view test-data/norm/Trinity_paired_unmerged_1.fasta @ 31:d2bc35f3d1c5 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 1b2ce625fad2514549bf2a675c26517c3d46ed81"
author iuc
date Sun, 19 Dec 2021 16:25:47 +0000
parents 171b827eadf2
children
line wrap: on
line source

>TRINITY_DN2_c0_g1_i1 len=229 path=[0:0-228]
AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGTTTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCTACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTATAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC
>TRINITY_DN1_c0_g1_i1 len=380 path=[0:0-379]
CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGGCTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGCAAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTTATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTGGGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATGAAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATGTATATGGTACAGATGTAAAG
>TRINITY_DN3_c0_g1_i1 len=669 path=[0:0-668]
GCTGCATCAGACCAAGATGAAAGCATAGTAGAACTTGCATTTCAGACAACAGGGCACATTGTCACTCTTGTATTTGAAAAACACTTTCCGGCCACCATTGATTCTTTCCAGGATGCAGTGAAGTGTTTGTCTGAATTCACATGTAATGCAGCTTTCCCAGACACAAGTATGGAAGCAATCCGACTTATTCGCCATTGTGCAAAATATGTGTCTGATAGACCGCAGGCTTTCAAGGAGTACACAAGTGATGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTTTGAGTTGTCTTGTATCATCAATAGATGCAAATTAGATGTAAGAACCAGGGGCTTAACAGTAATGTTTGAAATAATGAAAACATATGGCCACACTTATGAAAAACATTGGTGGCAGGACTTATTCAGAATTGTTTTCAGAATCTTTGACAACATGAAATTGCCAGAACAGCAGACAGAGAAAGCTGAATGGATGACAACAACTTGTAACCATGTCCTTTATGCAATATGTGATGTATTCACCCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTGGTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGTG
>TRINITY_DN3_c0_g2_i1 len=279 path=[0:0-278]
TCCAGACCATCGACAACATTGTCTTCTTCCCAGCCACAAGCAAGAAGGAGGATGCAGAGAACTTAGCTGCAGCCCAGAGAGATGCAGTAGACTTCGATGTTCGAGTTGATACTCAAGACCAAGGAATGTACCGCTTTTTAACATCACAACAACTGTTCAAGCTACTGGACTGCTTATTAGAGTCGCATAGATTTGCAAAAGCATTTAATTCCAACAATGAACAGAGGACTGCTCTGTGGAAAGCAGGCTTCAAAGGCAAGTCCAAGCCCAATCTTCTAA
>TRINITY_DN3_c0_g3_i1 len=240 path=[0:0-239]
ACAAGCAGCCTGGCGTGTGGGCTGCGCATTCTCTTCCGGATGTACATGGACGAGAGCAGAGTCAGTGCCTGGGAAGAAGTCCAGCAGAGGCTTTTAAACGTCTGCAGGGAAGCGCTGAGCTACTTCCTCACTCTAACATCCGAAAGTCACCGGGAAGCCTGGACTAACTTACTGTTACTGTTCCTCACTAAAGTTCTGAAGATCAGTGACAGCAGGTTTAAAGCTCACGCATCATTCTAC
>TRINITY_DN3_c0_g4_i1 len=202 path=[0:0-201]
GGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTCAAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCCCCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGACATACATGATTCTATTCAACCAA
>TRINITY_DN0_c0_g1_i1 len=216 path=[0:0-215]
ATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATGCTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCTACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCATATGTAGACCAACATGACTTTTCAGGAAAAGACTTT