view test-data/raw/Trinity.fasta @ 31:d2bc35f3d1c5 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 1b2ce625fad2514549bf2a675c26517c3d46ed81"
author iuc
date Sun, 19 Dec 2021 16:25:47 +0000
parents 171b827eadf2
children
line wrap: on
line source

>TRINITY_DN1_c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2]
CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGG
CTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGC
AAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTT
ATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTG
GGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATG
AAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATG
TATATGGTACAGATGTAAAG
>TRINITY_DN0_c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2]
AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGT
TTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCT
ACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTA
TAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC
>TRINITY_DN2_c0_g1_i1 len=279 path=[257:0-278] [-1, 257, -2]
TCCAGACCATCGACAACATTGTCTTCTTCCCAGCCACAAGCAAGAAGGAGGATGCAGAGA
ACTTAGCTGCAGCCCAGAGAGATGCAGTAGACTTCGATGTTCGAGTTGATACTCAAGACC
AAGGAATGTACCGCTTTTTAACATCACAACAACTGTTCAAGCTACTGGACTGCTTATTAG
AGTCGCATAGATTTGCAAAAGCATTTAATTCCAACAATGAACAGAGGACTGCTCTGTGGA
AAGCAGGCTTCAAAGGCAAGTCCAAGCCCAATCTTCTAA
>TRINITY_DN2_c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2]
GTCTGAATTCGCATGTAATGCAGCTTTCCCAGACACAAGTATGGAAGCAATCCGACTTAT
TCGCCATTGTGCAAAATATGTGTCTGATAGACCGCAGGCTTTCAAGGAGTACACAAGTGA
TGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTT
TGAGTTGTCTTGTATCATCAATAGATGCAAATTAGATGTAAGAACCAGGGGCTTAACAGT
AATGTTTGAAATAATGAAAACATATGGCCACACTTATGAAAAACATTGGTGGCAGGACTT
ATTCAGAATTGTTTTCAGAATCTTTGACAACATGAAATTGCCAGAACAGCAGACAGAGAA
AGCTGAATGGATGACAACAACTTGTAACCATGTCCTTTATGCAATATGTGATGTATTCAC
CCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTG
GTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGT
G
>TRINITY_DN2_c2_g1_i1 len=240 path=[218:0-239] [-1, 218, -2]
ACAAGCAGCCTGGCGTGTGGGCTGCGCATTCTCTTCCGGATGTACATGGACGAGAGCAGA
GTCAGTGCCTGGGAAGAAGTCCAGCAGAGGCTTTTAAACGTCTGCAGGGAAGCGCTGAGC
TACTTCCTCACTCTAACATCCGAAAGTCACCGGGAAGCCTGGACTAACTTACTGTTACTG
TTCCTCACTAAAGTTCTGAAGATCAGTGACAGCAGGTTTAAAGCTCACGCATCATTCTAC
>TRINITY_DN2_c3_g1_i1 len=202 path=[180:0-201] [-1, 180, -2]
GGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTC
AAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCC
CCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGAC
ATACATGATTCTATTCAACCAA
>TRINITY_DN3_c0_g1_i1 len=216 path=[194:0-215] [-1, 194, -2]
ATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATG
CTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCT
ACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCA
TATGTAGACCAACATGACTTTTCAGGAAAAGACTTT