Mercurial > repos > iuc > stacks_assembleperead
diff stacks_assembleperead.xml @ 8:e6919d8ae34d draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks commit dc23703c260d004a28fe24a2a7c00cb4371bc32e
author | iuc |
---|---|
date | Thu, 27 Apr 2017 04:18:45 -0400 |
parents | ae705d244e28 |
children | 0c741f364d18 |
line wrap: on
line diff
--- a/stacks_assembleperead.xml Fri Apr 07 11:48:12 2017 -0400 +++ b/stacks_assembleperead.xml Thu Apr 27 04:18:45 2017 -0400 @@ -11,45 +11,45 @@ && - #for $input_file in $stacks_col: + #for $input_file in $stacks_col #set $ext = "" - #if not str($input_file.element_identifier).endswith('.tsv'): + #if not str($input_file.element_identifier).endswith('.tsv') #set $ext = ".tsv" #end if - ln -s "${input_file}" "stacks_inputs/${input_file.element_identifier}${ext}" && + ln -s '${input_file}' 'stacks_inputs/${input_file.element_identifier}${ext}' && #end for - #for $input_file in $reads: + #for $input_file in $reads #set $name = str($input_file.element_identifier) ## sort_read_pairs is expecting strange fastq names: <sample_name>.fq_2 - #if $name.endswith('.1.fq'): + #if $name.endswith('.1.fq') ## handle a common case #set $name = $name[:-5]+".fq_1" - #else if $name.endswith('.2.fq'): + #else if $name.endswith('.2.fq') ## handle a common case #set $name = $name[:-5]+".fq_2" - #else if not $name.endswith('.fq') and not $name.endswith('.fq_2'): + #else if not $name.endswith('.fq') and not $name.endswith('.fq_2') ## no extension, consider it's a fq_2 file #set $name = $name + ".fq_2" #end if - ln -s "${input_file}" "reads/${name}" && + ln -s '${input_file}' 'reads/${name}' && #end for sort_read_pairs.pl -p stacks_inputs -s 'reads' - #if $whitelist: + #if $whitelist -w '$whitelist' #end if - #if $threshold: + #if $threshold -r $threshold #end if -o stacks_outputs - #if $velvet.use_velvet: + #if $velvet.use_velvet == "yes" ## remove possible empty files && find stacks_outputs -type f -size 0 -delete @@ -70,21 +70,24 @@ <param name="threshold" argument="-r" type="integer" value="" optional="true" label="Minimum number of reads by locus"/> <conditional name="velvet"> - <param name="use_velvet" type="boolean" checked="false" label="Perform assembly with Velvet" help="If not selected, the tool will only produce of collection of fasta files (one per locus) containing reads ready to assemble." /> - <when value="false"></when> - <when value="true"> + <param name="use_velvet" type="select" label="Perform assembly with Velvet" help="If not selected, the tool will only produce of collection of fasta files (one per locus) containing reads ready to assemble."> + <option value="no" selected="true">No</option> + <option value="yes">Yes</option> + </param> + <when value="no"/> + <when value="yes"> <param name="contig_length" type="integer" value="200" label="Minimum length for asssembled contigs"/> </when> </conditional> </inputs> <outputs> <collection name="collated" type="list" label="Collated FASTA files per locus on ${on_string}"> - <filter>not velvet['use_velvet']</filter> + <filter>velvet['use_velvet'] == "no"</filter> <discover_datasets pattern="(?P<name>.+)\.fa(sta)?$" ext="fasta" directory="stacks_outputs" /> </collection> <data format="fasta" name="contigs" label="Assembled contigs on ${on_string}" from_work_dir="assembled/collated.fa"> - <filter>velvet['use_velvet']</filter> + <filter>velvet['use_velvet'] == "yes"</filter> </data> </outputs> @@ -132,12 +135,12 @@ </collection> </param> <param name="reads" value="demultiplexed/PopA_01.2.fq,demultiplexed/PopA_02.2.fq" ftype="fastqsanger" /> - <param name="velvet|use_velvet" value="true" /> + <param name="velvet|use_velvet" value="yes" /> <param name="velvet|contig_length" value="20" /> <output name="contigs"> <assert_contents> - <has_text text="TGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGA" /> + <has_text text="|NODE_" /> </assert_contents> </output> </test>