view test-data/chr_m.fasta @ 13:0dbf49c414ae draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools/samtools_view commit 1354b1358df89a922c3243f7e27ce789094b8644"
author iuc
date Sun, 19 Dec 2021 15:58:19 +0000
parents 00d1f08bdcdc
children
line wrap: on
line source

>chrM
GTTAATGTAGCTTAATAATATAAAGCAAGGCACTGAAAATGCCTAGATGA
GTATTCTTACTCCATAAACACATAGGCTTGGTCCTAGCCTTTTTATTAGT
TATTAATAGAATTACACATGCAAGTATCCGCACCCCAGTGAGAATGCCCT
CTAAATCACGTCTCTACGATTAAAAGGAGCAGGTATCAAGCACACTAGAA
AGTAGCTCATAACACCTTGCTCAGCCACACCCCCACGGGACACAGCAGTG
ATAAAAATTAAGCTATGAACGAAAGTTCGACTAAGTCATATTAAATAAGG
GTTGGTAAATTTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAATTA
ATAAATCTCCGGCGTAAAGCGTGTCAAAGACTAATACCAAAATAAAGTTA
AAACCCAGTTAAGCCGTAAAAAGCTACAACCAAAGTAAAATAGACTACGA
AAGTGACTTTAATACCTCTGACTACACGATAGCTAAGACCCAAACTGGGA
TTAGATACCCCACTATGCTTAGCCCTAAACTAAAATAGCTTACCACAACA
AAGCTATTCGCCAGAGTACTACTAGCAACAGCCTAAAACTCAAAGGACTT
GGCGGTGCTTTACATCCCTCTAGAGGAGCCTGTTCCATAATCGATAAACC
CCGATAAACCCCACCATCCCTTGCTAATTCAGCCTATATACCGCCATCTT
CAGCAAACCCTAAACAAGGTACCGAAGTAAGCACAAATATCCAACATAAA
AACGTTAGGTCAAGGTGTAGCCCATGGGATGGAGAGAAATGGGCTACATT
TTCTACCCTAAGAACAAGAACTTTAACCCGGACGAAAGTCTCCATGAAAC
TGGAGACTAAAGGAGGATTTAGCAGTAAATTAAGAATAGAGAGCTTAATT
GAATCAGGCCATGAAGCGCGCACACACCGCCCGTCACCCTCCTTAAATAT
CACAAATCATAACATAACATAAAACCGTGACCCAAACATATGAAAGGAGA
CAAGTCGTAACAAGGTAAGTATACCGGAAGGTGTACTTGGATAACCAAAG
TGTAGCTTAAACAAAGCATCCAGCTTACACCTAGAAGATTTCACTCAAAA
TGAACACTTTGAACTAAAGCTAGCCCAAACAATACCTAATTCAATTACCC
TTAGTCACTTAACTAAAACATTCACCAAACCATTAAAGTATAGGAGATAG
AAATTTTAACTTGGCGCTATAGAGAAAGTACCGTAAGGGAACGATGAAAG
ATGCATTAAAAGTACTAAACAGCAAAGCTTACCCCTTTTACCTTTTGCAT
AATGATTTAACTAGAATAAACTTAGCAAAGAGAACTTAAGCTAAGCACCC
CGAAACCAGACGAGCTACCTATGAACAGTTACAAATGAACCAACTCATCT
ATGTCGCAAAATAGTGAGAAGATTCGTAGGTAGAGGTGAAAAGCCCAACG
AGCCTGGTGATAGCTGGTTGTCCAGAAACAGAATTTCAGTTCAAATTTAA
ATTTACCTAAAAACTACTCAATTCTAATGTAAATTTAAATTATAGTCTAA
AAAGGTACAGCTTTTTAGATACAGGTTACAACCTTCATTAGAGAGTAAGA
ACAAGATAAACCCATAGTTGGCTTAAAAGCAGCCATCAATTAAGAAAGCG
TTCAAGCTCAACGACACATCTATCTTAATCCCAACAATCAACCCAAACTA
ACTCCTAATCTCATACTGGACTATTCTATCAACACATAGAAGCAATAATG
TTAATATGAGTAACAAGAATTATTTCTCCTTGCATAAGCTTATATCAGAA
CGAATACTCACTGATAGTTAACAACAAGATAGGGATAATCCAAAAACTAA
TCATCTATTTAAACCATTGTTAACCCAACACAGGCATGCATCTATAAGGA
AAGATTAAAAGAAGTAAAAGGAACTCGGCAAACACAAACCCCGCCTGTTT
ACCAAAAACATCACCTCTAGCATTTCCAGTATTAGAGGCACTGCCTGCCC
AGTGACATCTGTTtaaacggccgcggtatcctaaccgtgcaaaggtagca
taatcacttgttccctaaatagggacttgtatgaatggccacacgagggt
tttactgtctcttacttccaatcagtgaaattgaccttcccgtgaagagg
cgggaatgactaaataagacgagaagaccctatggagcttTAATTAACTG
ATTCACAAAAAACAACACACAAACCTTAACCTTCAGGGACAACAAAACTT
TTGATTGAATCAGCAATTTCGGTTGGGGTGACCTCGGAGAACAAAACAAC
CTCCGAGTGATTTAAATCCAGACTAACCAGTCAAAATATATAATCACTTA
TTGATCCAAACCATTGATCAACGGAACAAGTTACCCTAGGGATAACAGCG
CAATCCTATTCCAGAGTCCATATCGACAATTAGGGTTTACGACCTCGATG
TTGGATCAAGACATCCTAATGGTGCAACCGCTATTAAGGGTTCGTTTGTT
CAACGATTAAAGTCTTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGT
CGGTTTCTATCTATTCTATACTTTTCCCAGTACGAAAGGACAAGAAAAGT
AGGGCCCACTTTACAAGAAGCGCCCTCAAACTAATAGATGACATAATCTA
AATCTAACTAATTTATAACTTCTACCGCCCTAGAACAGGGCTCgttaggg
tggcagagcccggaaattgcataaaacttaaacctttacactcagaggtt
caactcctctccctaacaacaTGTTCATAATTAACGTCCTCCTCCTAATT
GTCCCAATCTTGCTCGCCGTAGCATTCCTCACACTAGTTGAACGAAAAGT
CTTAGGCTATATGCAACTTCGCAAAGGACCCAACATCGTAGGCCCCTATG
GCCTACTACAACCTATTGCCGATGCCCTCAAACTATTTATCAAAGAGCCA
CTACAACCACTAACATCATCGACATCCATATTCATCATCGCACCAATCCT
AGCCCTAACCCTGGCCTTAACCATATGAATCCCTCTGCCCATACCATACC
CACTAATCAACATAAACCTAGGAATTCTATTCATACTAGCCATGTCCAGC
CTAGCTGTCTACTCAATCCTTTGATCAGGATGGGCCTCAAACTCAAAATA
CGCCCTAATTGGAGCTCTACGAGCAGTAGCACAAACCATCTCATACGAAG
TAACTCTAGCAATCATCCTACTCTCAGTCCTCCTAATAAGCGGATCATTC
ACATTATCAACACTTATTATTACCCAAGAATACCTCTGATTAATCTTCCC
ATCATGACCCTTAGCCATAATGTGATTCATCTCAACATTAGCCGAAACCA
ACCGAGCTCCATTTGACCTAACAGAAGGAGAATCAGAACTCGTCTCTGGA
TTCAACGTTGAATACGCAGCCGGCCCATTTGCTCTATTCTTCCTAGCAGA
ATACGCAAACATCATCATGATAAACATCTTCACAACAACCCTATTTCTAG
GAGCATTTCACAACCCCTACCTGCCAGAACTCTACTCAATTAATTTCACC
ATTAAAGCTCTCCTTCTAACATGTTCCTTCCTATGAATCCGAGCATCCTA
CCCACGATTCCGATATGACCAACTTATACACCTCCTATGAAAGAACTTCC
TACCACTCACACTAGCCCTCTGCATATGACACGTCTCACTTCCAATCATA
CTATCCAGCATCCCACCACAAACATAGGAAATATGTCTGACAAAAGAGTT
ACTTTGATAGAGTAAAACATAGAGGCTCAAACCCTCTTATTTctagaact
acaggaattgaacctgctcctgagaattcaaaatcctccgtgctaccgaa
ttacaccatgtcctaCAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCAT
ACCCCGAAAATGTTGGATTACACCCTTCCCGTACTAATAAATCCCCTTAT
CTTCACAACTATTCTAATAACAGTTCTTCTAGGAACTATAATCGTTATAA
TAAGCTCACACTGACTAATAATCTGAATCGGATTTGAAATAAATCTACTA
GCCATTATCCCTATCCTAATAAAAAAGTACAATCCCCGAACCATAGAAGC
CTCCACCAAATATTTTCTAACCCAAGCCACCGCATCAATACTCCTCATAA
TAGCGATCATCATTAACCTCATACACTCAGGCCAATGAACAATCACAAAA
GTCTTCAACCCCACAGCGTCCATCATTATAACTTCAGCTCTCGCCATAAA
ACTTGGACTCACACCATTCCACTTCTGAGTACCCGAAGTCACACAGGGCA
TCTCATTAACATCAGGTCTCATCCTACTTACATGACAAAAACTAGCCCCA
ATATCAATCCTATATCAAATCTCACCCTCAATTAACCTAAATATCTTATT
AACTATAGCCGTACTGTCAATCCTAGTAGGAGGCTGAGGCGGTCTCAACC
AAACCCAACTACGAAAAATCATAGCATACTCGTCAATCGCGCATATAGGA
TGAATAACAGCTGTCCTAGTATATAACCCAACACTAACAATACTAAACAT
ATTAATTTACATTATAATAACACTCACAATATTCATACTATTTATCCACA
GCTCCTCTACTACAACACTATCACTCTCCCACACATGAAACAAAATACCT
CTAACCACTACACTAATCTTAATTACCTTACTATCCATAGGAGGCCTCCC
CCCACTATCAGGATTCATACCCAAATGAATAATCATTCAAGAGCTCACCA
AAAATAGCAGCATCATCCTCCCCACACTAATAGCCATTATAGCACTACTC
AACCTCTACTTCTACATACGACTAACCTATTCCACCTCACTGACCATATT
CCCATCCACAAACAACATAAAAATAAAATGACAATTCGAAACCAAACGAA
TTACTCTCTTACCCCCGTTAATTGTTATATCCTCCCTACTCCTCCCCCTA
ACCCCCATACTATCAATTTTGGACTAGGAATTTAGGTTAACATCCCAGAC
CAAGAGCCTTCAAAGCTCTAAGCAAGTGAATCCACTTAATTCCTGCATAC
TAAGGACTGCGAGACTCTATCTCACATCAATTGAACGCAAATCAAACTCT
TTTATTAAGCTAAGCCCTTACTAGATTGGTGGGCTACCATCCCACGAAAT
TTTAGTTAACAGCTAAATACCCTAATCAACTGGCTTCAATCTACTTCTCC
CGCCGCCTAGAAAAAAAGGCGGGAGAAGCCCCGGCAGAAATTGAAGCTGC
TCCTTTGAATTTGCAATTCAATGTGAAAATTCACCACGGGACTTGATAAG
AAGAGGATTCCAACCCCTGTCTTTAGATTTACAGTCTAATGCTTACTCAG
CCATCTTACCTATGTTCATCAACCGCTGACTATTTTCAACTAACCACAAA
GACATCGGCACTCTGTACCTCCTATTCGGCGCTTGAGCTGGAATAGTAGG
AACTGCCCTAAGCCTCCTAATCCGTGCTGAATTAGGCCAACCTGGGACCC
TACTAGGAGATGATCAGATCTACAATGTCATTGTAACCGCCCATGCATTC
GTAATAATTTTCTTTATGGTCATACCCATTATAATCGGAGGATTCGGAAA
CTGATTAGTCCCCCTGATAATTGGAGCACCTGATATAGCTTTCCCCCGAA
TAAACAACATAAGCTTCTGATTACTTCCCCCATCATTCCTACTTCTTCTC
GCTTCCTCAATAATTGAAGCAGGTGCCGGAACAGGCTGAACCGTATATCC
TCCTCTAGCTGGAAATCTGGCGCATGCAGGAGCCTCTGTTGACTTAACCA
TTTTCTCTCTCCACCTAGCTGGGGTGTCCTCGATTTTAGGTGCCATCAAC
TTTATTACCACAATCATTAACATAAAACCACCAGCCCTATCCCAATATCA
AACCCCCCTATTCGTTTGATCTGTCCTTATTACGGCAGTACTCCTTCTCC
TAGCCCTCCCGGTCCTAGCAGCAGGCATTACCATGCTTCTCACAGACCGT
AACCTGAACACTACTTTCTTCGACCCCGCAGGAGGAGGGGATCCAATCCT
TTATCAACACCTATTCTGATTCTTCGGACACCCCGAAGTCTATATTCTTA
TCCTACCAGGCTTCGGTATAATCTCACACATCGTCACATACTACTCAGGT
AAAAAGGAACCTTTTGGCTACATGGGTATAGTGTGAGCTATAATATCCAT
TGGCTTTCTAGGCTTCATCGTATGGGCTCACCACATGTTTACAGTAGGGA
TAGACGTTGACACACGAGCATACTTCACATCAGCTACCATAATCATCGCT
ATCCCTACTGGTGTAAAAGTATTCAGCTGACTAGCCACCCTGCACGGAGG
AAATATCAAATGATCTCCAGCTATACTCTGAGCTCTAGGCTTCATCTTCT
TATTCACAGTAGGAGGTCTAACAGGAATCGTCCTAGCTAACTCATCCCTA
GATATTGTTCTCCACGATACTTATTATGTAGTAGCACATTTCCATTATGT
CCTGTCTATAGGAGCAGTCTTCGCCATTATGGGGGGATTTGTACACTGAT
TCCCTCTATTCTCAGGATACACACTCAACCAAACCTGAGCAAAAATCCAC
TTTACAATTATATTCGTAGGGGTAAATATAACCTTCTTCCCACAACATTT
CCTTGGCCTCTCAGGAATGCCACGACGCTATTCTGATTATCCAGACGCAT
ATACAACATGAAATACCATCTCATCCATAGGATCTTTTATCTCACTTACA
GCAGTGATACTAATAATTTTCATAATTTGAGAAGCGTTCGCATCCAAACG
AGAAGTGTCTACAGTAGAATTAACCTCAACTAATCTGGAATGACTACACG
GATGCCCCCCACCATACCACACATTTGAAGAACCCACCTACGTAAACCTA
AAAtaagaaaggaaggaatcgaaccccctctaactggtttcaagccaata
tcataaccactatgtctttctcCATCAATTGAGGTATTAGTAAAAATTAC
ATGACTTTGTCAAAGTTAAATTATAGGTTAAACCCCTATATACCTCTATG
GCCTACCCCTTCCAACTAGGATTCCAAGACGCAACATCCCCTATTATAGA
AGAACTCCTACACTTCCACGACCACACACTAATAATCGTATTCCTAATTA
GCTCTCTAGTATTATATATTATCTCATCAATACTAACAACTAAATTAACC
CATACCAGCACCATAGATGCTCAAGAAGTAGAGACAATTTGAACGATTTT
ACCAGCCATCATCCTTATTCTAATCGCCCTCCCATCCCTACGAATTCTAT
ATATAATAGATGAAATCAATAATCCGTCCCTCACAGTCAAAACAATAGGC
CACCAATGATACTGAAGCTACGAGTATACCGATTACGAAGACTTGACCTT
TGACTCCTACATGATCCCCACATCAGACCTAAAACCAGGAGAATTACGTC
TTCTAGAAGTCGACAATCGAGTGGTTCTCCCCATAGAAATAACCATCCGA
ATGCTAATTTCATCCGAAGACGTCCTACACTCATGAGCTGTGCCCTCCCT
AGGCCTAAAAACAGACGCTATCCCTGGGCGCCTAAATCAGACAACTCTCG
TGGCCTCTCGACCAGGACTTTACTACGGTCAATGCTCAGAGATCTGCGGA
TCAAACCACAGCTTTATACCAATTGTCCTTGAACTAGTTCCACTGAAACA
CTTCGAAGAATGATCTGCATCAATATTATAAAGTCACTAAGAAGCTATTA
TAGCATTAACCTTTTAAGTTAAAGATTGAGGGTTCAACCCCCTCCCTAGT
GATATGCCACAGTTGGATACATCAACATGATTTATTAATATCGTCTCAAT
AATCCTAACTCTATTTATTGTATTTCAACTAAAAATCTCAAAGCACTCCT
ATCCGACACACCCAGAAGTAAAGACAACCAAAATAACAAAACACTCTGCC
CCTTGAGAATCAAAATGAACGAAAATCTATTCGCCTCTTTCGCTACCCCA
ACAATAGTAGGCCTCCCTATTGTAATTCTGATCATCATATTTCCCAGCAT
CCTATTCCCCTCACCCAACCGACTAATCAACAATCGCCTAATCTCAATTC
AACAATGGCTAGTCCAACTTACATCAAAACAAATAATAGCTATCCATAAC
AGCAAAGGACAAACCTGAACTCTTATACTCATATCACTGATCCTATTCAT
TGGCTCAACAAACTTATTAGGCCTACTACCTCACTCATTTACACCAACAA
CACAACTATCAATAAACCTAGGCATAGCTATTCCCCTATGGGCAGGGACA
GTATTCATAGGCTTTCGTCACAAAACAAAAGCAGCCCTAGCCCACTTTCT
ACCTCAAGGGACGCCCATTTTCCTCATCCCCATACTAGTAATTATCGAGA
CTATCAGCCTATTTATTCAACCTGTAGCCCTAGCCGTGCGGCTAACCGCT
AACATTACCGCCGGACACCTCCTAATACACCTCATCGGAGGGGCAACACT
AGCCCTCATAAGCATCAGCCCCTCAACAGCCCTTATTACGTTTATCATCC
TAATTCTACTAACTATCCTCGAATTCGCAGTAGCTATAATCCAAGCCTAC
GTATTCACTCTCCTGGTAAGCCTTTACTTACACGACAACACCTAATGACC
CACCAAACCCACGCTTACCACATAGTAAACCCCAGCCCATGACCACTTAC
AGGAGCCCTATCAGCCCTCCTGATAACATCAGGACTAGCCATGTGATTTC
ACTTTAACTCAACCTTACTTCTAGCTATAGGGCTATTAACTAACATCCTT
ACCATATATCAATGATGACGAGACATCATCCGAGAAAGCACATTCCAAGG
CCATCACACATCAATCGTTCAAAAGGGACTCCGATATGGCATAATCCTTT
TTATTATCTCAGAAGTCTTCTTCTTCTCTGGCTTCTTCTGAGCCTTTTAC
CACTCAAGCCTAGCCCCCACACCCGAACTAGGCGGCTGCTGACCACCCAC
AGGTATCCACCCCTTAAACCCCCTAGAAGTCCCCTTACTCAACACCTCAG
TGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCACCATAGCCTAATA
GAAGGAAACCGTAAAAATATGCTCCAAGGCCTATTCATCACAATTTCACT
AGGCGTATACTTCACCCTTCTCCAAGCCTCAGAATACTATGAAGCCTCAT
TTACTATTTCAGATGGAGTATACGGATCAACATTTTTCGTAGCAACAGGG
TTCCACGGACTACACGTAATTATCGGATCTACCTTCCTCATTGTATGTTT
CCTACGCCAACTAAAATTCCACTTTACATCCAGCCACCACTTCGGATTCG
AAGCAGCCGCTTGATACTGACACTTCGTCGACGTAGTCTGACTATTCTTG
TACGTCTCTATTTATTGATGAGGATCCTATTCTTTTAGTATTGACCAGTA
CAATTGACTTCCAATCAATCAGCTTCGGTATAACCCGAAAAAGAATAATA
AACCTCATACTGACACTCCTCACTAACACATTACTAGCCTCGCTACTCGT
ACTCATCGCATTCTGACTACCACAACTAAACATCTATGCAGAAAAAACCA
GCCCATATGAATGCGGATTTGACCCTATAGGGTCAGCACGCCTCCCCTTC
TCAATAAAATTTTTCTTAGTGGCCATTACATTTCTGCTATTCGACTTAGA
AATTGCCCTCCTATTACCCCTTCCATGAGCATCCCAAACAACTAACCTAA
ACACTATACTTATCATAGCACTAGTCCTAATCTCTCTTCTAGCCATCAGC
CTAGCCTACGAATGAACCCAAAAAGGACTAGAATGAACTGAGTATGGTAA
TTAGTTTAAACCAAAACAAATGATTTCGACTCATTAAACTATGATTAACT
TCATAATTACCAACATGTCACTAGTCCATATTAATATCTTCCTAGCATTC
ACAGTATCCCTCGTAGGCCTACTAATGTACCGATCCCACCTAATATCCTC
ACTCCTATGCCTAGAAGGAATAATACTATCACTATTCGTCATAGCAACCA
TAATAGTCCTAAACACCCACTTCACACTAGCTAGTATAATACCTATCATC
TTACTAGTATTTGCTGCCTGCGAACGAGCTCTAGGATTATCCCTACTAGT
CATAGTCTCCAATACTTATGGAGTAGACCACGTACAAAACCTTAACCTCC
TCCAATGCTAAAAATTATCATTCCCACAATCATACTTATGCCCCTTACAT
GACTATCAAAAAAGAATATAATCTGAATCAACACTACAACCTATAGTCTA
TTAATCAGCCTTATCAGCCTATCCCTCCTAAACCAACCTAGCAACAATAG
CCTAAACTTCTCACTAATATTCTTCTCCGATCCCCTATCAGCCCCACTTC
TGGTGTTGACAACATGACTACTGCCACTAATACTCATAGCCAGCCAACAC
CATCTATCTAAGGAACCACTAATCCGAAAAAAACTCTACATCACCATGCT
AACCATACTTCAAACTTTCCTAATCATGACTTTTACCGCCACAGAACTAA
TCTCCTTCTACATCCTATTTGAAGCCACATTAGTTCCAACACTAATTATC
ATCACCCGCTGAGGCAACCAAACAGAACGCCTGAACGCAGGCCTCTACTT
CCTATTCTACACACTAATAGGTTCCCTCCCACTCTTAGTTGCACTAATCT
CTATCCAAAACCTAACAGGCTCACTAAACTTCCTATTAATTCAATACTGA
AACCAAGCACTACCCGACTCTTGATCCAATATTTTCCTATGACTAGCATG
TATAATAGCATTCATAGTCAAAATACCGGTATATGGTCTTCACCTCTGAC
TCCCAAAAGCCCATGTAGAAGCCCCAATTGCCGGATCCATAGTGCTAGCA
GCCATTCTACTAAAACTAGGAGGCTACGGAATACTACGAATTACAACAAT
ACTAAACCCCCAAACTAGCTTTATAGCCTACCCCTTCCTCATACTATCCC
TGTGAGGAATAATCATAACTAGTTCCATCTGCTTGCGACAAACCGATCTA
AAATCACTTATTGCATACTCCTCTGTCAGCCACATAGCCCTAGTAATCGT
AGCCGTCCTCATCCAAACACCATGAAGTTATATAGGAGCTACAGCCCTAA
TAATCGCTCACGGCCTTACATCATCAATACTATTCTGCCTGGCAAACTCA
AATTACGAACGTACCCATAGCCGAACTATAATCCTAGCCCGCGGGCTTCA
AACACTTCTTCCCCTTATAGCAGCCTGATGACTATTAGCCAGCCTAACCA
ACCTGGCCCTCCCTCCCAGCATTAACCTAATTGGAGAGCTATTCGTAGTA
ATATCATCATTCTCATGATCAAATATTACCATTATCCTAATAGGAGCCAA
TATCACCATCACCGCCCTCTACTCCCTATACATACTAATCACAACACAAC
GAGGGAAATACACACACCATATCAACAGCATTAAACCTTCATTTACACGA
GAAAACGCACTCATGGCCCTCCACATGACTCCCCTACTACTCCTATCACT
TAACCCTAAAATTATCCTAGGCTTTACGTACTGTAAATATAGTTTAACAA
AAACACTAGATTGTGGATCTAGAAACAGAAACTTAATATTTCTTATTTAC
CGAGAAAGTATGCAAGAACTGCTAATTCATGCCCCCATGTCCAACAAACA
TGGCTCTCTCAAACTTTTAAAGGATAGGAGCTATCCGTTGGTCTTAGGAA
CCAAAAAATTGGTGCAACTCCAAATAAAAGTAATCAACATGTTCTCCTCC
CTCATACTAGTTTCACTATTAGTACTAACCCTCCCAATCATATTATCAAT
CTTCAATACCTACAAAAACAGCACGTTCCCGCATCATGTAAAAAACACTA
TCTCATATGCCTTCATTACTAGCCTAATTCCCACTATAATATTTATTCAC
TCTGGACAAGAAACAATTATCTCAAACTGACACTGAATAACCATACAAAC
CCTCAAACTATCCCTAAGCTTCAAACTAGATTACTTCTCAATAATTTTCG
TACCAGTAGCCCTATTCGTAACATGATCTATTATGGAATTCTCCCTATGA
TACATGCACTCAGATCCTTACATTACTCGATTTTTTAAATACTTACTTAC
ATTCCTCATCACTATAATAATTCTAGTCACAGCTAACAACCTTTTCCAAC
TGTTCATCGGATGGGAGGGAGTAGGCATCATGTCATTCTTACTAATCGGA
TGATGATACGGCCGAACAGATGCCAACACCGCGGCCCTTCAAGCAATCCT
TTATAACCGCATCGGGGATATCGGCTTCATCATGGCCATAGCCTGATTCC
TATTCAACACCAACACATGAGACCTCCAACAAATCTTCATACTCGACCCC
AACCTTACCAACCTCCCGCTCCTAGGCCTCCTCCTAGCCGCAACTGGCAA
ATCCGCTCAATTTGGACTCCACCCATGACTTCCTTCAGCCATAGAGGGCC
CTACACCAGTCTCAGCCCTACTCCACTCCAGCACAATAGTTGTAGCAGGC
GTCTTCCTGCTAATCCGCTTCCATCCACTAATAGAAAACAACAAAACAAT
CCAGTCACTTACCCTATGCCTAGGAGCCATCACCACACTATTCACAGCAA
TCTGCGCACTCACTCAAAACGATATCAAAAAAATCATTGCTTTCTCCACC
TCCAGCCAACTAGGCCTGATAATCGTAACCATCGGTATCAATCAACCCTA
CCTAGCATTCCTCCACATTTGCACTCACGCATTCTTCAAAGCTATACTAT
TTATATGTTCCGGATCCATTATCCACAGCCTAAATGACGAGCAAGATATC
CGAAAAATAGGCGGACTATTTAATGCAATACCCTTCACCACCACATCTCT
AATTATTGGCAGCCTTGCACTCACCGGAATTCCTTTCCTCACAGGCTTCT
ACTCCAAAGACCTCATCATCGAAACCGCCAACACATCGTACACCAACGCC
TGAGCCCTACTAATAACTCTCATTGCCACATCCCTCACAGCTGTCTACAG
TACCCGAATCATCTTCTTTGCACTCCTAGGGCAACCCCGCTTCCTCCCTC
TGACCTCAATCAACGAAAATAACCCCTTTCTAATTAACTCCATCAAACGC
CTCTTAATTGGCAGCATTTTTGCCGGATTCTTCATCTCCAACAATATCTA
CCCCACAACCGTCCCAGAAATAACCATACCTACTTACATAAAACTCACCG
CCCTCGCAGTAACCATCCTAGGATTTACACTAGCCCTAGAACTAAGCTTG
ATAACCCATAACTTAAAACTAGAACACTCCACCAACGTATTCAAATTCTC
CAACCTCCTAGGATACTACCCAACAATTATACACCGACTCCCACCGCTCG
CTAACCTATCAATAAGCCAAAAATCAGCATCACTTCTACTAGACTCAATC
TGACTAGAAAACATCCTGCCAAAATCTATCTCCCAGTTCCAAATAAAAAC
CTCGATCCTAATTTCCACCCAAAAAGGACAAATCAAATTATATTTCCTCT
CATTCCTCATCACCCTTACCCTAAGCATACTACTTTTTAATCTCCACGAG
TAACCTCTAAAATTACCAAGACCCCAACAAGCAACGATCAACCAGTCACA
ATCACAACCCAAGCCCCATAACTATACAATGCAGCAGCCCCTATAATTTC
CTCACTAAACGCCCCAGAATCTCCAGTATCATAAATAGCTCAAGCCCCCA
CACCACTAAACTTAAACACTACCCCCACTTCCTCACTCTTCAGAACATAT
AAAACCAACATAACCTCCATCAACAACCCTAAAAGAAATACCCCCATAAC
AGTCGTATTAGACACCCATACCTCAGGATACTGCTCAGTAGCCATAGCCG
TTGTATAACCAAAAACAACCAACATTCCTCCCAAATAAATCAAAAACACC
ATCAACCCCAAAAAGGACCCTCCAAAATTCATAATAATACCACAACCTAC
CCCTCCACTTACAATCAGCACTAAACCCCCATAAATAGGTGAAGGTTTTG
AAGAAAACCCCACAAAACTAACAACAAAAATAACACTCAAAATAAACACA
ATATATGTCATCATTATTCCCACGTGGAATCTAACCACGACCAATGACAT
GAAAAATCATCGTTGTATTTCAACTATAAGAACACCAATGACAAACATCC
GGAAATCTCACCCACTAATTAAAATCATCAATCACTCTTTTATTGACCTA
CCAGCCCCCTCAAACATTTCATCATGATGAAACTTCGGCTCCCTCCTAGG
AATCTGCCTAATCCTCCAAATCTTAACAGGCCTATTCCTAGCCATACACT
ACACATCAGACACGACAACTGCCTTCTCATCCGTCACTCACATCTGCCGA
GACGTTAACTACGGATGAATTATTCGCTACCTCCATGCCAACGGAGCATC
AATATTTTTTATCTGCCTCTTCATTCACGTAGGACGCGGCCTCTACTACG
GCTCTTACACATTCCTAGAGACATGAAACATTGGAATCATCCTACTTTTC
ACAGTTATAGCTACAGCATTCATGGGCTATGTCCTACCATGAGGCCAAAT
ATCCTTTTGAGGAGCAACAGTCATCACGAACCTCCTATCAGCAATTCCCT
ACATCGGTACTACCCTCGTCGAGTGAATCTGAGGTGGATTCTCAGTAGAC
AAAGCCACCCTTACCCGATTTTTTGCTTTCCACTTCATCCTACCCTTCAT
CATCACAGCCCTGGTAGTCGTACATTTACTATTTCTTCACGAAACAGGAT
CTAATAACCCCTCAGGAATCCCATCCGATATGGACAAAATCCCATTCCAC
CCATATTATACAATTAAAGACATCCTAGGACTCCTCCTCCTGATCTTGCT
CCTACTAACTCTAGTATTATTCTCCCCCGACCTCCTAGGAGACCCAGACA
ACTACACCCCAGCTAACCCTCTCAGCACTCCCCCTCATATTAAACCAGAA
TGGTACTTCCTGTTTGCCTACGCCATCCTACGCTCCATTCCCAACAAACT
AGGCGGCGTATTAGCCCTAATCCTCTCCATCCTGATCCTAGCACTCATCC
CCACCCTCCACATATCAAAACAACGAAGCATAATATTCCGGCCTCTCAGC
CAATGCGTATTCTGACTCTTAGTGGCAGACTTACTGACACTAACATGAAT
CGGCGGACAGCCAGTGGAACACCCATACGTAATTATCGGCCAACTGGCCT
CAATCCTCTACTTCTCCCTAATTCTCATTTTTATACCACTCGCAAGCACC
ATCGAAAACAATCTTCTAAAATGAAGAGTCCCTGTAGTATATCGCACATT
ACCCTGGTCTTGTAAACCAGAAAAGGGGGAAAACGTTTCCTCCCAAGGAC
TATCAAGGAAGAAGCTCTAGCTCCACCATCAACACCCAAAGCTGAAATTC
TACTTAAACTATTCCTTGATTTCTTCCCCTAAACGACAACAATTTACCCT
CATGTGCTATGTCAGTATCAGATTATACCCCCACATAACACCATACCCAC
CTGACATGCAATATCTTATGAATGGCCTATGTACGTCGTGCATTAAATTG
TCTGCCCCATGAATAATAAGCATGTACATAATATCATTTATCTTACATAA
GTACATTATATTATTGATCGTGCATACCCCATCCAAGTCAAATCATTTCC
AGTCAACACGCATATCACAGCCCATGTTCCACGAGCTTAATCACCAAGCC
GCGGGAAATCAGCAACCCTCCCAACTACGTGTCCCAATCCTCGCTCCGGG
CCCATCCAAACGTGGGGGTTTCTACAATGAAACTATACCTGGCATCTGGT
TCTTTCTTCAGGGCCATTCCCACCCAACCTCGCCCATTCTTTCCCCTTAA
ATAAGACATCTCGATGGACTAATGACTAATCAGCCCATGCTCACACATAA
CTGTGATTTCATGCATTTGGTATCTTTTTATATTTGGGGATGCTATGACT
CAGCTATGGCCGTCAAAGGCCTCGACGCAGTCAATTAAATTGAAGCTGGA
CTTAAATTGAACGTTATTCCTCCGCATCAGCAACCATAAGGTGTTATTCA
GTCCATGGTAGCGGGACATAGGAAACAAgtgcacctgtgcacctgtgcac
ctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacct
gtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgt
gcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgc
acctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcac
ctgtgcacctACCCGCGCAGTAAGCAAGTAATATAGCTTTCTTAATCAAA
CCCCCCCTACCCCCCATTAAACTCCACATATGTACATTCAACACAATCTT
GCCAAACCCCAAAAACAAGACTAAACAATGCACAATACTTCATGAAGCTT
AACCCTCGCATGCCAACCATAATAACTCAACACACCTAACAATCTTAACA
GAACTTTCCCCCCGCCATTAATACCAACATGCTACTTTAATCAATAAAAT
TTCCATAGACAGGCATCCCCCTAGATCTAATTTTCTAAATCTGTCAACCC
TTCTTCCCCC