Mercurial > repos > iuc > shorah_amplicon
changeset 0:fc46049f6c27 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/shorah commit e302de4f94384825ead064acc33b33fc95c081d9
| author | iuc |
|---|---|
| date | Mon, 14 Jan 2019 15:17:56 -0500 |
| parents | |
| children | |
| files | shorah.xml test-data/shorah-amplicon-in1.bam test-data/shorah-amplicon-in1.fa test-data/shorah-amplicon-out1.tsv test-data/shorah-amplicon-out1.txt |
| diffstat | 5 files changed, 75 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/shorah.xml Mon Jan 14 15:17:56 2019 -0500 @@ -0,0 +1,64 @@ +<?xml version="1.0"?> +<tool id="shorah_amplicon" version="@VERSION@+galaxy0" name="Reconstruct haplotypes"> + <description>with ShoRAH in amplicon mode</description> + <macros> + <token name="@VERSION@">1.1.3</token> + </macros> + <requirements> + <requirement type="package" version="@VERSION@">shorah</requirement> + </requirements> + <command detect_errors="exit_code"> + <![CDATA[ + ln -s '$bam' input.bam && + ln -s '$fasta' input.fa && + amplian.py + --bam input.bam + --fasta input.fa + #if str($region): + --region '$region' + #end if + $diversity + --min_overlap $min_overlap + --alpha $alpha + --maxcov $maxcov + --sigma $sigma && + sed -i.bak 's/,/\t/g' SNVs_0.010000_final.csv + + ]]> + </command> + <inputs> + <param argument="--bam" type="data" format="bam" label="Aligned reads in .bam format" /> + <param argument="--fasta" type="data" format="fasta" label="Reference genome in fasta format" /> + <param argument="--region" type="text" value="" optional="true" label="Limit to a specific region" help="e.g. 'ch3:1000-1300'" /> + <param argument="--diversity" type="boolean" truevalue="--diversity" falsevalue="" label="Run on the highest entropy region" /> + <param argument="--min_overlap" type="float" value="0.95" min="0" max="1" optional="true" label="Fraction of read overlap to be included" /> + <param argument="--alpha" type="float" value="0.5" optional="true" label="Alpha in dpm sampling" /> + <param argument="--maxcov" type="integer" value="50000" optional="true" label="Approximate max coverage allowed" /> + <param argument="--sigma" type="float" value="0.01" optional="true" label="Sigma value to use when calling SNVs" /> + <param name="log_output" type="boolean" truevalue="log" falsevalue="" label="Include the log in the history" /> + </inputs> + <outputs> + <data name="haplotypes" format="tabular" from_work_dir="SNVs_0.010000_final.csv" label="${tool.name} on ${on_string}: Haplotypes" /> + <data name="log" format="txt" from_work_dir="SNV.txt" label="${tool.name} on ${on_string}: Log"> + <filter>log_output</filter> + </data> + </outputs> + <tests> + <test> + <param name="bam" ftype="bam" value="shorah-amplicon-in1.bam" /> + <param name="fasta" ftype="fasta" value="shorah-amplicon-in1.fa" /> + <param name="min_overlap" value="0.95" /> + <param name="log_output" value="log" /> + <output name="haplotypes" file="shorah-amplicon-out1.tsv" compare="re_match" /> + <output name="log" file="shorah-amplicon-out1.txt" compare="re_match" /> + </test> + </tests> + <help> +<![CDATA[ +ShoRAH is an open source project for the analysis of next generation sequencing data. It is designed to analyse genetically heterogeneous samples. Its tools are written in different programming languages and provide error correction, haplotype reconstruction and estimation of the frequency of the different genetic variants present in a mixed sample. +]]> + </help> + <citations> + <citation type="doi">10.1186/1471-2105-12-119</citation> + </citations> +</tool> \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shorah-amplicon-in1.fa Mon Jan 14 15:17:56 2019 -0500 @@ -0,0 +1,3 @@ +>reference +CTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGG +AAGCTCTATTAGA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shorah-amplicon-out1.tsv Mon Jan 14 15:17:56 2019 -0500 @@ -0,0 +1,4 @@ +Chromosome Pos Ref Var Freq Post Fvar Rvar Ftot Rtot Pval Qval +reference 8 C A 0.3... 1.0000 147 144 511 489 0.942186 1 +reference 28 T A 0.3... 1.0000 147 145 511 489 0.918406 1 +reference 35 A C 0.3... 1.0000 146 144 511 489 0.91896 1