comparison stacks_assembleperead.xml @ 8:e6919d8ae34d draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks commit dc23703c260d004a28fe24a2a7c00cb4371bc32e

7:e194abc415a6

        mkdir stacks_inputs reads stacks_outputs

        &&

        #for $input_file in $stacks_col:
            #set $ext = ""
            #if not str($input_file.element_identifier).endswith('.tsv'):
                #set $ext = ".tsv"
            #end if
            ln -s "${input_file}" "stacks_inputs/${input_file.element_identifier}${ext}" &&
        #end for

        #for $input_file in $reads:
            #set $name = str($input_file.element_identifier)
            ## sort_read_pairs is expecting strange fastq names: <sample_name>.fq_2
            #if $name.endswith('.1.fq'):
                ## handle a common case
                #set $name = $name[:-5]+".fq_1"
            #else if $name.endswith('.2.fq'):
                ## handle a common case
                #set $name = $name[:-5]+".fq_2"
            #else if not $name.endswith('.fq') and not $name.endswith('.fq_2'):
                ## no extension, consider it's a fq_2 file
                #set $name = $name + ".fq_2"
            #end if
            ln -s "${input_file}" "reads/${name}" &&
        #end for

        sort_read_pairs.pl
            -p stacks_inputs
            -s 'reads'

            #if $whitelist:
                -w '$whitelist'
            #end if

            #if $threshold:
                -r $threshold
            #end if

            -o stacks_outputs

        #if $velvet.use_velvet:
            ## remove possible empty files
            && find stacks_outputs -type f -size 0 -delete

            &&
            mkdir assembled

        <param name="whitelist" argument="-w" format="txt,tabular" type="data" optional="true" label="White list of catalog IDs to include" />
        <param name="threshold" argument="-r" type="integer" value="" optional="true" label="Minimum number of reads by locus"/>

       <conditional name="velvet">
            <param name="use_velvet" type="boolean" checked="false" label="Perform assembly with Velvet" help="If not selected, the tool will only produce of collection of fasta files (one per locus) containing reads ready to assemble." />
            <when value="false"></when>
            <when value="true">
                <param name="contig_length" type="integer" value="200" label="Minimum length for asssembled contigs"/>
            </when>
        </conditional>
    </inputs>
    <outputs>
        <collection name="collated" type="list" label="Collated FASTA files per locus on ${on_string}">
            <filter>not velvet['use_velvet']</filter>
            <discover_datasets pattern="(?P&lt;name&gt;.+)\.fa(sta)?$" ext="fasta" directory="stacks_outputs" />
        </collection>

        <data format="fasta" name="contigs" label="Assembled contigs on ${on_string}" from_work_dir="assembled/collated.fa">
            <filter>velvet['use_velvet']</filter>
        </data>
    </outputs>

    <tests>
        <test>

                    <element name="PopA_02.snps.tsv" ftype="tabular" value="genotypes/PopA_02.snps.tsv" />
                    <element name="PopA_02.tags.tsv" ftype="tabular" value="genotypes/PopA_02.tags.tsv" />
                </collection>
            </param>
            <param name="reads" value="demultiplexed/PopA_01.2.fq,demultiplexed/PopA_02.2.fq" ftype="fastqsanger" />
            <param name="velvet|use_velvet" value="true" />
            <param name="velvet|contig_length" value="20" />

            <output name="contigs">
                <assert_contents>
                    <has_text text="TGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGA" />
                </assert_contents>
            </output>
        </test>
    </tests>

8:e6919d8ae34d

        mkdir stacks_inputs reads stacks_outputs

        &&

        #for $input_file in $stacks_col
            #set $ext = ""
            #if not str($input_file.element_identifier).endswith('.tsv')
                #set $ext = ".tsv"
            #end if
            ln -s '${input_file}' 'stacks_inputs/${input_file.element_identifier}${ext}' &&
        #end for

        #for $input_file in $reads
            #set $name = str($input_file.element_identifier)
            ## sort_read_pairs is expecting strange fastq names: <sample_name>.fq_2
            #if $name.endswith('.1.fq')
                ## handle a common case
                #set $name = $name[:-5]+".fq_1"
            #else if $name.endswith('.2.fq')
                ## handle a common case
                #set $name = $name[:-5]+".fq_2"
            #else if not $name.endswith('.fq') and not $name.endswith('.fq_2')
                ## no extension, consider it's a fq_2 file
                #set $name = $name + ".fq_2"
            #end if
            ln -s '${input_file}' 'reads/${name}' &&
        #end for

        sort_read_pairs.pl
            -p stacks_inputs
            -s 'reads'

            #if $whitelist
                -w '$whitelist'
            #end if

            #if $threshold
                -r $threshold
            #end if

            -o stacks_outputs

        #if $velvet.use_velvet == "yes"
            ## remove possible empty files
            && find stacks_outputs -type f -size 0 -delete

            &&
            mkdir assembled

        <param name="whitelist" argument="-w" format="txt,tabular" type="data" optional="true" label="White list of catalog IDs to include" />
        <param name="threshold" argument="-r" type="integer" value="" optional="true" label="Minimum number of reads by locus"/>

       <conditional name="velvet">
            <param name="use_velvet" type="select" label="Perform assembly with Velvet" help="If not selected, the tool will only produce of collection of fasta files (one per locus) containing reads ready to assemble.">
                <option value="no" selected="true">No</option>
                <option value="yes">Yes</option>
            </param>
            <when value="no"/>
            <when value="yes">
                <param name="contig_length" type="integer" value="200" label="Minimum length for asssembled contigs"/>
            </when>
        </conditional>
    </inputs>
    <outputs>
        <collection name="collated" type="list" label="Collated FASTA files per locus on ${on_string}">
            <filter>velvet['use_velvet'] == "no"</filter>
            <discover_datasets pattern="(?P&lt;name&gt;.+)\.fa(sta)?$" ext="fasta" directory="stacks_outputs" />
        </collection>

        <data format="fasta" name="contigs" label="Assembled contigs on ${on_string}" from_work_dir="assembled/collated.fa">
            <filter>velvet['use_velvet'] == "yes"</filter>
        </data>
    </outputs>

    <tests>
        <test>

                    <element name="PopA_02.snps.tsv" ftype="tabular" value="genotypes/PopA_02.snps.tsv" />
                    <element name="PopA_02.tags.tsv" ftype="tabular" value="genotypes/PopA_02.tags.tsv" />
                </collection>
            </param>
            <param name="reads" value="demultiplexed/PopA_01.2.fq,demultiplexed/PopA_02.2.fq" ftype="fastqsanger" />
            <param name="velvet|use_velvet" value="yes" />
            <param name="velvet|contig_length" value="20" />

            <output name="contigs">
                <assert_contents>
                    <has_text text="|NODE_" />
                </assert_contents>
            </output>
        </test>
    </tests>