAGGTTGTGGATTCACCGTGAGTAGGCATTGGCGGCCCTTGGTTCGCCAGGTTCCCGGGCAGGGGGTGGTG
++
+ECFDCFFFCFCCECDFD8@FG@@FGFC<FFFFCAFGDGGGF8@EDEFGGGGGD<<FDCF,BEFF<B<,BECE?FFG8FGGGGGGCEE8,?FDFEGG8FC<F+A?FF9FC9FF@C:E:FF9@@;;EC@FG>8,,@ED===FFD+6B;?FCFFF>8E########################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2113:7529:7186 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GAAATTCTCGAACTCAA
+GATCAGGACTCCTCAGTGCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCAGTTTGCCGTGGGGATGTTGTGCTGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCTATCTCCTGCAGGTCTAGTCAAAGCCTCGTATCCCGTGCTGGAGACACCTACTTGAGTTGGTTTCACCAGAGGCCAGGCCAATCTCCCAGGCTCCTGATTTATTGGGTTTCTAATCGAGCCTCTGG
++
+GGDGGGGGGGF8FGGG9EFGGGGGGGGGGGGGFGGDFFGGFFGGGGFFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGDFGGFFFGFGFGGGGGGFGGGGFGGGGGGCEFGGGGGGGGGGGGGCGGGGGGGGGGGGGGFGGFFCFGG8?DDFGGGGGF7,,DF,33;8DFGD,41>C69?FFFFGFGGGGFFGGFFGEFGGFDFGFGFGGGGGGGGFG?###########################################
+@M01873:M01873:000000000-B9G3J:1:2115:11727:15140 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=GCACTTCCACATGGTAC
+GGTGCTGAGAGGCGCTGCTGGGCGTCTGGGCGGAGGACTCCTGGTTCTGGGTGCTGGGAGAGCGATGGGGCTCTCAGCGGTGGGAAGGACCCGAGCTGAGTCTGGGACAGCAGAGCGGGCAGCACCGGTTTTTGTCCTGGGCCTCCAGGCTGTGAGCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGCGATCGGAAGAGCGTCGGTTAGGGAAAGAGGGTGGATCTC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG7FGGGGGGGGGDGGGFCFFGGGFGFGGGGGGGGGGGGGGGGCGGGGGGGGDGE=5C9<<CF7:<8CGGGGGG*<CGF8:::<87?F7=ED###############################################
+@M01873:M01873:000000000-B9G3J:1:2116:5234:16363 2:Y:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CGGTCAGATAATCTTCT
+GAGTCAGACCCAGTCAGGACACAGCATGGACATGAGGGTCCACGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGCGACAGAGTCACCAGCACTTGCCTGTCCAGTCACAGTATTAATAACTGGTTGGCATTGTATCCGCCGAAACCAGGGAAAGCCCCTCAGCTCCTGATCTATAAGGCGTCTAGTTTGGAAAGAGGGGTCCCGTCACGGTT
++
+C:78CCEEFFFGGECFFCFD,E<AFFGGEFDGD9,@F7B6<,CFCGCEGGGDFDFDGGGC,BEGFGGGGGA<EFGGG7E<C=8EFCFFDG9,9FEFFEFF,C,AEEFF:=FAEFGGGGG,:?D,@BAECAFGAFA9>9,++3>+,,,,7DFG,,=FDGDF@,@9=,76@FC,;@9E,<EC:;C9;;E,E88D,,*,?@7E############################################################################
+@M01873:M01873:000000000-B9G3J:1:2106:24340:3314 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=GCGGCATTAGTATTGCA
+GTGATCAGGACTTCTCAGTTCATCTTCTCACCATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATACCTGGATGCAGTGCAGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATGTCCTGCAGGTCCAGTCAGAGCCTCCTGCATAGTGATGGAAGGACCTTATTCCAATGGTACCTGCAGAAGCCAGGCCGGTCTCCACAACTCCTGATCTATGCACTTTCCAAGCGGTTCTT
++
+GGGGGGFGGCGGGGGGGGGGGGGGGGFFGGGGEFGGGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGAFFDFDGGGGFGFEFFGGGFGGGGGGGGGGGG<FGGGGG=FGGFGCFEFGGGGG@FGFGGGGFEGGGGFDGGG+>D@FFFFAFAFCDFDC:CFCGGCGGGGGFFFFGG,3E>EEGGGFGF7,0>;<2DEGGF7,31:DFGG9,,6;<CF6DFFCECC=8CEF:C6*300<>*2+>+;+++5AFG?#############
+@M01873:M01873:000000000-B9G3J:1:2106:25011:8389 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=GAACTTCCCTAACGATT
+GGTGCTGAGAGGCGCTGCTGGGCGTCTGGGCGGAGGACTCCTGGTTCTGGGTGCTGGGAGAGCGATGGGGCTCTCAGCGGTGGGAAGGACCCGAGCTGAGTCTGGGACAGCAGAGCGGGCAGCACCGGTTTTTGTCCTGGGCCTCCAGGCTGTGAGCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGAGGACCTGGAAAACGTGTTCCCACCCTAGATCGGAAGGGGGGCGGGTAGGGAAAGGGGGGAGATATCGGGGGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGGEDGGGGGEGFGEEGGGGGG7FGGGGGGE@GGGG7FAFCGGG>CCFGGGGFGCFCCFGCCF<FGGGGGEEEFFFGGEGGFGGAEFEGGG>@FG@GFGGFGGFCFG9EEFGG7<@E=EGGGF?7+:C?*;>F@*8C=EGGGGF69F9EFCCEEGGCF=*9*2+3;5:*;C6CCF?##################################################
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_pairseq_test1_r2_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,348 @@
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=ATCTTTGCGGCTGGTTA
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCCACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGCCCCTGACCGATTCAGTGGCCGCGGGTCTGGGACAGAGTTCACTCTCAACATCAGCAGCATGCAGTCGGAAGA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFGFEFDG?EFGGCFFFGFF9CFE,E+ABE@EGFEGEFGGCFGGGGEGCGGGGGGDDFGGCFGDF,>D+44,@3DCFGC8CGGGFGC9@CGGGGGD8CGG?C79,1556C*00BC5D*/=EC5C4C<EDEC+:0<*:*19)8>*);7ECF*;>*0:9+<AC#############################
+@M01873:M01873:000000000-B9G3J:1:1112:28236:12457 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=CGGTTTGGTGCATCTAG
+GTGAGTGAACCAGGGCAGAAAAGAATGATGATATCCTTGAGAGTTTTACTGGTGATCCTGTGGCTTCAGTTAAGCTGGGTTTGGAGCCAACGGAAGGAGGTGGAGCAGGATCCTGGACCCTTCAATGTTCCAGAGGGAGCCACTGTCGCTTTCAACTGTACTTACAGCAACAGTGCTTCTCAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTGCTGATGTCCGTATACTCCCGTGGTAATGAAAATGGAAGGTTTACA
++
+GEGFGGGGGGGGFGGGGGGGGGGGDGGGGGGGFGGGGGGCGEFFCFDGGGGGGGGGGGGFGF8BFGGGGGFFDFCFGGGGEGGGGGGD=FFGGGGDDGCGGCFFGGCFGGG8FGGCGFGGGGGGCCF;FFGGFGGGGEE7FFFFGGGG6CFDFFG8==EA,,;CFGGGGGGC6CFF7;DCGGGFCG9B,;CCF6DFCGGGGGFFF4FFCFFFGE,AF6EFGGGFGFGFFF,:9BFCFF:.2AB+>)*:/989?C9@FF,29>+;98*??>C@7
+@M01873:M01873:000000000-B9G3J:1:2110:13535:17883 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TTTCTTTAGTGAAATGC
+AGGAACTGTTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCACAGATATCAACGGAGCAATTGTGTTGACACAGTTTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGGGCCACCCTCTCCTGCAGGGCCAGCCAGGCTGTTGGTACCTACTTAGCCTGTTACCAACAGAAACCTGGCCCGGCTCCCAGCCCCCTCCTCTATTATGCTTCCAACAGGGCCCCTGGCGTCCCCGCCCGG
++
+GGGDEFGGGGGDGGFGGFGFGEGGGGGGECDFGGGFC9FFGCFCEGCG<FDFFGGFGGAEECGGGCF,CFGGGFFFG,EFEDF?FG,?=C>FG+B,CFFEEFG=,CE,,EEFFGFFFFFCGGGGGEGAFFFFDEGGAFGEEG7,A?6+++3>@BF?EGGDFGGF6CGGG88,D8FFG?>,8C@;,,5DFC33E?>D,5?BFF?*4D6,;=C################################################################
+@M01873:M01873:000000000-B9G3J:1:1119:21261:11479 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=CTTGATAGGAATGAATA
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCCCCGGCCCCCTGGGTTCCCTTA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77FEEGEGGDGGGGGGGF:@CGGFFGGFECF5E7F7C:?CD7:494CF;C6FF3C3>FGGGFDGDF4CF*+9*2<7:4<7>F6)2(;F?):CG*?C###############
+@M01873:M01873:000000000-B9G3J:1:1101:10006:14034 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=ATTTCTATGGCTTTGTT
+GACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAGAGAAATACATGAGACTCTCATATACCTGCAAAAGTGAGCTATATCTCGATCACGTATTACAAGTCAGTACAGCCAGAAAAGAGGAATGTCGAAGATACTCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGFFFGGGGGGGGGGGGGGFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGDCGGGGGFFGGGFGGGGGGGEGGGGGF:AFE=FFEGGGGG=BFCC3DFEG@EFGFG@FEFF9CDFCFGGGC8DEGEE>7CFGCECFFFD:CE5E#######################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1117:17250:9432 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=CTTGCTTATGATTCCAG
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGATCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGAAGGGCCCTCGGTCTCTGGTTAAGGTTAACAGTGATGGCAGACGAAGCAAGGGGGAAGGGGTCCCGGATC
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9,2,,7,;,;6CF>>,8:8;<DE7**4*:7?DC5,,486DD:FC#############################################################################
+@M01873:M01873:000000000-B9G3J:1:2108:14465:19705 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=ACTTAACGGCCAATTAA
+GAGTCTGCCCACAGCAGGGCTGGGAGACACAAGATCCTGCCCTGGAGCTGAAATGGGCACGAGGCTCTTCTTCTATGTGGCCCTTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGAAATCACCCAGAGCCCAAGACACAAGATCACAGAGACAGGAAGGCAGGTGACCTTGGCGTGTCACCCGACTTGGAACCACAACAATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCCATTACTCATATGGTGTTCAAGACACT
++
+FGGGGGGGFGGGGGGG@FDEEEGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGCGGGFGECFGGGGGFGGGEE7+EFFGFGFCCEGFGFGAAFGGG7FFAFFGGGF88DEG+>AD,;DGE?FFGGGF,DBEC>EG,4DCGG9786CCCGFDDC,=:CEC,<,=?FGGGCEFGC71+>>@FCC79EGDGDDC8**AC=F::8@CGD8FF=;73=>F5C:>7<+A?F7+0<++CGCC?#########
+@M01873:M01873:000000000-B9G3J:1:2111:3554:13238 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TTAGCTACATGTAATTG
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCATCATATACAGTGATGGAACCAACTACTTGCGCTGGTTTCAGCAGCGGCCCGGCCAATATCACAGGCGGCTAATTGATAAGGAGTTTAACAGGGGCT
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDEF9=FFGGFGF6D@9ECGG7,@DF,@7,,@,,7:;C,53@,,3*@AFE695=9@,9@CGGF8F##########################################################
+@M01873:M01873:000000000-B9G3J:1:1109:19388:16328 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=GGGACTCCAAAATTAAT
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAACCTCCTCATCCATCGCAATACCCAGCGGCCC
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>48=CDGEG,BEC++,4=C+18>?:CCGGFFFFG6F8C55*1C5>73)1)<*:1:7?C##########################
+@M01873:M01873:000000000-B9G3J:1:1111:16537:24486 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CCTTGTCCGAGATGTCT
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTAGCAGCTCTGTAAATGGGTATCAGCTGAAGCCAGGGAAATCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGGCTTTCCGTCAAGGGTT
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGG93@8BGFC>9E,>9D8@ADF8CGECE>*;EFGGD7<8;CE=3=CC9F?FDFE@C@,<C#################################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10019:8146 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift0|BARCODE=CGCATATATCTGCAAAA
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGGCTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTATCGCAGGACCTGGGTCCGCCAGGCTCCGGGGAAGGGGCTGGAGTGGGTTGT
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C*2577:*2*7271*2?CC>/;ECEEEE*;:@######
+@M01873:M01873:000000000-B9G3J:1:2101:11039:4739 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=ATTAGTTCATAAATTCC
+AGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTTCCAACAGAAACCTGGCCAGGCTCCCCGGCTCCTCATCTATGATGCATCCAAAAGGGCCACGGGCATCCCCGCCAGG
++
+GGGGGGFGGGFGGGGGGGGGFGGDGGGGDGGGFGFGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDFGGGGGGGGGCGGEGCGGGGFFEFEDEGFGGGGGGGGGGGGGFEGFGGGGGGGGFCFCEFGCEEFFGGGGGGG??DFFGGGGGFFCEGC:DFFGF9<D:C:9ECFFFCFE,>EEE6FG*4,,1>7?8,1C7=E8DGGG,:?=2BED###################################################
+@M01873:M01873:000000000-B9G3J:1:2104:24954:20771 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CGATGTAATCTTAGCTG
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCTGCAGCAGCCAGACAAGGGCCCTCGCTACTTGATGACGGTTAAGCGTGATGGCAGCCCCATCAAGGGGGACGGGG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF78D6DDC:8,:D8D>7@CEE>EG755**C6,6*0,,4<1B686CG5=*7C***=***;:8**3;@C799CCCC9:D4C3*/*/:CD8*:*;***2*0<<??*??#####
+@M01873:M01873:000000000-B9G3J:1:1111:12286:7157 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TCCAGATTCGGATTACA
+AGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTTATATTCCTGTGGCTGCAGCTGGACTTGGTGAATGGAGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCAAACTACTTCCCTTGGTATAAGCAAGAACTTGGAAAAAGACCTCAGCTTATTATAGACATTCGTT
++
+GGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG88FFGGGGGGGGGGGGGFGFFGGGG?E8CGGFGGGGGGGGGGDFGGGGGG9D>EGFCCFGGGGFGGCGEGGGGGGGGGGGGGGGGGCG6CFFFFGGGGGGGCCCFDFGG+:CD7CGGGGGGGGGGG44C@9CCC7CF4?FFFGFEGFG6A*8D<7*<6:FG;EC+7<CF91;CFDFF
+@M01873:M01873:000000000-B9G3J:1:2103:2227:11139 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=TAGTCAGAAGATTATCT
+TCTCAGAGAGGTGCCTTAGCCCTGGATTCCAAGGCATCTCCACTTGGTGATCAGCACTGCACACAGAGGACTCACCATGGAGTTGGGGCTGTGTTGGGTTTTCCTTGTTGCTATGTTAGAAGGTGTCCAGTGTGAGGTTCAGTTGGTGGCGTCTGGGGTAGGCTTGGTACAGCATGGAGGGTCCCTGCGACTCTCCTGTGTAAGCTCAGGATTCGCCTCAAGTCGTCATGAAATGAATGGGGGCCGCCAGCCCCCCGGGACGGGGTCGGGTGG
++
+CFEGCDAFGGDAF8E9<CGGFG?88<C<FAFECF@,C@FFFDG9<<EE7F,,9C@,BFE,:BC<7@FGF8B8F<BA9EF8,AB?,98:F7C,B,BF8FG+CDADE<<5CFE,,9?9@,@FGG?E@FC?C8=E,9;F,E,,,C=;EC@+@,+6@+3>,@+63+98F8+3E;C9,,,3,,6++58::C:,*@CEEFAFGF###########################################################################
+@M01873:M01873:000000000-B9G3J:1:2116:17140:9378 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CGGAATACTCACAAATT
+GTCTGGGAGAGGAGCCCAGCACTAGAAGTCGGCGGTGTTTCCATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGTCCAGTGTCAGGTGGAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCAGCGTCAGTGCCTATGGCATGCACTGGGTCCGCCCGGCTCCAGGCAAGGGGCGGGCCGGGG
++
+CFGGGGGGGGGGGGGGGGGGGGGGGGGFFGFGGGGEGGGGGGGGGGGGBFGGGGGGGGGGGGGGGGGDFFGGGGGGGGFGGFGGGCFGGFGEFGGGGGGGGGGGGGGGGGGDDFGGGGGGGGGGDFGGGGGDFFFGGGGGGFGGGGFGGGFDGGFGGGGGCCEGEGGGFG?CFGGB=EF:AGE7AECFC8+?9?FGGC7+;9+568=8C8<9+<;1++)3***207C3*+::*2>FGGFGFF>20ADDD)9E88EE@CFC################
+@M01873:M01873:000000000-B9G3J:1:2106:21507:14943 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TCGGGTCGCCTTCTTTT
+GCTGGGGTCTCAGGAGGCAGCACTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTCCTCCTCAGCCTCCTCACTCAGGGCACAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCGCTCAGTGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAGCCAGCAGTGATGTTGGTAATTATAACTATGTCTCCTGGTACCAACAACACCCAGGCAAAGTCCCCACACTCATTATTTATGATGTCAGTAAACGGCCCTCAGGG
++
+:CFGDGGGEGGGD8FEGGGGGGGGGFGED77FEGGGGGGGGGGGGGGGD@CG8FFFFCFGGGGGGGCGGFCGGG9FEFGCFFGGG8EFFGGGGCGGGGGGGFDGFFGFGFGGGGGGGGGG@E7FGFGGGGGG@CEEAFFFGF7E@F>FFCFCCB9FAFCGGFGFGGGG>GEC88DFG6DGCCGGGGGGF9CF9EFGGGGC?CGCGGF,0;CFG?67*;B**=575*AF=69CFC853::D***0++3<CFGF?EGG7F+C<C?7*1:5:8@####
+@M01873:M01873:000000000-B9G3J:1:2101:22394:13872 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=ACTCGTGCTAATCCTTC
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGGGGTACCAGCAGCCCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCCCTGGGGTCCCTGC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG>FGGGGD5@ECGCGG84A,<:,BFGFGE+**/AEGGF+:C*=*=CEG5*::*2<CFGGC5E#############################################
+@M01873:M01873:000000000-B9G3J:1:1110:19157:20344 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GAAGAATTGTAACAATC
+GGCTGGGGTCTCAGGAGGCAGCACTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTCCTCCTCAGCCTCCTCACTCAGGGCACAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCGCTCAGTGTCCGGGTCTCCTGGCCAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGTACCCAGGCAAAGCCCCCAAATTCATGATTTATGATGTCAGTCACCGGCCCTCCGG
++
+GGGFGGGGGGGGGGFGGGGGGGGGGFFGGGGGGGCFCEFGGGGGGGGGGGGGGFGEFGGGFFGGFGGGFGGGGGGGGFGGG,=?FCFF<EFGGGGCDGGGGC<EFGGGGG,AD9FGGGG:FEE6@FD;FFGFFGGGEGGGFGC,@8DFG,;,5EEFCCFFFGGGGFGGG78:FGGGF?C?CFGG9CCFCG58AEF7@FG>:1=FC@CC7FC>F?GCEGCC++<=C57C/;76CGFGGCD4**<+<E77DF7+++<@E##################
+@M01873:M01873:000000000-B9G3J:1:2103:19958:12449 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=TAGCCTTCACTTTAGTT
+GGATCAGGACTTCTCAGTTCATCTTCTCACCATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATCCCTGGATCCAATGCGGATATTGTGATGACCCAAACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGCCAGAGCCTCCTACATAGTGATGGAAAGACCTACATATTTTGGTTCCTGCAGAAGCCAGGCCAGTCTCCAGAACACCTAATTTATGACGTTTCCCGCCGAGTCTCCGG
++
+GGGGGGGCGGGGGGGGGGGGFGGGGAEGGGFGFGGGGGGGGGFGFGGFGGGFGGFFGDGGFGGGGGGGFGGGGGGGGGGGGCFFGFFCFFGG+F:DGGGFGGGFGGGG7FFGCGGGGGGGFGGGGCFGFGGGFGGGGG8BEFCFGGGGGFFGGGFGGGGG?3BFGGCFFGGF:FGGFGFGGG8DDCFF@DFG6DC5?EEC,51=CF@FGGEFCGF+,55++?BF=9*/:8CC5++4+?3;5C*;EFE6@9C*02A7CE5FG<+58/>**;@FGGG5
+@M01873:M01873:000000000-B9G3J:1:2104:19897:23367 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=AATTAATGGTGTTGAGA
+AGGCTCTGCTTCAGCTGTGGGCACAAGAGGCAGCACTCAGGACAATCTCCAGCATGGCCTGCTCTCCTCTCCTCCTCACTCTCCTCGCTCACTGCACAGGGTCCTGGGCCCAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCCCTGGGAACAGCTCCAACATGGGGGCAGGTCATATTGTTCACTGGTACCAGCAGCCTCCACCTACAGCCCCCAACCTCCTCTTCTTTTTTAACCCCACTC
++
+@CEGGGGGGGGGGGGGGGFGGE8@FAEFCFGFE,EF@F,EFFGFGFGG9FF?FCFE<FGGF,EFA@FGGGGGFFGGGAFEAEC8FF,=FFGGGFFCA<BFGDEEFA=B<?FFGF@EFF?,E,9A+?BFCG+F:F@@FFEGF=FD8FC+3+8BE78@8@D8:C:@FCCF7D;FF9,8@2?EF8,,*DFFDFG#####################################################################################
+@M01873:M01873:000000000-B9G3J:1:2118:6488:16393 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=GAAAGACTTACATTTTT
+GCTTTCTGAGAGTCATGGATCTCATGTGCAAGAAAATGAAGCACCTGTGGTTCTTCCTCCTGCTGGTGGCGGCTCCCAGATGGGTCCTGTCCCTGCCGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGCAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGATGGCATCATCAGCACTAGTGGTTACTACTGGGGCTGGATCCGCCGGCCCCCAGGGAAGGACCTGGAGTGGATTGGGAGTTGTTTTTCCAATGGAAAAACCCACTACA
++
+GGEFGGGGGGGGGGGGGGGFGGGGGGGGGFCF8FGGGGGGGGGGGGGGGGEGGGGGGGGGGEGGFGGGGGGGGGGGGC8BFEFGGGFGGGGGGG?F8FGC@EFFFGGGGGGGGGGGGGGEGGGFFGG8EGGGGGGGGGCE@D+FC<FF?GGGBCF@EG6FGFGGCFEA9DFFCC@FFFGGFFFFG69;9DEF9?9CFF?:<5CEGG5C+2ACGGE8>CGC=CFE5CED*ACC*C482;*09+9*C*7/*+/*2;E+<<?9>D:C<*:EEG######
+@M01873:M01873:000000000-B9G3J:1:1117:6029:5428 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GAGACTTTGCTTGTACA
+GATTCCAGCCTCTGACAAACTCTGCACATTAGGCCAGGAGAAGCCCCCGAGCCAAGTCTCTTTTCTCATTCTCTTCCAACAAGTGCTTGGAGCTCCAAGAAGGCCCCCTTTGCACTATGAGCAACCAGGTGCTCTGCTGTGTGGTCCTTTGTCTCCTGGGAGCAAACACCGTGGATGGTGGAATCACTCAGTCCCCTAAGTACCTTTTCAGAACGACAGGACAGAATGTGACCCTGATGTGTGACCAGAATTTGAAACCCGAGGCCATGTACTGG
++
+GGGGCFGAFFCEGGGGGGGGFFGGGGGAEGF<<EFFGGGGGC<FFGGGE::C@FGGFFFFDFGGGGFFGF9FFGGCFFFGGGFGGGGC,:=FCEFEGFCFGGFGGDG7FFEFGFGDFFCEFCGGGGCECGF,4EEDFGG;=FFEGGGGGGGGGGD=EF,=DC>FFGGGFGGGFDD6D7EC>C::9CFGF7,@:??E*/97D:C7C######################################################################
+@M01873:M01873:000000000-B9G3J:1:2106:6159:11549 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GTTCGTACTCTAATAGA
+AGTTGGTAGATGCCCCTCTGGGAGAGATCCCCAGGGGTGACAGCCATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGTCCCAGGCAGCGCTGGCCCCTGCTGCTGCTGGGTCTGGCCATGGTCGCCCATGGCCTGCTGCGCCCAATGGTTGCACCCCAAAGCGGGGACCCCGACCCCGGGGCCCCCGGTGGAAGCAGCCGACCCCGCC
++
+GGGGGGGGGGGGGGGGGGGGGDFGDGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGCG8@FFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGDGGGGGGGGGFGGGFCFGGGGGGGGGFFGCFCDDFGGFD@GCGGGGGFGGEGCECFG++:CEEDGEFGFBFGCFCGGGGC:><8:FFFFGDGGGG=:E8=9CFGEGFC+9*2AC:5*<FCFGG6<8*1/*;9@5:C=*:ECE5<EEG################################
+@M01873:M01873:000000000-B9G3J:1:2103:16719:17340 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=ATGCATATGAGTGTGGC
+ACAAGATCCTGCCCTGGAGCTGAAATGGGCACCAGGCTCTTCTTCTATGTGGCCCTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGGAATCACCCAGAGCCCAAGATACAAGATCACAGAGACAGGAAGGCAGGTGACCTTGATGTGTCACCAGACTTGGAGCCACAGCTATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAGGCTGATCTATTCCTCATCAGCGTCTGATATTACAGATAAAGGAGAAGTCCCCGATGGCTATTT
++
+DGCEFGFFGGFGCFGGFGGGGGGGGGGGGCGGGFFDFFGGGGGGGGGGGDFGGFGGGGGGGGGGGGFFFEFFGGDGGGGG?F7FFDFGGGFGGGGGGGGFGGFGGFCEFFCFFGFFCF8?EFFCG8FGGGG>D@@CC,,:F;FC=DFF;FGGFGGCGGGFG8@==EF8,3=F=>@CFGGGCC7ECD;C@*AE68:,8,9D1:C*,6:;D5*1:**:,,,5,?,5,>,,,4=<C**3**1++1:++++1A9@CB+:8<EGGFGFC8?*/:CC####
+@M01873:M01873:000000000-B9G3J:1:2114:13033:12027 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TTAAGATACTAACAGGT
+TGGAGGAACTGCTCAGTTAGGACCCAGACGGGACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCTGCCACCCTGTCTCTGTCTCCAGGGGACAGAGCCACCCTCTCCTGCAGGGCCAGTGAGACTGTTAGAACCAAGGTAGTCTGGTACCAGCAGAAACCTGGCCAGCCTCCCAGGCTCCTCCTCTATGATGCATCCACCAGGCCCACTGGTATCCCGGC
++
+CGGDFEGFFFFGEEEFGGGGGGGGGGGGGG>EFBFGDFGGGG?EFEGGGGG@FFFGAEFFGGGGGGGFGGCGFGGGGGFGCF,AEECEF<EFE@EGFFEFGGGFFGGGGGGCGEGFE9:8@FGGDFDFGGAE;7EF9,FFGGCGGGGGF86FGDGGGGGGCC8C,@6EGGGG@D??,>;8CEGFGCFFCF7>*CFC=>CBF?FFGCC8?FF@C=ACFFGE=*2=AFDF)3*+*3<+)=;CGG979EGC=C?#######################
+@M01873:M01873:000000000-B9G3J:1:2107:25942:4834 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=GGGCCTCTTTATTTGTC
+GGGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCCCTGGAACCAGCCGTTACGTTGGTGGTTATAACTCTGTCTCCTGGTCACAAACGCACCCAGGCAAAGCCCCCAAACTAATGATTTATGATGTCCGTTAGAGGCCCTACGGG
++
+GGGGGGG8:CFG8CC<F8EEEGG8C+85*?CE?FF?EGGGGFG58CC58:8EGCFFCCFGGGGGGGF5;CFD71<F?F6/;8AF>>D8@FF76@CGGECCFG7:+AC>FGGEF+<8AFFE:@8C8EGC@C*:*;87@+:?>6C*3<88CF58?@:CFGF96@88FFFDFEC;855*A**/;*;F8=FG>C7A9CFGF99CFGF9CC+0++3++**1**18CCCFG*C6CF###########################################
+@M01873:M01873:000000000-B9G3J:1:1101:10044:7123 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GTACTATGAACACAACT
+GGGGGTCTCAGGAGGCAGCGCTCTCAGGACGTCACCACCATGGCCTGGGCTCTGCTCCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGTCTCCCTCCGCGTCCGGGTCTCCTGGACAGTCAGTCCCCATCTCCTGCACTGGCACCAGCACTGACATTGGATGTTCTCACTCTGTCTCTTGGCTTCAACAACACCACGGCCAAGCCCCACAACCCCTCATTTATCCCTGCATTGCTCGGCCCTCCGGGGC
++
+7:FGGGGGGGGGGGGGGGGGGGECGGGG,8:ECEE@FGGGGGGDCFFCCFGGGGFFCFC8A,;EGGGCEGGGDFGFCFC>CC8;;CGEFF?CFCGGD88CFEFFFFFGCCFG?C+32<FF8CE**1*/?:CEGECCFF6C688E:E7FCE+8EGGG79<+<E6<9C*78<C**2*206+C+9?<+++332+2*2:7CFCEC??########################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10044:7141 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GTACTATGAACACAACT
+GGGGGTCTCAGGAGGCAGCGCTCTCAGGACGTCACCACCATGGCCTGGGCTCTGCTCCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTCCCTCCGCGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGCACCAGCACTGACATTGGTGGTTATAACTCTGTCTCTTGGTATCAACAACACCCAGGCAAAGCCCCCAAACTCATCTTTTATAACGTCACTGACCGCCCCTCCGGGTC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGDGDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFFGGFGGGFGFGGG?AGGGEGCEFGGGGGFGGGGFCGGGGGGGGFGGGGFGGFGGGGGGGGGE5CEGG5C6@FGGFCEEFCFG7CFCFGGGFDFF?8?0<CF6CCF=*:C6:60+<+<?:?<AECFCFGGC>*:*2+0++:ECD70:FGGF*75EG5=F*1*19*96:E5DG#######################################
+@M01873:M01873:000000000-B9G3J:1:2116:7821:15323 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=CTATTTACCAGAATTAC
+GGGGTCTCAGGAGGCAGCGCTCTCAGGACGTCACCACCATGGCCTGGGCTCTGCTCCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTCCCTCCGCGTCCGGCTCTCCTGGACAGTCAGTCACCATTTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAATTATGTCTCCTGGTATCAACACCACCCAGGCGAAGCCCCCAAACTCATAATGTTTCAGGTCAGTAAGCGGCCCTCCGGGG
++
+GGGGGGGGGGGGGGDGGGGGGGGGGFFGGGGGGGGGGGFGECFFFGFGFGFGGGGCFGGGGGFGGGGGGGGGGGGGFGFGFGGGFGGGFGGGGGGGGC@CFGGCGGGGGGGG?<FGGGGFGGGGD>EGEEGGGEGGGGFCFGGGGFGCGGGGCFFGGGG?FDGG6CGFGG@=F6;FFCGGGDF*1:CEFCGFFDFD@7CCCF++<6DCCFGFGGGD**;1/*1753*)*<C<E*5CCCF?9@@DCDFF72<E<++*0<CFEE*:C*/78<CGG
+@M01873:M01873:000000000-B9G3J:1:1101:10051:12996 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TATTCAGTATAACATTA
+GTCTCAGAGAGGAGCCTTAGCCCTGGACTCCAAGGCCTTTCCACTTGGTGATCAGCACTGAGCACAGAGGACTCACCATGGAATTGGGGCTGAGCTGGGTTTTCATTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGTGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGGTCACTATTGGATGCGCTGGGTCCGCCGGGCCGCCGGGGAGGGGCGGGGGGG
++
+GGGGGGGGGGGGC@FGGGGGGGGGFGGGGGGGGFGGGFGGGGGAFFGGFGAFGGGGGGGGGGGGGGG8@DFGGGGGGGGGGGGGCGGGFGGGGGF9EFCEE>EF,A<FFFGGGCFGGGGGGGGGCCBF;F?@EEAEFGGFGFGFGGGFFGCFFFFFD8E>@CE+@,@CFC,2DF77C5*@E=CCFECG+<?**2:><7C90<07+77<*9>*CCFD7:?6AC+9D*6>*:CF##########################################
+@M01873:M01873:000000000-B9G3J:1:1107:13066:21126 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=GCTGCAGTAGAAGATAT
+GCTCATGTTCACAGAGGGCCTGGTCTGGAATATTCCACATCTGCTCTCACTCTGCCATGGGCTCCTGGACCCTCTGCTGTGTGTCCCTTTGCATCCTGGTAGCAAAGCACACAGATGCTGGAGTTATCCAGTCACCCCGGCACGAGGTGACAGAGATGGGACAAGAAGTGACTCTGAGATGTAAACCAATTTCAGGACATGACTACCTTTTCTGGTACAGACAGACCATGATGCGGGGACTGGAGTTGCTCATTTACTTTAACAACAACGTTCCGA
++
+CGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGFFFGGGGGGGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFFFGGGF8FGFGFGGGGGGFGGGFGEFGGGGGF9EEEGGGGGGGGGGGGEGGGGGGGGFGFFD?DEFGGGFFDEDCGECFG,,@EGFCFGGFC:AEFCC7F8CFGDDF*7CFC+=:7,9+2,+1;AFG*?*BCC<=?DDGGD*;CFFC5CCG7:7:0<C7F?EFGG7*78CE=CDC##
+@M01873:M01873:000000000-B9G3J:1:1117:12403:4599 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=ACGACAAATGTTCTTTC
+GAGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCTGCTTCTGGGGCCAGGCTCCGGGCTTGGTGCTGTCGTCTCTCAACATCCGAGCTGGGTTATCTGTAAGAGTGGAACCTCTGTGAAGATCGAGTGCCGTTCCCTGGACTTTCAGGCCACAACTATGTTTTGGTATCGTCAGTTCCCGAACCAGAGTCTCATCCTGCTGGCAACTTCCAATGAGGGCTCCAAGCCCACATACGAG
++
+GGGGGGGGGGGGGGGCGGGGGGGFGGGGGGGGFCFGGGGGGGGGGGGGGCFFGGGGG?FGGGGGGGGGGGGGGGGGGGGGGGGGGG>FFF8EFGGGGGGGGGGGGGFF?FGGGEF?AD@GGFE>EGGGGC8C79EGGGEC9DFGAF=E>FGD?CDFC7CFGGFEFGGGGCCGCCFG>CCFGECCFFGFG5:,:DG*=D8FFFFCG7CGBGG5>11::DGG)))*/*;:;AF7>+;CG#######################################
+@M01873:M01873:000000000-B9G3J:1:1117:22437:4121 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CAGACTGATTGACAAGA
+TGACTCTGAGAGGGGCTGTGCTGAGAGGCGCTGCTGGGCGTCTGGGCGGAGGACTCCTGGGTCTGGGTGCTGGGAGAGCGATGGGGCTCTCAGCGGTGGGAAGGACCCGAGCTGAGGCTGGGACAGCAGAGCGGGCAGCACCGGTGTTTGTCCTGGGCCTCCAGGCTGTGAGCACAGATACGCAGTGTATTTGCACAGGGACCCGGCGTCCAGTGCTCGATGACCTGAAAAACGTGTTTCCAACCGGGGTCGGTGTCGGGAGCGGGTGTGGGTGGG
++
+GGGCFGFE@,CCEE7F:EFGG9FFE<E@FGGCC+CEGDDGFEECFF<7C>C@E,EFF9F,+4?EFGGFD@BE<:=++=FECFF@AFC++AEEBEC:>+8CFCE+@FGCF@:CCF9D++8:EF,<D7,@83*2BE8CCC7C@BE7:1*3<*3?;E7<EC5*::*+7=6*=<2A?FC6>@CFFC##############################################################################################
+@M01873:M01873:000000000-B9G3J:1:1114:14006:15367 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=CTATTAACTGCAGAAAT
+GCAGTTTCTGTGCCGCGTCTCGGGGCTGTGAGCCAAAAACATTCAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGCTGGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAAAAGAAGAAACTGCGAGCTCACGACCCGTACTCTAGAAAATAGTGACATGAGATAGCAGACCACAAGCAGTATAAGAGGCTCAAGTAGAGA
++
+GGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG7FGFC;CGDGGEGGGGC0>EEGEDFECFGFGGGGGGGDG############################################################################################
+@M01873:M01873:000000000-B9G3J:1:1114:10168:21472 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=CCATGTCTTATTTTATA
+GCCCCAGCCCTGGGATTCCCAGGTGTTTCTGCTGGCTGATCAGGACTGCACACAGAGAACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGTCCAGTGTGACGTGCAACTGGTGGAGTCCGGGGGAGGCTTAGTTCAGCCTGGGGGGTCCCTGAGACTCTCTTGTGTAGGCTCTGGACTCGCCTTCAGCAGAGACTGGATGCACTGGGTCCGCCAAGCTCCCGGGAATCAGATGGTGTGGCTACGCCGTCT
++
+GGGGGEGDFGGFGGGG8EFGGCCFGGGGCG9DECCEGGGGGFGGDFEDGGGGGGGGGDFGGGGGEGGGGGGGGGG7:FGGGGGFFGGCCEFGGG,FFF8EF9FGFEDFFGCEFGGGFGC;>,>EFEGG@CCFFGGGFED,6DCCEEC:BEGE5D7@C:F@E<;,@EF8CGE555FG48>FCC9877>07C*A7668@F4+<+.879>=F47<*0);<C*85*/07;BF?5C?@7>EDG####################################
+@M01873:M01873:000000000-B9G3J:1:1114:16929:21025 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=CGATAAGCGTATTTAGT
+GAACCACATCTGTCCTCTAGAGAAAACCCTGTGAGCACAGCTCCTCACCATGGACGGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCTACAAGTGCCCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCAGCTATGATATCAACTGGGGTCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGAGGGACCCTAACAGTGGC
++
+GGGGGGCFGG,CCEFGGFEEGGGGGGFGGGFGGGGGFGGGGGD<CFGGGGGFEEGGGGGEF8FGGGDDGFEGGCFGDFFCFFEGC7BEGGGGGG9AFGGGGFGF8AFDGGGF@FFGFAE@8=8=E,@9,8>C8CEBD@DD,=BFGGE8FE6CEED8?FAFFGFCFCG74EG6CCDCFFDFGFFD7<C;>79,;C4,;9C<87?,+4BCC86<*<)*)2):1=A;<7F84;<*)*;*=DFC)7:6*:12.05*7?E*0***09<A*;;C?CCF##
+@M01873:M01873:000000000-B9G3J:1:1101:10064:16602 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TCTGGTCGTGCAAGTGA
+GAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAAGATAAATCCTGTGAGTCGTCCAAGTAGACAACAAAATCAGCGTCGGGAAATGGCATGGATAAAGACATTTATCGTGTAATGTACCGACCAGAACAGACATCACTGTCAGTCTGCGCTATATAAACGGAACAACTCGTACAGCT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGFFGGGGGGGEGGGFGDFGGGDGGGGGFGGGGGGGEGGGGGGGCCGGGFGGGFGCFEBE@E#################################################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10065:3493 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TAGCTACGCAGTTATTG
+ACAGTGATCCTGATCTGGTAAAGCTCCCATCCTGCCCTGACCCTGCCATGGGCACCAGGCTCCTCTTCTGGGTGGCCTTCTGTCTCCTGGGGGCAGATCACACAGGAGCTGGAGTCTCCCAGTCCCCCAGTAACAAGGTCACAGAGAAGGGAAAGGATGTAGAGCTCAGGTGTGATCCAATTTCAGGTCATACTGCCCTTTACTGGTACCGACAGAGCCTGGGGCAGGGCCTGGAGTTTTTAATTTTCTGCCAAGGAAAAGGGGGACCAGCAAAA
++
+GGGGGGGGGGGFGGGGGGGGGGGGGDGFGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGGGGGGGGDFFGGGGDFGCGGGGFFGFFGG@DGGCEE>EGGCCFFGFG9EGFEDCEAFGFGGGEFGGGCEG?BFGGF==>DGCGGG:@CFGGCFGCFGE7E:B?DCA:@F:,7@EFEFCFFFGGGG9:,+4=F9+C*9CDG4C6,4AFEDCDGD*5=FG*;+0;C7*2<CE#############################
+@M01873:M01873:000000000-B9G3J:1:1106:24704:16447 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=TGTAGAGACTAACATCA
+AGACACAGTGCTGCCTGCCCCTTTGTGCCATGGGCTCCAGGCTGCTCTGTTGGGTGCTGCTTTGTCTCCTGGGAGCAGGCCCAGTAAAGGCTGGAGTCACTCAAACTCCAAGATATCTGATCAAAACGAGAGGACAGCAAGTGACACTGAGCTGCTCCCCTATCTCTGGGCATAGGAGTGTATCCTGGTACCAACAGACCCCAGGACAGGGCATTCAGTTCCTCTTTGAATACTTCAGGTAGACACAGAGTAACAAAGGAAACTTCCCTGGGCGAT
++
+GGGGGGGGGGGGFGGGFGGGGDFGGGFGGGGFCF@FDFGCFGGFCEFGAFGG8FG7@FDGFGGGGGEFGGCEG8FGGG7FE:FF@FCEEGFFGGGGGGGFEFGFFFFFGGGG8FGGE;FF=FFGFGGC7EDEGGGGFFEFFGDGGGGFCGFFGGGGCGDCGG?FGGDGGGGGG,,2<CDFGG:=C,@7@C79:,@CECGF>EEC57*97>*441214=<CCF;CFGF=7::C<BC7+,*++0>+1=F5D<+<+9+@***=*0C9ECF?98C57=*?
+@M01873:M01873:000000000-B9G3J:1:2111:9741:23838 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TCTCTTCAATCTATTCG
+GCCCTCCTTTCCTCCACAGGACCAGATGCCTGAGCTAGGAAAGGCCTCATTCCTGCTGTGATCCTGCCATGGATACCTGGCTCCTATGCTGGGCAATTTTTATTCTCTTGAAAGCAGGACTCTCAGAACCTGAAGTCACCCAGACTCCCCTCCATCAGGTCACACAGATGGGACAGGAAGTGATCTTGCGCTGTGTCCCCATCTCTAATCACTTATACTTCTATTGTTCCAGACAAATCTTGGGGCAGCAAGACGAGTTTCTGGGTTCCTTTTTT
++
+GDECF,FFGGGGGGGFFF<,FDFF88CCFEGGGFFFE9EFG@,9CFFFCGEGA9,CFBC,<EFGG,AE,9,4,,,BEFG8,FE,AFFFFF<=?,,,,:AFF,,99E9D9FE=FC?F,A7:E@,9AEF,E@=E,,FFCF=F8=,@7DGG8+,6@>;EFD833,8=DCDDFF88?DDF6E7DF:,,7;EC9+@C5D6;,;3*3CCFGBD7;@#################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10067:5517 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GCAACAAAAGTTCGATA
+GGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGCCCCAGGATCCAGTGGGGATATTGTGATGACTCAGTCTCCACTCTCCCTGTCCGTCACACTTGGACAGCCGGCCTCCATCCCCTGCAGGTCTAGTCAAACCGTCGAAGACGGTGATGGAGACACCTACTTGATTTGGTTTCACCAGAGGCCAGGCCAATCTCCCAGGCGCATCATTTATGAGGTTTCTAGTCGGGACTCTG
++
+CGC@<<E,@CAAFEFGGGGFGDAAFFGGGGGGGGGF8@C,69FFC<DFEFCCCFEF7+=FCGGG9?FGFGGDFF,9>>CFF+B=A=?,EEBE++:@FGGG9BGFGGG8F;,C@AF?CFF,A@FF888>@E88,88,E=8,,@>==CEEE,D3<A,3::>>,@>:?9BEGGF,599*44;*4**=CCE5CFGG48097*C6EFGFF731;:F837@CC##########################################################
+@M01873:M01873:000000000-B9G3J:1:1114:20934:3692 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TGATAAATCCGACATGA
+GCTCAGTTAGGACCCAGAGGGAACCATGGAAACCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGAAATTGTGTTGACGCAGTCTCCAGGCACCCTGTCTTTGTCTCCAGGGGACAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTCAGCAGTACCTCCTTAGTCTGGTTTCAGCAGAAACCTGGCCAGCCTCCCAGGCTCCTCATCTATGGTGCATCCCATAGGGCCGCTGGCATCCCCGACAGGTTCA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEEGGGGGGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGC<FGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGFGGGGGGGCEFGGGGGGCGGGFGGGGGG8DCB?,<8EGGGGGGFGGG@FGGGGCGFGGGGGF7>:<FGGCC8CG4;=FG,?6;6*8A:5D:C*2:9FDG>4:>9>5)<6AF91@########################################
+@M01873:M01873:000000000-B9G3J:1:2107:3490:8582 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=TAATTTAGGTTATTTCC
+AGTCTGGGCCTAAGGAAGCAGCACTGGTGGTGCCTCAGCCATGGCCTGGACCGTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGTCTATGTGACCTCCTATGTATTGACTCAGCCACCCTCAGTGTCAGTGGCCCCAGGAACGACGGCCAGGCTTACCTGTGGGGCAGCCGACATTGGGAGCACAAGTGTGCACTGGTACCGCCAGAGGCCAGGCCGGGCCCACAGGCTGGTCATGTTTTATGATCGGGACCGCCCCTCCTGGACCCCTTA
++
+EGGFGFCEFGGGG8FD?FFGGGGGGF8F8CCFGGFGGFFGGGGFCFGGFDGGGGGGFGGGGG@EF@FGGGFGFFG<FEF<EGEGFGGF?FC<FFGGFAFG<=F9CF<C,;F;EFGFFFEFFCFCCE,4=;9,,8FGFE+388=A+8CE++@E66DFGGGGCA>,<EE>CEEEGGGG*5?F,@:EGF>C8=FC,>,<EG<+A>?5C####################################################################
+@M01873:M01873:000000000-B9G3J:1:2115:10908:20804 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=GATCATTTTGTTGATGT
+AGTCAGACCCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCCGAGTGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTGAGAGTATTGGTTACTTATTGGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCAGTAAGGCAACTAGTTTAGAAAGTGGGGTCCCATCAAGGT
++
+GGGGGGGGGGGGGGGDGGGGGGGGDAFFGGGGGGCEEGGGGGGGGGGFGFFGGDFFGGGGDFGGGGGGFGGGGGGCFGGFFFGGGGGGGGGGFFFFGCFFEFGGGD<FFGGGFGGGGGGGGGGGFFGGG9FGFGCEGGGGGG8DEFGGFFFGDEFFCECDEEGGD6;@DCF9CFGG7,@E>,,273,>CFFGGGG,2=EDF@EFFGGG<CFGC*ACF,8*:8CE+A7*0>8+:CCCFGFFFF6**++;:FGFF+<FDGCF=EGDF>@<D#####
+@M01873:M01873:000000000-B9G3J:1:2110:7628:11014 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GGATAACGTCAAAGAAT
+GGAAGGCGCTTTGTGAAGTAGGCCTTATTTCTCTTGTCCTTTCGTACAGGGAGGAATTTGAAGTAGATAGAAACCGACCTGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACGAACCTTTAATAGTGGCTGCACCATCTGTCAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGAGGTGGACGTATCATTAAAAACAAAAGAAGAGGAATGTATTGACAGAGAAAGGATGAAAGAGGACGATAG
++
+GGGGDGGGGEGGGGGGGAGGGFDEDGGGGFEGFGGFGGGGGGGGGGGGFACEGG@FCFFGGB9?FFFDFFFGGG8FCFECGG,A,B,9CFEE@F7FFGGGFGGGF8A:@FFF:,=A,;FGFC+AFF<ADAFFFG:C7>=,DFB@FF=,>+,@EF,,<;,,@@DCGF94@@CCECC8CCEE?E486,*5=BC8=<;+=E#############################################################################
+@M01873:M01873:000000000-B9G3J:1:2105:10953:6580 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=AGCTGTGTGACAATGGG
+GATGCTATGTTGTTGGAGCTTATCAAAGAAATTCTCATATCCTTCTTTGAGCATAACGTCAGATTCTGCCACAATTTCTTTAAGTTTAGCTTTTGGTAAAGCTTGCTGAACAAGCAAACCATGTGATTTAGTATACCATTCCATCATATCAGGGTGCAGACAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTGGCAGGATCATTAAAAAAAAAAATAATAAAAAACAGTACAAGTAGAACTATTTACACATAGATAA
++
+GGGFD9<FFEFGGGFEGGFGFFGGGGGGDFFGDFGGGGDGGGGGGGGGGGGFFGGGGFGGFGFGG9@FAFGGGFECGFCEFCEBEFGGGF9D<EFGEE??FGFGGGGGGGGGFECFFFGDFFGGGGGFFFGGGFFA9EFGGG;E,,EEEG9EF8FE+=EED8DGG9EEEE88DEF6@C>CGDFFGEFFEFGCCEGGG7CECFFC9ED***211*462,,65BGD?==DE############################################
+@M01873:M01873:000000000-B9G3J:1:2103:6418:17742 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=ACAACTTGTCTTGGCTC
+TTCAGACGTGTGCTCTTCCGATCTACTTTATGTATTCGATCATACGGGGGCTGAGAGGCGCTGCTGGGCGTCTGGGCGGAGGACTCCTGGTTCTGGGTGCTGGGAGAGCGATGGGGCTCTCAGCGGTGGGAAGGACCCGAGCTGAGTCTGGGACAGCAGAGCGGGCAGCACCGGGTTTTGTCCTGGGCCTCCAGGCTGTGAGCACAGATACGCAGTATTTTGGCCCCGGCACCCGGCTGCCCATGCTCGAGGACCTGAAAAACGTGTTCCCACCCC
++
+GGFFGGFEGGGGGGGGGGGDGGGGFGGGGGGFFFGGGGGGGGGGG8FCGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGDCFGGGGGGGGGGGGGGFGGGFBFGGGGGGGGGGFGGGFGGG>7C*B>FFGGGGGFF7BFGC6*?EGC5EG*0;EEE*:EGGGG?FG7FGGF8EF*CFGD=8C+<0<<8:6::?CE5**3AF?C+?FCC*:C8*>GEG**:C*9*+2;E9<5/:)*;C602<FCC852:263<C#####
+@M01873:M01873:000000000-B9G3J:1:1110:22639:11539 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CAGCTACACACAGTAGA
+GGAGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATAACACCGGAGAGATTGTATTGACACAGTCTCCAGCCATCGTGTCTTTGTCTCCAGGCGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGTAGCTACTTAGCCTGGTTTCACACGAGACCTGGCCAGGCTCCCAGGCTCCTCTTCTCTGATCACACCACCCGGGCCACCGACATCCCACCCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG9FGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGCFGFFFGGFGGFFGCGGG?FGGBFCEFGDFGGFF787EGGFDGFFGEGFDGG,@D:D>8>5CCEGGGGFE?D@CACC@FC;CFFFFGFFF5A,4:C#######################################################################
+@M01873:M01873:000000000-B9G3J:1:1113:6140:4661 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=AACCCTTCAGCAGTACC
+GGCTGGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTATTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCACCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCGCTGGAACCAGCCGTGACGTTGGGGGTTATAACTTTGTCTCCTGGTACCAACAACACCCAGTCCAGGCCCACACACTCATGATTTATGGTGTCACTAATCGGGCCCCA
++
+GDGDCFFGECCFFF@FECCFEDGG:FFGGGGGDGGC=<FEGGFGFGG8FECCCCFGGGFG9FFFGGGGGGGGGGFGGGFGGFFEGGGGFGGGGGCFFGGGGGGGGGGFFGGGGGGG,@D>FFGFDDC8DCFGGCE8,,79CCGFGG>@DC8CD*=CFCG?CC;,>C5*=CFF?CC<C***//CC8C84:>E>*9E4C70:E7C47797**00<*+7EG85=D*>35+/*2+7*>;<<B<BD<8?7=CF#########################
+@M01873:M01873:000000000-B9G3J:1:1114:9970:8638 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CCGGTTAAGATATCGTA
+GAAGCATTCTGGTGAGACCAACTGCATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAGGGCTTCTCCTCAACTCTCTCTGGAAGGTTGCAGAAAGCAAGGACCAAGTGTTTCAGCCGTCGACGGGTTCTGCAAGGCAACTGACCTTTGGATCTGGGACACAATTGACTGTTTTACCTGATATCCAGAACCCTGACCCTGCCGTGAGATCGGAAGAGCGTCGTGTCGGGAAAGAGTGTAGATCTCGGTGGTCGCGGTATCGTT
++
+GGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGCGGGGGGGGFGFGGGGGGGCGBFGGGGGDGGGFGGGGGFGDGGGDGCEEGGGGGGGDCFGGG>FCFCGGGGGDCGGGFGCCFGCF5:,05=FFECCFF>GFCGGFG6B@=:B<5=F<<FC*;FGG5>8*7CCGGEEDGF64>9*09<*)9>GF)5;99<GAF?<6+<3*:EE>52?D#########
+@M01873:M01873:000000000-B9G3J:1:1107:8981:22378 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GGATATCGAAGAATCGC
+GTCTCCACGTTCCCTGCCCGTCACCGTTGGACAGCCGGCCTCCATTTCTTGTAGGTCTAGTCAAAGTCTCGTGCACGGAAATGGAGACACGTACTTGAGTTGGTTTCAACAGAGGCCAGGCCAATCTCCAAGGCGCCTGATTTATAAGGTTTCTAACCGGGACTCTGGGGTCCCCGACAGATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAGAATTAGAAGAGTGGAGGCTGAGGATGTTGGCGTTTGCTTTTGCATGCAAAGTACAA
++
+GGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGEGGFGGGGGGGGGFGGGGGGGGGFGGGFGGGGGGGDEFGGF8?FFGGGGDGGGGFGGFGFGFGGGGGFFFGGGGCGGGFFFFGGGGGGGGDEGG@FGGGFEGG9;ECFGFGGCEGGGGG6;99<>8CFGGGDGGGFGGG7?757EG529<CEC768CD*767+;>CFCFGG*2<>GGGC6CC:*7DF5**9*7:9CCA6CFCCC67?C=*+3C2+09+<FDFGG?92+A#
+@M01873:M01873:000000000-B9G3J:1:1101:10099:23047 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CTGCCACACTTTGAAGA
+AGGAACTGCTCAGTTAGGACCCAGACGGCACCATGGAGGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACTTCTGGGAAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCAAGGGGAAAGAGCCACCTACTCCTGCAGTGCCAGTCAGAGTGGTATTATGAACTTAGCCTGGTACCAGCAGATACCTGGCGAGGAGCCCAGACTCCTCATCTATGGTGCATCCGCGAGGTTCACGGGTGTCCCAGCCAGT
++
+@+F@<FGGGGGD,@@DDGGCGG8FFCF,8@C<CFC,:,B@<:F7FFGE7EC<6CFDGFCEF,6EEFG9AFGGG8FE<F@,?BF,AFGFGGGF,A<<EFG9FA?FF,@7:>?=>99FGFGECEEFFGEAEDFFG,D,6E,7>8E8FCFCF,383,66CGGEGGG,,2@EG6,,7,,,,*@,@,7@CF:@B,3,57:C4;+@:=,10,**1+042CF*8C***2=/CF***0A?F+CFFC7@4:CF?CGG3=**:*2*0<<*1CEC*+<CG4:F###
+@M01873:M01873:000000000-B9G3J:1:1101:10100:15992 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=CCAAATGCTAAATATTC
+GATCCTGCCCTGACCCTGCCATGGGCACCAGGCTCCTCTTCTGGGTGGCCTTCTGTCTCCTGGGGGCAGATCACACAGGAGCTGGAGTCTCCCAGTCCCCCAGTAACAAGGTCACAGAGAAGGGAAAGGATGTAGAGCTCAGGTGTGATCCAATTTCAGGTCATACTGCCCTTTACTGGTACCGACAGAGCCTGGGGCAGGGCCTGGAGTTTTTAATTTACTTCCAAGGCAACAGTGCACCAGACAAATCAGGGCTGCCCAGTGATCGTTTCTC
++
+GGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGFGGGFGGF?@FGFFGGGGGGGGGGGGGGGGAFGCEAFGGGGGGGFFE8FFGFGCFGDE9EFFGGGFGGEE9DGDGGGGGD7C9EGGGCFGGGGGGGGEGAC6DAFDGDGDGGGGFFFGGGGEC5:ED*CFF;6CCFGGCC9E?+=<:>F+69FGFGGGFF+:C5>8**29C0+<<6CEGCEF56*0000+128@:<9
+@M01873:M01873:000000000-B9G3J:1:2107:8132:17450 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=TTGTCAGCCTGTGGTTC
+GGAGAGGGGCTGTGCTGAGAGGCGCTGCTGGGCGTCTGGGCGGAGGACTCCTGGTTCTGGGTGCTGGGAGAGCGATGGGGCTCTCAGCGGTGGGAAGGACCCGAGCTGAGTCTGGGACAGCAGAGCGGGCAGCACCGGTTTTTGTCCTGGGCCTCCAGGCTGTGAGCACAGATACGCCGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGTAAGAG
++
+GGGGCFEDCFGGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGGDDFGGFGGGGGGGGGGGGGGGGGGGGFGGGGGEGGGGGGGGGGGGGGG7@CGFCFEFGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGDBFGGGEGGFGCFFCF;?FGGGGFGGGG6C;@<E<EFEFFGGGFC*:CGGGFG7*<0CEE=5EGGGECEG5;CF?9:FDFGGGG*:CF66@7E@***/<CEC++2:EC<EG**C*1A*9@EC######################
+@M01873:M01873:000000000-B9G3J:1:2119:20248:11282 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TAATGTACGGAAATAGA
+GACTGATCAGGACTTCTCAGTTCTTCTTCTCACCATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATCCCTGGATCCAGTGCGGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGTCAGAGCCTCCTACATAGTGATGGAAAGACCTATTTGTATTGGTACCTGCAAAAGCCAGGCCAGTCTCCACAGCTCCTGTTCTTTGAAGTCCCCAACCGGTTCC
++
+GGGGGGGGGGGGGGGGGDGGGGGGGFFEGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGDGGGGGGGGGGGGGFFFFECFGFGGGGGGGGGGGGGGGGGGGGGGGGCCDGGGGGGCGGGFGGGGGGGGGGGFGFGGGGGCC9EFGGGGGGGGGF=F,D7;6DFF?FGGGGGFFFGGFFGGCCCFDGF;DFCFEGGGGGAF0+1C:1;<:C6><?)++4A+=BCF+<++=84*1CC*CE##
+@M01873:M01873:000000000-B9G3J:1:2115:23638:16692 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CACACAAGGAGACACGT
+GAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGCATGCCCTGGCTTCCTGTGGGCACTTGTGATCTCCACCTGTCTTGAATTTAGCATGGCTCAGACAGTCACTCAGTCTCAACCAGAGATGTCTGTGCAGGCGGCAGAGACCGTGACCCTGAGCTGCACATATGACACCAGTGAGAGTGATTATTATTTATTCTGGTTCAAGCAGCCTCCCAGCAGGCAGATGATTCTCGTTATTCTCCAATAAGCTTATAAGCAAA
++
+GCGGGFGGGGGGGFFFDEGGGFC9CAFFDFFEEE8DCFDFGGG<FGCGFGGCFGCFCFFGCGFGGGGGGGFCCEEGCGGGGGGGCECBGFGCCGAGEGGG<EFGGGCFGD:F@EF@AEEFD;9:FGG99=9:FF8E8EEFEAFBDFFGGG++@8@EFFGG6>CF5*3@FFFCCD,6,<AF?F?F7?FD5F962=CF:C>9,1=CFF7@=CGFEE80,,4>C+*58:CECCG+**25=F8=;+3C<FF+*79C@C9+3CC++<?+<A9+3+:97CC#
+@M01873:M01873:000000000-B9G3J:1:2106:2176:11695 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TGTAAATAGTTTGCCTA
+AGGAACTGCTCAGTTAGGACCCAGACGGAACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGGGCTGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCTACTTAGCCTGGTACCAGCAGCACGCGGGCCAGTCTCCCAGGCTCCCCATCTATTGTGCATCCACCAGGCCCACTGGTCCCCCCGCCAG
++
+GGGGGGGGGGGGGGGGGCACFGGGGGEGGGGGGGF8EGGGFFGE:FCFG@FCEGGGFEGGGG8,6,6,B<E9FEFEFGGF==FFGGG8FB,,:FGAEF<,,,9@=FG+F74??F9A@F7,A:+FFFC9<BCADAF,7D8F7:6@:D8DFGGF:6@:8@,,@:?6:CEEDDCCE<E,5<C,,5;9@,9DG?CED,=>5<DFC#########################################################################
+@M01873:M01873:000000000-B9G3J:1:2118:8705:16266 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=TGTGAACAAGATATCAT
+GGGGGTCACAAGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTGCTCCTCACTCTCCTAACTCAGGACACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGAAAGCAGTGGTGATTTTGGGACTTATAACCGTGTCTCCTGGTTCCAGCAAGTCCCAGGCAAACCCCCCAAACTCATCATTCATTCGGTCACTAAGCGGCCCTCAGGGGCT
++
+GGGGGGEFGGGGGGGGGGGGECGGEECGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGC,AEFGF,<ECFGGGGGGFGFFGGG>GGGGGGGGGGGGGEFGGGGGGGGG6@FGF6CC*?C@8FGFGGGGGFFDGGGGGGGGG*:@CFGDGGGGGGGGGGGGGGCC6<*<CC?E+9CFC?EGGGF+<+<CCFCGFGG?CCGGGCFF?C7C609<C9++8***:7CGG8:?C57FC?*<CF7EF<>F8<6?G#####################
+@M01873:M01873:000000000-B9G3J:1:1101:10107:18394 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TGTGTATGGGCACACTT
+GGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCTCTGGATCCAGTGGGTATATTGTGATGACTCAGTCTCCACTGTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCGCCTGCAGGTCTAGTCAGAGCCTCCTGCACAGTAATGGAGACAACTAGTTGGATTGGTACCTGCAGAAACCAGGGCAGTCTCCACCAGTCCTGATCTTTTTGGGTTCTAATCGGGCCTCC
++
+FGGGGGGCGGGGGGGGGGGGGGGGGGGGFGGFGGFFFGGGGGGGGGGFGFFGGGGGGGGGGGGGGGGGFGGGGFGGGGGGFFGGGGFFGCFE9FFGGCEFGGC9F,CEFGAE4==EFGGFEEC8EGGGCCEGG8EGFFGGGDGGGGG:>FGGFGDEEGFGGG>FFGGFGGDG,<CF?:DFGGFE,CGEFG,C4CCFDF=F,,48CG*;FG;D7:=CFG?6C6CCC#################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10111:8693 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=GCGACTCTTTCATTTAG
+AGGAACTGCTCAGTTAGGACCCAGACGGAACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGACTATTAGCGCCTCCTTAGCCTGGTCCCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCCTCTATTGTGCGTCCCCCAGGGCCACTGGTATCCCAGCCCG
++
+EGGGGGGGGDGGGGGGGGGGGGG,CFG7FGGGGGGGGGGGGGGDGGGGGGGGFGGGGGGGFGGGGGGGFGGGAEFGGGGGGDGGGGGGGGGGGCGGGGGDEGFGGGGGGGG@;@=EFGGG?FGGGGC;,39DFEGF9DFGDEEFGGGF>E?FGFGC?FFFGF9?EGG5DEG7EFC,@EG7=CGGGDGG>99778CF4C,AFDFG,**2*2CFEC5F##########################################################
+@M01873:M01873:000000000-B9G3J:1:1106:7472:17358 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=GTCATTTGCTGTAGGCA
+AGCTGTGGGCTCAGAAGCAGAGTTCTGGGGTGTCTCCACCATGGCCTGGACCCCTCTCTGGCTCACTCTCTTCACTCTTTGCAGAGGTTCTGTGGTTTCTTCTGAGCTGACTCAGGACCCTGCTGTGTCTGTGGCCTTGGGAGAGACAGTCCGGCTCACATGCCAAGGAGACAGCCTCAATAGTTTTTTTGCAAGCTGGTACCAACAGAAGCCAGGGCAGGCCCCTACAGTTCTCATGTTTGATAAAGACAATCGTACCTCAGGGAACCCATAC
++
+F:CFGG8F:FGGGGFEGFGGFGFGGGGGGGGGGGGGGFFGGFE@GGGGGGGGGGFDCFGGGFGBFFGGGGFFGGGGGGCFGGGGGCGFGG9EFFGFGGGGGGGFGGC?FGGGGGGGGGGGGGGGGFGGGFGGCFGGGGGGGCECEGGDGGGGGC+==FFGGGG8<7DFF6@FFGGCGG6CFAGG7CEF8C5EF=FCFDFGF<C,<9CAFF6CFC6C=8**?EE5C>CFCFF+=C>@:+;AFEFGFGF###########################
+@M01873:M01873:000000000-B9G3J:1:1113:11846:1631 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=TTTACAGTTCCTTTCTG
+GGTCTGGGCCTAAGGAAGCAGCACTGGTGGTGCCTCAGCCATGGCCTGGACCGTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGGCTCTTTGACCTCCTATGTACTCACTCAGGCACCCTCGGTGTCAGTGGCCCCAGGAGAGACGTCCAGGATTACCTGTGGGGGAGACAACATTCAAAATGAAGATGTGTACGGGTATCAGCAGCAGCCAAGCCTGGCCACTATGCTGGTCCTCCCTGATGCTGGTGACCGGCCCCCCAGGCTCCGTGTGGG
++
+GGGGGGGGFCGG,FFFFGFG<FGGGGGECEFCDGGGGGGGGGG8FGGCCFGGEEGGDEFG<<FEECG7=FFEFDGFGGGGGGGGFGDDEFF,C<FGGGCF8FGGFEFDG9==E@EFC,A:=DE+>BEGC;F;D=BEDCEG?>+33+,433@3@:::99F99AFC,:5**1?CCB:4=7+91?,4,1,5:,+1:+;+7*8598@CFF6<;*9<F###############################################################
+@M01873:M01873:000000000-B9G3J:1:1113:28641:15469 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=ACACGTTGCGTATGAGA
+GGAAGGCGCTTTGTGAAGTAGGCCTTATTTCTCTTGTCCTTTCGTACAGGGAGGAATTTGAAGTAGATAGAAACCGACCTGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACGAACCTTTAATAGCGGCTGCACCATCTGTCAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAACATATATCTCGATGGTGAGATAAGTCGAGAAACACAAATGTC
++
+GGGGGGGGFGGGGGGGGGGGGGGGGGGGFGGGGGEFGGGGGGGGGGGGGFGFFGGFGFGGGEGFEFGGGGFGGGGGGGGGGGFFGGGGGGGGGGGGFGDFGGGGGFEFGGGGGGGGGGGGGGGGFGGGGF@FGGGGECFFCGGGGGFEE>EGEGGGFEGFGGEFFGGFFEDGGGCFGGGG47=*>EE4CCC<FFCF7AGF7CF4EBCDE*8C;9:DCD7*<0AFCG#################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10117:24419 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=TAAGCTGCACAATGAAT
+AGAGCTCTGGGGTGTCTGCACCATGGACTGGACCCCACTCCTCCTCCTCTTTCCCTCTCCTCCTACACGGCACAGGGTCTCTCTCCCAGACTGTGCTGACTCAATCATAGTATGACTCTGCTTCCCTGGGATCCTCGGTCAACCTCACCTGCACTCTTGCCAGTGGACACAGTACATACATCGCATGGCATAAGCAGGAGCCAGGGAAGGACCATAGGTACTTGAGGAGGGTGGAAGGGAGTGGAAGGTACACCAAGGTGAACTGCGTTCGTG
++
+@CGDDD,ECEG7+88FFGAFF8@EEGCE,CE8,;B@CFF,@FGGEFFCCEC6C6C,B6,,@,BF,,B=,8+@=EFFGD=,5@FG,B845,:A5FFEGG,9A<<FFGGF;,4,,9,49,4;9,@,8EF=DBE>F?FAEEE>BF,76@@,,,68D=,,@=9,8A86EG,87@CFF7FC,@AFGD7>;CEFGFG5C2:7;*97;*01@D###################################################################
+@M01873:M01873:000000000-B9G3J:1:1117:12944:14016 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=AGCCCATTTCATAATTA
+GCTTTTCTCAGGGGAGAGGCCATCACTTGAAGATGCTGAGTCTTCTGCTCCTTCTCCTGGGACTAGGCTCTGTGTTCAGTGCTGTCATCTCTCAAAAGCCAAGCAGGGATATCTGTCAACGTGGAACCTCCCTGACGATCAAGTGTCAAGTCGATAGCCAAGTCACCATGATGTTCTGGTCCCGTCAGCAACATGGACAGAGCCTGACACTGATCGCAACTGCAAATCAGGGCTCTGAGGCCACATATGAAAGTGGATTTGTCATTTCAAAGTTT
++
+GGGGGGGFEE@F8FC:CCGFD@DC,6ECA<<AFGFDEF9F<A9EEG<,<9@CEFGF9<@8DFGFFDF8FF<EFFFGG9A<<<EFA9FEGGGFF,9FEC8A<FEFFGFC78FFG=FFFGGDEF7>C9F7EF,=44>8EGD8+@?>E;=D;=6@>CEGGGGGFGFEDCADAD3EF=C9DD,@,+47,;++@FGG*;C,;*<F>FCCDFF4*;<*4=@4;;99**,*4++*;BCGC##########################################
+@M01873:M01873:000000000-B9G3J:1:1111:27451:7271 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GCATTTCTTGCAACTAC
+GACCCAGAAGACCCCTCCATCCTGTAGCACCTGCCATGAGCATCGGGCTCCTGTGCTGTGTGGCCTTTTCTCTCCTGTGGGCAAGTCCAGTGAATGCTGGTGTCACTCAGACCCCAAAATTCCAGGTCCTGAAGACAGGACAGAGCATGACACTGCAGTGTGCCCAGGATATGAACCATAACTCCATGTACTAGTATCGACAAGACCCAGGCATGGGACTGAGGCCGATTTTTTAATCCGCTTCTGCGGGTACCACTGACAAAGGAGAAGTCCCC
++
+GGEGGGGGG@EFFGGGGGGGFGGCCGGFCFDCFGGGGGGFDGGGGC@FGGEGED@EE@A8,6,FFFGFGFBAFFFGEF8FCGA,BFFFFEG=EFFFFG9EFGFC@ED,FDFGFCFF+E8?F=FFFFEED9>F8FEF?8+@DEGFFFFG,>FCF==9,==8D8EGG?C6=F88DF7CF6,@6,3EF,7E39EC,+?BA@7A9D50,A79DC4C>F49C*8D?F#####################################################
+@M01873:M01873:000000000-B9G3J:1:1116:19939:2288 2:Y:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=GTCCGTCCTTATTTTGT
+GTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAATTCATATGATACTAGTAAAACGCACCGTGTGCCAAGTCAATGCGACGTCACTTATAGTAGTACATCGTAGGAGGCATGATACTATGTATTCGTATCTGCCAACTGCTCTGACGCAACAGGTGCTTATT
++
+GGGGGGFGGGGGGGGGGCGGGGGGFFDGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGEGGFGGGGGGGGGGGGGFGGGGGGGGGFGGG:FE+CFFGGGGGGGCFAEGFDDFGGFGGGGG@EE8*@>777,,5>?FGGGEDGE#################################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2108:15031:12741 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=GGTTTTCATAAAACTCT
+GGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAAGAAAGAACAAAAGAAGTCCCGACAGAACCGAAATCACAGAATAATGAAGATCACATAATGTGCTACTGGG
++
+GGGGGDFGGGGGGGGGGGGGFGGGGGFGGFFGGGGGGGGGGGFGFEFGGGGGGGGGGGG<ECGFGGGGGDF<EDFGGGFGGGGGFGGDFGCGGGGGGGGFGGGGDGGGFGGGGGGFEGFFGGGFGGGGGGCGGE@:@CCF:FGEEG::CG>CEEGFGF7E?,=@BFGGGFFF97;BCFCCGGFG>EE***=+9+<9CF*CC=C#########################################################################
+@M01873:M01873:000000000-B9G3J:1:2117:19601:12685 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CAGAAATTCTGTACAGC
+GGAAGAAATACTGTAAGTTGGTACCAGAAGGTCCCGGGAATGGCCCCCAAAGTCGTCATCTATAGTAATGATCAGCGGCCCTCCGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGTCTTCAGCCTGACGATGAGGCCCAATATTACTGTGCATCTTGGGATGACAGCCTCGACGCCCATGTGGTATTCGGCGGAGGGACCACGCTGACCGTCCTGAGTCAGCCCAAGGCTGCCCCCCCGGTCCC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGFGGGGGGGGGGCFGGGGEGGGGGGGGGGGGGGGGGGGCEDGGGGGGGGGCGGGGGGGGGGG>CGGGG?FGFDGCFGG7EDFGGFEF6:7EFECGGCEFGGGGF66BGGGG?C?FFFFGGGGGFGCCFFGGGGFGGGGDGDGF?FC>FFGGCF>5CDDGE)99CF=@?<E3*9D>DEE7+)39<D6CCFEG*1+*1;EGG########
+@M01873:M01873:000000000-B9G3J:1:2109:17364:9116 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=GCAATATATTTAGGCTT
+GATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTTCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCTCTGGATCCAGTGGGGATGTTGTGCTGACTCAGTTTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATTTCCTGCAGGTCTAATCAGAGCCTCCTACATCTTAATGGTTACAGTTCTTTGGACTTGTACTTTCAGAAGTCAGGAACTGTGGCTGCACCATCGTACAGAGCGGAAGAGGGTCGGGTGGGGG
++
+@@CCFCEFGFE,,<FF<CFG9FGFGGCEG8FF@,6EFG,C;EEFD6<CFGFF<@,@::CF>EFEAFF<FFG8<=F8,?BFAEFCBFDFFGGCCF?FEE@EE,:A?A8=,FFGG@?A=FE,AEGC,ACCFFG9EBDD=,,8>EGEE7>6D68;FG8EF9E6D?D8DDDGF9;A9?,,,>:9,,3,@,,3<;E,+;67?F:,=ECE7<2C,>92=7<19C,=>8;C##################################################
+@M01873:M01873:000000000-B9G3J:1:2105:12905:4671 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift4|BARCODE=ACATTAAGACCAGAATT
+ACTTCTTAGTGCCTTTTCTCAGGGGAGAGGCCATCACTTGAAGATGCTGAGTCTCCTGCTCCTTCTCCTGGGACTAGGCTCTGTGTTCAGTGCTGTCATCTCTCAAAAGCCAAGCAGGGGTATCTGTCAACGTGGAACCTCCCTGACGATCCAGTGTCAAGTCGATAGCCAAGTCACCATGGTGTTCTGGTACCGTCAGCAACCTGGACAGAGCCTGACCCTGATCGCAACTGCAAATCAGGGCTCTAAGGCCACCTATGAGGGTTGATTTGT
++
+GECFGGGGGCEFGGDCF@<,6CFCCCFECEGGGGGGDEFAAEAEFFFAEA,EFG,<FFGGGGGC<FGFGDGGEFFGCCF<FFA?FFFGFGGGFDCGGG9FEFCF?FE<<BEEEEGFGDE+64E?FG;,,C,6@8@?FGGFFECB@@8=CEGCE=>=,@EDG=,8AE889,93DEACFFGGA,7ECE7DFGFGGC58@C>8ADF,,=C=,,1<8E684,,,60:CFCCD5CEG+B++<@=DFFFE*8A##########################
+@M01873:M01873:000000000-B9G3J:1:2116:7856:19893 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TTTGAACTGGGTGCAGT
+CGTATCATCAACTGATGAGCAAGAAGGATATAATTCCTACGCCCTCTCAGCCGATGAACAGTTGGAATAGGTTGTTAGCGGTAACTAAGATTAGTATGGTAATTAGGAAAATGAGTAGATATTTGAAGAACTGATTAATGTTTGGGTCTGAGTTTATATATCACAGTGAGAATTCTATGATGGACCATGTAACGAACAATGCTACAGGGATGAATATTATGGAGAAGTAGTCTAGTTTGAAGCTTAGGGAGAGCGGGGTTGTTGGGGTTGTGGCT
++
+GGGGCFFADGFEGGGGGGGGGGGFGFF@CC9FE<FECFAFGGCEGG@CEFGGFFEGGGFC@,CFDBEGFGGGGGFFFGCFEGEEGF<BF9<,5E9A?EGGGCFGFFGGGGFEGF9,CBE9FFA9FFGGEG8,8,A9EF9EFFCFEC+@FFG;=D;E8E=8EFGFDEBF98>=E9ECEGGFG8,@@C?6EFFCFAE9C73939,2;9@ADF>C65>@C@F@D6;7C>6=986=,+,,1=2:CF?,>:,;CF=5A5*/CE?################
+@M01873:M01873:000000000-B9G3J:1:2106:17308:17099 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GTGAGCACCGTTTTGTA
+GCAGCACTGGGATTCCGAGGTGTTTCCATTCAGTGATCTGCACTGAACACAGAGGACTCGCCATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATGTTAAAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCTTCATCAGTAGTAACTACATTAATTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGGGTGGGTCTTCGTTCTTTCT
++
+GGEGGGGGGGGCFFGFG7FGGGFGGGFFEFGGGFGGGFGGGGGGFGGGGGGGGGGF@FGGGEEFGG8FGGGFGGC@CFF8AFGGGGGGGFCFEGGGFFFAFFGFF9FE7EEG8C,=FEFFCF8FG8?,FFGFFG7@CF:;DFGG>>BEG8DGCGGFCG8;D8FG8B=EGGFFGFGGFG8@8808FF#########################################################################################
+@M01873:M01873:000000000-B9G3J:1:1101:10137:13722 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=GAGAGTTGTCTAAAATC
+AACCACATCCCTCCTCAGAAGCCCCCAGAGCACAACTCCTTACCATGGACTGGACCTGGAGGATCCTCTTTTTGGTGGCAGCAGCCACAGGTGCCCACTCCCAGGTCCAGCTTGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACTGATTATGCTATACAGTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTTGATGGGATGGATCAACACTGGCAATGGTAACGCAA
++
+EGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGCGGGGGGGEGCGGGFCGGGGFGGGGGGGGGGGGFEF@CFFFFGGGGGGGGGGGGGGGFDFGGGEGG?@CFFGGGGGGCFGGG7E@=8E?ECFCFD>DFCGFGGGGGGGG8EGGGFFEGFFF:AC;<DFDF6899EFFCGGGGGGGGGFC:CCCGGGGFF,:::FGCFG44)497CG=:CEGG)/:5;DFF5C<)37@F?CFF6E:49C*3<*+*<C0<F5*08CCCCGGG*:C
+@M01873:M01873:000000000-B9G3J:1:1111:13857:12993 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=TGGATAGAAAGACTAGT
+ATACTTTCTGAGAGTCCTGGACCTCCTGTGCAAGAACATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCAGTGTCTCTGGTGGCTCCATCGGCAGCGGTGATTACTCCTGGAACTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATGTTTAACAGTGGGGGAACCCAAA
++
+GGGGGGGGGGGGGGGGFFGGGGGGEFGGGGGGGGFGGGGGGGGGGGEGGGFDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF8FFCFFGGGGFFGGCFGFGGGGGGFGGGGGGGGGGEGFFFGGGFGDFGGGGCFGGGFGGG8DEFFGGGGGGGGFGGGFGGGCDFFDCFGGDGGGGGGGG*@CGE9CCFGGGGCFGGGF>6?FGF>*;CCGDDF49CCCFDFG*A##############################################
+@M01873:M01873:000000000-B9G3J:1:1108:14300:19094 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=AAAGAAGGTGTAACTTC
+GAAGCTCTGCTTCAGCTGTGAGCGCAGAAGGCAGGACTCGGGACAATCTTCATCATGACCTGCTCCCCTCTCCTCCTCACCCTTCTCATTCACTGCACAGGGTCCTGGGCCCAGTCTGTGTTGACACAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGTTCACCATCTCCTGCTCTGGAAGCTCTTCCAACCTTGGTACCAATTATGTCTTCTGGTACCAGCAGCTCCCAGGCACAGCCCCCAAAGTCCTCATTTTTGACAGTAATAAGCC
++
+GGGGGGGGGGGGGGGGGGFCCGGGGGGGDFGGGDGGGFGGGGGGGGGGGGGGGGCGFGGGGGGGGGGGGEFFCFFFGGGGGGGGGGGGGGGGGGGGGGGGDEGGFGG?FGGGG?FFGCFGGFCEGGG?EFF+@E7CG8FGFGGGGGGEDGGGGDF*DDF?C6,@:FGF6ED>DGGCECC?96,<8:,,4<C?979/?8BE,,,01,;EGG7:+;9<FC+A+13+355*>FFGFG*7**284CGGG5**97<C7CC?FG#################
+@M01873:M01873:000000000-B9G3J:1:2107:6181:15590 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GCGCTATTCTAAATGGG
+GGGGTCTCAGGAGGCAGCGCTCTCGGGACGTCTCCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGGGACGTTGGTGGTTATAACTATGTCTCGTGGGACCCACATCACCCAGGCCAAGCCCCCCAACTCATGCTTTATGATGTCAATAACCGGCCCTCAGGGGTT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGG@EGFGGGGGGGFGDGGGFGGGGGGGGGFGGGFGGFF>FGGFFGFFGEGG<FGGGGGGGFGFF6<FGGGGGGFGCGCCEGCGD8@CFFFFGGDGFEG5EGGDGFCCGGGGGC66EGGGGGF>6C**2C8;ECEF55:CEGECEF@FC0@C7:++27E5*2>C#################################################################
+@M01873:M01873:000000000-B9G3J:1:1115:12252:7158 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TTCATAGAATCTTCTCA
+GGGGCCTCAGGAAGCAGCATCGGAGGTGCCTCAGCCATGGCATGGATCCCTCTCTTCCTCGGCGTCCTTGCTTACTGCACAGGGTCCGTGGCCTCCTATGACTTGACTCAGACACCCTCAGTGTCCGTGTCCGCAGGTCAAACAGCCACCATTTCCTGCTCTGCAGATGATTTGGGGGCCAATTATGTTGCCTGGTATCTGCAGAGGGCAGGCCAGTCCCCTATGATGGTCATTTATGAAAATAACAAGCGCCCCTCAGAGATCCCTGACCGCT
++
+GGGDGGGGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGCCFGDCGFEG6FGCGGFFGGGGCGGCFEFGGGGCGGGCFGF?FGGGGGGGGGECCEFGGFC88CFGGCDGGGGGGGFGGG?C+?FGGGGGGFFA<5:EGGGGDGGGG7C+:>3?>>++00*9CC3CDG35D<CG<7DGG67DFGF7FC>97CF9C*17=*A:**9*))*:)2//2*32<9@FFDFF######
+@M01873:M01873:000000000-B9G3J:1:1116:7180:16322 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=CGGACAGACCTAGGTAG
+GTGGGCCTAAGGAAGCAGCACTGGTGGTGCCTCAGCCATGGCCTGGACCGTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGGCTCTGTGACCTCCTATGAGGTGACTCAGCCACCCTCGGTGTCGGTGGCCCCAGGACAGACGGCCAAGATTACTTGTGGGGGGCACGACATTCGAGGTAGCAGTGTGCAGTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTCCTGGTCATCTATGATGACAGCGGCCGGCCCTTAGGGATCCCTGAACGAT
++
+GGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGFGGGGGGGGGGGGGGGGFFGGGGGGGGFFDGGDGGGGGGFGGGGGGGFBDFDGGGGGGGGGGDGCFEGG78DE7EEGFFCE>CGGFDB8DECEEGGFGGFGGFGGEFG5CEGDEGGCEEG??FFGGGGD87C?DGGGGGGGGGFCFGDGGGD9*9C4*9FC*9<FEGC*:F<7:*94**:7>:CDC4-*<7**/995EE5)2*09CEGCFGGGGG)<FF##
+@M01873:M01873:000000000-B9G3J:1:1111:16714:18923 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CTTGCTAGGTTACTTTT
+GAGAGCCCTGGGGAGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCCCCAGCTCAGCTTCTCCTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGAAATTGTTTTGACACAGTCTCCAGTCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTTTTGCAGGGCCAGTGAGAGTATTGATACCTACTTAGCCTGGTACCAACTGAAACCTGGCCAGCCTCCCAGGCTCCTCATTTCTGGTTCATCCAAGAGGGCCCCTGGC
++
+GGGGGFGFGGFDFGGGGGGGFFFFFGGGFGFGF<@FGFFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFEEGGG8,EDGFGGGFCCGGGG8,E<F<FGGE7=7:=AFFGDFGF8@F;EG8FGGGDFGGGGGG?FGDGGFGGGGGGGC?FGG68DGFGG6D6CCCGGFGGGGDE,*@EG:2,:EGGGFG,,5=C@7FDFCFGD?FC<:?+2+48?*;CFGCF*>A4;65D588C5**1=5C=CFFG+<+;>7:+<<CC################
+@M01873:M01873:000000000-B9G3J:1:2104:5522:14323 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=TCTCGAGATACTTATTA
+GAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAAAAAAGAATAACAGAAGAGACACTCGAATCAATAAAAATCAAAGTATAAAATTAAATGAATACAAA
++
+GGGGGGGGGGGGGDGGGEGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFG9FFCFGGFGFGGEGGGGGFGGGGGGGGGGCCGGGGGGFFFGGGG8FGGGGGFFGGFGGGFGGGAFDEFGGGEGGFGGEGGGGGGGGGGGGG7*>4:=>FDECCCGFG7ECECCBBFFGG5CGG9C*AC5*69@<FG+=F97CECD################################################################
+@M01873:M01873:000000000-B9G3J:1:1113:7318:10138 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=ATTTCTTTCCAACGTTA
+GAGATCTCAGAGAGGAGCCTTAGCCCTGGACTCCAAGGCCTTTCCACTTGGTGATCAGCACTGAGCACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTGGCCATATTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCGGGGGGAGGCGTGGTCGAGCCTGGGGGGGCCCTGGGACTGTCCGGTGTAGGTTGTGGATTCACCGTGAGTAGGCATTGGCGGCCCTTGGTTCGCCAGGTTCCCGGGCAGGGGGTGGTG
++
+ECFDCFFFCFCCECDFD8@FG@@FGFC<FFFFCAFGDGGGF8@EDEFGGGGGD<<FDCF,BEFF<B<,BECE?FFG8FGGGGGGCEE8,?FDFEGG8FC<F+A?FF9FC9FF@C:E:FF9@@;;EC@FG>8,,@ED===FFD+6B;?FCFFF>8E########################################################################################################################
+@M01873:M01873:000000000-B9G3J:1:2113:7529:7186 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift2|BARCODE=GAAATTCTCGAACTCAA
+GATCAGGACTCCTCAGTGCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCAGTTTGCCGTGGGGATGTTGTGCTGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCTATCTCCTGCAGGTCTAGTCAAAGCCTCGTATCCCGTGCTGGAGACACCTACTTGAGTTGGTTTCACCAGAGGCCAGGCCAATCTCCCAGGCTCCTGATTTATTGGGTTTCTAATCGAGCCTCTGG
++
+GGDGGGGGGGF8FGGG9EFGGGGGGGGGGGGGFGGDFFGGFFGGGGFFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGDFGGFFFGFGFGGGGGGFGGGGFGGGGGGCEFGGGGGGGGGGGGGCGGGGGGGGGGGGGGFGGFFCFGG8?DDFGGGGGF7,,DF,33;8DFGD,41>C69?FFFFGFGGGGFFGGFFGEFGGFDFGFGFGGGGGGGGFG?###########################################
+@M01873:M01873:000000000-B9G3J:1:2115:11727:15140 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=GCACTTCCACATGGTAC
+GGTGCTGAGAGGCGCTGCTGGGCGTCTGGGCGGAGGACTCCTGGTTCTGGGTGCTGGGAGAGCGATGGGGCTCTCAGCGGTGGGAAGGACCCGAGCTGAGTCTGGGACAGCAGAGCGGGCAGCACCGGTTTTTGTCCTGGGCCTCCAGGCTGTGAGCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGCGATCGGAAGAGCGTCGGTTAGGGAAAGAGGGTGGATCTC
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG7FGGGGGGGGGDGGGFCFFGGGFGFGGGGGGGGGGGGGGGGCGGGGGGGGDGE=5C9<<CF7:<8CGGGGGG*<CGF8:::<87?F7=ED###############################################
+@M01873:M01873:000000000-B9G3J:1:2116:5234:16363 2:Y:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift1|BARCODE=CGGTCAGATAATCTTCT
+GAGTCAGACCCAGTCAGGACACAGCATGGACATGAGGGTCCACGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGCGACAGAGTCACCAGCACTTGCCTGTCCAGTCACAGTATTAATAACTGGTTGGCATTGTATCCGCCGAAACCAGGGAAAGCCCCTCAGCTCCTGATCTATAAGGCGTCTAGTTTGGAAAGAGGGGTCCCGTCACGGTT
++
+C:78CCEEFFFGGECFFCFD,E<AFFGGEFDGD9,@F7B6<,CFCGCEGGGDFDFDGGGC,BEGFGGGGGA<EFGGG7E<C=8EFCFFDG9,9FEFFEFF,C,AEEFF:=FAEFGGGGG,:?D,@BAECAFGAFA9>9,++3>+,,,,7DFG,,=FDGDF@,@9=,76@FC,;@9E,<EC:;C9;;E,E88D,,*,?@7E############################################################################
+@M01873:M01873:000000000-B9G3J:1:2106:24340:3314 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=GCGGCATTAGTATTGCA
+GTGATCAGGACTTCTCAGTTCATCTTCTCACCATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATACCTGGATGCAGTGCAGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATGTCCTGCAGGTCCAGTCAGAGCCTCCTGCATAGTGATGGAAGGACCTTATTCCAATGGTACCTGCAGAAGCCAGGCCGGTCTCCACAACTCCTGATCTATGCACTTTCCAAGCGGTTCTT
++
+GGGGGGFGGCGGGGGGGGGGGGGGGGFFGGGGEFGGGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGAFFDFDGGGGFGFEFFGGGFGGGGGGGGGGGG<FGGGGG=FGGFGCFEFGGGGG@FGFGGGGFEGGGGFDGGG+>D@FFFFAFAFCDFDC:CFCGGCGGGGGFFFFGG,3E>EEGGGFGF7,0>;<2DEGGF7,31:DFGG9,,6;<CF6DFFCECC=8CEF:C6*300<>*2+>+;+++5AFG?#############
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_parseheaders_test_add_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,40 @@
+@CTTGCTTATGATTCCAG|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC|FOO=hello|BAR=world
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGNANGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
+@ATCTTTGCGGCTGGTTA|CONSCOUNT=1,1|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC|FOO=hello|BAR=world
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@GGGACTCCAAAATTAAT|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC|FOO=hello|BAR=world
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCNCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAAGCTCCTCATCCATAGCAATACTCNGCGGCCCTCNGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCTACATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>4G?CFGFG6BEC+:?7=CC78>?=CEGGFFFFGGGGGECFCC:>CDDGC<+:;ECGGGFGGGFGFDEC7GC<;-8*GGEDGGGFC*E87GGGBFCECGFFCGGFFFGFGGGGGCGFGFGGGGFGFGGDGGGGGGGGGGFGGFFGGFGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGG
+@CCTTGTCCGAGATGTCT|CONSCOUNT=1,1|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC|FOO=hello|BAR=world
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTANCAGCTCTGTAAATTGGTATCAGCTGAAGCCAGGGAANNCCCCTAANCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGNCGTCCCGTCAAGGNTCAGTGGGAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTCTGTCACCAGACTTACAATCCCCCGCTCGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGAA
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGE93>8BEFA>7C,>9DFGADFCCGEDF>7;=?GGDC<84;E=*=CCGFCFDFECEC6<CC76C>1?GGF@58C=04+9=**G@E:=>=*?<,?,?,,EFFFGFFB<?,FCD>,?,FGF>>:11*<AGEGFGFFC@+3*FDBFD8GGFDFGGGGGFFFAEFF9GFGFFEF<GFCFFGFFGGEE?GEGGGGGGGGFEEA<GGGGGCFDGF<FGGGGFCF9GGGGGGGFEEFGFEFGGCFF:GGGFFC7GGGGFGGGGGGGGFFGFGGGGGGDFGGGGEFEE
+@TTAGCTACATGTAATTG|CONSCOUNT=1,1|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC|FOO=hello|BAR=world
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCNTCATATACAGTGATGNNANCAACTACTTGNGCTGGTTTNNNNNNNNNNNNNNNNNNNCTCCAANGCGNCTAATATATAANGTTTCTAACCNGGNCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGTACAGGCACGGATTTCACACTGAAAATCAGTAGGGTGGGGGCTGAGGATGTTGGCATTTATTACTGCATGCAAACTACACCCTGTCCTTACACTTCTGGCCAGGGGACCAAGCTCCAGATCAAACGAA
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDED9=FFEGFGF4B@7EAGG5,@DF*@7,,@,,7:;C,53@**3(@ADE695=9@*7@CGGF8F###"##"####""######EFEC<5)+@,*,,AFC9DD=,3*,DC>173,>1*=3*AFB6++>GFFA,,C5BAF9FECDDF?,=<:,:?55E:+C=B7,,,FAGGGF?FGFE9CFAFFD8EFF@CGFF,DGFFFFFC9,,6,EFFFEE<C,,E9ECFE9C9E<FF@B68,F6<,<FEC@C9GFED;,,CFC,6<FFF<6,;C;,,FFGFBC9@@EFE
+@CTTGATAGGAATGAATA|CONSCOUNT=1,1|PRCONS=Human-TRB|SEQORIENT=F|PRIMER=Human-IGLC-1-InternalC|FOO=hello|BAR=world
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ATTAGTTCATAAATTCC|CONSCOUNT=2,2|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC|FOO=hello|BAR=world
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTACCAACAGAAACCTGGCCAGNCTCCCAGGCTCCTCATCNATGATGCANCCAATAGGGCCACTGGCANCCCAGCCANGTTCAGTGGCAGTGGGTCTGGGACANNCTTCACTCTCACCANCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGCGAGTGGCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAACGAA
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmkETNP^Qfh[idOFNIMLEdMfkk^hTIW[TNIPXBEEIHOLa[IIIHIHEFEIIAI!IIIIIlkbYdjeggibZ%R\jc]khf%fSff[Y\bil_jmhhiif!OcigRRg]%bR_illdjlcllc\QlgRee[_`R`!!Rgee_`RRlljQfl!mjlhRRReeckbcilkmlhRele_lmlmmlkjlilbjci_ml`]lfRkmmll^ili]i^_R\RmlfQmmkmml^Rfmmmmmmmimimmmmmmmmmmmmmml
+@CGCATATATCTGCAAAA|CONSCOUNT=1,1|PRCONS=Human-IGHA|SEQORIENT=F|PRIMER=Human-IGHA-InternalC|FOO=hello|BAR=world
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGNCTCTCNTGTNCAGCCTCTGGNTTNNCNTTCANTGACTATNNNANNANCNGGGNCCGCCAGGCTCCNGGGAAGGGGCTGGAGTGGGTCTCATNCATTGATNCTAGTAGAAGTTACATATACTATGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTGTATTACTGTTCTCGAGAATATAGCAGTGGCTGGCATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C(25FF:??@?771%F?CGF>;ECEGFE>B>C3?@:9EF=*:@GFD>:*@:CFC<+E7FA+FGFGF9C7FFC=?FGCC7CGFC:F5DGGGGFGGCFGGFD66DCD;FGGGGGGGGGGGGFGGCGFFDFAFFCF;;GGGGGFFDGGGGGGGGGGDGGFGGGFEEGGGGGGGGGGGGGGGGGGEDGGGGEGFFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF?GGFEGEGGDGGGGGGGGGGGGGGGGGGGGGGGG
+@CGATGTAATCTTAGCTG|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC|FOO=hello|BAR=world
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGANAAGGGCCCTCGCTACTTGATGACGGTTAAGAGTGATGGCAGCCACATCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGANCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF7@D77DGF8/:DCD>:@CEE>EG76F><C6C>7C>FGGEDF>6DG>A%CGEGEGEC7CFCGGGEEC79ECCGFC<D4C-GF?FCFDEF=C;?CFC6GGECGGGFGFGGEGC,GF@F1<CFFCGGGFGFGGGFCF>GGGGGGFF<7F*CGGFECFCFCFEFCF<GGGGGGFCGGGGF=9FFGGGGFCGF=99GGGGFFGGDFGGGGGGGCFEGGGGGGGF8GDGGGGGGGGGGGGGDGFGFGFGGGGGGGGGGGCF,GGGGGGGDGFGGGGGGGGGGDGGGG
+@ACTCGTGCTAATCCTTC|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC|FOO=hello|BAR=world
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_parseheaders_test_collapse_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,40 @@
+@CTTGCTTATGATTCCAG|CONSCOUNT=2|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGNANGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
+@ATCTTTGCGGCTGGTTA|CONSCOUNT=2|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@GGGACTCCAAAATTAAT|CONSCOUNT=2|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCNCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAAGCTCCTCATCCATAGCAATACTCNGCGGCCCTCNGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCTACATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>4G?CFGFG6BEC+:?7=CC78>?=CEGGFFFFGGGGGECFCC:>CDDGC<+:;ECGGGFGGGFGFDEC7GC<;-8*GGEDGGGFC*E87GGGBFCECGFFCGGFFFGFGGGGGCGFGFGGGGFGFGGDGGGGGGGGGGFGGFFGGFGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGG
+@CCTTGTCCGAGATGTCT|CONSCOUNT=2|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTANCAGCTCTGTAAATTGGTATCAGCTGAAGCCAGGGAANNCCCCTAANCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGNCGTCCCGTCAAGGNTCAGTGGGAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTCTGTCACCAGACTTACAATCCCCCGCTCGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGAA
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGE93>8BEFA>7C,>9DFGADFCCGEDF>7;=?GGDC<84;E=*=CCGFCFDFECEC6<CC76C>1?GGF@58C=04+9=**G@E:=>=*?<,?,?,,EFFFGFFB<?,FCD>,?,FGF>>:11*<AGEGFGFFC@+3*FDBFD8GGFDFGGGGGFFFAEFF9GFGFFEF<GFCFFGFFGGEE?GEGGGGGGGGFEEA<GGGGGCFDGF<FGGGGFCF9GGGGGGGFEEFGFEFGGCFF:GGGFFC7GGGGFGGGGGGGGFFGFGGGGGGDFGGGGEFEE
+@TTAGCTACATGTAATTG|CONSCOUNT=2|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCNTCATATACAGTGATGNNANCAACTACTTGNGCTGGTTTNNNNNNNNNNNNNNNNNNNCTCCAANGCGNCTAATATATAANGTTTCTAACCNGGNCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGTACAGGCACGGATTTCACACTGAAAATCAGTAGGGTGGGGGCTGAGGATGTTGGCATTTATTACTGCATGCAAACTACACCCTGTCCTTACACTTCTGGCCAGGGGACCAAGCTCCAGATCAAACGAA
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDED9=FFEGFGF4B@7EAGG5,@DF*@7,,@,,7:;C,53@**3(@ADE695=9@*7@CGGF8F###"##"####""######EFEC<5)+@,*,,AFC9DD=,3*,DC>173,>1*=3*AFB6++>GFFA,,C5BAF9FECDDF?,=<:,:?55E:+C=B7,,,FAGGGF?FGFE9CFAFFD8EFF@CGFF,DGFFFFFC9,,6,EFFFEE<C,,E9ECFE9C9E<FF@B68,F6<,<FEC@C9GFED;,,CFC,6<FFF<6,;C;,,FFGFBC9@@EFE
+@CTTGATAGGAATGAATA|CONSCOUNT=2|PRCONS=Human-TRB|SEQORIENT=F|PRIMER=Human-IGLC-1-InternalC
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ATTAGTTCATAAATTCC|CONSCOUNT=4|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTACCAACAGAAACCTGGCCAGNCTCCCAGGCTCCTCATCNATGATGCANCCAATAGGGCCACTGGCANCCCAGCCANGTTCAGTGGCAGTGGGTCTGGGACANNCTTCACTCTCACCANCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGCGAGTGGCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAACGAA
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmkETNP^Qfh[idOFNIMLEdMfkk^hTIW[TNIPXBEEIHOLa[IIIHIHEFEIIAI!IIIIIlkbYdjeggibZ%R\jc]khf%fSff[Y\bil_jmhhiif!OcigRRg]%bR_illdjlcllc\QlgRee[_`R`!!Rgee_`RRlljQfl!mjlhRRReeckbcilkmlhRele_lmlmmlkjlilbjci_ml`]lfRkmmll^ili]i^_R\RmlfQmmkmml^Rfmmmmmmmimimmmmmmmmmmmmmml
+@CGCATATATCTGCAAAA|CONSCOUNT=2|PRCONS=Human-IGHA|SEQORIENT=F|PRIMER=Human-IGHA-InternalC
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGNCTCTCNTGTNCAGCCTCTGGNTTNNCNTTCANTGACTATNNNANNANCNGGGNCCGCCAGGCTCCNGGGAAGGGGCTGGAGTGGGTCTCATNCATTGATNCTAGTAGAAGTTACATATACTATGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTGTATTACTGTTCTCGAGAATATAGCAGTGGCTGGCATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C(25FF:??@?771%F?CGF>;ECEGFE>B>C3?@:9EF=*:@GFD>:*@:CFC<+E7FA+FGFGF9C7FFC=?FGCC7CGFC:F5DGGGGFGGCFGGFD66DCD;FGGGGGGGGGGGGFGGCGFFDFAFFCF;;GGGGGFFDGGGGGGGGGGDGGFGGGFEEGGGGGGGGGGGGGGGGGGEDGGGGEGFFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF?GGFEGEGGDGGGGGGGGGGGGGGGGGGGGGGGG
+@CGATGTAATCTTAGCTG|CONSCOUNT=2|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGANAAGGGCCCTCGCTACTTGATGACGGTTAAGAGTGATGGCAGCCACATCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGANCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF7@D77DGF8/:DCD>:@CEE>EG76F><C6C>7C>FGGEDF>6DG>A%CGEGEGEC7CFCGGGEEC79ECCGFC<D4C-GF?FCFDEF=C;?CFC6GGECGGGFGFGGEGC,GF@F1<CFFCGGGFGFGGGFCF>GGGGGGFF<7F*CGGFECFCFCFEFCF<GGGGGGFCGGGGF=9FFGGGGFCGF=99GGGGFFGGDFGGGGGGGCFEGGGGGGGF8GDGGGGGGGGGGGGGDGFGFGFGGGGGGGGGGGCF,GGGGGGGDGFGGGGGGGGGGDGGGG
+@ACTCGTGCTAATCCTTC|CONSCOUNT=2|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_parseheaders_test_copy_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,40 @@
+@CTTGCTTATGATTCCAG|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGL,Human-IGLC-2-InternalC
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGNANGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
+@ATCTTTGCGGCTGGTTA|CONSCOUNT=1,1|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGK,Human-IGKC-IGKJ-InternalC
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@GGGACTCCAAAATTAAT|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGL,Human-IGLC-2-InternalC
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCNCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAAGCTCCTCATCCATAGCAATACTCNGCGGCCCTCNGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCTACATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>4G?CFGFG6BEC+:?7=CC78>?=CEGGFFFFGGGGGECFCC:>CDDGC<+:;ECGGGFGGGFGFDEC7GC<;-8*GGEDGGGFC*E87GGGBFCECGFFCGGFFFGFGGGGGCGFGFGGGGFGFGGDGGGGGGGGGGFGGFFGGFGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGG
+@CCTTGTCCGAGATGTCT|CONSCOUNT=1,1|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGK,Human-IGKC-IGKJ-InternalC
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTANCAGCTCTGTAAATTGGTATCAGCTGAAGCCAGGGAANNCCCCTAANCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGNCGTCCCGTCAAGGNTCAGTGGGAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTCTGTCACCAGACTTACAATCCCCCGCTCGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGAA
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGE93>8BEFA>7C,>9DFGADFCCGEDF>7;=?GGDC<84;E=*=CCGFCFDFECEC6<CC76C>1?GGF@58C=04+9=**G@E:=>=*?<,?,?,,EFFFGFFB<?,FCD>,?,FGF>>:11*<AGEGFGFFC@+3*FDBFD8GGFDFGGGGGFFFAEFF9GFGFFEF<GFCFFGFFGGEE?GEGGGGGGGGFEEA<GGGGGCFDGF<FGGGGFCF9GGGGGGGFEEFGFEFGGCFF:GGGFFC7GGGGFGGGGGGGGFFGFGGGGGGDFGGGGEFEE
+@TTAGCTACATGTAATTG|CONSCOUNT=1,1|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGK,Human-IGKC-IGKJ-InternalC
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCNTCATATACAGTGATGNNANCAACTACTTGNGCTGGTTTNNNNNNNNNNNNNNNNNNNCTCCAANGCGNCTAATATATAANGTTTCTAACCNGGNCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGTACAGGCACGGATTTCACACTGAAAATCAGTAGGGTGGGGGCTGAGGATGTTGGCATTTATTACTGCATGCAAACTACACCCTGTCCTTACACTTCTGGCCAGGGGACCAAGCTCCAGATCAAACGAA
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDED9=FFEGFGF4B@7EAGG5,@DF*@7,,@,,7:;C,53@**3(@ADE695=9@*7@CGGF8F###"##"####""######EFEC<5)+@,*,,AFC9DD=,3*,DC>173,>1*=3*AFB6++>GFFA,,C5BAF9FECDDF?,=<:,:?55E:+C=B7,,,FAGGGF?FGFE9CFAFFD8EFF@CGFF,DGFFFFFC9,,6,EFFFEE<C,,E9ECFE9C9E<FF@B68,F6<,<FEC@C9GFED;,,CFC,6<FFF<6,;C;,,FFGFBC9@@EFE
+@CTTGATAGGAATGAATA|CONSCOUNT=1,1|PRCONS=Human-TRB|SEQORIENT=F|PRIMER=Human-IGLC-1-InternalC,Human-TRB
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ATTAGTTCATAAATTCC|CONSCOUNT=2,2|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGK,Human-IGKC-IGKJ-InternalC
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTACCAACAGAAACCTGGCCAGNCTCCCAGGCTCCTCATCNATGATGCANCCAATAGGGCCACTGGCANCCCAGCCANGTTCAGTGGCAGTGGGTCTGGGACANNCTTCACTCTCACCANCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGCGAGTGGCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAACGAA
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmkETNP^Qfh[idOFNIMLEdMfkk^hTIW[TNIPXBEEIHOLa[IIIHIHEFEIIAI!IIIIIlkbYdjeggibZ%R\jc]khf%fSff[Y\bil_jmhhiif!OcigRRg]%bR_illdjlcllc\QlgRee[_`R`!!Rgee_`RRlljQfl!mjlhRRReeckbcilkmlhRele_lmlmmlkjlilbjci_ml`]lfRkmmll^ili]i^_R\RmlfQmmkmml^Rfmmmmmmmimimmmmmmmmmmmmmml
+@CGCATATATCTGCAAAA|CONSCOUNT=1,1|PRCONS=Human-IGHA|SEQORIENT=F|PRIMER=Human-IGHA,Human-IGHA-InternalC
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGNCTCTCNTGTNCAGCCTCTGGNTTNNCNTTCANTGACTATNNNANNANCNGGGNCCGCCAGGCTCCNGGGAAGGGGCTGGAGTGGGTCTCATNCATTGATNCTAGTAGAAGTTACATATACTATGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTGTATTACTGTTCTCGAGAATATAGCAGTGGCTGGCATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C(25FF:??@?771%F?CGF>;ECEGFE>B>C3?@:9EF=*:@GFD>:*@:CFC<+E7FA+FGFGF9C7FFC=?FGCC7CGFC:F5DGGGGFGGCFGGFD66DCD;FGGGGGGGGGGGGFGGCGFFDFAFFCF;;GGGGGFFDGGGGGGGGGGDGGFGGGFEEGGGGGGGGGGGGGGGGGGEDGGGGEGFFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF?GGFEGEGGDGGGGGGGGGGGGGGGGGGGGGGGG
+@CGATGTAATCTTAGCTG|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGL,Human-IGLC-2-InternalC
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGANAAGGGCCCTCGCTACTTGATGACGGTTAAGAGTGATGGCAGCCACATCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGANCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF7@D77DGF8/:DCD>:@CEE>EG76F><C6C>7C>FGGEDF>6DG>A%CGEGEGEC7CFCGGGEEC79ECCGFC<D4C-GF?FCFDEF=C;?CFC6GGECGGGFGFGGEGC,GF@F1<CFFCGGGFGFGGGFCF>GGGGGGFF<7F*CGGFECFCFCFEFCF<GGGGGGFCGGGGF=9FFGGGGFCGF=99GGGGFFGGDFGGGGGGGCFEGGGGGGGF8GDGGGGGGGGGGGGGDGFGFGFGGGGGGGGGGGCF,GGGGGGGDGFGGGGGGGGGGDGGGG
+@ACTCGTGCTAATCCTTC|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGL,Human-IGLC-2-InternalC
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_parseheaders_test_delete_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,40 @@
+@CTTGCTTATGATTCCAG|PRCONS=Human-IGL|PRIMER=Human-IGLC-2-InternalC
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGNANGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
+@ATCTTTGCGGCTGGTTA|PRCONS=Human-IGK|PRIMER=Human-IGKC-IGKJ-InternalC
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@GGGACTCCAAAATTAAT|PRCONS=Human-IGL|PRIMER=Human-IGLC-2-InternalC
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCNCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAAGCTCCTCATCCATAGCAATACTCNGCGGCCCTCNGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCTACATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>4G?CFGFG6BEC+:?7=CC78>?=CEGGFFFFGGGGGECFCC:>CDDGC<+:;ECGGGFGGGFGFDEC7GC<;-8*GGEDGGGFC*E87GGGBFCECGFFCGGFFFGFGGGGGCGFGFGGGGFGFGGDGGGGGGGGGGFGGFFGGFGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGG
+@CCTTGTCCGAGATGTCT|PRCONS=Human-IGK|PRIMER=Human-IGKC-IGKJ-InternalC
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTANCAGCTCTGTAAATTGGTATCAGCTGAAGCCAGGGAANNCCCCTAANCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGNCGTCCCGTCAAGGNTCAGTGGGAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTCTGTCACCAGACTTACAATCCCCCGCTCGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGAA
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGE93>8BEFA>7C,>9DFGADFCCGEDF>7;=?GGDC<84;E=*=CCGFCFDFECEC6<CC76C>1?GGF@58C=04+9=**G@E:=>=*?<,?,?,,EFFFGFFB<?,FCD>,?,FGF>>:11*<AGEGFGFFC@+3*FDBFD8GGFDFGGGGGFFFAEFF9GFGFFEF<GFCFFGFFGGEE?GEGGGGGGGGFEEA<GGGGGCFDGF<FGGGGFCF9GGGGGGGFEEFGFEFGGCFF:GGGFFC7GGGGFGGGGGGGGFFGFGGGGGGDFGGGGEFEE
+@TTAGCTACATGTAATTG|PRCONS=Human-IGK|PRIMER=Human-IGKC-IGKJ-InternalC
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCNTCATATACAGTGATGNNANCAACTACTTGNGCTGGTTTNNNNNNNNNNNNNNNNNNNCTCCAANGCGNCTAATATATAANGTTTCTAACCNGGNCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGTACAGGCACGGATTTCACACTGAAAATCAGTAGGGTGGGGGCTGAGGATGTTGGCATTTATTACTGCATGCAAACTACACCCTGTCCTTACACTTCTGGCCAGGGGACCAAGCTCCAGATCAAACGAA
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDED9=FFEGFGF4B@7EAGG5,@DF*@7,,@,,7:;C,53@**3(@ADE695=9@*7@CGGF8F###"##"####""######EFEC<5)+@,*,,AFC9DD=,3*,DC>173,>1*=3*AFB6++>GFFA,,C5BAF9FECDDF?,=<:,:?55E:+C=B7,,,FAGGGF?FGFE9CFAFFD8EFF@CGFF,DGFFFFFC9,,6,EFFFEE<C,,E9ECFE9C9E<FF@B68,F6<,<FEC@C9GFED;,,CFC,6<FFF<6,;C;,,FFGFBC9@@EFE
+@CTTGATAGGAATGAATA|PRCONS=Human-TRB|PRIMER=Human-IGLC-1-InternalC
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ATTAGTTCATAAATTCC|PRCONS=Human-IGK|PRIMER=Human-IGKC-IGKJ-InternalC
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTACCAACAGAAACCTGGCCAGNCTCCCAGGCTCCTCATCNATGATGCANCCAATAGGGCCACTGGCANCCCAGCCANGTTCAGTGGCAGTGGGTCTGGGACANNCTTCACTCTCACCANCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGCGAGTGGCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAACGAA
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmkETNP^Qfh[idOFNIMLEdMfkk^hTIW[TNIPXBEEIHOLa[IIIHIHEFEIIAI!IIIIIlkbYdjeggibZ%R\jc]khf%fSff[Y\bil_jmhhiif!OcigRRg]%bR_illdjlcllc\QlgRee[_`R`!!Rgee_`RRlljQfl!mjlhRRReeckbcilkmlhRele_lmlmmlkjlilbjci_ml`]lfRkmmll^ili]i^_R\RmlfQmmkmml^Rfmmmmmmmimimmmmmmmmmmmmmml
+@CGCATATATCTGCAAAA|PRCONS=Human-IGHA|PRIMER=Human-IGHA-InternalC
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGNCTCTCNTGTNCAGCCTCTGGNTTNNCNTTCANTGACTATNNNANNANCNGGGNCCGCCAGGCTCCNGGGAAGGGGCTGGAGTGGGTCTCATNCATTGATNCTAGTAGAAGTTACATATACTATGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTGTATTACTGTTCTCGAGAATATAGCAGTGGCTGGCATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C(25FF:??@?771%F?CGF>;ECEGFE>B>C3?@:9EF=*:@GFD>:*@:CFC<+E7FA+FGFGF9C7FFC=?FGCC7CGFC:F5DGGGGFGGCFGGFD66DCD;FGGGGGGGGGGGGFGGCGFFDFAFFCF;;GGGGGFFDGGGGGGGGGGDGGFGGGFEEGGGGGGGGGGGGGGGGGGEDGGGGEGFFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF?GGFEGEGGDGGGGGGGGGGGGGGGGGGGGGGGG
+@CGATGTAATCTTAGCTG|PRCONS=Human-IGL|PRIMER=Human-IGLC-2-InternalC
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGANAAGGGCCCTCGCTACTTGATGACGGTTAAGAGTGATGGCAGCCACATCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGANCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF7@D77DGF8/:DCD>:@CEE>EG76F><C6C>7C>FGGEDF>6DG>A%CGEGEGEC7CFCGGGEEC79ECCGFC<D4C-GF?FCFDEF=C;?CFC6GGECGGGFGFGGEGC,GF@F1<CFFCGGGFGFGGGFCF>GGGGGGFF<7F*CGGFECFCFCFEFCF<GGGGGGFCGGGGF=9FFGGGGFCGF=99GGGGFFGGDFGGGGGGGCFEGGGGGGGF8GDGGGGGGGGGGGGGDGFGFGFGGGGGGGGGGGCF,GGGGGGGDGFGGGGGGGGGGDGGGG
+@ACTCGTGCTAATCCTTC|PRCONS=Human-IGL|PRIMER=Human-IGLC-2-InternalC
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_parseheaders_test_expand_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,40 @@
+@CTTGCTTATGATTCCAG|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC|CONSCOUNT1=1|CONSCOUNT2=1
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGNANGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
+@ATCTTTGCGGCTGGTTA|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC|CONSCOUNT1=1|CONSCOUNT2=1
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@GGGACTCCAAAATTAAT|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC|CONSCOUNT1=1|CONSCOUNT2=1
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCNCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAAGCTCCTCATCCATAGCAATACTCNGCGGCCCTCNGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCTACATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>4G?CFGFG6BEC+:?7=CC78>?=CEGGFFFFGGGGGECFCC:>CDDGC<+:;ECGGGFGGGFGFDEC7GC<;-8*GGEDGGGFC*E87GGGBFCECGFFCGGFFFGFGGGGGCGFGFGGGGFGFGGDGGGGGGGGGGFGGFFGGFGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGG
+@CCTTGTCCGAGATGTCT|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC|CONSCOUNT1=1|CONSCOUNT2=1
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTANCAGCTCTGTAAATTGGTATCAGCTGAAGCCAGGGAANNCCCCTAANCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGNCGTCCCGTCAAGGNTCAGTGGGAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTCTGTCACCAGACTTACAATCCCCCGCTCGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGAA
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGE93>8BEFA>7C,>9DFGADFCCGEDF>7;=?GGDC<84;E=*=CCGFCFDFECEC6<CC76C>1?GGF@58C=04+9=**G@E:=>=*?<,?,?,,EFFFGFFB<?,FCD>,?,FGF>>:11*<AGEGFGFFC@+3*FDBFD8GGFDFGGGGGFFFAEFF9GFGFFEF<GFCFFGFFGGEE?GEGGGGGGGGFEEA<GGGGGCFDGF<FGGGGFCF9GGGGGGGFEEFGFEFGGCFF:GGGFFC7GGGGFGGGGGGGGFFGFGGGGGGDFGGGGEFEE
+@TTAGCTACATGTAATTG|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC|CONSCOUNT1=1|CONSCOUNT2=1
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCNTCATATACAGTGATGNNANCAACTACTTGNGCTGGTTTNNNNNNNNNNNNNNNNNNNCTCCAANGCGNCTAATATATAANGTTTCTAACCNGGNCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGTACAGGCACGGATTTCACACTGAAAATCAGTAGGGTGGGGGCTGAGGATGTTGGCATTTATTACTGCATGCAAACTACACCCTGTCCTTACACTTCTGGCCAGGGGACCAAGCTCCAGATCAAACGAA
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDED9=FFEGFGF4B@7EAGG5,@DF*@7,,@,,7:;C,53@**3(@ADE695=9@*7@CGGF8F###"##"####""######EFEC<5)+@,*,,AFC9DD=,3*,DC>173,>1*=3*AFB6++>GFFA,,C5BAF9FECDDF?,=<:,:?55E:+C=B7,,,FAGGGF?FGFE9CFAFFD8EFF@CGFF,DGFFFFFC9,,6,EFFFEE<C,,E9ECFE9C9E<FF@B68,F6<,<FEC@C9GFED;,,CFC,6<FFF<6,;C;,,FFGFBC9@@EFE
+@CTTGATAGGAATGAATA|PRCONS=Human-TRB|SEQORIENT=F|PRIMER=Human-IGLC-1-InternalC|CONSCOUNT1=1|CONSCOUNT2=1
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ATTAGTTCATAAATTCC|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC|CONSCOUNT1=2|CONSCOUNT2=2
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTACCAACAGAAACCTGGCCAGNCTCCCAGGCTCCTCATCNATGATGCANCCAATAGGGCCACTGGCANCCCAGCCANGTTCAGTGGCAGTGGGTCTGGGACANNCTTCACTCTCACCANCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGCGAGTGGCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAACGAA
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmkETNP^Qfh[idOFNIMLEdMfkk^hTIW[TNIPXBEEIHOLa[IIIHIHEFEIIAI!IIIIIlkbYdjeggibZ%R\jc]khf%fSff[Y\bil_jmhhiif!OcigRRg]%bR_illdjlcllc\QlgRee[_`R`!!Rgee_`RRlljQfl!mjlhRRReeckbcilkmlhRele_lmlmmlkjlilbjci_ml`]lfRkmmll^ili]i^_R\RmlfQmmkmml^Rfmmmmmmmimimmmmmmmmmmmmmml
+@CGCATATATCTGCAAAA|PRCONS=Human-IGHA|SEQORIENT=F|PRIMER=Human-IGHA-InternalC|CONSCOUNT1=1|CONSCOUNT2=1
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGNCTCTCNTGTNCAGCCTCTGGNTTNNCNTTCANTGACTATNNNANNANCNGGGNCCGCCAGGCTCCNGGGAAGGGGCTGGAGTGGGTCTCATNCATTGATNCTAGTAGAAGTTACATATACTATGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTGTATTACTGTTCTCGAGAATATAGCAGTGGCTGGCATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C(25FF:??@?771%F?CGF>;ECEGFE>B>C3?@:9EF=*:@GFD>:*@:CFC<+E7FA+FGFGF9C7FFC=?FGCC7CGFC:F5DGGGGFGGCFGGFD66DCD;FGGGGGGGGGGGGFGGCGFFDFAFFCF;;GGGGGFFDGGGGGGGGGGDGGFGGGFEEGGGGGGGGGGGGGGGGGGEDGGGGEGFFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF?GGFEGEGGDGGGGGGGGGGGGGGGGGGGGGGGG
+@CGATGTAATCTTAGCTG|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC|CONSCOUNT1=1|CONSCOUNT2=1
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGANAAGGGCCCTCGCTACTTGATGACGGTTAAGAGTGATGGCAGCCACATCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGANCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF7@D77DGF8/:DCD>:@CEE>EG76F><C6C>7C>FGGEDF>6DG>A%CGEGEGEC7CFCGGGEEC79ECCGFC<D4C-GF?FCFDEF=C;?CFC6GGECGGGFGFGGEGC,GF@F1<CFFCGGGFGFGGGFCF>GGGGGGFF<7F*CGGFECFCFCFEFCF<GGGGGGFCGGGGF=9FFGGGGFCGF=99GGGGFFGGDFGGGGGGGCFEGGGGGGGF8GDGGGGGGGGGGGGGDGFGFGFGGGGGGGGGGGCF,GGGGGGGDGFGGGGGGGGGGDGGGG
+@ACTCGTGCTAATCCTTC|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC|CONSCOUNT1=1|CONSCOUNT2=1
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_parseheaders_test_in.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,40 @@
+@CTTGCTTATGATTCCAG|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGNANGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
+@ATCTTTGCGGCTGGTTA|CONSCOUNT=1,1|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@GGGACTCCAAAATTAAT|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCNCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAAGCTCCTCATCCATAGCAATACTCNGCGGCCCTCNGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCTACATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>4G?CFGFG6BEC+:?7=CC78>?=CEGGFFFFGGGGGECFCC:>CDDGC<+:;ECGGGFGGGFGFDEC7GC<;-8*GGEDGGGFC*E87GGGBFCECGFFCGGFFFGFGGGGGCGFGFGGGGFGFGGDGGGGGGGGGGFGGFFGGFGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGG
+@CCTTGTCCGAGATGTCT|CONSCOUNT=1,1|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTANCAGCTCTGTAAATTGGTATCAGCTGAAGCCAGGGAANNCCCCTAANCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGNCGTCCCGTCAAGGNTCAGTGGGAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTCTGTCACCAGACTTACAATCCCCCGCTCGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGAA
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGE93>8BEFA>7C,>9DFGADFCCGEDF>7;=?GGDC<84;E=*=CCGFCFDFECEC6<CC76C>1?GGF@58C=04+9=**G@E:=>=*?<,?,?,,EFFFGFFB<?,FCD>,?,FGF>>:11*<AGEGFGFFC@+3*FDBFD8GGFDFGGGGGFFFAEFF9GFGFFEF<GFCFFGFFGGEE?GEGGGGGGGGFEEA<GGGGGCFDGF<FGGGGFCF9GGGGGGGFEEFGFEFGGCFF:GGGFFC7GGGGFGGGGGGGGFFGFGGGGGGDFGGGGEFEE
+@TTAGCTACATGTAATTG|CONSCOUNT=1,1|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCNTCATATACAGTGATGNNANCAACTACTTGNGCTGGTTTNNNNNNNNNNNNNNNNNNNCTCCAANGCGNCTAATATATAANGTTTCTAACCNGGNCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGTACAGGCACGGATTTCACACTGAAAATCAGTAGGGTGGGGGCTGAGGATGTTGGCATTTATTACTGCATGCAAACTACACCCTGTCCTTACACTTCTGGCCAGGGGACCAAGCTCCAGATCAAACGAA
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDED9=FFEGFGF4B@7EAGG5,@DF*@7,,@,,7:;C,53@**3(@ADE695=9@*7@CGGF8F###"##"####""######EFEC<5)+@,*,,AFC9DD=,3*,DC>173,>1*=3*AFB6++>GFFA,,C5BAF9FECDDF?,=<:,:?55E:+C=B7,,,FAGGGF?FGFE9CFAFFD8EFF@CGFF,DGFFFFFC9,,6,EFFFEE<C,,E9ECFE9C9E<FF@B68,F6<,<FEC@C9GFED;,,CFC,6<FFF<6,;C;,,FFGFBC9@@EFE
+@CTTGATAGGAATGAATA|CONSCOUNT=1,1|PRCONS=Human-TRB|SEQORIENT=F|PRIMER=Human-IGLC-1-InternalC
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ATTAGTTCATAAATTCC|CONSCOUNT=2,2|PRCONS=Human-IGK|SEQORIENT=F|PRIMER=Human-IGKC-IGKJ-InternalC
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTACCAACAGAAACCTGGCCAGNCTCCCAGGCTCCTCATCNATGATGCANCCAATAGGGCCACTGGCANCCCAGCCANGTTCAGTGGCAGTGGGTCTGGGACANNCTTCACTCTCACCANCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGCGAGTGGCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAACGAA
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmkETNP^Qfh[idOFNIMLEdMfkk^hTIW[TNIPXBEEIHOLa[IIIHIHEFEIIAI!IIIIIlkbYdjeggibZ%R\jc]khf%fSff[Y\bil_jmhhiif!OcigRRg]%bR_illdjlcllc\QlgRee[_`R`!!Rgee_`RRlljQfl!mjlhRRReeckbcilkmlhRele_lmlmmlkjlilbjci_ml`]lfRkmmll^ili]i^_R\RmlfQmmkmml^Rfmmmmmmmimimmmmmmmmmmmmmml
+@CGCATATATCTGCAAAA|CONSCOUNT=1,1|PRCONS=Human-IGHA|SEQORIENT=F|PRIMER=Human-IGHA-InternalC
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGNCTCTCNTGTNCAGCCTCTGGNTTNNCNTTCANTGACTATNNNANNANCNGGGNCCGCCAGGCTCCNGGGAAGGGGCTGGAGTGGGTCTCATNCATTGATNCTAGTAGAAGTTACATATACTATGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTGTATTACTGTTCTCGAGAATATAGCAGTGGCTGGCATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C(25FF:??@?771%F?CGF>;ECEGFE>B>C3?@:9EF=*:@GFD>:*@:CFC<+E7FA+FGFGF9C7FFC=?FGCC7CGFC:F5DGGGGFGGCFGGFD66DCD;FGGGGGGGGGGGGFGGCGFFDFAFFCF;;GGGGGFFDGGGGGGGGGGDGGFGGGFEEGGGGGGGGGGGGGGGGGGEDGGGGEGFFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF?GGFEGEGGDGGGGGGGGGGGGGGGGGGGGGGGG
+@CGATGTAATCTTAGCTG|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGANAAGGGCCCTCGCTACTTGATGACGGTTAAGAGTGATGGCAGCCACATCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGANCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF7@D77DGF8/:DCD>:@CEE>EG76F><C6C>7C>FGGEDF>6DG>A%CGEGEGEC7CFCGGGEEC79ECCGFC<D4C-GF?FCFDEF=C;?CFC6GGECGGGFGFGGEGC,GF@F1<CFFCGGGFGFGGGFCF>GGGGGGFF<7F*CGGFECFCFCFEFCF<GGGGGGFCGGGGF=9FFGGGGFCGF=99GGGGFFGGDFGGGGGGGCFEGGGGGGGF8GDGGGGGGGGGGGGGDGFGFGFGGGGGGGGGGGCF,GGGGGGGDGFGGGGGGGGGGDGGGG
+@ACTCGTGCTAATCCTTC|CONSCOUNT=1,1|PRCONS=Human-IGL|SEQORIENT=F|PRIMER=Human-IGLC-2-InternalC
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_parseheaders_test_rename_out.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,40 @@
+@CTTGCTTATGATTCCAG|CONSCOUNT=1,1|SEQORIENT=F|PRIMER=Human-IGL,Human-IGLC-2-InternalC
+GAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGCGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGCGCCTCGGTCACGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCACAGNANGGCCCTCGGTATCTGATGAAGGTTAACAGTGATGGCAGTCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCTGGCTCCACCTCTGGGGCTGAGCACTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGCTGGCACTTGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGG8EFFGGFGGGGGGAGGGGGGGGGGFEEFGGDGGC@,CEFGGGGGGGCEEFDAFFFGGGGGGGGGGGGCGFCFFDCGG8FGGGEFGGGC:FGFGGFGGDFCFGF8AFGGGFCFG:EFC8@EE,BCE==>8@E>>BC>8CGGGFFCF9FEC9-F<:<@;<;?CF>>,8:8DCDE7C5DC@>@DC@9,FA6DD:GFFFGFFF>*1*GD>3GGECCGEGECGEGEFFGCCGGGGCDGCFF?GFGDEGCDCFGFDGGEECFCFFGDCGFFCF@C<GGGDFGGGGGGGGCDGGGGGEFGGGFFGGGFGGFFGGGGGFECF<CEFEGFFDFGCGGCGGGGFGGGFGGFGGGGGGGGGGGGGGGGGCFEGGGGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFEGG
+@ATCTTTGCGGCTGGTTA|CONSCOUNT=1,1|SEQORIENT=F|PRIMER=Human-IGK,Human-IGKC-IGKJ-InternalC
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@GGGACTCCAAAATTAAT|CONSCOUNT=1,1|SEQORIENT=F|PRIMER=Human-IGL,Human-IGLC-2-InternalC
+GAGCTTCAGCTGTGGGTAGAGAAGACAGGACTCAGGACAATCTCCAGCATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCNCCAACATCGGAAGTAATAATGTAAACTGGTACCAGCAACTCCCCGGAACGGCCCCCAAGCTCCTCATCCATAGCAATACTCNGCGGCCCTCNGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCTACATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGFGGGGGGGEGFGGGGGGGGFGGGFFFGGGGGGGGGGGGGGGGGGGCFGGGGGGGGGGGGFGGEGFGFFGGGGDGGGGCGCFFFCGGGGG9EC?FFGGG7F@E@EEFGF?=FFA?ABFFEEGGGGGGGFGGGGEGCCFGGGGGGGG+CC6F+;+ACFFFF7CCGGDEG7DFGG>F6E?FG*AFCEF>4G?CFGFG6BEC+:?7=CC78>?=CEGGFFFFGGGGGECFCC:>CDDGC<+:;ECGGGFGGGFGFDEC7GC<;-8*GGEDGGGFC*E87GGGBFCECGFFCGGFFFGFGGGGGCGFGFGGGGFGFGGDGGGGGGGGGGFGGFFGGFGGGGGGGGGGFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGG
+@CCTTGTCCGAGATGTCT|CONSCOUNT=1,1|SEQORIENT=F|PRIMER=Human-IGK,Human-IGKC-IGKJ-InternalC
+GTCAGTCTCAGTCAGGACACAGCATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCATCCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCGCTTGCCGGGCAAGTCAGAGCGTTANCAGCTCTGTAAATTGGTATCAGCTGAAGCCAGGGAANNCCCCTAANCTCCTGATCTATGCTGCATCCAGTTTGCACAGTGNCGTCCCGTCAAGGNTCAGTGGGAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTCTGTCACCAGACTTACAATCCCCCGCTCGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGAA
++
+GGGGGGGGGGGGFFGGCC@CGGGGGFGGGDFGDFGGGGGGGFDFCE?CCEFGFGGEGEGGEFGGGFGGGGGFF8CC:FFEGGGGFGGGFGFAFEFGGCGGAFGEEEGGGE9FFGF@EGC:FDG8EFGE@CEGFGGE93>8BEFA>7C,>9DFGADFCCGEDF>7;=?GGDC<84;E=*=CCGFCFDFECEC6<CC76C>1?GGF@58C=04+9=**G@E:=>=*?<,?,?,,EFFFGFFB<?,FCD>,?,FGF>>:11*<AGEGFGFFC@+3*FDBFD8GGFDFGGGGGFFFAEFF9GFGFFEF<GFCFFGFFGGEE?GEGGGGGGGGFEEA<GGGGGCFDGF<FGGGGFCF9GGGGGGGFEEFGFEFGGCFF:GGGFFC7GGGGFGGGGGGGGFFGFGGGGGGDFGGGGEFEE
+@TTAGCTACATGTAATTG|CONSCOUNT=1,1|SEQORIENT=F|PRIMER=Human-IGK,Human-IGKC-IGKJ-InternalC
+ACTGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCACTGGGTCCCAGGATGCAGTGGGGATGTTGTGATGACTCAGTATCCACTCTCACTGCCCGTCACCCTTGGGCAGACGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCNTCATATACAGTGATGNNANCAACTACTTGNGCTGGTTTNNNNNNNNNNNNNNNNNNNCTCCAANGCGNCTAATATATAANGTTTCTAACCNGGNCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGTACAGGCACGGATTTCACACTGAAAATCAGTAGGGTGGGGGCTGAGGATGTTGGCATTTATTACTGCATGCAAACTACACCCTGTCCTTACACTTCTGGCCAGGGGACCAAGCTCCAGATCAAACGAA
++
+GGGGFDCEFGGGGFDFGGGGGFFDFFEEE<EFGEC<FGF,FF,CFFGF@9EE9<8C<EGDCFGCEEECAB,:,,BF=E8<E@FB=B85,,BFDCCEFFCF=FBFFFD9,AEF=@F,44A8,9,C=FE@8FF@EE9,+4,,,A8++A+88@CFDED9=FFEGFGF4B@7EAGG5,@DF*@7,,@,,7:;C,53@**3(@ADE695=9@*7@CGGF8F###"##"####""######EFEC<5)+@,*,,AFC9DD=,3*,DC>173,>1*=3*AFB6++>GFFA,,C5BAF9FECDDF?,=<:,:?55E:+C=B7,,,FAGGGF?FGFE9CFAFFD8EFF@CGFF,DGFFFFFC9,,6,EFFFEE<C,,E9ECFE9C9E<FF@B68,F6<,<FEC@C9GFED;,,CFC,6<FFF<6,;C;,,FFGFBC9@@EFE
+@CTTGATAGGAATGAATA|CONSCOUNT=1,1|SEQORIENT=F|PRIMER=Human-IGLC-1-InternalC,Human-TRB
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ATTAGTTCATAAATTCC|CONSCOUNT=2,2|SEQORIENT=F|PRIMER=Human-IGK,Human-IGKC-IGKJ-InternalC
+NGGAACTGCTCAGTTAGGACCCAGAGGGAACCATGGAAGCNCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGAGACATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTATTAGCAGCTACTTAGGCTGGTACCAACAGAAACCTGGCCAGNCTCCCAGGCTCCTCATCNATGATGCANCCAATAGGGCCACTGGCANCCCAGCCANGTTCAGTGGCAGTGGGTCTGGGACANNCTTCACTCTCACCANCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGCGAGTGGCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAACGAA
++
+!ffflchRi[_bclkmm^eRYclc^`Qeilejlmaglcl]!`Rebll^ghbklglgm_blmilbcjhe[^jbRRhlj`km^d^lhYjiikmdlilmjcg`_X^OPRXjiihliiRRelmikkm]RellRabkki^^dQ`LUUOWPehdddkdefk[illkmkETNP^Qfh[idOFNIMLEdMfkk^hTIW[TNIPXBEEIHOLa[IIIHIHEFEIIAI!IIIIIlkbYdjeggibZ%R\jc]khf%fSff[Y\bil_jmhhiif!OcigRRg]%bR_illdjlcllc\QlgRee[_`R`!!Rgee_`RRlljQfl!mjlhRRReeckbcilkmlhRele_lmlmmlkjlilbjci_ml`]lfRkmmll^ili]i^_R\RmlfQmmkmml^Rfmmmmmmmimimmmmmmmmmmmmmml
+@CGCATATATCTGCAAAA|CONSCOUNT=1,1|SEQORIENT=F|PRIMER=Human-IGHA,Human-IGHA-InternalC
+GGAGAGAGGAGCCTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGATTCACCATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGNCTCTCNTGTNCAGCCTCTGGNTTNNCNTTCANTGACTATNNNANNANCNGGGNCCGCCAGGCTCCNGGGAAGGGGCTGGAGTGGGTCTCATNCATTGATNCTAGTAGAAGTTACATATACTATGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTGTATTACTGTTCTCGAGAATATAGCAGTGGCTGGCATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+GGFGGGCFGGGGGGGGGGGGGGGDFCFEGEFCEGGGGGGGGGGGFGGFCEAEFGGGGCEFFGGGGGGGGGGGGFFFGGFCGGGGG=FEGGGGDGECE7FFGGGEFGFGGGGGGGFGGCGFFGGGFGGFGGGG9,8>=DCC@D8,>8+6D>EFGC6BCCEDEGC5:ECGDGFFFFGG555:CCCF6E7*2:=+0*?4:*:>GFFFGCCC*27**2*20<7*0+2++37***9**A*:*98C(25FF:??@?771%F?CGF>;ECEGFE>B>C3?@:9EF=*:@GFD>:*@:CFC<+E7FA+FGFGF9C7FFC=?FGCC7CGFC:F5DGGGGFGGCFGGFD66DCD;FGGGGGGGGGGGGFGGCGFFDFAFFCF;;GGGGGFFDGGGGGGGGGGDGGFGGGFEEGGGGGGGGGGGGGGGGGGEDGGGGEGFFGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF?GGFEGEGGDGGGGGGGGGGGGGGGGGGGGGGGG
+@CGATGTAATCTTAGCTG|CONSCOUNT=1,1|SEQORIENT=F|PRIMER=Human-IGL,Human-IGLC-2-InternalC
+GAGCCTCAGCAGAGCTCTGGGGAGTCTGCACCATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGGTCTCTCTCCCAGCTTGTGGTGACTCACTCGCCCTCTGATTCTGCCTCCCTGGGAGCCTCGGTCAAGTTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGANAAGGGCCCTCGCTACTTGATGACGGTTAAGAGTGATGGCAGCCACATCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGANCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+EGGEGGGFCFGGGGGFGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGFGGA<FFGGGGGEFGGGGGGGFGDGGGGGCGGEEFF@FGFGFFGGDGGGGGEGEED5FDFF,?FD7F@F:E?FEF;FEFGFGGGGGDCDEGCGDEG8FFDE9@DFG9=BGCCF8D;ACF7@D77DGF8/:DCD>:@CEE>EG76F><C6C>7C>FGGEDF>6DG>A%CGEGEGEC7CFCGGGEEC79ECCGFC<D4C-GF?FCFDEF=C;?CFC6GGECGGGFGFGGEGC,GF@F1<CFFCGGGFGFGGGFCF>GGGGGGFF<7F*CGGFECFCFCFEFCF<GGGGGGFCGGGGF=9FFGGGGFCGF=99GGGGFFGGDFGGGGGGGCFEGGGGGGGF8GDGGGGGGGGGGGGGDGFGFGFGGGGGGGGGGGCF,GGGGGGGDGFGGGGGGGGGGDGGGG
+@ACTCGTGCTAATCCTTC|CONSCOUNT=1,1|SEQORIENT=F|PRIMER=Human-IGL,Human-IGLC-2-InternalC
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_parseheaders_test_table_out.tsv	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,11 @@
+PRCONS	PRIMER
+Human-IGL	Human-IGLC-2-InternalC
+Human-IGK	Human-IGKC-IGKJ-InternalC
+Human-IGL	Human-IGLC-2-InternalC
+Human-IGK	Human-IGKC-IGKJ-InternalC
+Human-IGK	Human-IGKC-IGKJ-InternalC
+Human-TRB	Human-IGLC-1-InternalC
+Human-IGK	Human-IGKC-IGKJ-InternalC
+Human-IGHA	Human-IGHA-InternalC
+Human-IGL	Human-IGLC-2-InternalC
+Human-IGL	Human-IGLC-2-InternalC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_parselog_test_in.txt	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+     ID> M01873:M01873:000000000-B9G3J:1:2116:20980:12498
+    SEQ> GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
+QUALITY> 33.166666666666664
+
+     ID> M01873:M01873:000000000-B9G3J:1:2103:2227:11139
+    SEQ> GGGTGCTGCAGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCAGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGAAGTCAAACTCCGCCACCTCCGTTGTAGCTCCCACTACAGTCGTCGTATCCCTCGCACAGTAATAAACAGCCGTGTCCTCTGCTGTCAGGCCGTTCATTTGCAGATAAAGTGAATTCTTGGCGTTGTCTCTGGAGATGCTGAATCGGAACTTCACAGAATCTGCATAGTACTCGGTTGTTCAATTTCTTCTATTGTCTTAAACCCACTCCAGCCCCT
+QUALITY> 23.87
+
+     ID> M01873:M01873:000000000-B9G3J:1:2110:13535:17883
+    SEQ> GACAGATGGTGCAGCCACAGTTCGCTTGATCTCCACCTTGGTCCCCCCGCCGAAAGTACACCAGTCGCTACGTTGCTGACAGAAATAAACTGCAAAATCTTCAGGCTCTAGGCTGTCGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGACGCCAGTGGCCCTGTTGGACGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGGCTAAGTAGGTACCAACATCCTGGCTGGCCCTGCAGGAGAGGGTGGCCCTTTCCCCTGG
+QUALITY> 34.693333333333335
+
+     ID> M01873:M01873:000000000-B9G3J:1:1115:18550:17263
+    SEQ> GGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGTAGATCTCCGCTATCCAAAGACCAGACCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAACGACCAGACTAAGATCGTTAAAAGAAAATGAGTTGATACAGTAGAGCACAGAAGAGTACAAGCACGTGA
+QUALITY> 24.28
+
+     ID> M01873:M01873:000000000-B9G3J:1:1101:10006:14034
+    SEQ> CGACCTCGGGTGGGAACACCTTGTTCAGGTCCTCTAGGATGGAGAGTCGAGTCCCATCACCAAAATGCTGGGGCTGATTGCTACACAGTGCATCATGAGTGTCCCCGTATCGAACAAAGCCATAGAAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAATAAGCGAAAGACTGCACGCACTGCACTCGAACAACCAGACATTGATCAAAACAGACACAATAAGGTTAATCATTCTCAATCTAAGCGAACATTCG
+QUALITY> 25.906666666666666
+
+     ID> M01873:M01873:000000000-B9G3J:1:1117:17250:9432
+    SEQ> AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCCAAGTGCCAGCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGTGCTCAGCCCCAGAGGTGGAGCCAGAGAAGCGATCAGGGATCCCGTCCCCCTTGCTGTGACTGCCATCACTGTTAACCTTCATCAGATACCGAGGGCCCTTCTGTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCCCACTGC
+QUALITY> 35.35666666666667
+
+     ID> M01873:M01873:000000000-B9G3J:1:2108:14465:19705
+    SEQ> CGACCTCGGGTGGGAACACGTTTTTCAGGTCCTCTAGCACGGTGAGCCGTGTCCCTGGCCCGAAGAACTGCTCATTGGCCCCTAATGAGCTGGCGCAGAAATATACAGATGTCTGGGAGGAGGCAGCAGACTCCAGAGTGAGGGGGAGGTCCTCTGTGTTTGATCTAGAGACACTGTAGCCATCTGAGACTTCTCCTTTGTTAGTGTCTTGAACACCATATGAGTAATGGATCAGCCTCAGCCCATGTCCCAGGTCTTGTCGATACCAGAACATATTGTTGTGGTTCCAAGTCTGGTGAC
+QUALITY> 36.166666666666664
+
+     ID> M01873:M01873:000000000-B9G3J:1:2111:3554:13238
+    SEQ> GACAGATGGTGCAGCCACAGTTCGTTTGATCTGGAGCTTGGTCCCCTGGCCAGAAGTGTAAGGACAGGGTGTAGTTTGCATGCAGTAATAAATGCCAACATCCTCAGCCCCCACCCTACTGATTTTCAGTGTGAAATCCGTGCCTGTACCACTGCCGCTGAATCTGTCTGGGACCCCAGAGACCAGGTTAGAAACTTTATATATTAGGCGCGTTGGAGATTGGCATGGCCTCTTCTGAAACCAGATCAAGTAGATGTTGACATCACTGTATATGAGGCTTAGAATCGTACTGCGGGAGGT
+QUALITY> 21.26
+
+     ID> M01873:M01873:000000000-B9G3J:1:1112:28236:12457
+    SEQ> CACGGCAGGGTCAGGGTTCTGGATATCAGGTAAAACAGTCAATTGTGTCCCAGATCCAAAGGTCAGTTGCCTTGCAGAACCAGAGTAGAGAGTTCACCACACAGAGGTAGGTGGCTGAATCACTGAGCTTGGAGTCTCTGATGAGCAGGGAAATATACTGGCCGGCTCTATTGAGCTGTGCTGTAAACCTTCCATCTTCATTACCACTGGAGTATACGGACATCAGCAACTTAGGTTCTTTCCTGCAATCCTGTCTGTACCAGAAGAAAGACTGAGAAGCACTGTTGCTGTAAGTACAGT
+QUALITY> 36.72
+
+     ID> M01873:M01873:000000000-B9G3J:1:1119:21261:11479
+    SEQ> CGACCTCGGGTGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACTTAGGACGGTGACCCTGGTCCCAGTTCCGAAGACCACAGTGCTGCTGTCCCACACCTGACAGGAATAGTCAGCCTCATCCCCGGCTTGGGCTCTGCTGATAATCAGGGTGGCCGTGTTCCCCGAGTTGGAGCCAGAGAATCGGTCAGGGATCCCAGAGGGCCGGTGGATATCCCTATAGATGATCAGCACAGGGGCCTGGCCTGGCTTCTGCTGGAACCAGTACACACTTTTACTTCCAATGTTGTTTCCCC
+QUALITY> 37.026666666666664
+
+     ID> M01873:M01873:000000000-B9G3J:1:1106:23126:20933
+    SEQ> CGACCTCGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAACTTGGTCCCTCCGCCGAAGACCGAACCACTCAGCCTAAAGTCGTAAGACTGGCAGTAATATAGAGCCTCATCGTCAGGCTGGAGTCCAGTGATGGCCAGGGAGGCTGAGGTGCCAGATTTGGAGGCAGAGAATCGGTCAGGAACTCCTGAGGGCCGATCGTCCTTAGTATGGATGAGGACGTTGGGGGCTGTTCCTGGAACGTGTTGGTACCAGACAATTTCATAACCTGCCCCGATGT
+QUALITY> 26.183333333333334
+
+     ID> M01873:M01873:000000000-B9G3J:1:2111:10779:3698
+    SEQ> AGGGGGGGAACACGGTTTTCCCGTCGTCGAACACTGACAGGCGGGAGCCCGGGCCAACCTACCCCGTATCTGTGACCCCTGGCCCCCGTATACCACTGGCCCCGAGGTAGTAAGCTGTCGGGTTCTCTTGGCCCGATGTCACAGTTAGCGGATACAGTGCCTTCTTGTCCCTATCGATGCTGTAGCTGTCTGCTATATCTACATACTGAAAGTCATTTACTATCTGTCAGTAGTAACTAAATCTCAGACCCTGCCCCGGGCCCTTTCGGTACCAGTGCATGGCCCCGTGTTTCTAATTCT
+QUALITY> 12.566666666666666
+
+     ID> M01873:M01873:000000000-B9G3J:1:2112:20595:25092
+    SEQ> AGGGCGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACCTAGGACGGTGACCGTGGTCCCAGTTCCGAAGACCCAATAATCACTGGCACTATCCCACACCTGACAGTAATAGTCGGCCTCATCCCCGGCTTCGACCCCGCTGATGGTCAGGGTGGCCGTGTTCCCAGAGTTGGAGCCAGAGAAGCGCTCAGGGATCACTGAGGGCCGGTCTCTATCATAATACATGACCAAAACAGGGGCCGGGCCTGGCGTCTGTTTGTACCAGTGGCCACCCTTTATTCCAATGTTGGCTGCGC
+QUALITY> 26.416666666666668
+
+     ID> M01873:M01873:000000000-B9G3J:1:1112:18419:7621
+    SEQ> CGACCTGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTGCCCCACAGGCTCCGCAGGCTGGATCGGCTGCTTCCAACTGAGGCTCCAGGGTCTGGGTCCCCGCTTTGCGGTGCAACCATTGGGCGCAGCAGGCCATGGGCGACCATGGCCAGACCCAGCAGCAGCAGGGGCCAGCGCTGCCTGGGACCAGGGCCCAGCTCCTCAGGGGTCTCACAACCCACTTGGCCTGTCTTGGGTCTCATTGGCCTTCAGGTTCAGGGGCACCTCTGGCCCGACTTGCAGCATGGGC
+QUALITY> 33.31666666666667
+
+     ID> M01873:M01873:000000000-B9G3J:1:1101:10014:22200
+    SEQ> CCAGGGGGAAGACCGATGGGCCCTTGGTGGAAGCGAGGTGGGGGTCTCAGCCCTTCCTGTTGTGGCGAGGTACATGTGGGCAGCCTTGCCCACGCTGTCAGCTGCCATTTGTCTTCCTAGGAAATCACAGCTCGGCCCCCAGGTCCCCAGGGTTGTGAACTCCACGCTGCAAACACTAAGAACAGGATTGAAACTCCCCGTATCGGCTTCCAGTAGGAACAGATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+QUALITY> 23.25
+
+     ID> M01873:M01873:000000000-B9G3J:1:1109:19388:16328
+    SEQ> AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAACCATTCAGGCTGTCATCCCATGTAGCACAGTAATAATCAGCCTCATCCTCAGACTGGAGCCCACTGATGGCCAGGGAGGCTGAGGTGCCAGACTTGGAGCCAGAGAATCGGTCAGGGACCCCTGAGGGCCGCTGAGTATTGCTATGGATGAGGAGCTTGGGGGCCGTTCCGGGGAGTTGCTGGTACCAGTTTACATTATTACTTCCGATGTTGGAGCTGC
+QUALITY> 33.88333333333333
+
+     ID> M01873:M01873:000000000-B9G3J:1:1111:16537:24486
+    SEQ> GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGCGAGCGGGGGATTGTAAGTCTGGTGACAGAAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAATCTGTCCCAGATCCACTCCCACTGAACCTTGACGGGACGCCACTGTGCAAACTGGATGCAGCATAGATCAGGAGCTTAGGGGATTTCCCTGGCTTCAGCTGATACCAATTTACAGAGCTGATACAGCTCTGGTTTGCCCGGCAAGCGATGGACAATATGGCTAC
+QUALITY> 30.52
+
+     ID> M01873:M01873:000000000-B9G3J:1:1110:23072:9989
+    SEQ> GACAGAGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCCACGGAGAACTATAATATTGGTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACGCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAAATGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGGAGTTCTCATTGTTGGATCTGTATAAAACACTCTGGCTGGACTTGCAGTTT
+QUALITY> 35.79666666666667
+
+     ID> M01873:M01873:000000000-B9G3J:1:1101:10019:8146
+    SEQ> GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCATTGTCCCTTGGCCCCACATATCAAAAGCATGCCAGCCACTGCTATATTCTCGAGAACAGTAATACACAGCCGTGTCGTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCCTTCACTGAGTCTGCATAGTATATGTAACTTCTACTAGCATCAATGGATGAGACCCACTCCAGCCCCTTCCCTGGAGCCTGGCGGG
+QUALITY> 34.70666666666666
+
+     ID> M01873:M01873:000000000-B9G3J:1:2101:11039:4739
+    SEQ> GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCCTGGTCCCTCCGCCGAAAGTGAGAGGCCACTCGCTACGGTGCTGACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCTGGGATGCCAGTGGCCCTATTGGATGCATCATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCTGTTGGTACCAGCC
+QUALITY> 37.22357723577236
+
+     ID> M01873:M01873:000000000-B9G3J:1:2104:24954:20771
+    SEQ> AGGGCGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAACACCCAATGCCAGTGCCCCAGGTCTGACAGTAATAGTCAGCCTCATCCTCAGACTGGAGGCTGGAGATGGTGAGGTAGCGCTCAGCCCCAGAGCTGGAGCCTGAGAAGCGATCAGGGATCCCGTCCCCCTTGATGTGGCTGCCATCACTCTTAACCGTCATCAAGTAGCGAGGGCCCTTCTCTGGCTGCTGCTGATGCCATGCGATGGCGTAGCTGCTGTGCTCACT
+QUALITY> 33.943333333333335
+
+     ID> M01873:M01873:000000000-B9G3J:1:1111:12286:7157
+    SEQ> CACGGCAGGGTCAGGGTTCTGGATATAGGACTTGACTCTCAGAATGGTTCCTGCGCCAAAGACCAGTTTGTTTCCATGCCCATCGGGGCTTGCTGCACAGAAGTAGACAGCCGAGTCTTCAGGTTGGGTCTCTGTGATGTGCAGGGAGAAATGTTTGGCTGTCTTGTTCAATGTAACAGCAATTCGTTGGTCTTTCTTTTCGCCCACATTTGAACGAATGTCTATAATAAGCTGAGGTCTTTTTCCAAGTTCTTGCTTATACCAAGGGAAGTAGTTTGAGGCACTGTCTGAATAAGTACA
+QUALITY> 36.916666666666664
+
+     ID> M01873:M01873:000000000-B9G3J:1:2116:17140:9378
+    SEQ> GGGTGCTGTCGAGGCTCAGCGGGAAGACCTTGGGGCTGGTCGGGGATGCTGAAGAGACGGTGACCACTGTCCCTTGGCCCCAGACATCAAAAGCAGGAGTGCGACCTGCTATAAAAGCCTCCTTCGCACAGAAATATACAGCCGTGTCTTCAGGTCTCAGGCTGTTCATTTCCAGAAACAGTGTGTTCTTGGAATTGTCTCTGGAGAGGGTGAACCGGCCCTTCACGGAGTCTCCGAAGGATTTGTAACTTCCATCATAGAAGATAACTGACACCCAGTCCCGCCCCTTCCTTGGACCTG
+QUALITY> 31.756666666666668
+
+     ID> M01873:M01873:000000000-B9G3J:1:2105:17710:2946
+    SEQ> TGTCTGCACCCTGGCCCCTCCGCCGAAAGTGAAAGGTGAGCTACCATACTGCTGACAGTAATACACTGCAAAATCTTCAGGCTCCAGTCTGCTGATGGTGAGAGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGTCTGGGATGCCAGTGGCCCTGCTGGATGCAGCAAAGATGAGGAGCCTGGGAGCCTGGCCAGGTTCCTGCTGGTACCAGGCTAAGCCGCTGCTGCTAACACTCTGACTGGCCCTGCAGGAGCGGGTGGCGCTTTGCCCTGGATACAACGACATGAGCACTGG
+QUALITY> 27.796666666666667
+
+     ID> M01873:M01873:000000000-B9G3J:1:2106:21507:14943
+    SEQ> CGACCTCGGGTGGGAACAGAGTGACCGAGGGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACTCCGAAAGTGTAGCTGCCTGCATATGAGAAGCAGTAATAATCAGCCTCATCTTCAGCCT
+QUALITY> 37.737588652482266
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_parselog_test_out.txt	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,26 @@
+ID	QUALITY
+M01873:M01873:000000000-B9G3J:1:2116:20980:12498	33.166666666666664
+M01873:M01873:000000000-B9G3J:1:2103:2227:11139	23.87
+M01873:M01873:000000000-B9G3J:1:2110:13535:17883	34.693333333333335
+M01873:M01873:000000000-B9G3J:1:1115:18550:17263	24.28
+M01873:M01873:000000000-B9G3J:1:1101:10006:14034	25.906666666666666
+M01873:M01873:000000000-B9G3J:1:1117:17250:9432	35.35666666666667
+M01873:M01873:000000000-B9G3J:1:2108:14465:19705	36.166666666666664
+M01873:M01873:000000000-B9G3J:1:2111:3554:13238	21.26
+M01873:M01873:000000000-B9G3J:1:1112:28236:12457	36.72
+M01873:M01873:000000000-B9G3J:1:1119:21261:11479	37.026666666666664
+M01873:M01873:000000000-B9G3J:1:1106:23126:20933	26.183333333333334
+M01873:M01873:000000000-B9G3J:1:2111:10779:3698	12.566666666666666
+M01873:M01873:000000000-B9G3J:1:2112:20595:25092	26.416666666666668
+M01873:M01873:000000000-B9G3J:1:1112:18419:7621	33.31666666666667
+M01873:M01873:000000000-B9G3J:1:1101:10014:22200	23.25
+M01873:M01873:000000000-B9G3J:1:1109:19388:16328	33.88333333333333
+M01873:M01873:000000000-B9G3J:1:1111:16537:24486	30.52
+M01873:M01873:000000000-B9G3J:1:1110:23072:9989	35.79666666666667
+M01873:M01873:000000000-B9G3J:1:1101:10019:8146	34.70666666666666
+M01873:M01873:000000000-B9G3J:1:2101:11039:4739	37.22357723577236
+M01873:M01873:000000000-B9G3J:1:2104:24954:20771	33.943333333333335
+M01873:M01873:000000000-B9G3J:1:1111:12286:7157	36.916666666666664
+M01873:M01873:000000000-B9G3J:1:2116:17140:9378	31.756666666666668
+M01873:M01873:000000000-B9G3J:1:2105:17710:2946	27.796666666666667
+M01873:M01873:000000000-B9G3J:1:2106:21507:14943	37.737588652482266
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_splitseq_partition_test_in.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,52 @@
+@ATCTTTGCGGCTGGTTA|PRCONS=Human-IGK|SEQORIENT=F|CREGION=Human-IGKC-IGKJ-InternalC|DUPCOUNT=1,1|CONSCOUNT=1
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@CTTGATAGGAATGAATA|PRCONS=Human-TRB|SEQORIENT=F|CREGION=Human-IGLC-1-InternalC|DUPCOUNT=1,1|CONSCOUNT=1
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ACTCGTGCTAATCCTTC|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=1
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ACCAAAAGTTTACACTC|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=2
+CTCACTGCACAGGGTCCTGGGCCCAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCACTGGGACCAGATCCAACATCGGGGGAGGTTATGATGTACACTGGTACCAGCAACTTCCAGGAACAGCCCCCAAACTCCTCGTCTATGGTAACATCCATCGGCCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCACTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTTATGTGGTTTTCGGCGGAGGGACCAAGTTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+kklmmlmmmmmlmjmmmlilmbj]lkklmmmklglallmmmjlmmmmlmlfllllmmlm]`flmkmmmmmmmmmmfckelljbklmm^l\ljmm^_R^h^aimmiik[gkhiglmklmkmiflklmlilj\cifhkllmmjeEXd^i`RblhVcfjlikkli`imjklkmliiled_fkllh_idkebi[a^Wlilcdeh^fmmmmlimmmlmmmmmldlglihmmllkmmmmmmmmmmmjmljmmmlgkYRkjbmmjilml]mmmljmilleRliillmllmmlkllQlbmlmlmmmljmlmmmmmlhlmmmmklkgllmmmmlklmmmmkllimmlijmmliRilmimkkflmmmlmmlmmmmmlmmmljmkfQfQiklmm
+@TCTTGATGAAGTATAAC|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=2
+AGCTGTGGGCTCAGAAGCAGAGTTCTGGGGTGTCTCCACCATGGCCTGGACCCCTCTCTGGCTCACTCTCCTCACTCTTTGCATAGGTTCTGTTATTTCTTCTGAGCTGACTCAGGACCCTGCTATGTCTGTGGCCCTGGGACAGACAGTCAGGATCACATGCCAAGGAGAGAGCCTCGGAAGCTATCATGCAAGCTGGTACCAACAGAGGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAAAACAACCGGCCCCCAGGGATCCCCGCCCGATTCTCTGGCTCCAGCTCAGGAAACACAGCTTCCTTGACCATCGCTGGGGCTCAGGCGGAAGATGAGGCTGTCTATTACTGTAACTCCGGGGACAACGGTGGTAACCTTTGGGTGTTCGGCGGAGGGACCAAGGTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+ikmmmmfmmmlmmmmmkmimkmmmmmlfkkmmmmmmmmmmml_kmmmmikmjllmmmmmlkmmmmmmmmmmmi_jhljmml^kkikmlkjmiklglllmmmmmlmlmm^kkmmmhllljilmmmilklml[lkkeCdQ]d]hj^jlRc]j_j^cj^jj]f^jhkiikHXR\R[S[Wg^g\XIJfehfNfl]aZkg`gklgi\^ahjd__OLX^glmi`[VYageGQ]mlcbQPlh]_l^OTYmlmkeWigW^iki`mimkiimmlmmkhjkikj`eiemmmmmfj^ljmmmlililfljlbdiZmjmmmlmmmmljlmmlmmmllkmlmmmmkmmmmimmmmmmlmmkmllmmlmmmmjmkdjmmmlmlfmmmmmmmmmmmmmmmmmmmmmmmlmmmlmlllmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmkmm
+@CTATTTTAATCATAATG|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=2
+GGGGCCTCAGGAAGCAGCATCGGAGGTGCCTCAGCCATGGCATGGATCCCTCTCTTCCTCGGCGTCCTTGCTTACTGCACAGGATCCGTGGCCTCCTATGCCTTAACTCAGGCACCCTCAGTGTCCGTGTCCCCAGGACAGACAGCCACCATCACCTGCTCTGGATATAAATTGGGGGATAAATATGTTTGCTGGTATCAACAGAGGCCAGGGCAGTCCCCTGTGTTGGTCATCTCTCAAGATGATAAACGGGCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACTCTGGGAACACAGCCACTCTGACCATCAGCGGGACCCAGGCTGTGGATGAGGCTGACTATTACTGTCAGGCGAAGGACAGCAACACTGTGATATTCGGCGGAGGGACCAAACTGACCGTCCTAAGTCAGCCCAAGGCTGCCCCCTCG
++
+immmmmmmmmmmmimmlllmmYYk3@elhilmmmllmmmlmmmmmmmmmmmmmilmmmmlkjmkkllmmmmmllmllmmmmi`ilmmjkkiiiilfiJfc_lmmmmmlhl[O]^Pfkcilileb`i^`fgikmlX`kXhbhULZ`ilmmmmlllmmkil[bifllkleldcYUik\bclmhefhZkkibjiiihPlcckkc^l^hih_cmljjhV[mmmhkeWjghhhlkejifll_]kimila[jmkikmmmkkfkWjikhflmmmmmmmmmmmilkmmmmmlmlilc]lmlmmmmmijl\jmmlmlmmmmmmklmmmlmlilkmmmmmlllgllmmmmmmmlkmmljmmjl^mmmmmmmmmmmmmmimmmmmmmmmmmmmmmmmmmmmmmmmmmlmmmmmmmmmmmmmmmmmmmmmlmmmmmmgmmmlmmmmm
+@TAGCAACTTTTTGTGAT|PRCONS=Human-IGHA|SEQORIENT=F|CREGION=Human-IGHA-InternalC|DUPCOUNT=1,1|CONSCOUNT=3
+GATAACAACCAGATTCCTCCTCTAAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCACCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGCCTTGAGTGGATGGGAAGGATCGTCCCTATCCTTGGTATAGCAGACTACGCACAGAACTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACAAACACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTATTGTGCGAGATATTACTATGATGGTAGTGGGCAAGGAAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{o{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{u{{{x{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{x{{{{{{{{{{{{{z{{{{{{{{{{{{{{{{{{{{{{{{{v{{{{{{{{{{{{{{{{{{{{y{y{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{x{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{
+@CGATAAGCACTTAATTA|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=3
+GAGCTGGGAAGCCTGAGAACACTTAGCCTTCATGAGTGTCCCCACCATGGCCTGCATGATGCTTCTCCTCGGACTCCTTGCTTATGGACCAGGAGTGGATTCTCAGACCGTGGTGACCCAGGAGTCATCGTTCTCAGTGTCCCCTGGAGGGACAGTCACGCTCACTTGTGGCTTGAACTCTGCTTCAGTCTCGACTGATCGGCGCCCCAGCTGGTACCGGCAGACCCCAGGCCAGGCTCCACGCACCCTCATCTACAACACAAACACTCGCTTTTCCGGGGTCCCTGATCGCTTCTCTGGCTCCATCCTTGGGAACAAAGCTGCCCTCACCATCACGGGGGCCCAGGCAGATGATGAATCTATTTACTACTGTGTTCTCTCTGTGCGTAGTGGCTTTTGGGTGTTCGGCGGAGGGACCAGGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{w{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{uwv{{v{{{{{{{{{{{{{{{{{{{{{{{{auwyvqyBx{{{{{{{{{{{{{by{{]cz{n{{{{{{{{{{{{{{{h{{{{{{{x{{Ps{{mzjxcwlgkomzY{m{{`jfj^]lk\\e_Ynnomflo{{_{{{{{{{{{k{{{{{v{{{y^Wq{p{{{u{{{{p{{{{t{{{{{{{b{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{xvV{{{{xx{{{{{{{{{{{{{{{{{{{{{{c{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{
+@ATGCCTTATGGTTTAAA|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=3
+AAAAACAGAGCTTCAGCAAACATAGTGGGAATCTGCACCATGCCCTGGGCTCTGCTCCTCCTGACCCTCCTCACTCACTCTGCAGTGTCAGTGGTCCAGGCAGGGCTGACTCAGCCACCCTCGGTGTCCAAGGGCTTGAGACAGACCGCCACACTCACCTGCACTGGGAACAGCAACAATGTTGGCGACCAAGGAGCAGCTTGGCTACAGCAGCACCAGGGCCACCCTCCCAAACTCCTGTTCTACAGGAGTAACATCCGGCCCTCTGGGACCTCAGAGAGACTATCTACATCCAGGTCAGGAAACACAGCCTCCCTGACCATTAGTGGACTCCAGCCTGAGGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAATGCTCAGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{w{{{{{{{{{{{{{x{{{{{{{{{u{{{{w{u{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{Z{{{{{{{{{{{{{{{{{{{{{{{{{{x{wx{{{v{`ii{i{n{t{Yq{{s{t{{mZg{{{stOjk{jm8Gpf{geRS[gWGNESPik9GF?G1CA>JCDJGKBKFJ>4;CJHG>7<YeCe]X@P{{uGBg>v{bjvgy{{{n{umir{{_+;^UZr{{{y{{{b{{{{{{uobih{{{{{{{{{{{{{{p{{{{{{c{{{{{yx{{{u{{{{{{{{{{{x{{t{m{{{{{{{{{{{{{{{{{{{{{{{{{{{xw{p{{{{{{{{{{{{{{{{{{{{{{{{{{{{{a{xw{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{x{{{{{{{{{{{{{{{{{
+@GGGCAATCTTATCAAAT|PRCONS=Human-TRA|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=4,1|CONSCOUNT=4
+ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGGCCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACTGCCTGCTGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFEGCGGGGGGGGGGGGGGGGGGGG@GDGGGGGGGGGGGGGGGGGGGGGGGGGAFGGGGGGGGEGGGGGGGGGGGGGGGGGGGFGGGFFGGDFGGGGGGGGGGGFFGFFFGGGGGGGGGGEGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGFGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGEGGGGGEGGGGGGGGGEGGGGAEGGEGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFEGG
+@GGTGCTTGTGCTGATCG|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-1-InternalC|DUPCOUNT=3,1|CONSCOUNT=4
+GAGTTGAGCCCTGGATTGTGACTGCTTCAGGGCAGTTGGTAGATGCCCCTCTGGGAGAGATCCCCAGGGGTGACAGCCATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGTCCCAGGCAGCGCTGGCCCCTGCTGCTGCTGGGTCTGGCCATGGTCGCCCATGGCCTGCTGCGCCCAATGGTTGCACCGCAAAGCGGGGACCCAGACCCTGGAGCCTCAGTTGGAAGCAGCCGATCCAGCCTGCGGAGCCTGTGGGGCAGGTCAGCCCAAGGCCAACCCCACT
++
+mmmmmlmllmmmmmmmmmmmmmmmmmmmmmmmliljkmmmmmlmimllmmmmmmmlmmmlmmmlmmmmjmmmlmmmmmmmmmmmmmmllmldflllimmlmlklillmmmlmmmmlmljlmmmimmllmhljmmmmmmmmlmmlhmmmmmjljmlmmmmmmmmmkmmlmlmmlmmmllmmmmmjmmmimmmmmmmlmlmmmmmmmmmmmmmlmmmmmmmmmmjmmljjlikmmmmmmjmmmmimimlmmmmmmmmmmmmmmmmmllimmmmmmmjlmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmkmmmmmmmmmmmmlmmmmmmmmmmmmmmmmmmmlmmmlmmmmm
+@GTTGAATGCAGAATGTT|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-1-InternalC|DUPCOUNT=4,1|CONSCOUNT=4
+GGACTGCTTCAGGGCAGTTGGTAGATGCCCCTCTGGGAGAGATCCCCAGGGGTGACAGCCATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGTCCCAGGCAGCGCTGGCCCCTGCTGCTGCTGGGTCTGGCCATGGTCGCCCATGGCCTGCTGCGCCCAATGGTTGCACCGCAAAGCGGGGACCCAGACCCTGGAGCCTCAGTTGGAAGCAGCCGATCCAGCCTGCGGAGCCTGTGGGGCAGGTCAGCCCAAGGCCAACCCCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGFC<FGGFFGFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGEGGGGGGFCGGGGGEGGGGGGGGGGGGGEGGGGGGGEGGGEGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ACACGTATATTAAAGGG|PRCONS=Human-IGK|SEQORIENT=F|CREGION=Human-IGKC-IGKJ-InternalC|DUPCOUNT=5,1|CONSCOUNT=5
+GGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCTCTGGATCCAGTGGGGATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCCTGCATAGTAATGGATACAACTATTTGGATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATTTGGGTTCTAATCGGGCCTCCGGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGFGGGGGGFGGGGGGGGGGCF8FGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGFFFGFFGFCGFFFGGGFFGGFGGGGGGGFGGGGGFGFGGGFGFGFGGGGGGGFFGGGGGGGGGGGFGGGGGGGGGFGGGGGGGGGGCGGGGGGGG@GGGGG9GGGGGGGGFGGGGGGGGGGGGGDGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFF,GGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_splitseq_partition_test_out_atleast.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,28 @@
+@TAGCAACTTTTTGTGAT|PRCONS=Human-IGHA|SEQORIENT=F|CREGION=Human-IGHA-InternalC|DUPCOUNT=1,1|CONSCOUNT=3
+GATAACAACCAGATTCCTCCTCTAAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCACCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGCCTTGAGTGGATGGGAAGGATCGTCCCTATCCTTGGTATAGCAGACTACGCACAGAACTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACAAACACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTATTGTGCGAGATATTACTATGATGGTAGTGGGCAAGGAAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGCATCCCCGACCAGCCCCAAGGTCTTCCCG
++
+{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{o{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{u{{{x{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{x{{{{{{{{{{{{{z{{{{{{{{{{{{{{{{{{{{{{{{{v{{{{{{{{{{{{{{{{{{{{y{y{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{x{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{
+@CGATAAGCACTTAATTA|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=3
+GAGCTGGGAAGCCTGAGAACACTTAGCCTTCATGAGTGTCCCCACCATGGCCTGCATGATGCTTCTCCTCGGACTCCTTGCTTATGGACCAGGAGTGGATTCTCAGACCGTGGTGACCCAGGAGTCATCGTTCTCAGTGTCCCCTGGAGGGACAGTCACGCTCACTTGTGGCTTGAACTCTGCTTCAGTCTCGACTGATCGGCGCCCCAGCTGGTACCGGCAGACCCCAGGCCAGGCTCCACGCACCCTCATCTACAACACAAACACTCGCTTTTCCGGGGTCCCTGATCGCTTCTCTGGCTCCATCCTTGGGAACAAAGCTGCCCTCACCATCACGGGGGCCCAGGCAGATGATGAATCTATTTACTACTGTGTTCTCTCTGTGCGTAGTGGCTTTTGGGTGTTCGGCGGAGGGACCAGGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{w{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{uwv{{v{{{{{{{{{{{{{{{{{{{{{{{{auwyvqyBx{{{{{{{{{{{{{by{{]cz{n{{{{{{{{{{{{{{{h{{{{{{{x{{Ps{{mzjxcwlgkomzY{m{{`jfj^]lk\\e_Ynnomflo{{_{{{{{{{{{k{{{{{v{{{y^Wq{p{{{u{{{{p{{{{t{{{{{{{b{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{xvV{{{{xx{{{{{{{{{{{{{{{{{{{{{{c{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{
+@ATGCCTTATGGTTTAAA|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=3
+AAAAACAGAGCTTCAGCAAACATAGTGGGAATCTGCACCATGCCCTGGGCTCTGCTCCTCCTGACCCTCCTCACTCACTCTGCAGTGTCAGTGGTCCAGGCAGGGCTGACTCAGCCACCCTCGGTGTCCAAGGGCTTGAGACAGACCGCCACACTCACCTGCACTGGGAACAGCAACAATGTTGGCGACCAAGGAGCAGCTTGGCTACAGCAGCACCAGGGCCACCCTCCCAAACTCCTGTTCTACAGGAGTAACATCCGGCCCTCTGGGACCTCAGAGAGACTATCTACATCCAGGTCAGGAAACACAGCCTCCCTGACCATTAGTGGACTCCAGCCTGAGGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAATGCTCAGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{w{{{{{{{{{{{{{x{{{{{{{{{u{{{{w{u{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{Z{{{{{{{{{{{{{{{{{{{{{{{{{{x{wx{{{v{`ii{i{n{t{Yq{{s{t{{mZg{{{stOjk{jm8Gpf{geRS[gWGNESPik9GF?G1CA>JCDJGKBKFJ>4;CJHG>7<YeCe]X@P{{uGBg>v{bjvgy{{{n{umir{{_+;^UZr{{{y{{{b{{{{{{uobih{{{{{{{{{{{{{{p{{{{{{c{{{{{yx{{{u{{{{{{{{{{{x{{t{m{{{{{{{{{{{{{{{{{{{{{{{{{{{xw{p{{{{{{{{{{{{{{{{{{{{{{{{{{{{{a{xw{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{x{{{{{{{{{{{{{{{{{
+@GGGCAATCTTATCAAAT|PRCONS=Human-TRA|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=4,1|CONSCOUNT=4
+ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGGCCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACTGCCTGCTGG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFEGCGGGGGGGGGGGGGGGGGGGG@GDGGGGGGGGGGGGGGGGGGGGGGGGGAFGGGGGGGGEGGGGGGGGGGGGGGGGGGGFGGGFFGGDFGGGGGGGGGGGFFGFFFGGGGGGGGGGEGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGFGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGEGGGGGEGGGGGGGGGEGGGGAEGGEGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFEGG
+@GGTGCTTGTGCTGATCG|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-1-InternalC|DUPCOUNT=3,1|CONSCOUNT=4
+GAGTTGAGCCCTGGATTGTGACTGCTTCAGGGCAGTTGGTAGATGCCCCTCTGGGAGAGATCCCCAGGGGTGACAGCCATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGTCCCAGGCAGCGCTGGCCCCTGCTGCTGCTGGGTCTGGCCATGGTCGCCCATGGCCTGCTGCGCCCAATGGTTGCACCGCAAAGCGGGGACCCAGACCCTGGAGCCTCAGTTGGAAGCAGCCGATCCAGCCTGCGGAGCCTGTGGGGCAGGTCAGCCCAAGGCCAACCCCACT
++
+mmmmmlmllmmmmmmmmmmmmmmmmmmmmmmmliljkmmmmmlmimllmmmmmmmlmmmlmmmlmmmmjmmmlmmmmmmmmmmmmmmllmldflllimmlmlklillmmmlmmmmlmljlmmmimmllmhljmmmmmmmmlmmlhmmmmmjljmlmmmmmmmmmkmmlmlmmlmmmllmmmmmjmmmimmmmmmmlmlmmmmmmmmmmmmmlmmmmmmmmmmjmmljjlikmmmmmmjmmmmimimlmmmmmmmmmmmmmmmmmllimmmmmmmjlmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmkmmmmmmmmmmmmlmmmmmmmmmmmmmmmmmmmlmmmlmmmmm
+@GTTGAATGCAGAATGTT|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-1-InternalC|DUPCOUNT=4,1|CONSCOUNT=4
+GGACTGCTTCAGGGCAGTTGGTAGATGCCCCTCTGGGAGAGATCCCCAGGGGTGACAGCCATGGACCCTGGAAGGGCCTGGGCTAGGGACAGGGACCAGAGCCAGTCCAGGGAGAGGACAGAGCCAATGGACTGGGGTGTACTGTAACAGCCCTGCTGGTCCCAGGCAGCGCTGGCCCCTGCTGCTGCTGGGTCTGGCCATGGTCGCCCATGGCCTGCTGCGCCCAATGGTTGCACCGCAAAGCGGGGACCCAGACCCTGGAGCCTCAGTTGGAAGCAGCCGATCCAGCCTGCGGAGCCTGTGGGGCAGGTCAGCCCAAGGCCAACCCCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGFC<FGGFFGFGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGEGGGGGGFCGGGGGEGGGGGGGGGGGGGEGGGGGGGEGGGEGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ACACGTATATTAAAGGG|PRCONS=Human-IGK|SEQORIENT=F|CREGION=Human-IGKC-IGKJ-InternalC|DUPCOUNT=5,1|CONSCOUNT=5
+GGATCAGGACTCCTCAGTTCACCTTCTCACAATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCTCTGGATCCAGTGGGGATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCCTGCATAGTAATGGATACAACTATTTGGATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATTTGGGTTCTAATCGGGCCTCCGGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGFGGGGGGFGGGGGGGGGGCF8FGGGGGGGGFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGFFFGFFGFCGFFFGGGFFGGFGGGGGGGFGGGGGFGFGGGFGFGFGGGGGGGFFGGGGGGGGGGGFGGGGGGGGGFGGGGGGGGGGCGGGGGGGG@GGGGG9GGGGGGGGFGGGGGGGGGGGGGDGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFF,GGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/presto_splitseq_partition_test_out_under.fastq	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,24 @@
+@ATCTTTGCGGCTGGTTA|PRCONS=Human-IGK|SEQORIENT=F|CREGION=Human-IGKC-IGKJ-InternalC|DUPCOUNT=1,1|CONSCOUNT=1
+GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAA
++
+GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFG>EFGGFGGGGCFFFGFFGCFE,F>CBFDEGFGGEFGGCFGGGGFGEGGGGGGDDFGGCFGFGGGGFCC>@FGFFGFDCGGGFGC1FGGGGGGGGGGGEGEDEGGFEECFCEFCG?GGFCEF@FFFDFFA:0<EG=FBE?F8FCFEFGGFEA<GFGFEC4,DF7E?9EFFACGFEGGCGGEFEDGGGGF@?GGGGGGGGGFCGDCGGGGGGGGFFGGGGGGGGGFB78GGGGGGCFCF8FCAGFGFGGGGGGGGGGGGGDGGGDGGFF
+@CTTGATAGGAATGAATA|PRCONS=Human-TRB|SEQORIENT=F|CREGION=Human-IGLC-1-InternalC|DUPCOUNT=1,1|CONSCOUNT=1
+AGCCTGGGCCTCAGGAAGCAGCATCGGGGGTGCCGCAGCCATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAAGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGTACTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGATCATCTATAGGGATATCCACCGGCCCTCTGGGATCCCTGACCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGATTATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTCCTGTCAGGTGTGGGACAGCAGCACTGTGGTCTTCGGAACTGGGACCAGGGTCACCGTCCTAAGTCAGCCCAAGGCCAACCCCACTGTCACT
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGDGEGGGGGGGGGGGGGGGGGGGEGGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFGGGGGGFFGGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGDGGF7DFGGG7FGGGGGGEGGGC8FEFGGGGC77GFEGEGGDGGGGGGGFFGFGGGFGGGGFFGGFFGFFCFGGFDF;CGGGGFF4C=>FGGGFFGFGGGGGGGFGECGGGGDGGGGGGGG@GGGGGGFEGGGGGEGGGGGEGGGGGGGFFFGEFGGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ACTCGTGCTAATCCTTC|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=1
+GAGCTCAGGAAGCAGAGCCTGGAGCATCTCCACTATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGATTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGGGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATGCCGGCAGGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+GGGGGGGGGGGGGGGGGGGGGGGGGGFGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCEEGGGGGF9F9FGGGGAFGGFGGGCGGGGGGGGGGGGGGGDGGGGGDEDGGGGGGGECCCFFGGGGDE7FFCG7BCCCGGGGFBFGGGGGGFEEEEEGG?FGGGGD@DEGGFGGGGFD>>7FGGFGFF>GGFGGGF<GGGG?GGGGGGGFEGGGFGGC5EFGGGGGGGGGGFGGGGGGGGFGGFFGCEGFFEGGGGGGGGGGGGCEFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGFFGFGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+@ACCAAAAGTTTACACTC|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=2
+CTCACTGCACAGGGTCCTGGGCCCAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCACTGGGACCAGATCCAACATCGGGGGAGGTTATGATGTACACTGGTACCAGCAACTTCCAGGAACAGCCCCCAAACTCCTCGTCTATGGTAACATCCATCGGCCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCACTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTTATGTGGTTTTCGGCGGAGGGACCAAGTTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+kklmmlmmmmmlmjmmmlilmbj]lkklmmmklglallmmmjlmmmmlmlfllllmmlm]`flmkmmmmmmmmmmfckelljbklmm^l\ljmm^_R^h^aimmiik[gkhiglmklmkmiflklmlilj\cifhkllmmjeEXd^i`RblhVcfjlikkli`imjklkmliiled_fkllh_idkebi[a^Wlilcdeh^fmmmmlimmmlmmmmmldlglihmmllkmmmmmmmmmmmjmljmmmlgkYRkjbmmjilml]mmmljmilleRliillmllmmlkllQlbmlmlmmmljmlmmmmmlhlmmmmklkgllmmmmlklmmmmkllimmlijmmliRilmimkkflmmmlmmlmmmmmlmmmljmkfQfQiklmm
+@TCTTGATGAAGTATAAC|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=2
+AGCTGTGGGCTCAGAAGCAGAGTTCTGGGGTGTCTCCACCATGGCCTGGACCCCTCTCTGGCTCACTCTCCTCACTCTTTGCATAGGTTCTGTTATTTCTTCTGAGCTGACTCAGGACCCTGCTATGTCTGTGGCCCTGGGACAGACAGTCAGGATCACATGCCAAGGAGAGAGCCTCGGAAGCTATCATGCAAGCTGGTACCAACAGAGGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAAAACAACCGGCCCCCAGGGATCCCCGCCCGATTCTCTGGCTCCAGCTCAGGAAACACAGCTTCCTTGACCATCGCTGGGGCTCAGGCGGAAGATGAGGCTGTCTATTACTGTAACTCCGGGGACAACGGTGGTAACCTTTGGGTGTTCGGCGGAGGGACCAAGGTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCG
++
+ikmmmmfmmmlmmmmmkmimkmmmmmlfkkmmmmmmmmmmml_kmmmmikmjllmmmmmlkmmmmmmmmmmmi_jhljmml^kkikmlkjmiklglllmmmmmlmlmm^kkmmmhllljilmmmilklml[lkkeCdQ]d]hj^jlRc]j_j^cj^jj]f^jhkiikHXR\R[S[Wg^g\XIJfehfNfl]aZkg`gklgi\^ahjd__OLX^glmi`[VYageGQ]mlcbQPlh]_l^OTYmlmkeWigW^iki`mimkiimmlmmkhjkikj`eiemmmmmfj^ljmmmlililfljlbdiZmjmmmlmmmmljlmmlmmmllkmlmmmmkmmmmimmmmmmlmmkmllmmlmmmmjmkdjmmmlmlfmmmmmmmmmmmmmmmmmmmmmmmlmmmlmlllmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmkmm
+@CTATTTTAATCATAATG|PRCONS=Human-IGL|SEQORIENT=F|CREGION=Human-IGLC-2-InternalC|DUPCOUNT=1,1|CONSCOUNT=2
+GGGGCCTCAGGAAGCAGCATCGGAGGTGCCTCAGCCATGGCATGGATCCCTCTCTTCCTCGGCGTCCTTGCTTACTGCACAGGATCCGTGGCCTCCTATGCCTTAACTCAGGCACCCTCAGTGTCCGTGTCCCCAGGACAGACAGCCACCATCACCTGCTCTGGATATAAATTGGGGGATAAATATGTTTGCTGGTATCAACAGAGGCCAGGGCAGTCCCCTGTGTTGGTCATCTCTCAAGATGATAAACGGGCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACTCTGGGAACACAGCCACTCTGACCATCAGCGGGACCCAGGCTGTGGATGAGGCTGACTATTACTGTCAGGCGAAGGACAGCAACACTGTGATATTCGGCGGAGGGACCAAACTGACCGTCCTAAGTCAGCCCAAGGCTGCCCCCTCG
++
+immmmmmmmmmmmimmlllmmYYk3@elhilmmmllmmmlmmmmmmmmmmmmmilmmmmlkjmkkllmmmmmllmllmmmmi`ilmmjkkiiiilfiJfc_lmmmmmlhl[O]^Pfkcilileb`i^`fgikmlX`kXhbhULZ`ilmmmmlllmmkil[bifllkleldcYUik\bclmhefhZkkibjiiihPlcckkc^l^hih_cmljjhV[mmmhkeWjghhhlkejifll_]kimila[jmkikmmmkkfkWjikhflmmmmmmmmmmmilkmmmmmlmlilc]lmlmmmmmijl\jmmlmlmmmmmmklmmmlmlilkmmmmmlllgllmmmmmmmlkmmljmmjl^mmmmmmmmmmmmmmimmmmmmmmmmmmmmmmmmmmmmmmmmmlmmmmmmmmmmmmmmmmmmmmmlmmmmmmgmmmlmmmmm
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/prestor_logs/assemble_table.tab	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+ID	REFID	LENGTH	OVERLAP	GAP	ERROR	PVALUE	EVALUE1	EVALUE2	IDENTITY	FIELDS1	FIELDS2
+CTTGCTTATGATTCCAG		435	120		0.0833	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+CGGTTTGGTGCATCTAG		435	119		0.0168	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRA
+ATCTTTGCGGCTGGTTA		354	200		0.0500	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+TTTCTTTAGTGAAATGC		414	141		0.0780	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+ATTTCTATGGCTTTGTT		471	84		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+CCTTGTCCGAGATGTCT		414	141		0.1135	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+GGGACTCCAAAATTAAT		459	95		0.0316	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+CTTGATAGGAATGAATA		445	109		0.0367	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+TTAGCTACATGTAATTG		433	121		0.2645	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+CGATGTAATCTTAGCTG		448	109		0.0550	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+ACTTAACGGCCAATTAA		458	98		0.0000	1.1102e-16				CONSCOUNT=2	CONSCOUNT=2|PRCONS=Human-TRB
+CGCATATATCTGCAAAA		521	37		0.1351	3.0804e-15				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGHA
+TCCAGATTCGGATTACA		467	88		0.0000	1.1102e-16				CONSCOUNT=2	CONSCOUNT=2|PRCONS=Human-TRA
+ATTAGTTCATAAATTCC		417	138		0.0000	1.1102e-16				CONSCOUNT=2	CONSCOUNT=2|PRCONS=Human-IGK
+ACTCGTGCTAATCCTTC		445	109		0.0367	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+TAGCCTTCACTTTAGTT		431	125		0.0160	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+AATTAATGGTGTTGAGA		470	87		0.1954	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+GAAGAATTGTAACAATC		453	103		0.0388	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+GAGACTTTGCTTGTACA		530	26		0.0769	3.4228e-13				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+ATGCATATGAGTGTGGC		432	124		0.0403	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+GTTCGTACTCTAATAGA		317	239		0.0460	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+CGGAATACTCACAAATT		347	210		0.1762	1.1102e-16				CONSCOUNT=2	CONSCOUNT=2|PRCONS=Human-IGHA
+TTAAGATACTAACAGGT		423	131		0.0305	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+GGGCCTCTTTATTTGTC		453	101		0.1386	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+GAAAGACTTACATTTTT		486	72		0.0000	1.1102e-16				CONSCOUNT=2	CONSCOUNT=2|PRCONS=Human-IGHG
+TATTCAGTATAACATTA		504	52		0.1923	8.7994e-17				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGHG
+GCTGCAGTAGAAGATAT		467	90		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+ACGACAAATGTTCTTTC		459	98		0.0408	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+CTATTAACTGCAGAAAT		460	94		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+TCTGGTCGTGCAAGTGA		513	43		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+CGATAAGCGTATTTAGT		505	50		0.0400	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGHA
+CTATTTACCAGAATTAC		449	105		0.0000	1.1102e-16				CONSCOUNT=2	CONSCOUNT=2|PRCONS=Human-IGL
+GTACTATGAACACAACT		459	97		0.0103	1.1102e-16				CONSCOUNT=3	CONSCOUNT=2|PRCONS=Human-TRB
+TAGCTACGCAGTTATTG		464	92		0.1196	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+TGTAGAGACTAACATCA		446	111		0.0631	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+TCTCTTCAATCTATTCG		485	71		0.1549	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+GCAACAAAAGTTCGATA		431	124		0.1532	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+TGATAAATCCGACATGA		413	142		0.0070	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+CAGACTGATTGACAAGA		324	233		0.0000	1.1102e-16				CONSCOUNT=3	CONSCOUNT=3|PRCONS=Human-TRB
+GATCATTTTGTTGATGT		418	136		0.0221	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+GGATAACGTCAAAGAAT		412	143		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+AGCTGTGTGACAATGGG		411	140		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGHD
+ACAACTTGTCTTGGCTC		294	263		0.0228	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+CAGCTACACACAGTAGA		425	130		0.1077	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+TAGTCAGAAGATTATCT	IGHV3-48*03	541	13	0			5.1900e-30	3.1100e-47	0.8288	CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGHA
+CCATGTCTTATTTTATA	IGHV3-74*03	524	31	0			1.1000e-46	6.4900e-69	0.9247	CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGHA
+AACCCTTCAGCAGTACC		456	98		0.0714	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+GGATATCGAAGAATCGC		323	232		0.0129	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+CTGCCACACTTTGAAGA		414	141		0.1348	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+CCAAATGCTAAATATTC		434	121		0.0083	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+TAATTTAGGTTATTTCC		445	109		0.0000	1.1102e-16				CONSCOUNT=2	CONSCOUNT=2|PRCONS=Human-IGL
+TTGTCAGCCTGTGGTTC		330	227		0.0044	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+TGTGAACAAGATATCAT		450	107		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+TGTAAATAGTTTGCCTA		420	134		0.1045	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+TAATGTACGGAAATAGA		437	118		0.0424	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+TGTGTATGGGCACACTT		431	123		0.0325	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+GTCATTTGCTGTAGGCA		445	110		0.0909	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+TTTACAGTTCCTTTCTG		445	112		0.1607	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+ACACGTTGCGTATGAGA		412	143		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+CACACAAGGAGACACGT		458	99		0.0909	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRA
+GCGACTCTTTCATTTAG		420	134		0.0299	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+TAAGCTGCACAATGAAT		446	108		0.2407	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+CCGGTTAAGATATCGTA		358	198		0.0000	1.1102e-16				CONSCOUNT=2	CONSCOUNT=2|PRCONS=Human-TRA
+AGCCCATTTCATAATTA		431	125		0.0800	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+GTCCGTCCTTATTTTGT		497	57		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+TTTGAACTGGGTGCAGT		288	267		0.0112	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+GGTTTTCATAAAACTCT		440	117		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+GTGAGCACCGTTTTGTA		515	41		0.1220	9.2193e-17				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGHA
+GCATTTCTTGCAACTAC		443	113		0.0531	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+ACATTAAGACCAGAATT		451	103		0.0485	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+AAAGAAGGTGTAACTTC		465	91		0.0769	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+GCGCTATTCTAAATGGG		449	107		0.0467	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+TGGATAGAAAGACTAGT		478	78		0.0513	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGHA
+CAGAAATTCTGTACAGC		286	270		0.0037	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+TTCATAGAATCTTCTCA		435	120		0.0167	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+GAGAGTTGTCTAAAATC		491	66		0.0303	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGHA
+ATTTCTTTCCAACGTTA		524	32		0.2812	1.9143e-08				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGHA
+CTTGCTAGGTTACTTTT		427	129		0.0310	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+TCTCGAGATACTTATTA		432	123		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+CGGACAGACCTAGGTAG		445	111		0.0090	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+GCAATATATTTAGGCTT		325	229		0.0087	1.1102e-16				CONSCOUNT=2	CONSCOUNT=2|PRCONS=Human-IGK
+GCACTTCCACATGGTAC		340	217		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+CGGTCAGATAATCTTCT		407	149		0.1208	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+GCGGCATTAGTATTGCA		432	122		0.0328	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+GAAATTCTCGAACTCAA		433	122		0.0574	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+CCGGGTGTCACTTTTTA		432	125		0.2400	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+CGGAATTGGAGTGACAA		417	136		0.0221	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+GATGAAATTTGATCGCG		453	103		0.0194	1.1102e-16				CONSCOUNT=2	CONSCOUNT=2|PRCONS=Human-IGL
+TTAGAAGACATTGCCGG		451	103		0.0583	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+ATCTTTGGATCATAAAT		521	34		0.2059	2.3495e-11				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGHA
+GTCTATCTTATTACTTT		371	184		0.0054	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+GCTTCTCCATTTACAAT		285	269		0.0409	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+GCATTTCCTCATTACAG		446	108		0.0000	1.1102e-16				CONSCOUNT=2	CONSCOUNT=2|PRCONS=Human-TRA
+ATTTGAAATTCTTGATT		432	123		0.2764	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGK
+CTTGCAACACATCTTTC		435	122		0.0574	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+CAATCTGAGTTTATTAG		427	129		0.0000	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+GTCTGTTGCAATCATGG		440	114		0.1228	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
+TAAGTTGGTTCAGTTAC		417	140		0.0286	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-TRB
+TTAATAAAATTAACAGA		461	96		0.0625	1.1102e-16				CONSCOUNT=1	CONSCOUNT=1|PRCONS=Human-IGL
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/prestor_logs/consensus-1_table.tab	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+BARCODE	SEQCOUNT	CONSCOUNT	PRIMER	PRCONS	PRCOUNT	PRFREQ	ERROR
+CTTGATAGGAATGAATA	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+CGGTTTGGTGCATCTAG	1	1	Human-TRA	Human-TRA	1	1.0	0.0
+TTTCTTTAGTGAAATGC	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+ATTTCTATGGCTTTGTT	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+ATCTTTGCGGCTGGTTA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+CCTTGTCCGAGATGTCT	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+CTTGCTTATGATTCCAG	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+CGATGTAATCTTAGCTG	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+CGCATATATCTGCAAAA	1	1	Human-IGHA	Human-IGHA	1	1.0	0.0
+TAGTCAGAAGATTATCT	1	1	Human-IGHA	Human-IGHA	1	1.0	0.0
+TTAGCTACATGTAATTG	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+GGGACTCCAAAATTAAT	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+ACTTAACGGCCAATTAA	2	2	Human-TRB	Human-TRB	2	1.0	0.0
+TCGGGTCGCCTTCTTTT	2		Human-IGL,Human-TRB	Human-IGL	1,1	0.5	
+ATTAGTTCATAAATTCC	2	2	Human-IGK	Human-IGK	2	1.0	0.0
+TCCAGATTCGGATTACA	2	2	Human-TRA	Human-TRA	2	1.0	0.0
+TAGCCTTCACTTTAGTT	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+ACTCGTGCTAATCCTTC	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+GAGACTTTGCTTGTACA	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+GAAGAATTGTAACAATC	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+AATTAATGGTGTTGAGA	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+ATGCATATGAGTGTGGC	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+CGGAATACTCACAAATT	2	2	Human-IGHA	Human-IGHA	2	1.0	0.0
+GAAAGACTTACATTTTT	2	2	Human-IGHG	Human-IGHG	2	1.0	0.0
+GTTCGTACTCTAATAGA	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+TTAAGATACTAACAGGT	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+GGGCCTCTTTATTTGTC	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+TATTCAGTATAACATTA	1	1	Human-IGHG	Human-IGHG	1	1.0	0.0
+GCTGCAGTAGAAGATAT	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+ACGACAAATGTTCTTTC	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+CTATTTACCAGAATTAC	2	2	Human-IGL	Human-IGL	2	1.0	0.0
+GTACTATGAACACAACT	3	2	Human-IGL,Human-TRB	Human-TRB	1,2	0.6666666666666666	0.0
+CCATGTCTTATTTTATA	1	1	Human-IGHA	Human-IGHA	1	1.0	0.0
+CTATTAACTGCAGAAAT	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+TCTGGTCGTGCAAGTGA	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+CGATAAGCGTATTTAGT	1	1	Human-IGHA	Human-IGHA	1	1.0	0.0
+TAGCTACGCAGTTATTG	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+TCTCTTCAATCTATTCG	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+GCAACAAAAGTTCGATA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+TGATAAATCCGACATGA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+CAGACTGATTGACAAGA	3	3	Human-TRB	Human-TRB	3	1.0	0.009489916963226541
+GATCATTTTGTTGATGT	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+AGCTGTGTGACAATGGG	1	1	Human-IGHD	Human-IGHD	1	1.0	0.0
+ACAACTTGTCTTGGCTC	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+AACCCTTCAGCAGTACC	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+GGATAACGTCAAAGAAT	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+CAGCTACACACAGTAGA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+GGATATCGAAGAATCGC	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+CTGCCACACTTTGAAGA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+TGTAGAGACTAACATCA	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+CCAAATGCTAAATATTC	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+TAATTTAGGTTATTTCC	2	2	Human-IGL	Human-IGL	2	1.0	0.0
+TTGTCAGCCTGTGGTTC	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+TAATGTACGGAAATAGA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+CACACAAGGAGACACGT	1	1	Human-TRA	Human-TRA	1	1.0	0.0
+TGTAAATAGTTTGCCTA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+TGTGAACAAGATATCAT	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+CCGGTTAAGATATCGTA	2	2	Human-TRA	Human-TRA	2	1.0	0.0
+TGTGTATGGGCACACTT	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+TTTACAGTTCCTTTCTG	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+GCGACTCTTTCATTTAG	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+GTCATTTGCTGTAGGCA	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+TAAGCTGCACAATGAAT	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+ACACGTTGCGTATGAGA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+GTCCGTCCTTATTTTGT	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+GGTTTTCATAAAACTCT	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+CAGAAATTCTGTACAGC	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+AGCCCATTTCATAATTA	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+ACATTAAGACCAGAATT	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+TTTGAACTGGGTGCAGT	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+GTGAGCACCGTTTTGTA	1	1	Human-IGHA	Human-IGHA	1	1.0	0.0
+TGGATAGAAAGACTAGT	1	1	Human-IGHA	Human-IGHA	1	1.0	0.0
+GAGAGTTGTCTAAAATC	1	1	Human-IGHA	Human-IGHA	1	1.0	0.0
+AAAGAAGGTGTAACTTC	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+GCGCTATTCTAAATGGG	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+TCTCGAGATACTTATTA	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+TTCATAGAATCTTCTCA	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+CGGACAGACCTAGGTAG	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+CTTGCTAGGTTACTTTT	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+GCATTTCTTGCAACTAC	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+ATTTCTTTCCAACGTTA	1	1	Human-IGHA	Human-IGHA	1	1.0	0.0
+GAAATTCTCGAACTCAA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+GCACTTCCACATGGTAC	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+GCAATATATTTAGGCTT	2	2	Human-IGK	Human-IGK	2	1.0	0.0
+CGGTCAGATAATCTTCT	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+GCGGCATTAGTATTGCA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+ATCTTTGGATCATAAAT	1	1	Human-IGHA	Human-IGHA	1	1.0	0.0
+TTAGAAGACATTGCCGG	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+CCGGGTGTCACTTTTTA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+ATTTGAAATTCTTGATT	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+GCTTCTCCATTTACAAT	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+GATGAAATTTGATCGCG	2	2	Human-IGL	Human-IGL	2	1.0	0.0
+CGGAATTGGAGTGACAA	1	1	Human-IGK	Human-IGK	1	1.0	0.0
+GCATTTCCTCATTACAG	2	2	Human-TRA	Human-TRA	2	1.0	0.0
+GTCTATCTTATTACTTT	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+TAAGTTGGTTCAGTTAC	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+GTCTGTTGCAATCATGG	1	1	Human-IGL	Human-IGL	1	1.0	0.0
+CTTGTTACATCTGATGT	1	1	Human-TRB	Human-TRB	1	1.0	0.0
+TTAATAAAATTAACAGA	1	1	Human-IGL	Human-IGL	1	1.0	0.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/prestor_logs/consensus-2_table.tab	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+BARCODE	SEQCOUNT	CONSCOUNT	PRIMER	PRCONS	PRCOUNT	PRFREQ	ERROR
+ATCTTTGCGGCTGGTTA	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+CGGTTTGGTGCATCTAG	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+CTTGCTTATGATTCCAG	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+TTTCTTTAGTGAAATGC	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+ATTTCTATGGCTTTGTT	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+GGGACTCCAAAATTAAT	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+CCTTGTCCGAGATGTCT	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+CGATGTAATCTTAGCTG	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+CTTGATAGGAATGAATA	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+TTAGCTACATGTAATTG	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+ACTTAACGGCCAATTAA	2	2	TS-shift2	TS-shift2	2	1.0	0.0
+TCCAGATTCGGATTACA	2	2	TS-shift3	TS-shift3	2	1.0	0.0
+CGCATATATCTGCAAAA	1	1	TS-shift0	TS-shift0	1	1.0	0.0
+ATTAGTTCATAAATTCC	2	2	TS-shift2	TS-shift2	2	1.0	0.0
+ACTCGTGCTAATCCTTC	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+AATTAATGGTGTTGAGA	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+TAGTCAGAAGATTATCT	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+TAGCCTTCACTTTAGTT	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+GAAGAATTGTAACAATC	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+TCGGGTCGCCTTCTTTT	2	2	TS-shift2	TS-shift2	2	1.0	0.0
+GAGACTTTGCTTGTACA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+GTTCGTACTCTAATAGA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+ATGCATATGAGTGTGGC	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+CGGAATACTCACAAATT	2	2	TS-shift1	TS-shift1	2	1.0	0.0
+TTAAGATACTAACAGGT	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+GGGCCTCTTTATTTGTC	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+GAAAGACTTACATTTTT	2	2	TS-shift1	TS-shift1	2	1.0	0.0
+TATTCAGTATAACATTA	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+GCTGCAGTAGAAGATAT	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+ACGACAAATGTTCTTTC	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+CTATTAACTGCAGAAAT	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+CCATGTCTTATTTTATA	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+TCTGGTCGTGCAAGTGA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+CGATAAGCGTATTTAGT	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+CTATTTACCAGAATTAC	2	2	TS-shift4	TS-shift4	2	1.0	0.0
+GTACTATGAACACAACT	3	3	TS-shift2	TS-shift2	3	1.0	0.03284671532846717
+TAGCTACGCAGTTATTG	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+TGTAGAGACTAACATCA	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+TCTCTTCAATCTATTCG	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+GCAACAAAAGTTCGATA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+TGATAAATCCGACATGA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+CAGACTGATTGACAAGA	3	3	TS-shift1	TS-shift1	3	1.0	0.035151515151515156
+GATCATTTTGTTGATGT	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+GGATAACGTCAAAGAAT	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+AGCTGTGTGACAATGGG	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+ACAACTTGTCTTGGCTC	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+CAGCTACACACAGTAGA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+AACCCTTCAGCAGTACC	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+GGATATCGAAGAATCGC	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+CTGCCACACTTTGAAGA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+CCAAATGCTAAATATTC	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+TAATTTAGGTTATTTCC	2	2	TS-shift4	TS-shift4	2	1.0	0.0
+TTGTCAGCCTGTGGTTC	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+TGTGAACAAGATATCAT	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+TGTAAATAGTTTGCCTA	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+TAATGTACGGAAATAGA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+TGTGTATGGGCACACTT	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+GTCATTTGCTGTAGGCA	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+TTTACAGTTCCTTTCTG	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+ACACGTTGCGTATGAGA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+CACACAAGGAGACACGT	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+GCGACTCTTTCATTTAG	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+TAAGCTGCACAATGAAT	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+CCGGTTAAGATATCGTA	2	2	TS-shift2	TS-shift2	2	1.0	0.0
+AGCCCATTTCATAATTA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+GTCCGTCCTTATTTTGT	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+TTTGAACTGGGTGCAGT	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+GGTTTTCATAAAACTCT	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+GTGAGCACCGTTTTGTA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+GCATTTCTTGCAACTAC	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+ACATTAAGACCAGAATT	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+AAAGAAGGTGTAACTTC	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+GCGCTATTCTAAATGGG	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+TGGATAGAAAGACTAGT	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+CAGAAATTCTGTACAGC	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+TTCATAGAATCTTCTCA	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+GAGAGTTGTCTAAAATC	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+ATTTCTTTCCAACGTTA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+TCTCGAGATACTTATTA	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+CTTGCTAGGTTACTTTT	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+CGGACAGACCTAGGTAG	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+GCAATATATTTAGGCTT	2	2	TS-shift3	TS-shift3	2	1.0	0.0
+GCACTTCCACATGGTAC	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+CGGTCAGATAATCTTCT	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+GCGGCATTAGTATTGCA	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+GAAATTCTCGAACTCAA	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+CCGGGTGTCACTTTTTA	1	1	TS-shift0	TS-shift0	1	1.0	0.0
+CGGAATTGGAGTGACAA	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+TTAGAAGACATTGCCGG	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+GATGAAATTTGATCGCG	2	2	TS-shift2	TS-shift2	2	1.0	0.0
+ATCTTTGGATCATAAAT	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+GTCTATCTTATTACTTT	1	1	TS-shift3	TS-shift3	1	1.0	0.0
+GCTTCTCCATTTACAAT	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+ATTTGAAATTCTTGATT	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+GCATTTCCTCATTACAG	2	2	TS-shift4	TS-shift4	2	1.0	0.0
+CTTGCAACACATCTTTC	1	1	TS-shift1	TS-shift1	1	1.0	0.0
+CAATCTGAGTTTATTAG	1	1	TS-shift2	TS-shift2	1	1.0	0.0
+GTCTGTTGCAATCATGG	1	1	TS-shift4	TS-shift4	1	1.0	0.0
+TAAGTTGGTTCAGTTAC	1	1	TS-shift1	TS-shift1	1	1.0	0.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/prestor_logs/cregion_table.tab	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+ID	PRIMER	ERROR
+CTTGCTTATGATTCCAG|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+ATCTTTGCGGCTGGTTA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+GGGACTCCAAAATTAAT|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+CCTTGTCCGAGATGTCT|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+TTAGCTACATGTAATTG|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0.125
+CTTGATAGGAATGAATA|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGLC-1-InternalC	0
+CGGTTTGGTGCATCTAG|CONSCOUNT=1,1|PRCONS=Human-TRA	Human-IGHD-InternalC	0.375
+ATTAGTTCATAAATTCC|CONSCOUNT=2,2|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+CGCATATATCTGCAAAA|CONSCOUNT=1,1|PRCONS=Human-IGHA	Human-IGHA-InternalC	0
+CGATGTAATCTTAGCTG|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+ACTCGTGCTAATCCTTC|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+ACTTAACGGCCAATTAA|CONSCOUNT=2,2|PRCONS=Human-TRB	Human-IGHG-InternalC	0.375
+TTTCTTTAGTGAAATGC|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0.0625
+ATTTCTATGGCTTTGTT|CONSCOUNT=1,1|PRCONS=Human-TRB		
+TCCAGATTCGGATTACA|CONSCOUNT=2,2|PRCONS=Human-TRA	Human-IGHA-InternalC	0.375
+TAGCCTTCACTTTAGTT|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+GAAGAATTGTAACAATC|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+AATTAATGGTGTTGAGA|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+CGGAATACTCACAAATT|CONSCOUNT=2,2|PRCONS=Human-IGHA	Human-IGHA-InternalC	0
+GGGCCTCTTTATTTGTC|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGLC-2-InternalC	0
+GTTCGTACTCTAATAGA|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-3-InternalC	0.125
+TATTCAGTATAACATTA|CONSCOUNT=1,1|PRCONS=Human-IGHG	Human-IGHG-InternalC	0
+GAAAGACTTACATTTTT|CONSCOUNT=2,2|PRCONS=Human-IGHG	Human-IGHA-InternalC	0.0625
+TTAAGATACTAACAGGT|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0.125
+ATGCATATGAGTGTGGC|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGHG-InternalC	0.375
+CGATAAGCGTATTTAGT|CONSCOUNT=1,1|PRCONS=Human-IGHA	Human-IGHA-InternalC	0
+GAGACTTTGCTTGTACA|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGHG-InternalC	0.375
+CTATTTACCAGAATTAC|CONSCOUNT=2,2|PRCONS=Human-IGL	Human-IGLC-1-InternalC	0
+GTACTATGAACACAACT|CONSCOUNT=3,2|PRCONS=Human-TRB	Human-IGLC-1-InternalC	0
+ACGACAAATGTTCTTTC|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGHD-InternalC	0.375
+GCTGCAGTAGAAGATAT|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGHG-InternalC	0.3125
+TAGCTACGCAGTTATTG|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGHM-InternalC	0.25
+TCTGGTCGTGCAAGTGA|CONSCOUNT=1,1|PRCONS=Human-TRB		
+CTATTAACTGCAGAAAT|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGKC-IGKJ-InternalC	0.625
+TGTAGAGACTAACATCA|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGKC-IGKJ-InternalC	0.375
+GATCATTTTGTTGATGT|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+TCTCTTCAATCTATTCG|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGLC-4-InternalC	0.3125
+GCAACAAAAGTTCGATA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0.0625
+CAGCTACACACAGTAGA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+TAGTCAGAAGATTATCT|CONSCOUNT=1,1|PRCONS=Human-IGHA	Human-IGHA-InternalC	0
+CCATGTCTTATTTTATA|CONSCOUNT=1,1|PRCONS=Human-IGHA	Human-IGHA-InternalC	0
+AACCCTTCAGCAGTACC|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+TGATAAATCCGACATGA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0.0625
+CAGACTGATTGACAAGA|CONSCOUNT=3,3|PRCONS=Human-TRB	Human-IGHD-InternalC	0.375
+CTGCCACACTTTGAAGA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+AGCTGTGTGACAATGGG|CONSCOUNT=1,1|PRCONS=Human-IGHD	Human-IGKC-IGKJ-InternalC	0.3125
+TAATTTAGGTTATTTCC|CONSCOUNT=2,2|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+GGATAACGTCAAAGAAT|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0.5
+TGTGAACAAGATATCAT|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+TGTAAATAGTTTGCCTA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+TAATGTACGGAAATAGA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+TGTGTATGGGCACACTT|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+GTCATTTGCTGTAGGCA|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+TTTACAGTTCCTTTCTG|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+ACAACTTGTCTTGGCTC|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGHD-InternalC	0.375
+GGATATCGAAGAATCGC|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0.125
+GCGACTCTTTCATTTAG|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+TAAGCTGCACAATGAAT|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+CCAAATGCTAAATATTC|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGHA-InternalC	0.375
+TTGTCAGCCTGTGGTTC|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGHD-InternalC	0.375
+ACACGTTGCGTATGAGA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGHM-InternalC	0.5
+CACACAAGGAGACACGT|CONSCOUNT=1,1|PRCONS=Human-TRA	Human-IGLC-4-InternalC	0.3125
+CCGGTTAAGATATCGTA|CONSCOUNT=2,2|PRCONS=Human-TRA	Human-IGHA-InternalC	0.375
+AGCCCATTTCATAATTA|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGLC-4-InternalC	0.3125
+GTGAGCACCGTTTTGTA|CONSCOUNT=1,1|PRCONS=Human-IGHA	Human-IGHA-InternalC	0
+TTTGAACTGGGTGCAGT|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0.3125
+AAAGAAGGTGTAACTTC|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+GCGCTATTCTAAATGGG|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-1-InternalC	0
+TGGATAGAAAGACTAGT|CONSCOUNT=1,1|PRCONS=Human-IGHA	Human-IGHA-InternalC	0
+CAGAAATTCTGTACAGC|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+TTCATAGAATCTTCTCA|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+GGTTTTCATAAAACTCT|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGKC-IGKJ-InternalC	0.4375
+GAGAGTTGTCTAAAATC|CONSCOUNT=1,1|PRCONS=Human-IGHA	Human-IGHA-InternalC	0
+ATTTCTTTCCAACGTTA|CONSCOUNT=1,1|PRCONS=Human-IGHA	Human-IGHA-InternalC	0
+CTTGCTAGGTTACTTTT|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+GTCCGTCCTTATTTTGT|CONSCOUNT=1,1|PRCONS=Human-IGL		
+CGGACAGACCTAGGTAG|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+ACATTAAGACCAGAATT|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGLC-4-InternalC	0.3125
+GCATTTCTTGCAACTAC|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGLC-4-InternalC	0.3125
+GCGGCATTAGTATTGCA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+GAAATTCTCGAACTCAA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+CCGGGTGTCACTTTTTA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+CGGAATTGGAGTGACAA|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+GATGAAATTTGATCGCG|CONSCOUNT=2,2|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+TTAGAAGACATTGCCGG|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+ATCTTTGGATCATAAAT|CONSCOUNT=1,1|PRCONS=Human-IGHA	Human-IGHA-InternalC	0
+GCAATATATTTAGGCTT|CONSCOUNT=2,2|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0.3125
+GCACTTCCACATGGTAC|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGHD-InternalC	0.375
+TCTCGAGATACTTATTA|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGKC-IGKJ-InternalC	0.4375
+ATTTGAAATTCTTGATT|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0
+CTTGCAACACATCTTTC|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-1-InternalC	0
+CGGTCAGATAATCTTCT|CONSCOUNT=1,1|PRCONS=Human-IGK	Human-IGKC-IGKJ-InternalC	0.0625
+GTCTATCTTATTACTTT|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGKC-IGKJ-InternalC	0.3125
+GTCTGTTGCAATCATGG|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+GCTTCTCCATTTACAAT|CONSCOUNT=1,1|PRCONS=Human-TRB	Human-IGHE-InternalC	0.375
+TTAATAAAATTAACAGA|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-1-InternalC	0
+GCATTTCCTCATTACAG|CONSCOUNT=2,2|PRCONS=Human-TRA	Human-IGKC-IGKJ-InternalC	0.3125
+TCGGAATCGGATTATTT|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
+CTGGGATACACACACGC|CONSCOUNT=1,1|PRCONS=Human-IGL	Human-IGLC-2-InternalC	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/prestor_logs/maskqual_table.tab	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+ID	MASKED
+CTTGCTTATGATTCCAG|CONSCOUNT=1,1|PRCONS=Human-IGL	2
+CCTTGTCCGAGATGTCT|CONSCOUNT=1,1|PRCONS=Human-IGK	6
+TTAGCTACATGTAATTG|CONSCOUNT=1,1|PRCONS=Human-IGK	29
+ATTTCTATGGCTTTGTT|CONSCOUNT=1,1|PRCONS=Human-TRB	200
+TTTCTTTAGTGAAATGC|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+ATCTTTGCGGCTGGTTA|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+CGGTTTGGTGCATCTAG|CONSCOUNT=1,1|PRCONS=Human-TRA	0
+GGGACTCCAAAATTAAT|CONSCOUNT=1,1|PRCONS=Human-IGL	3
+ACTTAACGGCCAATTAA|CONSCOUNT=2,2|PRCONS=Human-TRB	1
+CTTGATAGGAATGAATA|CONSCOUNT=1,1|PRCONS=Human-TRB	0
+CGATGTAATCTTAGCTG|CONSCOUNT=1,1|PRCONS=Human-IGL	2
+TCCAGATTCGGATTACA|CONSCOUNT=2,2|PRCONS=Human-TRA	0
+ATTAGTTCATAAATTCC|CONSCOUNT=2,2|PRCONS=Human-IGK	10
+CGCATATATCTGCAAAA|CONSCOUNT=1,1|PRCONS=Human-IGHA	19
+ACTCGTGCTAATCCTTC|CONSCOUNT=1,1|PRCONS=Human-IGL	0
+TAGCCTTCACTTTAGTT|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+GAAGAATTGTAACAATC|CONSCOUNT=1,1|PRCONS=Human-IGL	0
+AATTAATGGTGTTGAGA|CONSCOUNT=1,1|PRCONS=Human-IGL	30
+GAGACTTTGCTTGTACA|CONSCOUNT=1,1|PRCONS=Human-TRB	62
+ATGCATATGAGTGTGGC|CONSCOUNT=1,1|PRCONS=Human-TRB	0
+GTTCGTACTCTAATAGA|CONSCOUNT=1,1|PRCONS=Human-IGL	0
+CGGAATACTCACAAATT|CONSCOUNT=2,2|PRCONS=Human-IGHA	17
+TTAAGATACTAACAGGT|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+GGGCCTCTTTATTTGTC|CONSCOUNT=1,1|PRCONS=Human-TRB	6
+GAAAGACTTACATTTTT|CONSCOUNT=2,2|PRCONS=Human-IGHG	15
+TATTCAGTATAACATTA|CONSCOUNT=1,1|PRCONS=Human-IGHG	13
+GCTGCAGTAGAAGATAT|CONSCOUNT=1,1|PRCONS=Human-TRB	0
+ACGACAAATGTTCTTTC|CONSCOUNT=1,1|PRCONS=Human-TRB	0
+CTATTAACTGCAGAAAT|CONSCOUNT=1,1|PRCONS=Human-TRB	178
+CGATAAGCGTATTTAGT|CONSCOUNT=1,1|PRCONS=Human-IGHA	7
+TCTGGTCGTGCAAGTGA|CONSCOUNT=1,1|PRCONS=Human-TRB	284
+CTATTTACCAGAATTAC|CONSCOUNT=2,2|PRCONS=Human-IGL	1
+GTACTATGAACACAACT|CONSCOUNT=3,2|PRCONS=Human-TRB	1
+TAGCTACGCAGTTATTG|CONSCOUNT=1,1|PRCONS=Human-TRB	0
+TGTAGAGACTAACATCA|CONSCOUNT=1,1|PRCONS=Human-TRB	1
+TCTCTTCAATCTATTCG|CONSCOUNT=1,1|PRCONS=Human-TRB	28
+GCAACAAAAGTTCGATA|CONSCOUNT=1,1|PRCONS=Human-IGK	15
+TGATAAATCCGACATGA|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+CAGACTGATTGACAAGA|CONSCOUNT=3,3|PRCONS=Human-TRB	19
+GATCATTTTGTTGATGT|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+GGATAACGTCAAAGAAT|CONSCOUNT=1,1|PRCONS=Human-IGK	118
+AGCTGTGTGACAATGGG|CONSCOUNT=1,1|PRCONS=Human-IGHD	99
+ACAACTTGTCTTGGCTC|CONSCOUNT=1,1|PRCONS=Human-TRB	12
+CAGCTACACACAGTAGA|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+TAGTCAGAAGATTATCT|CONSCOUNT=1,1|PRCONS=Human-IGHA	125
+CCATGTCTTATTTTATA|CONSCOUNT=1,1|PRCONS=Human-IGHA	22
+AACCCTTCAGCAGTACC|CONSCOUNT=1,1|PRCONS=Human-IGL	14
+GGATATCGAAGAATCGC|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+CTGCCACACTTTGAAGA|CONSCOUNT=1,1|PRCONS=Human-IGK	7
+CCAAATGCTAAATATTC|CONSCOUNT=1,1|PRCONS=Human-TRB	0
+TAATTTAGGTTATTTCC|CONSCOUNT=2,2|PRCONS=Human-IGL	1
+TTGTCAGCCTGTGGTTC|CONSCOUNT=1,1|PRCONS=Human-TRB	30
+TGTGAACAAGATATCAT|CONSCOUNT=1,1|PRCONS=Human-IGL	3
+TGTAAATAGTTTGCCTA|CONSCOUNT=1,1|PRCONS=Human-IGK	4
+TAATGTACGGAAATAGA|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+TGTGTATGGGCACACTT|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+GTCATTTGCTGTAGGCA|CONSCOUNT=1,1|PRCONS=Human-IGL	2
+TTTACAGTTCCTTTCTG|CONSCOUNT=1,1|PRCONS=Human-IGL	6
+ACACGTTGCGTATGAGA|CONSCOUNT=1,1|PRCONS=Human-IGK	96
+CACACAAGGAGACACGT|CONSCOUNT=1,1|PRCONS=Human-TRA	4
+GCGACTCTTTCATTTAG|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+TAAGCTGCACAATGAAT|CONSCOUNT=1,1|PRCONS=Human-IGL	36
+CCGGTTAAGATATCGTA|CONSCOUNT=2,2|PRCONS=Human-TRA	23
+AGCCCATTTCATAATTA|CONSCOUNT=1,1|PRCONS=Human-TRB	3
+GTCCGTCCTTATTTTGT|CONSCOUNT=1,1|PRCONS=Human-IGL	258
+TTTGAACTGGGTGCAGT|CONSCOUNT=1,1|PRCONS=Human-IGK	8
+GGTTTTCATAAAACTCT|CONSCOUNT=1,1|PRCONS=Human-TRB	143
+GTGAGCACCGTTTTGTA|CONSCOUNT=1,1|PRCONS=Human-IGHA	58
+GCATTTCTTGCAACTAC|CONSCOUNT=1,1|PRCONS=Human-TRB	0
+ACATTAAGACCAGAATT|CONSCOUNT=1,1|PRCONS=Human-TRB	2
+AAAGAAGGTGTAACTTC|CONSCOUNT=1,1|PRCONS=Human-IGL	1
+GCGCTATTCTAAATGGG|CONSCOUNT=1,1|PRCONS=Human-IGL	1
+TGGATAGAAAGACTAGT|CONSCOUNT=1,1|PRCONS=Human-IGHA	2
+CAGAAATTCTGTACAGC|CONSCOUNT=1,1|PRCONS=Human-IGL	5
+TTCATAGAATCTTCTCA|CONSCOUNT=1,1|PRCONS=Human-IGL	0
+GAGAGTTGTCTAAAATC|CONSCOUNT=1,1|PRCONS=Human-IGHA	2
+ATTTCTTTCCAACGTTA|CONSCOUNT=1,1|PRCONS=Human-IGHA	107
+CTTGCTAGGTTACTTTT|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+TCTCGAGATACTTATTA|CONSCOUNT=1,1|PRCONS=Human-TRB	126
+CGGACAGACCTAGGTAG|CONSCOUNT=1,1|PRCONS=Human-IGL	0
+GCAATATATTTAGGCTT|CONSCOUNT=2,2|PRCONS=Human-IGK	78
+GCACTTCCACATGGTAC|CONSCOUNT=1,1|PRCONS=Human-TRB	48
+CGGTCAGATAATCTTCT|CONSCOUNT=1,1|PRCONS=Human-IGK	11
+GCGGCATTAGTATTGCA|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+GAAATTCTCGAACTCAA|CONSCOUNT=1,1|PRCONS=Human-IGK	1
+CCGGGTGTCACTTTTTA|CONSCOUNT=1,1|PRCONS=Human-IGK	4
+CGGAATTGGAGTGACAA|CONSCOUNT=1,1|PRCONS=Human-IGK	0
+GATGAAATTTGATCGCG|CONSCOUNT=2,2|PRCONS=Human-IGL	3
+TTAGAAGACATTGCCGG|CONSCOUNT=1,1|PRCONS=Human-IGL	5
+ATCTTTGGATCATAAAT|CONSCOUNT=1,1|PRCONS=Human-IGHA	79
+GTCTATCTTATTACTTT|CONSCOUNT=1,1|PRCONS=Human-TRB	68
+GCTTCTCCATTTACAAT|CONSCOUNT=1,1|PRCONS=Human-TRB	18
+GCATTTCCTCATTACAG|CONSCOUNT=2,2|PRCONS=Human-TRA	151
+ATTTGAAATTCTTGATT|CONSCOUNT=1,1|PRCONS=Human-IGK	17
+CTTGCAACACATCTTTC|CONSCOUNT=1,1|PRCONS=Human-IGL	1
+CAATCTGAGTTTATTAG|CONSCOUNT=1,1|PRCONS=Human-TRB	115
+GTCTGTTGCAATCATGG|CONSCOUNT=1,1|PRCONS=Human-IGL	2
+TAAGTTGGTTCAGTTAC|CONSCOUNT=1,1|PRCONS=Human-TRB	0
+TTGTCTTACAAGATTAT|CONSCOUNT=1,1|PRCONS=Human-IGK	6
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/prestor_logs/primers-1_table.tab	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+ID	BARCODE	PRIMER	ERROR
+M01873:M01873:000000000-B9G3J:1:2116:20980:12498		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:2103:2227:11139		Human-IGHA	0.0
+M01873:M01873:000000000-B9G3J:1:1117:17250:9432		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1112:28236:12457		Human-TRA	0.0
+M01873:M01873:000000000-B9G3J:1:2110:13535:17883		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:1119:21261:11479		Human-TRB	0.052631578947368474
+M01873:M01873:000000000-B9G3J:1:2108:14465:19705		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:2112:20595:25092		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1115:18550:17263		Human-IGHA	0.42105263157894735
+M01873:M01873:000000000-B9G3J:1:2111:3554:13238		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10006:14034		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1106:23126:20933		Human-TRB	0.052631578947368474
+M01873:M01873:000000000-B9G3J:1:1112:18419:7621		Human-TRB	0.42105263157894735
+M01873:M01873:000000000-B9G3J:1:1111:16537:24486		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10014:22200		Human-IGHG	0.0
+M01873:M01873:000000000-B9G3J:1:1110:23072:9989		Human-IGHA	0.4736842105263158
+M01873:M01873:000000000-B9G3J:1:1109:19388:16328		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10019:8146		Human-IGHA	0.0
+M01873:M01873:000000000-B9G3J:1:2101:11039:4739		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:2104:24954:20771		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1111:12286:7157		Human-TRA	0.0
+M01873:M01873:000000000-B9G3J:1:2116:17140:9378		Human-IGHA	0.0
+M01873:M01873:000000000-B9G3J:1:2105:17710:2946		Human-IGHD	0.36363636363636365
+M01873:M01873:000000000-B9G3J:1:2106:21507:14943		Human-TRB	0.052631578947368474
+M01873:M01873:000000000-B9G3J:1:1110:19157:20344		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:2103:19958:12449		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:2101:22394:13872		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:2104:19897:23367		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10031:4758		Human-IGL	0.3157894736842105
+M01873:M01873:000000000-B9G3J:1:2118:6488:16393		Human-IGHG	0.16666666666666663
+M01873:M01873:000000000-B9G3J:1:1117:6029:5428		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:2106:6159:11549		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:2103:16719:17340		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1108:22114:18127		Human-IGHA	0.0
+M01873:M01873:000000000-B9G3J:1:2114:13033:12027		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10044:7123		Human-TRB	0.10526315789473684
+M01873:M01873:000000000-B9G3J:1:1101:10044:7141		Human-TRB	0.052631578947368474
+M01873:M01873:000000000-B9G3J:1:2102:22537:8542		Human-IGL	0.26315789473684215
+M01873:M01873:000000000-B9G3J:1:2107:25942:4834		Human-TRB	0.052631578947368474
+M01873:M01873:000000000-B9G3J:1:2116:7821:15323		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10051:12996		Human-IGHG	0.0
+M01873:M01873:000000000-B9G3J:1:1107:13066:21126		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1117:12403:4599		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1117:22437:4121		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1114:14006:15367		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1109:25889:19697		Human-IGHA	0.0
+M01873:M01873:000000000-B9G3J:1:1112:3818:19684		Human-IGHA	0.0
+M01873:M01873:000000000-B9G3J:1:1114:10168:21472		Human-IGHA	0.0
+M01873:M01873:000000000-B9G3J:1:1114:16929:21025		Human-IGHA	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10064:16602		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1106:24704:16447		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:2106:19562:4616		Human-IGL	0.26315789473684215
+M01873:M01873:000000000-B9G3J:1:1101:10065:3493		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:2111:9741:23838		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10067:5517		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:1114:20934:3692		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:2107:3490:8582		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:2115:10908:20804		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:2110:7628:11014		Human-IGK	0.09999999999999998
+M01873:M01873:000000000-B9G3J:1:2105:10953:6580		Human-IGHD	0.0
+M01873:M01873:000000000-B9G3J:1:2103:6418:17742		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1110:22639:11539		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:1113:10584:15580		Human-IGHA	0.0
+M01873:M01873:000000000-B9G3J:1:2109:27379:20759		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1109:21161:8210		Human-IGHG	0.0
+M01873:M01873:000000000-B9G3J:1:1113:6140:4661		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1114:9970:8638		Human-TRA	0.0
+M01873:M01873:000000000-B9G3J:1:2117:24875:22401		Human-IGHE	0.42105263157894735
+M01873:M01873:000000000-B9G3J:1:1107:8981:22378		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10099:23047		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:2107:8132:17450		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:2119:20248:11282		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10100:15992		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:2106:2176:11695		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:2115:23638:16692		Human-TRA	0.0
+M01873:M01873:000000000-B9G3J:1:2118:8705:16266		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10107:18394		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10111:8693		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:2111:7262:22830		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1113:11846:1631		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1113:28641:15469		Human-IGK	0.15000000000000002
+M01873:M01873:000000000-B9G3J:1:1106:7472:17358		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10117:6605		Human-IGL	0.26315789473684215
+M01873:M01873:000000000-B9G3J:1:1101:10117:24419		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1107:11849:2638		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:1117:12944:14016		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1111:27451:7271		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1116:19939:2288		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:2108:15031:12741		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:2117:19601:12685		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:2109:17364:9116		Human-IGK	0.0
+M01873:M01873:000000000-B9G3J:1:2105:12905:4671		Human-TRB	0.0
+M01873:M01873:000000000-B9G3J:1:1119:16240:10507		Human-IGL	0.5263157894736843
+M01873:M01873:000000000-B9G3J:1:2116:7856:19893		Human-IGK	0.050000000000000044
+M01873:M01873:000000000-B9G3J:1:1111:13857:12993		Human-IGHA	0.0
+M01873:M01873:000000000-B9G3J:1:2106:17308:17099		Human-IGHA	0.0
+M01873:M01873:000000000-B9G3J:1:1108:14300:19094		Human-IGL	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10137:13722		Human-IGHA	0.052631578947368474
+M01873:M01873:000000000-B9G3J:1:2107:6181:15590		Human-IGL	0.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/prestor_logs/primers-2_table.tab	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+ID	BARCODE	PRIMER	ERROR
+M01873:M01873:000000000-B9G3J:1:2116:20980:12498	ATCTTTGCGGCTGGTTA	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1112:28236:12457	CGGTTTGGTGCATCTAG	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:2110:13535:17883	TTTCTTTAGTGAAATGC	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1119:21261:11479	CTTGATAGGAATGAATA	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10006:14034	ATTTCTATGGCTTTGTT	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1117:17250:9432	CTTGCTTATGATTCCAG	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:2108:14465:19705	ACTTAACGGCCAATTAA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1115:18550:17263	GGTCTTTGGATAGCGGA	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:2111:3554:13238	TTAGCTACATGTAATTG	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1112:18419:7621	CACACTGACAATATTCT	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1109:19388:16328	GGGACTCCAAAATTAAT	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:1111:16537:24486	CCTTGTCCGAGATGTCT	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10019:8146	CGCATATATCTGCAAAA	TS-shift0	0.0
+M01873:M01873:000000000-B9G3J:1:1110:23072:9989	ATGGTACTCTATCAGGG	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:2101:11039:4739	ATTAGTTCATAAATTCC	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2104:24954:20771	CGATGTAATCTTAGCTG	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:1111:12286:7157	TCCAGATTCGGATTACA	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:2103:2227:11139	TAGTCAGAAGATTATCT	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:2116:17140:9378	CGGAATACTCACAAATT	TS-shift1	0.1428571428571429
+M01873:M01873:000000000-B9G3J:1:2105:17710:2946	CTGCCATCAGCTTCATT	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:2106:21507:14943	TCGGGTCGCCTTCTTTT	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2101:22394:13872	ACTCGTGCTAATCCTTC	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:1110:19157:20344	GAAGAATTGTAACAATC	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2103:19958:12449	TAGCCTTCACTTTAGTT	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:2104:19897:23367	AATTAATGGTGTTGAGA	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10031:4758	GTTTATGTTTGACTAGC	TS-shift4	0.09999999999999998
+M01873:M01873:000000000-B9G3J:1:2118:6488:16393	GAAAGACTTACATTTTT	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:1117:6029:5428	GAGACTTTGCTTGTACA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2106:6159:11549	GTTCGTACTCTAATAGA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2103:16719:17340	ATGCATATGAGTGTGGC	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2114:13033:12027	TTAAGATACTAACAGGT	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:2107:25942:4834	GGGCCTCTTTATTTGTC	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10044:7123	GTACTATGAACACAACT	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10044:7141	GTACTATGAACACAACT	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2102:22537:8542	CAAACTTGCGCTACTGA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2116:7821:15323	CTATTTACCAGAATTAC	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10051:12996	TATTCAGTATAACATTA	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1107:13066:21126	GCTGCAGTAGAAGATAT	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:1117:12403:4599	ACGACAAATGTTCTTTC	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:1117:22437:4121	CAGACTGATTGACAAGA	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:1114:14006:15367	CTATTAACTGCAGAAAT	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:1112:3818:19684	ATAATAAACTGAAGCGG	TS-shift2	0.625
+M01873:M01873:000000000-B9G3J:1:1114:10168:21472	CCATGTCTTATTTTATA	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1114:16929:21025	CGATAAGCGTATTTAGT	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10064:16602	TCTGGTCGTGCAAGTGA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10065:3493	TAGCTACGCAGTTATTG	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2106:19562:4616	TAAAAACGTCGAAAATA	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1106:24704:16447	TGTAGAGACTAACATCA	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:2111:9741:23838	TCTCTTCAATCTATTCG	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10067:5517	GCAACAAAAGTTCGATA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1114:20934:3692	TGATAAATCCGACATGA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2107:3490:8582	TAATTTAGGTTATTTCC	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:2115:10908:20804	GATCATTTTGTTGATGT	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:2110:7628:11014	GGATAACGTCAAAGAAT	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2105:10953:6580	AGCTGTGTGACAATGGG	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:2103:6418:17742	ACAACTTGTCTTGGCTC	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:1110:22639:11539	CAGCTACACACAGTAGA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2119:26638:5460	CCTCAACAACTTGCAAT	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1113:6140:4661	AACCCTTCAGCAGTACC	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:1114:9970:8638	CCGGTTAAGATATCGTA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2117:24875:22401	ATACCTTCACTTTAGTA	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:1107:8981:22378	GGATATCGAAGAATCGC	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10099:23047	CTGCCACACTTTGAAGA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10100:15992	CCAAATGCTAAATATTC	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:2107:8132:17450	TTGTCAGCCTGTGGTTC	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:2119:20248:11282	TAATGTACGGAAATAGA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2115:23638:16692	CACACAAGGAGACACGT	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:2106:2176:11695	TGTAAATAGTTTGCCTA	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:2118:8705:16266	TGTGAACAAGATATCAT	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:2111:7262:22830	GTTTATTCTGTAGGCCT	TS-shift4	0.6
+M01873:M01873:000000000-B9G3J:1:1101:10107:18394	TGTGTATGGGCACACTT	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10111:8693	GCGACTCTTTCATTTAG	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1106:7472:17358	GTCATTTGCTGTAGGCA	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1113:11846:1631	TTTACAGTTCCTTTCTG	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:1113:28641:15469	ACACGTTGCGTATGAGA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10117:6605	TTCAGTGGGTCTTCTTT	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:1101:10117:24419	TAAGCTGCACAATGAAT	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:1107:11849:2638	ATAGGACTCATACGATT	TS-shift3	0.5555555555555556
+M01873:M01873:000000000-B9G3J:1:1117:12944:14016	AGCCCATTTCATAATTA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1111:27451:7271	GCATTTCTTGCAACTAC	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1116:19939:2288	GTCCGTCCTTATTTTGT	TS-shift4	0.09999999999999998
+M01873:M01873:000000000-B9G3J:1:2108:15031:12741	GGTTTTCATAAAACTCT	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:2117:19601:12685	CAGAAATTCTGTACAGC	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2109:17364:9116	GCAATATATTTAGGCTT	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:2105:12905:4671	ACATTAAGACCAGAATT	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:1119:16240:10507	TTTAATGCTGGTCATGG	TS-shift4	0.0
+M01873:M01873:000000000-B9G3J:1:2116:7856:19893	TTTGAACTGGGTGCAGT	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2106:17308:17099	GTGAGCACCGTTTTGTA	TS-shift2	0.125
+M01873:M01873:000000000-B9G3J:1:1101:10137:13722	GAGAGTTGTCTAAAATC	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:1111:13857:12993	TGGATAGAAAGACTAGT	TS-shift2	0.125
+M01873:M01873:000000000-B9G3J:1:1108:14300:19094	AAAGAAGGTGTAACTTC	TS-shift2	0.25
+M01873:M01873:000000000-B9G3J:1:2107:6181:15590	GCGCTATTCTAAATGGG	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1115:12252:7158	TTCATAGAATCTTCTCA	TS-shift3	0.11111111111111116
+M01873:M01873:000000000-B9G3J:1:1116:7180:16322	CGGACAGACCTAGGTAG	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:1112:10448:18448	CGACGTTCACATTGTAA	TS-shift0	0.0
+M01873:M01873:000000000-B9G3J:1:1111:16714:18923	CTTGCTAGGTTACTTTT	TS-shift1	0.0
+M01873:M01873:000000000-B9G3J:1:2104:5522:14323	TCTCGAGATACTTATTA	TS-shift3	0.0
+M01873:M01873:000000000-B9G3J:1:1113:7318:10138	ATTTCTTTCCAACGTTA	TS-shift2	0.0
+M01873:M01873:000000000-B9G3J:1:2113:7529:7186	GAAATTCTCGAACTCAA	TS-shift2	0.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/prestor_logs/quality-1_table.tab	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+ID	QUALITY
+M01873:M01873:000000000-B9G3J:1:2116:20980:12498	33.166666666666664
+M01873:M01873:000000000-B9G3J:1:2103:2227:11139	23.87
+M01873:M01873:000000000-B9G3J:1:1117:17250:9432	35.35666666666667
+M01873:M01873:000000000-B9G3J:1:2108:14465:19705	36.166666666666664
+M01873:M01873:000000000-B9G3J:1:2111:3554:13238	21.26
+M01873:M01873:000000000-B9G3J:1:1112:28236:12457	36.72
+M01873:M01873:000000000-B9G3J:1:2110:13535:17883	34.693333333333335
+M01873:M01873:000000000-B9G3J:1:1119:21261:11479	37.026666666666664
+M01873:M01873:000000000-B9G3J:1:1115:18550:17263	24.28
+M01873:M01873:000000000-B9G3J:1:1101:10006:14034	25.906666666666666
+M01873:M01873:000000000-B9G3J:1:1106:23126:20933	26.183333333333334
+M01873:M01873:000000000-B9G3J:1:2111:10779:3698	12.566666666666666
+M01873:M01873:000000000-B9G3J:1:2112:20595:25092	26.416666666666668
+M01873:M01873:000000000-B9G3J:1:1112:18419:7621	33.31666666666667
+M01873:M01873:000000000-B9G3J:1:1101:10014:22200	23.25
+M01873:M01873:000000000-B9G3J:1:1109:19388:16328	33.88333333333333
+M01873:M01873:000000000-B9G3J:1:1111:16537:24486	30.52
+M01873:M01873:000000000-B9G3J:1:1110:23072:9989	35.79666666666667
+M01873:M01873:000000000-B9G3J:1:1101:10019:8146	34.70666666666666
+M01873:M01873:000000000-B9G3J:1:2101:11039:4739	36.41
+M01873:M01873:000000000-B9G3J:1:2104:24954:20771	33.943333333333335
+M01873:M01873:000000000-B9G3J:1:1111:12286:7157	36.916666666666664
+M01873:M01873:000000000-B9G3J:1:2116:17140:9378	31.756666666666668
+M01873:M01873:000000000-B9G3J:1:2105:17710:2946	27.796666666666667
+M01873:M01873:000000000-B9G3J:1:2106:21507:14943	35.39333333333333
+M01873:M01873:000000000-B9G3J:1:2101:22394:13872	36.85333333333333
+M01873:M01873:000000000-B9G3J:1:1110:19157:20344	36.21
+M01873:M01873:000000000-B9G3J:1:2103:19958:12449	36.193333333333335
+M01873:M01873:000000000-B9G3J:1:2104:19897:23367	29.08
+M01873:M01873:000000000-B9G3J:1:1101:10031:4758	25.656666666666666
+M01873:M01873:000000000-B9G3J:1:2118:6488:16393	32.29333333333334
+M01873:M01873:000000000-B9G3J:1:1117:6029:5428	31.486666666666668
+M01873:M01873:000000000-B9G3J:1:1108:22114:18127	35.16
+M01873:M01873:000000000-B9G3J:1:2106:6159:11549	34.583333333333336
+M01873:M01873:000000000-B9G3J:1:2103:16719:17340	35.35
+M01873:M01873:000000000-B9G3J:1:2114:13033:12027	36.723333333333336
+M01873:M01873:000000000-B9G3J:1:2107:25942:4834	33.74
+M01873:M01873:000000000-B9G3J:1:2119:12504:23408	18.963333333333335
+M01873:M01873:000000000-B9G3J:1:1101:10044:7123	27.913333333333334
+M01873:M01873:000000000-B9G3J:1:1101:10044:7141	36.49
+M01873:M01873:000000000-B9G3J:1:1110:5939:19097	15.253333333333334
+M01873:M01873:000000000-B9G3J:1:2102:22537:8542	36.48
+M01873:M01873:000000000-B9G3J:1:2116:7821:15323	37.17666666666667
+M01873:M01873:000000000-B9G3J:1:1101:10051:12996	33.68
+M01873:M01873:000000000-B9G3J:1:1107:13066:21126	36.49333333333333
+M01873:M01873:000000000-B9G3J:1:1117:12403:4599	35.61
+M01873:M01873:000000000-B9G3J:1:1117:22437:4121	27.93
+M01873:M01873:000000000-B9G3J:1:1114:14006:15367	27.58
+M01873:M01873:000000000-B9G3J:1:1109:25889:19697	36.083333333333336
+M01873:M01873:000000000-B9G3J:1:1112:3818:19684	29.916666666666668
+M01873:M01873:000000000-B9G3J:1:1114:10168:21472	32.96
+M01873:M01873:000000000-B9G3J:1:1114:16929:21025	33.81666666666667
+M01873:M01873:000000000-B9G3J:1:1101:10064:16602	21.236666666666668
+M01873:M01873:000000000-B9G3J:1:2106:19562:4616	35.02333333333333
+M01873:M01873:000000000-B9G3J:1:1101:10065:3493	33.87
+M01873:M01873:000000000-B9G3J:1:1106:24704:16447	34.77
+M01873:M01873:000000000-B9G3J:1:2111:9741:23838	29.996666666666666
+M01873:M01873:000000000-B9G3J:1:1101:10067:5517	22.196666666666665
+M01873:M01873:000000000-B9G3J:1:1114:20934:3692	34.156666666666666
+M01873:M01873:000000000-B9G3J:1:1110:6263:18595	4.633333333333334
+M01873:M01873:000000000-B9G3J:1:2107:3490:8582	35.58
+M01873:M01873:000000000-B9G3J:1:2115:10908:20804	36.04
+M01873:M01873:000000000-B9G3J:1:2110:7628:11014	30.58
+M01873:M01873:000000000-B9G3J:1:2103:6418:17742	34.62
+M01873:M01873:000000000-B9G3J:1:2105:10953:6580	26.606666666666666
+M01873:M01873:000000000-B9G3J:1:2112:10597:16621	17.69
+M01873:M01873:000000000-B9G3J:1:1110:22639:11539	36.946666666666665
+M01873:M01873:000000000-B9G3J:1:1113:10584:15580	30.843333333333334
+M01873:M01873:000000000-B9G3J:1:2109:27379:20759	21.363333333333333
+M01873:M01873:000000000-B9G3J:1:1109:21161:8210	23.756666666666668
+M01873:M01873:000000000-B9G3J:1:1113:6140:4661	30.123333333333335
+M01873:M01873:000000000-B9G3J:1:2119:26638:5460	18.403333333333332
+M01873:M01873:000000000-B9G3J:1:1114:9970:8638	34.403333333333336
+M01873:M01873:000000000-B9G3J:1:2108:9212:24235	9.846666666666666
+M01873:M01873:000000000-B9G3J:1:2117:24875:22401	33.276666666666664
+M01873:M01873:000000000-B9G3J:1:1107:8981:22378	37.07
+M01873:M01873:000000000-B9G3J:1:1101:10099:23047	26.883333333333333
+M01873:M01873:000000000-B9G3J:1:1101:10100:15992	36.97666666666667
+M01873:M01873:000000000-B9G3J:1:2107:8132:17450	35.51
+M01873:M01873:000000000-B9G3J:1:2119:20248:11282	35.39333333333333
+M01873:M01873:000000000-B9G3J:1:2106:2176:11695	31.24
+M01873:M01873:000000000-B9G3J:1:2115:23638:16692	30.536666666666665
+M01873:M01873:000000000-B9G3J:1:2106:9089:24713	14.486666666666666
+M01873:M01873:000000000-B9G3J:1:2118:8705:16266	35.18333333333333
+M01873:M01873:000000000-B9G3J:1:1101:10107:18394	35.18
+M01873:M01873:000000000-B9G3J:1:1109:5020:19893	9.443333333333333
+M01873:M01873:000000000-B9G3J:1:2111:7262:22830	32.763333333333335
+M01873:M01873:000000000-B9G3J:1:1101:10111:8693	36.35
+M01873:M01873:000000000-B9G3J:1:1106:7472:17358	33.33
+M01873:M01873:000000000-B9G3J:1:1113:11846:1631	34.223333333333336
+M01873:M01873:000000000-B9G3J:1:1113:28641:15469	32.24666666666667
+M01873:M01873:000000000-B9G3J:1:1101:10117:24419	26.013333333333332
+M01873:M01873:000000000-B9G3J:1:1101:10117:6605	35.48
+M01873:M01873:000000000-B9G3J:1:1107:11849:2638	35.236666666666665
+M01873:M01873:000000000-B9G3J:1:1117:12944:14016	29.513333333333332
+M01873:M01873:000000000-B9G3J:1:1111:27451:7271	36.026666666666664
+M01873:M01873:000000000-B9G3J:1:1101:10123:14211	6.546666666666667
+M01873:M01873:000000000-B9G3J:1:1116:19939:2288	20.55666666666667
+M01873:M01873:000000000-B9G3J:1:2113:3270:19150	8.15
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/prestor_logs/quality-2_table.tab	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,100 @@
+ID	QUALITY
+M01873:M01873:000000000-B9G3J:1:2116:20980:12498	29.67
+M01873:M01873:000000000-B9G3J:1:1117:17250:9432	25.023333333333333
+M01873:M01873:000000000-B9G3J:1:2108:14465:19705	32.56666666666667
+M01873:M01873:000000000-B9G3J:1:2111:3554:13238	24.566666666666666
+M01873:M01873:000000000-B9G3J:1:1112:28236:12457	34.11
+M01873:M01873:000000000-B9G3J:1:2103:2227:11139	21.66
+M01873:M01873:000000000-B9G3J:1:2110:13535:17883	26.336666666666666
+M01873:M01873:000000000-B9G3J:1:1115:18550:17263	22.80666666666667
+M01873:M01873:000000000-B9G3J:1:1119:21261:11479	33.166666666666664
+M01873:M01873:000000000-B9G3J:1:1101:10006:14034	24.683333333333334
+M01873:M01873:000000000-B9G3J:1:1106:23126:20933	10.25
+M01873:M01873:000000000-B9G3J:1:2111:10779:3698	3.82
+M01873:M01873:000000000-B9G3J:1:2112:20595:25092	13.696666666666667
+M01873:M01873:000000000-B9G3J:1:1112:18419:7621	22.47
+M01873:M01873:000000000-B9G3J:1:1101:10014:22200	19.913333333333334
+M01873:M01873:000000000-B9G3J:1:1109:19388:16328	30.983333333333334
+M01873:M01873:000000000-B9G3J:1:1111:16537:24486	25.916666666666668
+M01873:M01873:000000000-B9G3J:1:1110:23072:9989	29.606666666666666
+M01873:M01873:000000000-B9G3J:1:1101:10019:8146	30.643333333333334
+M01873:M01873:000000000-B9G3J:1:2101:11039:4739	29.723333333333333
+M01873:M01873:000000000-B9G3J:1:2104:24954:20771	30.80666666666667
+M01873:M01873:000000000-B9G3J:1:1111:12286:7157	35.70333333333333
+M01873:M01873:000000000-B9G3J:1:2116:17140:9378	32.31666666666667
+M01873:M01873:000000000-B9G3J:1:2105:17710:2946	28.526666666666667
+M01873:M01873:000000000-B9G3J:1:2106:21507:14943	32.93
+M01873:M01873:000000000-B9G3J:1:2101:22394:13872	30.053333333333335
+M01873:M01873:000000000-B9G3J:1:1110:19157:20344	31.81
+M01873:M01873:000000000-B9G3J:1:2103:19958:12449	33.696666666666665
+M01873:M01873:000000000-B9G3J:1:2104:19897:23367	24.073333333333334
+M01873:M01873:000000000-B9G3J:1:1101:10031:4758	23.17
+M01873:M01873:000000000-B9G3J:1:2118:6488:16393	33.013333333333335
+M01873:M01873:000000000-B9G3J:1:1117:6029:5428	26.97
+M01873:M01873:000000000-B9G3J:1:1108:22114:18127	16.926666666666666
+M01873:M01873:000000000-B9G3J:1:2106:6159:11549	31.326666666666668
+M01873:M01873:000000000-B9G3J:1:2103:16719:17340	31.11
+M01873:M01873:000000000-B9G3J:1:2114:13033:12027	31.45
+M01873:M01873:000000000-B9G3J:1:2107:25942:4834	25.716666666666665
+M01873:M01873:000000000-B9G3J:1:2119:12504:23408	2.0
+M01873:M01873:000000000-B9G3J:1:1101:10044:7123	24.01
+M01873:M01873:000000000-B9G3J:1:1101:10044:7141	29.516666666666666
+M01873:M01873:000000000-B9G3J:1:1110:5939:19097	11.76
+M01873:M01873:000000000-B9G3J:1:2102:22537:8542	32.196666666666665
+M01873:M01873:000000000-B9G3J:1:2116:7821:15323	33.943333333333335
+M01873:M01873:000000000-B9G3J:1:1101:10051:12996	29.043333333333333
+M01873:M01873:000000000-B9G3J:1:1107:13066:21126	34.43
+M01873:M01873:000000000-B9G3J:1:1117:12403:4599	30.363333333333333
+M01873:M01873:000000000-B9G3J:1:1117:22437:4121	21.01
+M01873:M01873:000000000-B9G3J:1:1114:14006:15367	26.55666666666667
+M01873:M01873:000000000-B9G3J:1:1109:25889:19697	17.423333333333332
+M01873:M01873:000000000-B9G3J:1:1112:3818:19684	23.753333333333334
+M01873:M01873:000000000-B9G3J:1:1114:10168:21472	28.79
+M01873:M01873:000000000-B9G3J:1:1114:16929:21025	30.886666666666667
+M01873:M01873:000000000-B9G3J:1:1101:10064:16602	20.37
+M01873:M01873:000000000-B9G3J:1:2106:19562:4616	29.55
+M01873:M01873:000000000-B9G3J:1:1101:10065:3493	31.37
+M01873:M01873:000000000-B9G3J:1:1106:24704:16447	32.38666666666666
+M01873:M01873:000000000-B9G3J:1:2111:9741:23838	23.496666666666666
+M01873:M01873:000000000-B9G3J:1:1101:10067:5517	24.44
+M01873:M01873:000000000-B9G3J:1:1114:20934:3692	30.716666666666665
+M01873:M01873:000000000-B9G3J:1:1110:6263:18595	8.323333333333334
+M01873:M01873:000000000-B9G3J:1:2107:3490:8582	26.033333333333335
+M01873:M01873:000000000-B9G3J:1:2115:10908:20804	33.656666666666666
+M01873:M01873:000000000-B9G3J:1:2110:7628:11014	24.786666666666665
+M01873:M01873:000000000-B9G3J:1:2103:6418:17742	32.39333333333333
+M01873:M01873:000000000-B9G3J:1:2105:10953:6580	29.47
+M01873:M01873:000000000-B9G3J:1:2112:10597:16621	18.37
+M01873:M01873:000000000-B9G3J:1:1110:22639:11539	28.09
+M01873:M01873:000000000-B9G3J:1:1113:10584:15580	15.64
+M01873:M01873:000000000-B9G3J:1:2109:27379:20759	15.06
+M01873:M01873:000000000-B9G3J:1:1113:6140:4661	29.05
+M01873:M01873:000000000-B9G3J:1:1109:21161:8210	4.193333333333333
+M01873:M01873:000000000-B9G3J:1:2119:26638:5460	23.376666666666665
+M01873:M01873:000000000-B9G3J:1:1114:9970:8638	33.446666666666665
+M01873:M01873:000000000-B9G3J:1:2108:9212:24235	5.066666666666666
+M01873:M01873:000000000-B9G3J:1:2117:24875:22401	23.326666666666668
+M01873:M01873:000000000-B9G3J:1:1107:8981:22378	33.53
+M01873:M01873:000000000-B9G3J:1:1101:10099:23047	27.39666666666667
+M01873:M01873:000000000-B9G3J:1:1101:10100:15992	34.35
+M01873:M01873:000000000-B9G3J:1:2107:8132:17450	32.07666666666667
+M01873:M01873:000000000-B9G3J:1:2119:20248:11282	34.983333333333334
+M01873:M01873:000000000-B9G3J:1:2106:2176:11695	24.333333333333332
+M01873:M01873:000000000-B9G3J:1:2106:9089:24713	13.333333333333334
+M01873:M01873:000000000-B9G3J:1:2115:23638:16692	31.426666666666666
+M01873:M01873:000000000-B9G3J:1:2118:8705:16266	31.72
+M01873:M01873:000000000-B9G3J:1:1101:10107:18394	29.726666666666667
+M01873:M01873:000000000-B9G3J:1:1109:5020:19893	5.23
+M01873:M01873:000000000-B9G3J:1:2111:7262:22830	27.933333333333334
+M01873:M01873:000000000-B9G3J:1:1101:10111:8693	28.463333333333335
+M01873:M01873:000000000-B9G3J:1:1106:7472:17358	32.08
+M01873:M01873:000000000-B9G3J:1:1113:11846:1631	24.973333333333333
+M01873:M01873:000000000-B9G3J:1:1113:28641:15469	30.41
+M01873:M01873:000000000-B9G3J:1:1101:10117:24419	22.316666666666666
+M01873:M01873:000000000-B9G3J:1:1101:10117:6605	32.3
+M01873:M01873:000000000-B9G3J:1:1107:11849:2638	32.50333333333333
+M01873:M01873:000000000-B9G3J:1:1117:12944:14016	26.413333333333334
+M01873:M01873:000000000-B9G3J:1:1111:27451:7271	27.006666666666668
+M01873:M01873:000000000-B9G3J:1:1101:10123:14211	2.37
+M01873:M01873:000000000-B9G3J:1:1116:19939:2288	21.436666666666667
+M01873:M01873:000000000-B9G3J:1:2113:3270:19150	5.403333333333333
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/read1_primers.fasta	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,18 @@
+>Human-IGHM
+GAATTCTCACAGGAGACGAGG
+>Human-IGHD
+TGTCTGCACCCTGATATGATGG
+>Human-IGHA
+GGGTGCTGYMGAGGCTCAG
+>Human-IGHE
+TTGCAGCAGCGGGTCAAGG
+>Human-IGHG
+CCAGGGGGAAGACSGATG
+>Human-IGK
+GACAGATGGTGCAGCCACAG
+>Human-IGL
+AGGGYGGGAACAGAGTGAC
+>Human-TRA
+CACGGCAGGGTCAGGGTTC
+>Human-TRB
+CGACCTCGGGTGGGAACAC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/read2_primers.fasta	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,10 @@
+>TS-shift0
+TACGGG
+>TS-shift1
+ATACGGG
+>TS-shift2
+TCTACGGG
+>TS-shift3
+CGATACGGG
+>TS-shift4
+GATCTACGGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/reference_repertoire.fasta	Wed May 30 15:35:32 2018 -0400
@@ -0,0 +1,3250 @@
+>IGHV1-18*01
+caggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcag
+agtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
+>IGHV1-18*02
+caggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcag
+agtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctaagatctgacgacacggcc
+>IGHV1-18*03
+caggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcag
+agtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacatggccgtgtattactgtgcgagaga
+>IGHV1-18*04
+caggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctacggta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcag
+agtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
+>IGHV1-2*01
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactata
+tgcactgggtgcgacaggcccctggacaagggcttgagtggatgggacggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcag
+ggtcaccagtaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggtcgtgtattactgtgcgagaga
+>IGHV1-2*02
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactata
+tgcactgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcag
+ggtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggccgtgtattactgtgcgagaga
+>IGHV1-2*03
+caggtgcagctggtgcagtctggggctgaggtgaagaagcttggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactata
+tgcactgggtgcnacaggcccctggacaagggcttgagtggatgggatggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcag
+ggtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggccgtgtattactgtgcgagaga
+>IGHV1-2*04
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactata
+tgcactgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggctg
+ggtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggccgtgtattactgtgcgagaga
+>IGHV1-2*05
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactata
+tgcactgggtgcgacaggcccctggacaagggcttgagtggatgggacggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcag
+ggtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggtcgtgtattactgtgcgagaga
+>IGHV1-24*01
+caggtccagctggtacagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggtttccggatacaccctcactgaattatcca
+tgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcag
+agtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcaacaga
+>IGHV1-3*01
+caggtccagcttgtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtttcctgcaaggcttctggatacaccttcactagctatgcta
+tgcattgggtgcgccaggcccccggacaaaggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcag
+agtcaccattaccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtgcgagaga
+>IGHV1-3*02
+caggttcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtttcctgcaaggcttctggatacaccttcactagctatgcta
+tgcattgggtgcgccaggcccccggacaaaggcttgagtggatgggatggagcaacgctggcaatggtaacacaaaatattcacaggagttccagggcag
+agtcaccattaccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaggacatggctgtgtattactgtgcgagaga
+>IGHV1-38-4*01
+caggtccagctggtgcagtcttgggctgaggtgaggaagtctggggcctcagtgaaagtctcctgtagtttttctgggtttaccatcaccagctacggta
+tacattgggtgcaacagtcccctggacaagggcttgagtggatgggatggatcaaccctggcaatggtagcccaagctatgccaagaagtttcagggcag
+attcaccatgaccagggacatgtccacaaccacagcctacacagacctgagcagcctgacatctgaggacatggctgtgtattactatgcaagaca
+>IGHV1-45*01
+cagatgcagctggtgcagtctggggctgaggtgaagaagactgggtcctcagtgaaggtttcctgcaaggcttccggatacaccttcacctaccgctacc
+tgcactgggtgcgacaggcccccggacaagcgcttgagtggatgggatggatcacacctttcaatggtaacaccaactacgcacagaaattccaggacag
+agtcaccattactagggacaggtctatgagcacagcctacatggagctgagcagcctgagatctgaggacacagccatgtattactgtgcaagana
+>IGHV1-45*02
+cagatgcagctggtgcagtctggggctgaggtgaagaagactgggtcctcagtgaaggtttcctgcaaggcttccggatacaccttcacctaccgctacc
+tgcactgggtgcgacaggcccccggacaagcgcttgagtggatgggatggatcacacctttcaatggtaacaccaactacgcacagaaattccaggacag
+agtcaccattaccagggacaggtctatgagcacagcctacatggagctgagcagcctgagatctgaggacacagccatgtattactgtgcaagata
+>IGHV1-45*03
+agaagactgggtcctcagtgaaggtttcctgcaaggcttccggatacaccttcacctaccgctacctgcactgggtgcgacaggcccccagacaagcgct
+tgagtggatgggatggatcacacctttcaatggtaacaccaactacgcacagaaattccaggacagagtcaccattaccagggacaggtctatgagcaca
+gcctacatggagctgagcagcctgagatctgaggacacagccatgtattactgtgcaaga
+>IGHV1-46*01
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtttcctgcaaggcatctggatacaccttcaccagctactata
+tgcactgggtgcgacaggcccctggacaagggcttgagtggatgggaataatcaaccctagtggtggtagcacaagctacgcacagaagttccagggcag
+agtcaccatgaccagggacacgtccacgagcacagtctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-46*02
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtttcctgcaaggcatctggatacaccttcaacagctactata
+tgcactgggtgcgacaggcccctggacaagggcttgagtggatgggaataatcaaccctagtggtggtagcacaagctacgcacagaagttccagggcag
+agtcaccatgaccagggacacgtccacgagcacagtctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-46*03
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtttcctgcaaggcatctggatacaccttcaccagctactata
+tgcactgggtgcgacaggcccctggacaagggcttgagtggatgggaataatcaaccctagtggtggtagcacaagctacgcacagaagttccagggcag
+agtcaccatgaccagggacacgtccacgagcacagtctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgctagaga
+>IGHV1-58*01
+caaatgcagctggtgcagtctgggcctgaggtgaagaagcctgggacctcagtgaaggtctcctgcaaggcttctggattcacctttactagctctgctg
+tgcagtgggtgcgacaggctcgtggacaacgccttgagtggataggatggatcgtcgttggcagtggtaacacaaactacgcacagaagttccaggaaag
+agtcaccattaccagggacatgtccacaagcacagcctacatggagctgagcagcctgagatccgaggacacggccgtgtattactgtgcggcaga
+>IGHV1-58*02
+caaatgcagctggtgcagtctgggcctgaggtgaagaagcctgggacctcagtgaaggtctcctgcaaggcttctggattcacctttactagctctgcta
+tgcagtgggtgcgacaggctcgtggacaacgccttgagtggataggatggatcgtcgttggcagtggtaacacaaactacgcacagaagttccaggaaag
+agtcaccattaccagggacatgtccacaagcacagcctacatggagctgagcagcctgagatccgaggacacggccgtgtattactgtgcggcaga
+>IGHV1-68*01
+caggtgcagctggggcagtctgaggctgaggtaaagaagcctggggcctcagtgaaggtctcctgcaaggcttccggatacaccttcacttgctgctcct
+tgcactggttgcaacaggcccctggacaagggcttgaaaggatgagatggatcacactttacaatggtaacaccaactatgcaaagaagttccagggcag
+agtcaccattaccagggacatgtccctgaggacagcctacatagagctgagcagcctgagatctgaggactcggctgtgtattactgggcaagata
+>IGHV1-69*01
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*02
+caggtccagctggtgcaatctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatacta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatccttggtatagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgaga
+>IGHV1-69*03
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgatgacacggc
+>IGHV1-69*04
+caggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatccttggtatagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*05
+caggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcag
+agtcacgattaccacggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgaga
+>IGHV1-69*06
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*07
+agaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggct
+tgagtggatgggaaggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcaca
+gcctacatggagctgagcagcctgagatctgag
+>IGHV1-69*08
+caggtccagctggtgcaatctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatacta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatccttggtacagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*09
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatccttggtatagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*10
+caggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcagtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatccttggtatagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*11
+caggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatccttggtacagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*12
+caggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*13
+caggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcagtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*14
+caggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69-2*01
+gaggtccagctggtacagtctggggctgaggtgaagaagcctggggctacagtgaaaatctcctgcaaggtttctggatacaccttcaccgactactaca
+tgcactgggtgcaacaggcccctggaaaagggcttgagtggatgggacttgttgatcctgaagatggtgaaacaatatacgcagagaagttccagggcag
+agtcaccataaccgcggacacgtctacagacacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcaacaga
+>IGHV1-69-2*02
+agaagcctggggctacagtgaaaatctcctgcaaggtttctggatacaccttcaccgactactacatgcactgggtgcaacaggcccctggaaaagggct
+tgagtggatgggacttgttgatcctgaagatggtgaaacaatatatgcagagaagttccagggcagagtcaccataaccgcggacacgtctacagacaca
+gcctacatggagctgagcagcctgagatctgag
+>IGHV1-69D*01
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgcta
+tcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcag
+agtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-8*01
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccagttatgata
+tcaactgggtgcgacaggccactggacaagggcttgagtggatgggatggatgaaccctaacagtggtaacacaggctatgcacagaagttccagggcag
+agtcaccatgaccaggaacacctccataagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagagg
+>IGHV1-8*02
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccagctatgata
+tcaactgggtgcgacaggccactggacaagggcttgagtggatgggatggatgaaccctaacagtggtaacacaggctatgcacagaagttccagggcag
+agtcaccatgaccaggaacacctccataagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagagg
+>IGHV1-NL1*01
+caggttcagctgttgcagcctggggtccaggtgaagaagcctgggtcctcagtgaaggtctcctgctaggcttccagatacaccttcaccaaatacttta
+cacggtgggtgtgacaaagccctggacaagggcatnagtggatgggatgaatcaacccttacaacgataacacacactacgcacagacgttctggggcag
+agtcaccattaccagtgacaggtccatgagcacagcctacatggagctgagcngcctgagatccgaagacatggtcgtgtattactgtgtgagaga
+>IGHV1/OR15-1*01
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacatcttcaccgactactata
+tgcactgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcag
+agtcaccatgaccagggacacgtccatcagcacagcctacacggagctgagcagcctgagatctgaggacacggccacgtattactgtgcgaga
+>IGHV1/OR15-1*02
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacatcttcaccgactactata
+tgcactgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcag
+agtcaccatgaccagggacacgtccatcagcacagcctgcacggagctgagcagcctgagatctgaggacacggccacgtattactgtgcgagaga
+>IGHV1/OR15-1*03
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacatcttcaccgactactata
+tgcactgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcag
+agtcaccatgaccagggacacgtccatcagcacagcctacacggagctgagcagcctgagatctgaggacacagccacgtattactgtgcgagaga
+>IGHV1/OR15-1*04
+caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacatcttcaccgactactata
+tgcactgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcag
+agtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcagcctgagatctgaggacacggccacgtattactgtgcgagaga
+>IGHV1/OR15-2*01
+caggtgcagctggtgcagtctggagctgaggtgaagaagcctagagcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctactata
+tgcactgggtgtgacaggcccctgaacaagggcttgagtggatgggatggatcaacacttacaatggtaacacaaactacccacagaagctccagggcag
+agtcaccatgaccagagacacatccacgagcacagcctacatggagctgagcaggctgagatctgacgacatggccgtgtattactgtgcgagaga
+>IGHV1/OR15-2*02
+caggtgcagctggtgcagtctggagctgaggtgaagaagcctggagcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctactata
+tgcactgggtgtgacaggcccctgaacaagggcttgagtggatgggatggatcaacacttacaatggtaacacaaactacccacagaagctccagggcag
+agtcaccatgaccagagacacatccacgagcacagcctacatggagctgagcagcctgagatctgacgacatggccgtgtattactgtgcgagaga
+>IGHV1/OR15-2*03
+caggtgcagctggtgcagtctggagctgaggtgaagaagcctagagcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctactata
+tgcactgggtgtgacaggcccctgaacaagggcttgagtggatgggatggatcaacacttacaatggtaacacaaactacccacagaagctccagggcag
+agtcaccatgaccagagacacatccacgagcacagcctacatggagctgagcagcctgagatctgacgacatggccgtgtattactgtgcgagaga
+>IGHV1/OR15-3*01
+caggtccaactggtgtagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccgactacttta
+tgaactggatgcgccaggcccctggacaaaggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagctccagggcag
+agtcaccattaccagggacacatcttcgagcacagcctacatgcagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgaga
+>IGHV1/OR15-3*02
+caggtccaactggtgtagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccgactacttta
+tgaactggatgcgccaggcccctggacaaaggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagctccagggcag
+agtcaccattaccagggacacatctgcgagcacagcctacatgcagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1/OR15-3*03
+caggtccaactggtgtagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccagctactata
+tgaactggatgcgccaggcccctggacaaggcttcgagtggatgggatggatcaacgctggcaatggtaacacaaagtattcacagaagctccagggcag
+agtcaccattac