view test-data/supertranscripts/trinity_genes.fasta @ 31:d2bc35f3d1c5 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 1b2ce625fad2514549bf2a675c26517c3d46ed81"
author iuc
date Sun, 19 Dec 2021 16:25:47 +0000
parents 940901f74064
children
line wrap: on
line source

>TRINITY_DN2_c3_g1
GGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTCAAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCCCCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGACATACATGATTCTATTCAACCAA
>TRINITY_DN0_c0_g1
AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGTTTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCTACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTATAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC
>TRINITY_DN2_c0_g1
TCCAGACCATCGACAACATTGTCTTCTTCCCAGCCACAAGCAAGAAGGAGGATGCAGAGAACTTAGCTGCAGCCCAGAGAGATGCAGTAGACTTCGATGTTCGAGTTGATACTCAAGACCAAGGAATGTACCGCTTTTTAACATCACAACAACTGTTCAAGCTACTGGACTGCTTATTAGAGTCGCATAGATTTGCAAAAGCATTTAATTCCAACAATGAACAGAGGACTGCTCTGTGGAAAGCAGGCTTCAAAGGCAAGTCCAAGCCCAATCTTCTAA
>TRINITY_DN3_c0_g1
ATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATGCTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCTACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCATATGTAGACCAACATGACTTTTCAGGAAAAGACTTT
>TRINITY_DN2_c2_g1
ACAAGCAGCCTGGCGTGTGGGCTGCGCATTCTCTTCCGGATGTACATGGACGAGAGCAGAGTCAGTGCCTGGGAAGAAGTCCAGCAGAGGCTTTTAAACGTCTGCAGGGAAGCGCTGAGCTACTTCCTCACTCTAACATCCGAAAGTCACCGGGAAGCCTGGACTAACTTACTGTTACTGTTCCTCACTAAAGTTCTGAAGATCAGTGACAGCAGGTTTAAAGCTCACGCATCATTCTAC
>TRINITY_DN2_c1_g1
GTCTGAATTCGCATGTAATGCAGCTTTCCCAGACACAAGTATGGAAGCAATCCGACTTATTCGCCATTGTGCAAAATATGTGTCTGATAGACCGCAGGCTTTCAAGGAGTACACAAGTGATGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTTTGAGTTGTCTTGTATCATCAATAGATGCAAATTAGATGTAAGAACCAGGGGCTTAACAGTAATGTTTGAAATAATGAAAACATATGGCCACACTTATGAAAAACATTGGTGGCAGGACTTATTCAGAATTGTTTTCAGAATCTTTGACAACATGAAATTGCCAGAACAGCAGACAGAGAAAGCTGAATGGATGACAACAACTTGTAACCATGTCCTTTATGCAATATGTGATGTATTCACCCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTGGTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGTG
>TRINITY_DN1_c0_g1
CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGGCTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGCAAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTTATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTGGGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATGAAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATGTATATGGTACAGATGTAAAG
u{ OIc }1Q-{SeKHvcBC+ -mhB \+vi& [P{+r4&feL$V*Bx>EgeU!w*t<ە+!Scl;<)?DrL7`lYў~i@qƠ_Pf~1,v\eԊPj8Լ[.q'c0ڎww1fɇO%DŽ:hΉ,Wpj\wtAM5\Vw9 \Q.艛3]صʏ9w |mwg[o-zOǞl3:t9X1yө>ujYR+]7lu^$;zYw#wHOz f/`C+˖dާ9suZO͹q߮K̽5eri ?}tyS_ %wd<5\SU^+_ԞKk4pznHa.ێѓ/*EysISszuqhVn/,| |޸ߪ/ aqކ%\##}XIm92_3dzkwZ{ʔᔚ<_QysWz<#ZGEJCj5zaeNcSI)XgbrfzE^Jؾ`>|Y%|j_v(K^֌3S}Hu_}[;;]mzLjx/u9JM> Y^hݽq':%Յsq7Mɕ8vmC7REwԥu3&S\l9ai|e^%ߍ/JS̽}9V={hQ^;X_`s:v3Ԃ+.ةz{fp@&g* m/.ENF-9ޛM{3n[lk ;rP[Y^1:^7鹁U`s&[b דN11ya;6}9U2p3ԏg҇;ԫ\D7Y}xs cMe͜Y$ެ=&oTGP P!J$V֥n$ȌJ1 r!]T;wK. >_~1-r6* zaYML,|<͸# ."kծ¥ʓX)|M:4x=F0nr2mĂڭ APibPvrK9HEy\xXgB=]cnćQŁ[ϔc7׫3|d3|NAQ98=\S=Bf6팥"1v;),LRu:H69z୤{`&׌ޫ]{=Aq!T.2_uF8>|fRKn(&G$! Jɥv<& nW$Rk߿ғv@oۄ)%8lPy,tkRzE<+hZB/@c\Znӻ5kI-Arlڎb}c l2Dvʆ"ftdsWPbܑ+E.I/C{J U+\ܼ_brU`쥐͌a\"gÄCbyoI=ѥe.qznKa+stZޚDum_w7pVpf[wځzZ#),S- 1=5$ܘ Ve[@/!ߪ ~ IP)FRE`f#&PBa`"1X2AbCa)JI(%U(U"ZM3h[RծMZ/Ú\ 1>.J@A5pl+}uA{KPik|̋Tf ns;xW=[k|OD? Q "w.FUrѧyh8ڼ9##(~0D +W$H0EԼY.LV+8by'^X yX7 ?OQ}s悀'T:LHm.D D_ 'G0XÚ_>w9t{_Ms}r`] sUMYWP!9u #U/,ݗ.Dm=nk^[`w寝{/uw+m|kF-r<=*7ź=#/{(u/9:Iˆ.r+QA"6V,@E`*B b&]qGuz9q< {G.*C!d#H\jQww;^tsѽwwxuǸD\{Sx!$0HE[߷ý?E?U?5V{sw=!|ytʝ=/?]9#;{BZ;{J3?m60Bb}_Tû k&.1߽A=z SF-rqnu/n~Mpg_VفF+EWX:uW-Q7M)oyr|m0~)Žd+NقV|ik~vuw- k;Z0~Ax袿|qjQCtsw}X'}ڝ"<'>~OF3O7: f{3ge {ުXqp3s)*crRYw rʇܯ0k`pb,QNU T0saJ6[°Y88BwXJo +& ֟kooznJólɤRU{~4x/Z/AY7áS΢nC&R*w9k81}.f7rnnlyI& kG ?"vˍ˹bm-8qLֺ˰髄R]^C&*o$k2&Wɨźޮ:IX~׃CmUsr'Pgs ӷvF/)KUe/] WΉuiؐ 7#\oɏjU}|Ug'f{nMy޻!gPL^Z>>*0SR=~=mGYhb'Foq U6 ׇ""cm^`)UF3ʊYI^z}hӻnlxծ?g$wQٖ)׌$[V7} B|>fz WUsPKl7o;>ˋ0?nٲ]t=wT]dH;Jؾvkܙn눌ct>gFm1\xo}Wg+mޏzgcDCҵefWRojpw+&4P#6 ݎ-8-26rٕo.d"՚VujOC>g1dG)ogB\mfI< lE xU* .ul$whkaUj9{޾ܵ/v쥙25X2Jj'ql~5CY /FC8M8 }w\Ji+0ёMFw *@a9a6+ wr(4w̚y[;Y60ܣN}[2骥ޒ;rqFmdjtMSM(>a<ڵAճDK!4gDMy|WR,N6//]xòg잏p WT ^]rGfͬ۝ؾWtANPg$RLoaFO_plu7y9+`bb/r# 2׫A!rۦk~Snlwf}DL1doޣtߟگd~S-=&MC@sy~¶mˢh*設yؔtjvb3}=΂ɞ3FgAZ$7/ӵ( sܺwԹSص}.'}t0seu_R}L|* @z}}#(Oodغ*v{c1z)l S rfbޮb6Z=-Ҭ-aTuϻPysnjo2# a`ģaSIwS2;ڑJuɋEP]ot&  :Bv#V:9shwi]&U`{ŎX6\\tά?2𘁦}z&ō:9A" @̓]ZU \fsfS馥ΣG3y=]]QQ;ox_O:3 Wq>e#/M>} Y;#cWoJ f&_J ,u퉊ı l-lQnTLZAYsd a/ݎJ3̃Е8O\& q0eoM"=Zr.' fVL۫ɺ\%Pw]HhDBAƐ#z:5ڏstsa:sׯ[svVaPSv\-TOƑʬOH5sX};Ny5uT^FVOkQ UwyN=l[V^33,i{~]\Nߤj<{'<%d{\h1ҫ2l[me`U2^*h RwBY0e r lɖ3l:tO)|T'Ƽʨ>پc>#=%;?^hz3HĿxW}T^']# FpyBS/_Fі5v5wEVLW^JSC=1QL9;-qڎsL& NiL斝׈u[./1u)`Q},ku{}Y3nT.y$UuUST> _juJ(DvE~gù oVf- ]%HfWާsy'Fn3e1/5'\ζ^ da<6=Usį_@:xﻙ~&c)RYr෻^tujm*l)whbP n@W[6>wnNe?o73{m듟 DSN~ßq/M>viw a셌4U+[u?qAO"ٰ˃|4CY #n~u6Feo[gpt[ObOjs=57C} f{>YϚL|}R!xvuiWBDWe\wKIQ!Uux=-ǥ ^ѮP,{1ln;1St=q)EkCE=Twz!Lվ$Pomb .y-rYp%yC&GKATcOQ]أ|sU |LSf3KD&*Ud ě,;z"KrgE ."b8+bLPx'5A~P~c_CgUAaCM5g:G_pږOBa£_aν!Yk#y{MKrm{v)[͛cd*v{F3ζ cG/.(ݘfo<;|H~2xݵgD͎W{שL\!~ȚNP@q+od^z.K[Ɉ7Qw2eFM/+idHd۲ϡr& !eGyCȓ4ЏுNtmyw:R/lxjv1ik=5|ϫ ʛdt< Z!]sb}'}cFgӌ^Vz. \B>)*T~;Rf/TNjNמ>q”o]CuQ_E^I jWkLӻ3)f0yEN֫Ҽ{p݃W]:ԀN.Gg#RwPJݤ#IKes4F5 !p]`Nw&սxMth-%{ecg} gޜ`y ?my CU'9&4U즞ګrEE\w2lۑt]J;Bd{rs}̬j* ~}.D#}]7N ſRHԽBx"Nl'wR`,bCtFRAn)E˳6/٣zU%CڶaN^w\"J9 ~z;zcѪ=Nfͪ"D:[!.nxDs۔8S;]sNxm"D69^By$TB}Raɛ&:43&JȺ>C&)nwcrNFk=츪D`eyQ^3a(m앙2\XvzH닸ggXO]KvfƬrtz99rIcrb1S;+<;LuыqdfUR5}{e b*5ޟ-w<]gYċFzubb@Ʈ" m=Kbѻ^R=VHښK#g";8V=0"vnezA{Ƴ8_ws,@md6 p yiU/m1T}9d[՛yK "*Sͺe3<;IR6J _y]qK{A]V(5a{Ȃ{^X̸*ZX:{fBW.w]:f(\M7=+8Ch񞬕z%Ts;VL˟2uܥ(=6OZU3.9+#$Yه&jF]:QWslks/=.52vJI;醶vaxUg/QB={w\<ɓk$9*`ƛ9fi|Ho&^d.[8 *%QB^Oݮ#Xat1Y i*b5K<tu)Qڐ_hx,N6 ,RerU h>7tuccnsa53LaǛ(NT3W t"6ڶBg2׾,+~ca2 ߁8(0 r0K5=.}fH|{+]o\? ne\AWݍ,tV̠]oO%]b{3]rf!ƽSA&[|e4 +*)XDfr԰R̽0KIi*&Vu"Y3q/{T7 wvN<XJ9b \t}SK46 J](wʋgsLjӘLTdm}1lYvVn۷Ϝ'i?kV6۵ (t{9JB6MP夫]~#s7R&7=0ft5V`heůcFDZgn(ont,8;ɵ*v>Շust31Hvբ y,C7/2"{ 1yVD܎\me.J=45x7kxLV%Q;ވj"ęB. )n,q ;*n䩣]J現;ߓ5}Oja\Xe&kBOxZApMKsQ4Cyg jW(;KLsQ$KڬV]Ί= c5"n[bv6vdǚY$ٖ"u-6Ŋht >ˈqQ#s2kJI,ogE0 !Hڧw<`>0~Xfwgp'.KcBs@QҳX۳/Wpl zX%aaė2n\OZKGNo+k35G4bƠ%/u+&sF[q_g\e^4UG~couswqZbklSeqwtq/u*Q*4JrvS$/.J"-{ϬUdedF3ڍћv8=}Eyt bM#a2oU4 psg8c:fЅ;ӑ/{Gb[/sojh8v\Z8SwC9f7"MRoUds.AFpnsKw.$~*TE 8cX'a.2S;i]s|(u'Be{]OnGPRWi0A5UN;*aAdCl;BGR5IpP{]}zw=TNW@>A@#1AZ?}Sa}NOw9gD,x`7r~w?>=vj{ӕxyy38黫7^׽;lq/%IIi$I@b@I IN8טˋs۹\Gs^wu㎮{;Dy{+^"4" ?"F EIHs53uEfi7毋iwwrq^;wni9Iu;y|#G^.sw=oG.+K\r ysq.rtޯU7$nE d]" Eρ0H Rg$m ~?3-~ .ބ{a] r e8J[>~P5RBWj{us:[%dA6UDIH־Q X駿({Lupj`@JHҊ֑Ldh6߸z:[a9K1UKs}ȝc9Z/)W׾NdIuV鞔A5w}[xid} t2QDR2 ncļn.ё;=C=[P/%XNȦ/+*o*3|wKY*c5s|_fǯQ GG_+𛬛l"*L[ٰ_쭏gkHFGZy_}3L^u0f>ұΊB`$q;>eRi.rS%}b,~SrkPCwv_Aˈ3T\3H-x_]s$UI޾Rzxt5IRS,FmD*.hKx$Y܄bgcu0ʢ2{ggGttZ^=*!S!,.ÔK7)m &>6OXپ9F1I^)r 9o>oBx"idbQ&85AɃ*`"#BON\s ? `WZ uiޕOwH9Ns]x"{EBx+gZ}0ǝv-!koSɾܢ;;ެnVO=40}DJ*'5 6z=ٽַ_3QU[ݔ pƌ7c[޾:;Zԧ6+@*Gv9;P` }&{jr׫^{'M{W~J}T:=7"hm栖(*W<^ BSATyrX읇58oyBHQ|*<3c6>r`k1\ӹ{aǐJ9i`PTz#VEDCSBcDuy"}5,WI ;EHӹX6SPhތ֞DnlT?HG/[vac.ŹLLskQn;c:v{f'dxX󳰢 &B*z`xpk{*WxK {ŧLgJ<ߟqG6QSn?~3bx.\MZ# {}yuB6hڷ`9z'.7lLsF^+3OdC^yٛRϓ} D,j"2Ӱ֞LʍA 5d:1lCf>R.|X6W%A"Ǣ?g&pj8yyum{;R5]֚0#эӯ^KZ'3&ZXsUޚ{3?^5VIʴEoܸ__"oatw[_'ܭOtjŷ[$d1P2 'M@YB1Թ}ד[lv*!f kT(0!}9 ΚZg,j*D2 훐w5}&fjO&>ʫys*UԒD'o,Dzb~!q/UkZo",zhUjJWp'Wr|s[Ʒ\E4g9 'wgTXIA]9DqФpyVrt5WofoTh)Ya>sC yWz6.>}^NtApto thItv'uf ލ)[pg4KS6ѫv֏,29[]1/>Ҕ|)xgҷco"ZNuUY=p\+yFyEYCDeP*fs$fvH͠|9nኡo538'Sj>cqb։jW{]W~zFOsQp}JۨUG5K:vǸ/\>m5ʫ6o}=YJUߐW랕y%I;ۙ(E7}.ȂySgy)Ct,?9TDz}z'y7[敓gGAꐍNETwc,[wmXy2O8v|8+cB۰:2}<,n]_̒pw<+M[JX2 ڢetw& wU\gōђB) [Fϧ!nIJĉh/?y+<3ZHo27b{Eܛc dw865=N4~ߏUW٠d/1:>F(=#W/S}} #m0z1?k+zFx;N_"|}e{y9p7pM%NPۨz%bmnq=}X*bh+{Vw4N0ּS6*q@0K17BΰjP|$ZOE ;bث7Rzcj%B woJabלH; M |ʅ=J]袳~:0JLoFC?cNȻɚ".\.Sv%23ǬYќ")F϶3U 4ԙCSv_6سf܁ΛDsI߫L2̥FrSx7mC=.Y6Ej[VY,XUi+Ek`^^^NxF>Sw@JۚB:}h]o*3 gOzuU ՃCۺ9WCMc+W۸ffoZ:SU/.gʌ%12[Q\}"z_ɕw?o\*^g(K#2VNiwdvm_#[;v\*:<)/ќaXE=z&^.!HZ0FаY8=zʀs7Ǻ|2ٚ=c=uP9j/\=amg쪌uFQmxZezuuguV\u:u/M>ͽ%+nȌNOBB~MW[^/?:3S yftk[|"SD;5woL6EhA-鮛t麿K+S g;YsuN ,w: 'CÏFߥjo<'+jT jOsYul-{ǯwdG;<])EЩs Jյ 4Pt(}Jiى۷1cl׽:cا(G PO"(a:}~Eo=<6;nEXL&/,}#чcD^NL-Xm#zK&8Htۼ}m}}ڧu@@I[ vԭb$"0oZTA~g'5T-]o{{?%c/}/l rks1898Y"nC:Icgc҃K1k " ׃_ٝႾw HԼ!k{·]|yۏ֭hitUxh@_ wL2kv)w'l`rq[)w;W 4 ]bC}>mN 2@l 1{aC݌%}\uv Oerٕn0hdG퟇[KfGUӧ*|^Yxz²-P5r>q7Of EYq[ƃ:+aJϫiFKg}|F~/Iyfthk+SǮJ?C4Pu 'Zlf_ ꫻ƥķ=ukЭۗИ{o,yVSl㍈]ٝ^{!'CKB՜-X"4[4plҰ!%*vsw-yvw)+0%NX}݊^UT0ۺ\yC eY6EwC9T+sV8Ž-]:^ykU Xy9~ML W(5K}IOs _o`/D!;\ f\/vr> n<| kuKPq9Kvw cڷ[:]6Y]|xl E҇5kq0,ȱk-8f09Xj3oxrʗKwVh4eVgm5t0-@ffob%髷AJ̕ŧ 7|cqcy/K,[Qu߱&dZT=.Į׎[uӮ>;I"(^bXGol uVUB!AK5.Uc*UT9Y](ե]2S]m{Y 7Wl'v|0(P軤—W׍o>=_B쏝Rj= )jNeMuc߅ʜm{=7"|q Wu~_q䥯iOY9>]潿3vyGMXsCRM^d6y,sm|Zh#EMe=N/Nza["6pi"xdm}_ f* )!qXn WcfuX_o뫩 q{Hާ6ro/sjaSӂat$s=266ۅsف2a]D΋`3Ow+uE2RO0\Fֻ&¯ urvޭi&ヺlso˰2N h&"x8$2kY[Bou&]'XqnNgvwerz5u`ЏN&Lј^xGzDU_E6Ɏ)S({ޏ+rXf80rR @J-ci}vZKd> Ęji꛿=٤"+lI%MHO{t}`?` kұ55qAyE;ݙbKvZ슑n^ 1^)n`k[u~;?= FkOͷ@*^{7lh $ &MfG*Lsv}}qտ{W}P61e~bzEd{7̭P()dzi-q]]=һA1Sd be#I}7G m`_۠Zz]X% 6Tƾ}g3j6irVy_O%5z;hR,ϏZ'4}mL*?+wRLoLRۗ鿼ъLןf-ʑkt䕕pQW,ȏMˆ6yee_W}9gm>9F͸ i^R sz*㭻sgXӾ W.L@,Y3R|`yoU:lÑ֫yΖ/!@c>ǠR?Edv ̝R^ִJаǻTBvLKbڣۣ<[2w?I^\A#-\/oi*"dDrFֻʳ}S^ռ;x/=ĕב:I~{d]Gnn!g(ƼqݔYq.QgRB ȎHJj;]nx;Zǔem>s'E,yo*oNG$2S;*k #Ywlk2WVs;/9nr0MND W#c>&\S֫3AզfyW93nsz/ȓm/ѳO߉,!I[>Is5Y[y:T .C]?T~/{ǯFlaX0deWP-v&-rkv z3S^Um#.!״3垺ܹs6hiJ^yK gQ A; ~$5Zqp1%-痹(X;xj s)+'%|;TVt>袷WޗufF[W/3d>Jz(PѧSjf4pSI{n}]$n/bۭpbLl[1'KY{>ƳmLdv:$bʊLWYm%OR]kK^Nv}|>uvqYǝj5o >R5n>"侌OVKZv&ն5tuCW 8+jk| 2 0@`!P @Yp؛ Bwst,R  6{[⻛;~ . B99Q|5Te<%k[LK\qV.:5EDKًyYyUF5mMo _d.zӵghv%Bv_ doqN.f7OO SEZC:{y<]|S%FgE4"MW_/\uo`7UyJο=O]ׁmӂ.sJ^`z83j̚u^AȝMqoDF2 %V.五g]%5 T1(jzk~SmNKŇ.nU^_l*1׾whʒv)H֭A[R%vqq3,-XHnR;dW ˮ:ڭY=ÏS7! SiBŚ]gQ^$luJ) F9L_Mt%zv0y'KZ?>sxm{&c6Q,{jS#ٗ+Ř-޵SrΕj1/װ:w!8r&K7&PPL{ι{}u pB݅龠ۆ][3TUVG]jb3NGee6P枫]|1tE^?^ˍ)x䊇_9+MCal/ihMo^pg5=g͔EF=h>͡OCc}r.P"Ed ,ґS[u3j(A Iλ 6ۅkS*UIIBDbWk[泦<ǥk7ZHN +); ubVjVv wMKK$P# tz`aḪ=a@ ELDsOy-}[fLw 4"v𾠺>ObtȬͫf7J,֪.ڱ`bGBVћn嵜:}>9YjnZ(-q\-xtym:e|n)ؽJU\Qi&\% 9.\y;5 3)+!ZC;0c?$E0"SY_V?[fn+vwro]lP=Wwht6` k3D C5y'~>d85u|rl.B']pϋ7GuOwzٝ"O7+y-W_?AeM;Z،geծ"p2U`\hGolH^eb|> :ܹNE)B)P% %@0CЖP,hP)(p+(614:ٳ2u}ZV\箾~]C* H5I$aF͈cl&rD6$ qL HE`` ҁ B!#F 5t#@6@ @n+ ܟ׮RM^N\z^WL8 @(?詡- ?!@`.HQZE_XQRYW/RHQ0E )" h8?Qr?;Gpx w`~,+t$<O`!eOO}&T#=vpNWݬ0HE"~a{ˑ痛JwQw\CG1r/+X/nIˮ\o"ݱ=-c=ksr{n={^JW4 *8U4k^o+7 wEtcti$js:s̗ەri3nU͓9{5 ܒ\(פhhyw(PoX ~ %[jJYIiVRIVZ[*RʵZVB`+MW5UzrW=.?d=8T[UْmpÅu 4 dڭ]V&zKԠ#)9W&{2cPmEyEt|j 2;b;+<=lG@T7`BdswXR,21e=di}ZonvGȝ"DϐF6ˏI~{ZUm}N:Y]燱xO&5xF]iYUb-^/.4.oPMeQ#ͬIWzYغl(dAC~g%~#o7nnLV|w| Y=Q/j1=E$\Fl@O3صj0/Uy^OЕ\D &n$~,)W1޽,!"wRh0m-byt 9cvmϼ:Qm͜Y0j;SkEYQLA,tN^YigXKr`K!r&]H#W7Ynkb_ /2cv3:S:ͻ7gaQ%4wCbBзCK[7E:}mSWwjM. @HA񽚼 @B  0`@@E>߫Dׅ&800 O@4ӻ-?~hq)׳=ު*;z" YX) /[]&:A-V󝻽z0s.9,*]-w`hz%7zzd@:}CQ ⳢJgxܽ$6a ΘV %ے0D(K;}h c3~Ot x=!:`P :WUdr|׺8H%vN{Utk=tT;}ɰ]p7-qV 3$<.߅zUzMVw6?~~6oFɽڙQ+~Fm?ZeY^Ftv7P^ cgg)zJ:Z- U+Oo ^W qGzLp}=]m|Xe%w@Q۩#Go8ouvmqr~'7!'RY-7@O5sRoG0Mئ  AH74 l A }W s{] }kٿsIQq%*?x,bF BbxbαϠߡalBPޛZfy ˱}po;-|uCb+AFxIo{&!SvpomqF&˨CBج[v-h0$9qWDD>Bz3A~3߬8kc+NO7w#3ERL֋ 0;6>\g&}oL$6|ʄ=-f-Gt"sPH-ѽNbҁwwњJwYHQ%rw Uw8܌FشlW6ìV­Ÿ==(6կnm+y!Kt/.%[O+#é^"?ś:DO.ڸnSY b$HO$V报{D}_ B,{GÛ鳎gb*tUӱG2EM!zrp G#| gz)+ϩ:nx:y߮ej%fv3׳dsB*M \O>gQXV7B;7{gޞsccdB;Xj)ˍh㜭ʪ7I`J,ʦ>ޜF>,t2%*7 g1輗w#D(q_8db;N^P?nщX*Rkb^>aj"<^4)];:,U1%d.w;tQ: Y㾃<yf(먍 >fk;[v-ך<{,W w9{۬ͭ[<<~=u)xr".3lF_FN/.;?JsHv(.yh{޻3>;'پO;i~m>g4 sp\j&.[lo)V4;5Lm,% eɏ#7G{^q}6IÓ2L{c9F8A6lj`FjF̈ Un3by 3Ĺ.3*o~H ">D ?k kjcX/u;:LFnqλ1"z7hL~3ًyKlVFp fZu}ֻwۂ#*τ 9|vj  AwtR gNn({'J]%z`~s^U^v?{rr]ݱ1~ UUb?&kw,Te\c-h{8nҒJ>#bF;òfonKv}bMk |BU ϳ zwj] 5&d >0cm 6]JRGV=?m0L[^x~nDU~C7wb+]vL"=D:ٲjQÔӕbܺ2].p|txfe^7ϖig7ij^ AVX+@'ZȼFo[7ԷFSsj{o%`:>OUNGНN*mœ$:_f-u*^opS7y'fIiM6e5|K.a^dzf,#py7UMܚڕ-EwL J{pI!ͻr9"N͛@苻0y%]VܵJ//6=sq03U2W}*^dcԟ1t1YN*R,Y6[#!W ?ʤ^b]3[E&lˡlyժȉ"&zgXWc_#%ïnUФnpDOOߞîxL0SwQqU~mSizK1C#տљQI]M.ݵrs48B9Gʑ9b$"]./RŐMJǤ]WN?B}9-/R]͑x)m{{{ /|ј^_ز')JF4!H־\}wP}ZwNЁ *)S[ \e]6k]F|{ޚ=5|r1(HYv0YrWn|? et;Ck1AM[pۊ*6j^: }s!]k75luS)5([*di=뺙 :jlfs'jԘ!n}l!Wݏ2!=s/=:Q='*gܸɃ}7e._U3df"<]+Vhf =QZz6=7yvsXe_<BvǣU`[aPi$4̧=K#h*63fpNVbݬOgTQ7Cވ^NϾMlFZ" ϛ;C8VhtϨ)-I/f9pmZ'Xh c;Oمl8,|X9Ozifk=;&|RUR Q#}x]l9yم>9c"_ufShICX3{[F 8۹>)43Џ!IuݏC8{V7f=Am `tf]9m#u+Sz'$zc5ǞEF"+hA%׮:Kљ긎KNZ"i[2E<+8o#7G,b#G1Y\]}JF]Mq;B@8 /g޼dN{;|{W0Q7_n?SЋx{l;7aج$NĞ۔{mw=3lÚJVë S `uױx{ey+~I'|wC]"O S{(s5WC ۙD=/i,ٺuNpv ̛ͮ! n]f3/=*331c+NƹE]},+RH~e?יؿ ۬vV;5{e`v|mF3.mFռ;#DWΌ?' OwG@^Ζ3P'<")?c oo]h>ݴWWc `U7SZѹFYo= +kr؞As;G\n)N^Nb5v.罝^,Y Se;Wal6a\-_(? bpX"2!7N0J&fqDk'"y}~]^fe Cbb 'y}2ezJTڐ^Œhgf6n;^ݷCG)BxR!O2.µ-0h)q=Gp 3 m&<ƥ?g,Xn}Q;v/*n G{LM9yřNmɳ_u mR_֗#)#oevyOU3svξ;2WPί|wmTjcдa{ :0(Jؼ#$ 3_Ob,_o͉{3lc/*{* jVۖnq a%bYrt_%DMKӦPizX3:] :痷g.r'6~+ЎoȬs3QYݹB;p;.E.&n}x1DPKT/n^f͗SsX=n<=}9/3J}Vʭ\{i>8.ږvz6{LO7E}#>TuVE^v=;%<['gkm;5Luubh垕3'8:5z%CHsE˴y9|>T|ߜ{3 CV4܎d)P=[f͂[e:X{,ӫHd%GTث,dtYwg>ܝ ` H(?wt!}owwS~ʇ869nex&No_1Խ镇%囻ȿo{Pv DFbg>f[Dg'@A{tNߊtMctQ2;9]dc~)ޫREs(I̗ks#vן/:S6_ۢZ`^q?.=2لv#FQ2׼wq2V&\YumI<~o?ْko[UXR!Z{Θ_&m@wyEW\S`C4w "ja=٭Tw=A"ȝ׳*y;5&.V.q}\9:"hT'Zp,DŽo{Wr:緎#xV;2aaouA o^}ƹ+y2s[% ڤAUw{VÍlN܁SWd:Nos%hi3G_9=9۸ׁrfb:nFH +TCs-;JmJel2{> ;,;p?hv9͗"ӷ7faJ a2c%9Qwo ]34Tg|0xߌn{ۘ{%$dx *#$MQ?}=AGr{vjG2qū&bbyI3UVuj/T?8x pb;k[Ml'pT'FUẊ7sO/sb+JڃSiq|+Y:mI+immˣXgomk:tM9vu.KWQCv:tS\th%Ut xp ƔU]vXA59.Tû@s<ۅa(wXfɅG^ZiTTnnս!C9Y`_v jai;b>v>5bS|g;)nLFɤ[nGO[Ur<ՖLNoVFuNf`h!2,b#^d|svc p]X^ ʺȧ3%.鏹3/oZqKK!w4Gs,X|,iLsZPogOKuao3% Jo7q=BQC!b{*nu` cW:r }u97ݽp3f0DtlUfFX@0Tt"׸֜ vla4-]CUz~tr|#$V2ŀH xKTWٖ6_h%;^'fwI   X_*?T;PB?$Dm&! R!BŋeUz[n-ڑt4eA)"0J,!m$‡D@RBD`/fNᵡ^*N1QA{q~ΜK`"dHB` , @~"@`}MJ>%YraiUrNp  ]K[ehF/ nz?˪jA>!pPMõg?iKюܹ@ 8M6M5)*Z~1.!X[~QOWڒHT?jZT&H0.cdpT.,wk{|bE~5^rnvE9_^^Wsy5^j:rk'T EHU /eŋfk&گ~to5r/建6Jp\}V|ogDEF\Z^||sr=nj܏K#SE\-W/6+۝4EuR\W7JJsJ*?) ZVҴJ+m-U҉/R*~!!>T"  r߲dz`W}SgQtTsB0Ob <+EV7(xM̉&7ǞSy 59),@斈]6~`RLgW-K{KPf3\8;Kװf_Kyߵzfi4ga3۔/Tg!;G!V@jf,]<&7:S0ssWu'"(ý}-,:N8W{Wmq/#y f/gG -N74\^@:;`vA9KaPZ`Joƛu{Dk9d~5}c[V1_.M$mnrշp")zZǍ΋lBXuYA)~Cbvќ2 |gYB!:=Vg>>={>ѠAs?]NήeBnj3[Ɗ 6VIczYUwS>'UZ:L{zQXEsTYb8iXW mh{A|-_LmU8ԯ/aջkZco&֫WçU{M͘+qՃ)ΙbK@ۭȳWI̽ <{<t?aL7ZyRd`*VU@Z̽b 96Ic}Z7:o5f0&xR= (D5ً:`ʹ >]5*3"Yip[%So6/z=YXY(Zl tIWg3OG -`g$&4^rumnݬHwdSw*wd#gF]Qu״j^J{3],Wsilu^T/AwM{bf.V?"ov.r :5ZKܨ׮mn{YS5BUr\Yyd~ߏ:!lܵBU}:-^e(F-T}/nXCIٺ͆Aw!B;2nܼ_O .T Sv7y3ѢzW?sN쉾nV)s Ƌ_ vrrp-“[Kʂ)cyPoBnxv1,,2 v.聛̘o+}kw(iNukp*[|2e8K7yITt,9q #\d ncy%]S_<[ß]7].POrt> n\5HV9(FYO*o} ҘHc fN_Cw֭Ukru@z0{mW=.%K}}46 =it6yHKJhy+YЛvzf,z7"М5)(zV]V'UEv@wRA.f*.Dߖժ nYy$Xi7'-SY1:ˍ]lvvsSf#8느`4XU;Xvۊڟc_:֝ꓽ#ʱR$udpYd/U^u:oSMPKN#ffEQ7JiwtT-ߤl"k$MŵcݧFT׉0DhגOK9GJ1;Zb:pmgYH(tkxgMҵvҹjYj[jCzz `צ1yw/J&>Q[<"72lZkѸaU7}ݴ ߯Qb囪s5rb+C!qOmXHph|5y\#F7v8r[Q ¼PmZP~&] YT,>Yνt2i/l<Υ^SAv~Аbtfj]-w%RGB::*g^c@Agp @`#^X2s>{@@b$V;,Nnj=r^finCw6,HTÔ 6֊ۭns66ɦDQrtz߶L W^uX7+FL`0j3z;f7SAlblONثvz<㶒5P%{ n$e..jޜ42hL,2Յ4AqX:54$W; קܢƾ|SqɿguE%su(۸bMXH,@Bu*plBs8 ` ?Cݟğ>hƧQpsf֯u!^L޾敌s.ݸ^+贑j.8<ĖY]<<" +rŹظ1+Eޣ%];n:a.G2 {eT.30"pk nu`uВ3Rwc&3嗟[άRֳd<"#߭fњ(DVۣ8 Ҧ fi'®je{-AQ1Ғ_Gf[u&o.[d V˚Ƕh]f=~;\o[Gb$e'چxڇvwRANQ֑ڀqΘ}6b<4e=xmJc鑈צ<9vIվRgбT\՟dP9WIgШ\꾓r&c(]N ,ġATc,{m^rĴl;{\-vſz5wC욃{"_~uҼ~ۘ*] CSb=+ 85SP X*6:#Fs'*]NQxܪrExERFdb?)-X m{rEuWWnt3A / *0N̓һ̥`cETnm]ʎa-rOJ~@G+2`,bo쮄~_ {`#X#hG?VsUwW4]fN{zֿKS /Lݑc_ i_^&'%|~O S5Ŷ(EzF~çoocXU*>S]ޙat#WD;mnyƏɎPwrqyii@b>YsX!LG73r`;Y]fuު2ըZtO03c!|fxF^Ks9Ko-艕G=ecW&~^Vp^ n:fqtk9;2s#sݵHwh;#ΦfCF`_ohySͥWZ 'W!-PU UVVIŚaCZyg`^S%]/݊_Dɽn=4 r|j:oL(P`w2.;7-sETy!uzRɇ5"3ݜ_n6+ `[*ֹi+ cqM| RVd `Qmh}u/{4CMu3ٝcC= `DTo\w<~Xc5Э>*ue޸E_Xq9DRMXShҋ#@ pc6V-VxjIumb;t2ͦ{i=Jd**_Qt-'F=w) ) #e A=ӝ5,w7b;iMcSZI][u.L.wzr +*IWڲk7 '~@w"w͊}!f\`Ft¢/ʔe@P"2핌r^/_UZٷjlՑͳWK _:ݙQ>Pdk:L/jU'V~ @+["q!V£Sr!a*9KE 7T\0k]4\4\ԹW!eg7W˧_C2` 4@}z MBUr,GG'n38fdz>"}Vt\P%LK,F+zC*h8-QF;u{uHE^8 8l,by**'naFwK]!XsFj>n]\rKuyy%ӡDFpBW fmbUlq |Pk}XϐΝ$6%묏3ʗG+?w,fL)GxpZ#3b1=&y6sȍTZk8dڻVosvӻP!o0ltq(Ijs ~=y @Vwziw$TGE ynT=2c~Pg ;גR _0@ǴWXf{^@ȻwJ';GR[s /?ڥj&n+ U[QU~HLY5x؏u~S}TG듆@,Wlh770)FNR h.$Lk^;VhV]ջ%k^SjOdvܽ*]tx㝓{tl6"$<XNjH+ 9TɄGd>9`# A] -h|6v`!>b,;Y5m٤=)Z.݂-c1yRquv&kO&-4=Et9^3nk}6H[` RsnB.syfgW^̣w;LNtKx5TX4h)Rؽ>^b)(x˵*ܼ*m2vk>.zvH!;f{)*1wNEGIeMNg8,=OXSb'+ESns]:rN[`ݨ0pMV`{dN T+͓mT8 X]Бb;(KӅ 7btfGWkgM]{o:lp#҆yԡ`fߤDw:y[-Qvj{aWԧG3>#'՘Y[{Dd2"P!ݸos̹&}*Ub~vRyYoul+T&lͶyl8"2oe»&+Z0t^J9~5t:=#U6[=;93V߹;߶{sjp Q=ro 5Q&\BDi eŎR-s]1j^eJ+Pkuw?O߹Ckř%ǃ0VόRJqeJ<5r([JM˰㻮x`#/W3W|Z}-DdH^{iN]3L̂[J[.7aEW. EwC2cRãG]*)\#nʧ :c&KKIR3q5+(<9̀< 0*$ 0C.L<y6,pTNV?KЧD,׿j?sl 58y5pb;z^g-h!7 };wv^hAӷگK5'\V]WX:#r9C:Cz=r̾O&bcjT[ը-W'e:5ۛ ~f^7ǟڍRoilv q3u'C'r(~:N5;S r%wuIiIv󒾍`{} ~/<ǹ<)\]R+~x\oUj[Zii i p~ͭ.L/ Nߜ>tb;ɩ=-[ShHOv"d7XeY^>WǛ.~J_kb9N謌=i6^]|zeH[99)hKc*wc!{#L6Þ-[BkxynL'qLTry!ڴ ^,s۝\`!ˣ~q/hrtL7sw{錊V:ݵdJҽ՚+KXg &ǒᰋ{a90u֌1t8eĘC^;[\Ɛгi.ut]5_`/v‘+1.kR r !P)|Jȴf+`/s#TOd/kfnLxrFӻL:VtBn3t3tŮ{[g(]xVFB>Aa|zOWcȐEd޿<;cqT0Rf-ڽ|uuFuAuۺyPؠIطG}uNGt.R٠8&y)?|?Ŕ|dvRw˜kja~ᣨ֟c}s4ylPu!@A$ A Κ^XPkT=yQVuYvH}G&H@\!N$yCB 4h !p%A(-, ~ 5G~Nh=zl^W߷}tX$K,S>Ā`ⅆT?Ysf#|Z A\~,J<X 0- =/aj)!me߀T@ 'ʚ^{LT~z |(w3jY7>}6(P~$JI= .@27^yFyFݙ#sӘlb1ͯ1ߝG|y\3*+W\qR*?HHMi[ifZk6:y^{l_>vZ5%漻nmrC<<{wEy{wn*绫͓\׮_":o>_lP(Jjvk.cԈ^|@uw ř=8~ oǨ]<(_2.vIy߯ؖPeOoGvk ܺ vlFU\aЂYn̛$~4Vu:}z<++UoՎV {A~ĭVhmX;+[_$uj0O{S g,5{{WF>t#z M CmE T*J={c#pwja}7˘VBπ島5 h*O~9 E܍Xɼ9H[owJmw02teF֞y꾘{(AޔfIە|ydGss=tyBR$8 5r׳\69O]5,[]S|>%`)TQggЊ sDPXZ dX>5;O!+%]W%#-[W!yoVWٜ 0~7R !]ڴ6XTwȏVەsmPu1`Ȅ]zieCϴ ay}Ϭܸ\/:Pޕ7Ҙ>[[>7>"y׻UHO'?#GZ_bN;qA?֎r)wmReat0v/.T2AߪaC4!bf3wgp1sp 3&jջ::@Tsd`r!&gs4 WfgJޯ\߶qChl /(}DR") = ^kߪ"atF>{ゆ}{۩Ԕ*ߑKRrdD7O'*"3:i1ј b}⪵\H/ ͹0՚^_ܞ<<{ӂMo.u 5|MojimoEeiSfguSzlDE\ʴ3o`oKa=fR;NVh~ .̾pAD[=^kn4Uåd?w:3&5On7 ǯڻZ-ԭzu˴[*3N]=- IƢ'/Dw$=:mLU6T_vsT לW?n dRշ/krCǚ-Usj3pMܺ`ˎbe-r.>^| D|'spEq E(2vZAf!NJ+,@~VCr]"3kml޽抔9.>ctw^ u7ïx;~ qer2ղSI/Q#rIW˞ǺPR}}<Uܻ#[+ GGYۥԗQy&<2oOrK8d\8 _J\7Gf-ؒ url-NRӲ_n!.-H b '՞X6Rz/X\r[jAɳ{ʵV|mQT4Ӫ=aNEA9MY$,UyȊژ󞾮jUUnV\DDʙk{܏\6E)Ŏg3.v{`( Jp6Բ7 ٵV,] _FvZQuS ؽN.J} ny#P(Q>KKe%f-3;x7NtoV*28GڱՐ}mV͔.$v/~ 9:՘ʏdP\IKL -eR{';?XWTA"XXhel n #}qkM㈝gM=^4EprӞ˩~>f- ЎC:c]t7aj3M Nn/«Wh']ώm&ޛU^K܆gԪz%|u}z}HJN{c7K3:5ÎshxH&Ubyr>^W/ݔw5yg۱'iuOdVDj c)F`\)ee1Vea|2+ *'/<)DEI^mw-.gIĞryhLNh]/8t[ءB MݫNW󤶍#Y117$h\n`z cg8Nl%eB] yݻmeWצIǴ;J@~ym=ʭ{yBܽ.l1Q×TlH|%Oæ~ jM 3+9<\o|Io4ޟ2ϝm݌12dy#*`mk>hힿ?cݽ WBiQ b=&3E5fgacTϪX(0x ٿgV2zuWt#9dwT Oӏi/N3~B~o_74eqsr O_-l*QkkNFp0]TTcVHQЛtwO]T+ 07NJ2y^/ bΦ Osn8duj9*ծWG߻u_;?`}_EYZL[|]Gv_Pux`&΁P$Zyw uq3YBx泇ks$+ ŠrS|/3!N  ss ]+bKUT;7{vrB,ۈmUօKf.a'~UjWs6iI/pH1y7XW}P~\bޛ=]{cl+ĂM(%D# 1=y}ˋjGk_kg^]UxGS[˥fEԯR-_Ώj؄Pw~/mϏ>ןwQrSz ᤀV>gɌee׮'a5f.+?}?--5„GaKiS]s>δEMg+dn>WlS:_=e=k6,nԜ(qz㑇S=1wj랾0qgd/(jO\'?(̬V/8S{V'kj-,SֲImA>gC+:Pz;wԿhUlw?$ǽɍV}"Fs2Ͳ[ANNPwډ`=u1}&>ܥT9׷% @l=x l ~fIf=9y(Of%2XB][Zb^(Z5_I7dϥ/^|ˡ-!#Z˵3xRUj:g&7JywRL'3v%γ*ve>Uy\޲YļwM;rqO#Om.R+ xr;yøVa8HkL^Feew-빆`7FaQ'}lPJhO%ڪ|2PZPy"]Ԩ{>Rg>ȯA]8^A pRkSh-ٖ:c@/9 P?]~ A`IOoh߫}\Tn'# gL/譧iF$[h@3qVV`7!CoO7ҧMzfvV8Z2G_TDcVwy7$|tʪn/?>s?Rby&g7; JDJ?Da1Gj_UXteS]h$Ik{<{Ԫu|Pդo-=xGQRu;&6MUe8EcST= ,sw-+6'nnj{#Ğ1-zfmWsf._^ʹ mf|h%v8wy2rfӔ~؜H[!.T3%Pr޾SRHy7O(FObae,xCtSopS3C;9 70kZ=1[uz~ //ѐ`יIyP(C7mVZFŚf*4K"I>оkݞtuDMw[}!Κu 睾[18y.{ ehWw1}:,m We2^gO*~M_wr׉=UJD.k(mXUƽ7%YzkiKڟx]r0;(cbe罝ؽ㙤Cʹqj{fM+'%_!]OuD[}f{ ӑ!Uz&w7VĖݓbTz@jy{0MZXvi%>R"žB65uʱ^7@8NeY~3~=u@  `*BffmKM3@H)~lϯ'Xۥ Ady+jqm9e Up^;m+˧8 o209D+{;sGg,"3nuR)~7eD"w4_if1Lk\-(b묓v(b7>3ǨAW:!!ٗ/ڶ(Ұ}FȂ1ݝ{ ѣs?|SgjK|,nʙy =Bng}#D"7Ҵ=&D4,s2ukU3OeQnH`~厗 Þ7KF79/<0eb"58n \ܲ8E8//J;VMר rV$[{yF5xЗx0~*W$ jtWǝE#{ܾGM2[2+8<{HWs#P>fdmEZjw55;s.x2w"؊<҆7,u!V^uj+.¦;c!ܟϷvmO@h<.nUl蓚;Pͅ+g,<^67{*)bN+wA+){(ݞ^эٿw uĺ=4Vɷt-Wwo5L+*D- K?{^/-+ _tjWǥԑ!/ EKdh{-ت [;25J;gd纶!0i?H>IODT&" IywϮ="f{܏ϔ{Mr>útNf Jt\o -PEi,= VHu[JXݖ{) =&̈́ ^C>c5V%HdWn)=6h2N?w"$Gu~Ug[og뻗9]Ҷk;Xޕ ܺJR]?SyۻoX+/K;7˦ob^fK Q?zK~e f/M{:~YgV˞]Bz/r[WD 79@եt^]APP@15siMu\i [>Z;މ]4hgz2?M퀯^7_-~ĭ`|2\;oKћC~Qˮ4 &=`>GWeNł?kTK}CGxbi ̬{ Q"[鹞=2{o}xk_g(Q=$6 !GFNTGٟ^Nf=ĴZn>ÈdϺw`-N rg*P۫v&ng}>"7}{yu#aetDئeoR0ld"F8s#\v/vTiR]lѷK<7gHxf\2rJ cB!t 8FDEΥfsS;q3RR&cՕ}s@֯7BjB ^cޜfmݞ}0ȧodJ>~=7DARE$CJB(>&WE  &܌ꆮ]rcws`WhTܰfoq%PYŅOS^jm.Y$6l᫶$QJ>suUˮ뺋Y[-/q u_ V+RhVȍ!M/o,.aDC9eՊV#zV bD4*9 ٽύsXAnBYȋ18{f.yoC]|Cӽ^*1hF6eR=ֶt&sBېD{\b;X ȲM[\ jWfLG;QcTڟ@7 +n;H!y##qkw t#L澞[;=BXD3WII澱ع}53/P ceWT&Vmׄ @+K)s..ӽYmM}Tً:Mv!8N n2KU⼃H( Mwڍ‚q9L Kzovpk,mH[wQhz,% r=ؘ\_ 0sM꛽:S%\兇]TF\JLCn>Y]w'"r qjXvZn`n La-* 2p[Mf4ܛ,M ݍؽ[omb֜Mz+;aps1"N.r\[(]+h4V(̳+Mw]DB]-*$J1 ubGumU뱷f| nu(;n;Hʼ*de A-Wjiz9|__=As{(1bxqXژр|cܡZw'w_?p[pBp {ۖ'|# ?s2/ƨU7 $"H#, BWyB[:8SlNoF!AIkW*WK]z[Q~mSD X 6% #QHRRZPK%A _z]5J_N1\$fjKgMjۺ/kO$JTBh@P"+}9_έo_oT#Kw|P!@P%ȔULU֫p^}kblLeЮq/X*?EQ`$`@8 "߉/eU5w5ic,Q| %smvK$(H">ae~_ܺstIQUPT*A.F+ݱ\Fܹn$UP7r[BȊ-w;n[_wꖤԬB*BG ,H#FF&S'.e2*HHn#Dnt5>],r,Twv5鼺~,Q˾}w-Hk.%1@9׻~;@@ H{9ߢL֚H\;dnfz8jk% LZ.d {V"]R3J=iq5}; >\LM:=F\?ywB.?6`襱}wJ0TsK~Q%4_.kcf[=%מ=(8vUw'X6Y6UQ׎[ΈٗJ/~v(V0@mgOv}G] RdE,̦CHu;1Wo9FYY[-P 0U1C|RDR;OXUזyH oJ|;q<@ `t2K0-+F2Y]\'mboWW_dg ] x<@*V[lUrϋʎߛ_ - ESָя@̸IdIvt=o=]mw;wHPUemYZXzxqV%fBfK|u{|S}{i E?C82it:E4}쓛6uv4!<-y&'㢴sF|]r !.كowe`U#䪷Mrn;Bu}r./a½̍@ evoVXǷ/~1սP]#DXQ]7\*#42>`z׹ ;Je^U|t:yx2aՊZNpZY2rqvw d\ %G;,;bʽ_v]mMw,%k]ŏݘ1_Qw͌M{t{/`OK=LigqʡJ5 2]Ds3ɳD?]"=Ccg{1s® W$+@Wg'`Q~3ݚjm-I7Qɷ&(;[&ꋾ̥}6sXjl?[]ltKž >^Ip9 65::0[saIT~U7='[~/޵wӒV."|aR^rH%DiNȺ@u,`f%t'O@AU :?TӡlEjdԱqM$-MTo645Ip؄~2sIX%Fն(1nwPlf-nyx+7V㎂Tޛ5:\}FtҸʘiy1|\N#7gD4Dy^L\Ыr83G3KR3qdx)9;VIg%eaNZhtC 6XwCcT҅v\Kˎ0 R9Ew MTsw?z3ugtSPtڥMp5ӧ\=ۃ/an,Yƌ=L8?a}<Lg DvTjԣxmx֋D ^Wqf{%x~5N/ԏ6E'WqC,6vW3S I"#´Wm$Qu[T[ 6͌<᷃Ӯrs&<6ᚶΚzkw0&|^Vxڂ2fwf!kߢw(4W1+eNvw΃+,~6,JvU-HU8tENÜFI®oR :|ƪ yquB 5;xj/g^{ƆgΞpm>Gx"¼n~Eܪ`95Xe b aQð+: 4:e=6SwuayY:0Y)EUS_be|.v+bkW ӼLH{ΦM^vѱ%O76=_ЇhْyaIJt+ )0ޭ);4nc}MC(p~u,ݝ~P?XT}Eg'=LZ3p19Nc"qk41 7+60}>nن`Ŝ&Zzk(!'U*uP{G4s"e U͈e}q5Yn^z Pr~}u}뇿cOh[}BpL\VTmlYJ< ]\S3 2mnX_ng09^4 ُo0$5_e)h޹}ߵϷb &9@4QR)Y_g&}?~Gj9[c9kơE<μQk*ݴ^s ^Q{9vm)k3㊷a scbPhE=Fp:&śm3go %D K_&/z(w*s3fG"E>ihbTK@+Nl$q:^ylU sd$<6͝*ml٘;^I=6=¯rvoyN"2͕2-x-y]O\}F0X$ sZHgaˀjl,8[|.*{X=73oru{Zj=믄1djZy7gft#7\}'9˂AK+em7BbRsA|wF ڭof.Ϗ }U=V ;h`Q~!;͋>n}̝?M/VS|qʻ6m?98m"=iJYk-;&R}X.܄چK 8٨S&\}Xr]oy52ĨNK{bNx~C.e`O,3_6=tSǬtϽ5N֭[k$[ Ky0\dLjFf(yoΆmLӌ]y"…;tݨ|T^V3,m\5"FuJ+>EQFcR±CE|zM؎՛M' *e=嚎GDi9Z(ϐ7)x7U-pY Y)s-dC3̥WXs|;LG j^@űq>_@V{q f܂Z;)HH)E'^jq-Ȫ9Yw=IEQX)WY}SW Ks4d0W].Vm)#)]gK}sᒬ7J߶ F>'5RbԖuX1pތ\?>J\ޮ^['sf/`x93)hS7usg\i@鈞cR~ClVc.`7|DgKݓ6Seg-bxJjf6J͌ ktYT,}oəF0hʖ?)euͳloʓrF\^K5;}弛oȮ ROw@x+s(`>&yЭMC{BCW*W7AE yc^XW{/B&]l9`w[׉PVJΆ{1$gKVHLM^]]2B/{68GN?΋?(}CuEq~P/:T2fg qG$)Z'A@\ l^^OYek*Kr},~|A/Yq$-:9YG=q>KHfBGWǦֆuD:La߻hPh\Ef&S=E_if daO s_;#Dcqo4)fWf[?h}fBffy|*dqb>kqneOD8FF%NKId(%UdB1.o)x a\KЈ; $M-vscGnSK vz Kj.^ 75&xo$>{]=<6Uܱ 5 ?N(}p^,}#X멫o3CO;]Mgu\3L;M tK:Q]~w~!(*=7d{).BQ6&X@'igwv4vu}LU ^2'Cw_Ÿ@&,Kyz;;(N[fU~[.,= <*cд;2;_߽Pzm멨TA3Eۉ N~U0a=`YFq^K!-T`պjdZZ[lz~4#{jrShaVʼni:sZ#D?`ZBEbUMqU? XU{7 2%^^g'ۅaKTaby.5((_-ZJ1Q6ʻwA+4L 7>{}>"|irW1#3m]Cu*S ="$ ْNng|/:n,` *pȄT5ysvIw]/ E|ȴ5ِD&τ9ƁM;r\=w+p4> VNʐJRbN`ZVYSVu1V_zxAZRc+!/l[%jꞻLߺ|S1Cu5C=s}DnNl5~9-ڗ.;%M#aqݲָ,>m] $|"S/F}Uj\>G9'4N9:AqȚ%wFmB:(ʎ~<͎|]gE6)^yyU}1^,I㠏 U;8TڲsEvbh8u,`_E"^߹qs°BnrWEUVKG1s|r[|ev 4m?/hnSUEktbTVwK}r'}m#Rkz9W LΞu u 8=U0},xOqA)![FVDy9^IOdQ{$%Yz$"Zy?dwu" +}Iq,l Ч8np&u".:VFgTEj#z3/,]\b s﹧)KYv>O~ٷ2Y5:Z]B{\=}v d:m=Z{juv[p'ष]g`)r~uzauO'Pr{mSYE{Ǔ^~(VR{YUDU=@Êh 8*jiH)Lx nj[cs#n],Upױ78dg%%l.JųăeeM!+<{,$j,m2s"k]IEVҖ$@ WZ=VNh!^wEȣ$#91-jRN/o?*DU2X}Rֺhr2dʳ; ;#uvnO'S:nB\b0N[izs4"-yW9}闳|7@..7..Fn]+9W9/}U^Nr'ۊ|]ur;clFN];A 5YDiv f;Z-%᳐ۥAnQ̔a;wX2T}/2y5|"w:Zn4a9U xVDsw"Eut1.JF0SdYծnu=BZ\7k xvQLn:],ذV)(k,6*S$듂!I|fVֹln^UI],sEChc!eP(=G'Y6X5}18=dFI9r 17:>L[eOZMjMmKYvv)ǥGA8;{5 w{tg̕".`ꙋ\ÓLy9dSѫ܎-q= p;ûOuJvuX&1m;K[L3١8LgaNJ\rPxMj +)=b̨go ע=ʒ#xL'RMw>7dNawb;%9/=k.zDy[Qb_d*`Ӑz=9tlЏ{/%s"XW/^w/yu酊p؅ګf{[vej`o˿J}m]w6uLpMc[}Xd.J ݵ{U&w5~WBA_9߹fO]F͆dAXݝw7^X;b 6>},ks4( lޓ:0G@p6[J٭IuInk[;~SA`H 0F P/:;Xjk}eeAM EB!DVuڔo}Omcöks=wڛK$ PŸK(j QT@(R+1u7ڮ45Y bF|,(Ag~߳sw3bAgݣurwUɇA<(`@A?@2bnbk2{R h( Pܐ Gq7MwW1ZQSҚU0,NBC6کMM%6۵m$ko˟伋~6zo{^Bqи[yeԯm㫶L LQ{~LǏ+oN..ZBF|5>夭~wqX4p۩+6^]8kf7UguOת;E%foEwݡ7Llr ޮXCNoSs6p .gdh 7ݸ]Gvd _[̑,Ϝ#{)5ޚCٿڥ󗺫*, r1x}]fz_c'^Ю xjGAUe;Ck|co?1fSG,M6O1 ŸdЗWY\Jmfso򎢚y/+؂tHyju1!N5xC63w,HXwZt_;{>xQ{W5Ǧu1FxoISPkc((c u+y^X݊RAFc 7_Vr#:Ox5azDG=yU8UJLKapjw}ӈ7A/4oL,+ʥ }5T'XLpToc=ԻqXylUud]OPʥRElp^:+UX(k7`'djB+ 4~ uR JP&8남y`^l46A}z˟ S_܆/ YD["*f|-ˆCsn}%p#A@SoݼmUEu޷sQ_mv&/銗qlj4R2*SLsgdõ8W#?>!R+c1Uw˖ V-]x x|Pv<[r vɚl_7{vQJ&Gϗ nSͣXV$Wkqgy{dt+9Dӌf&btxϮ J:wd.[Gm_ ?O6n\~Bˊ,ML]/:G񟏹COֵu{j+OΛʾ٣}1ûfV EIw;AîKcdC­'J<J6?-U}vUHϷJkT` d*Jڷ5C&j]Ҳsw*qYrp 2/鋟ޏUڼ92] a{GU9rvo νsKٞ+:4s.xm_oLnҽJ{k6=o L^j:j5^nOPM ڶs' M"E[)˔UAZ Z^÷2Qe)dta|\&3 SFa{~kj^(/%v\@|;B7ƶ|W'%\nġ$"w!Dt:'Zŏ}kګNh;k^|Jv,NEKaU@>9;5ʻΚϠBn2Mۻ\voNf+/K״urvf(+nR7ՂΫ[}W2!ȿo{P(OK9˾YZ\r')mț8:.ZZyof#)wl[@kVQw_v‹p(R4R n5d;W7/e=pVkrXjvl{RӳB f)mʅV%> zt߫_ۮW,|nf6 Cq 0./UQuM7`9AʇB q{-\?>9IV$TZ﷣S };"2~'ZkOmI.۠GxL' ǧsQ'}Kq,R#SXQ8Ws[+2}lj)ݠ߸uҷ}:E2-qWީt$^LxT5>G}6Wu#*{[ص<]#ם#b﷕U5I}gR\0aUf 2rzH[QZen=2:o<%Ca6v+=W6`=W&9QV z?AXt9l]#yCnmvrٲtKެ9dkGX$4[]>vu`nUw{.}XK=&UǒO}[ئ竄o8Ѿz;1B^~W wW+_d3PL`R\;mn'{ʓr{nqq6r|;d>ݹԚOFX'b;餛VXۆ\3aU]iJ/zv_C{~Mu\ 7aeIj;*~!SŏYf_RQ]nt:=[ϧ]':?ot0Evi9}hERj裝~{bIxfXUz7yKJG2`f>Ѳ(Wj²3՜9xgz `}e^EП\V'a|BF2:Ct3m"qy]: 0Z3Gpv YMu?M~pb UIY[ڬQ=WrDޑT _7`.NT5n)GJ*Ol{o[n^}|λ'ruI8RRl .U' Fxz(͎/$df?j9EBx ڭ{nwj]ab.M&,t []#W9yq!g l[E!\_8`;#\~H <{ckX:_f"Զ׎;KwOf]^_fC;i)q<+WW`,Y;0n wLͮw#iMbr!=z;vD-jYjz?:;MfzB\9$EJ w<$7<弆dݝҐ0s9R<]^/"u~st,E/x;7pyYe9Mn_z'Kzٞ*f}Sv>ڕn71xUf*Vq]ab~1ͤb~Ii>헕_)8UOfN[}68OwVWv zE}G߅=i)<zy<}v-R^wڿ"ռ%~Nn"*P Ӗc)_DžCŶht.l_:4W: ac W]eOtʘ,w;2n^vsc7g%V{M-cuYIr ~,N̑YI U)D:"] V5Vck`:r.^ _0ӏt,7z YFQ]- QO3\A+J&u9wglLj.Ypy릈[lys@=W?ʒ.q|4;oIRss$(ڞ:yJ=3=wC|Srag1̚ /!wG:85Y#ƪygūcjb:̇W{> QBmv7/ۨH1҆W%9.vg3o+qV2uQ|+b){uۡ."B~Wz _hAL7]~#+]O1N5S)U}w ח|DIu)kW{󂞫o-on+7^zk6t7znn:')QuY ?0i!kԯRRk(:ϕ龰Y# ݘL0sSUn`+:,!\Ž˛9K3fЍIӅ\^)h2_URٻsZ" fe(X}8>K2?vpmy*jOd?`Lv>i9-듾/?5KޠW^vtG{iaĦ&.FS%wl;74 yX6<~oɐRz:.uZ7ЍG̈קf9uZ1yU3oʚ/T& ;"kY!]xڄEՅs 5\' cI/HۿShYݾJ+' p{fRiCPm_dLb 6{.D{wc<cYK-m\򮉴U^4;sn(b]kOOÓ%( \!8x^ 9%Vf؍z15:7OZ[wRsUEuL Zd>6/p81р{2v<`teݪS|0fY]ozFb%c{\}bfFv8`!BV(69s܌`~*> KwX; z\k]֪4:&)P33 ge'p V3]sWdSϕ "'|a+3FIsWwgR=nlq{Hj0w*zqnd9( `[zsY`Hf~ggܫWE%jG k5K<~ѻ~#|uz.Ҕ] \tYv^[{|UTd8ap ']qMkUS[(d;tr*ɼ!ޑK"r8uw>G ^[ms< QG}w/ 0LقΓ{sN,,zaf{sN fV|nwXfX`\zNW+\-x(A|mK~r?X NEK/wie߯ZBjgi{hC:*=W|k[#)x>&qyi+zuuk`1{\.f;$%DvMuhW}6pGw%1|"%(nӕBwy+:k5]\qJJbrPH&a.ů1/]lƔyv_{9|ȳּ[߻M$PAݧ@uW^̲_n:e]"l8 ;FU/~d&1eY(b fkrYweb `U/ʹg \%H^OškK}g==7^kzQ\goiOY5AcQ-f;,*>kOd80:/G)eȻyo { Vytµ oJ!]ə럝>#p;mk= Ѳv}l2*m."\2yjEuɇbo5w5e]xSkuЍIkYT U;ۧxw {09|CnU,+"۽l_Pv ݅#H@}]I |BH@>,~':qGo5\rro{ތWwrWK.Wt\dnkr\_A?@2>Ӎ~zնjwUci|/6,ѻZ aŶ P5ekۦ\"qis3{&=7VuJu;_ZҞ<}YBurj۬B0+,Yq*mܧZiY="=[TbSx'^5P8Ljè+Cvw;\J $}.Zs._kÅ92U I.-AU 1t7է"z3)9eMc37ELʎ7Yi,;V)v䤞J9k\AszMnK3^.2;%PuFmIk3 :"nR؋[١Y :Yr{iv< ~NS͗cC뇻h!`-iLs!fV0䙖0BH+f<UZ[3v"8dZZÄp"k"&lOn ݵbU gScO`Wi-ɓth0VbbxWV&kFn' 訖kv޾Nw7M&4NJz7tC Yt)B0Lׇ(Yvf'n ˺=LUl^ m=sԩ/EcFt.j؇l{"%47ժXث8սxkH-,4΍t[սkO^6`j$M4*r\)IV8:mCpXy''JY2 X\kDg5ܻ< L}۴L`adoL:{VQ?HFwᄐʭl_V xyd{wgk|2m0Qd@ۻ]La8$xW7@mo3ww[epঅ;>?O'}}Q9>}6xms>B ?mХ A6 l ? & f`f)'͘wK˭9P$$\P> DePE0[0,5$M@t߀~C^_k3ؖC3s'bpA *  Q?XG?oq }>hr<&FOa0`{Sǡ1ܱiXy|7ѡ<@ !ڮngw"uRsl]ؾ[m6jw2>X$D|XH *D Wɒ)(({\ c^أW҂r4F(56 i T {y|) ^Cq*(ډbʚɓ1pڱQoLuڻIBt7\$etv#X-gG{=y֮2zST gJEvtVuOacW|*Į{=1sͭ[(U#]og}캾 Xz:\knQXf.-Fd_wnD\^sWzEsyBIR7gUsh*ʉǽ{}&df-3>;ܑC*ޗUӼEξ5գt[Ju@c|fq}+\.7UJ}Y ̏6~+UPU%pd!;|i+q؎ۘ^BHڏpZ"vu*GN6pPv}i4+\;]k}T0=kyaڜLU{9aLWVW&з$9AiQ={ {%P>y v:eΝΟQuy\p^#)\իUҡL4]R5#M2M+ͶuS_bdnv!Bh.wEC_c?}rz}e9=7K=سX, #eN%#WL˺/Em,Jlgʲfh`Sz o.pAWNu7Wܨ{"6aw)bgk^_ΧZ xǼ:C JJoVuaȤdc"sح*TK:^Qn Goww<}2 U3ew专 dgՅAǩ*S2Hau.oTw ŽLj..A75Gu$<ϯxqWorQQ'O$隷RB-qI彋Ub>(5IȮ^z߼R JTm`"~yw/zܥJJ*|ڶwX7jvY\J:ssN&đ|Ϭv}LMJu Vöz|N?+o+`皜օ@eneŴu/1J dF26;Zvcyn{tz}8'pKx٨nt*1Gj?]y9چu<T paPh6O 2ӱ|4=@c,\P):!%yrU3{M6nwWQ{c2?=˫Vk8 W=o$]]U8)t7cJէ;p5UNwsF}sK Texb}ۂz{յI5'Oz 6vL\8Q)6w F4۔ínp Ԑr_,NBmWܞ崼9-#'p:K\r2/ t#mJyެp &.a)f3Nmn;9Ӱp1VGVXtshɳKRݢτ3֎_gpC8'92.DD<ԝv $& 5+VoܩQN>˭]erXrF@2lLT}p,;RxڕXwe)dP,pFZLYsT}"&g ̓ǻ% 1嚦gw.nRE+~csY)|aJfVw{]!l+5%trXDBD]ɿ W?ڜ)O-R賚RꜜS*yQ,o{sEj冰azxm'5F Sot޳]zg(=!ݠ7'y<]KggjD[BEaYhOrfɋs.K=y͝;n:{Wۜyds7:8Q3-cV=7jE  ;UvSoh43.Uh*(eS = 9\la3ԧ^9 hݍjJD5BZBY=ykyS$zly'`suδ1[Lfa9*Ը_X}y9_ȍwlau1Vuq&${n}{uʞUUCp.jEXsZP] XVޖps}xDjUG 6[~.?UWcM_uvu*۱ؿ{&X<0k(9ޘq=f^ =z#m.yo޿'0ڿ2a:苿geodwDz(2\71kv ķ*G_ԡzLՌ2+Bϻ^ԧmrX>w;]ޠkU=PNO8`1N3>r&DKG:-W p)ːnn=bV.]1>Lq;s=+,N_75L2XQgh|)y4Iu.ڼ |̳uxwIsϪ[s1rS6#Hu+7Je]f):Omܬ0OcմPa6q63~S\ӫk֨zϼ]*eb*]!ʹUzydPCIYzhՔkTD k#2ؐyu"DM-b'۹D c*&eF_} ƢDХ{?xkws?:0y|1 lZ}gpr60ސrl\L1}U]KTi>vWT8w(e u֮/9CV#0#v!ϸ ]u@6u(RXVq+97ɬg.={u5vIv1OB*ۉwfߢ>uOQ:ZrQ *"#LT!p7mmtOK|D:ubjϣ\l>}뱬 Y'&Xֲܽn]=sgۘVEAn펵F݈$gRW)/7}!0tww?_=zqJᄡP@VI{E׸ǵ3ګ]j=MkV^X{ݯxW^oڒLQkhAt wN~/IWýVӹ*Ɖ:YkH\MH73C1WE0F ksWnsz8 R_;yf Yz^ۺ^:Շ}b+9Na̛eK4jE߲֘yb'ri`dSc?Ev.\rgub;Y=CVR޻^$*sϝԺLj[c!Fqrn9ɮ;ꎼ9 ?~)["w4' Tk8hs_̮9LpyVKZ3˘-Q5GDߌCT:yx1LwoI ;{_G%] :7Skl{WSX&N4Č=})]NmǦtE]SL JO>N0ӽ$魬EV Ӌޱ5]QФ8e_! Gu (S]h[V%h-0]6NmkɏcM1+0=;ӝ<Â]d:Qw>AAfݩU\)e+۶&Zä=*Myc{2]ɎXߺtW2Y3?57YXϻn "2)(hzRv29wy%,9tu djG?qvc&վ3gqFl[Uk}3s)У8/\W:~mzRf3Eڼ#xD]ܟ TNx}h[/4k~n_ECR-02/o"Yʻ1&{$㙰^Q(s ;*wnSUW ~JVXCN3u:MMn"!Q=e;M nr]|fyG?}ۗ/#ci";C2r uHNإ6hj 嶷wk8ӓb`j'xL >ӫ+dVL&g]4tj!ڸo5kUTvmh(9LUfjm-_70gWJA KnQ`w~wR 7 Q)t\{Eա7ܿ%:!DEM9*)=Ȯoami>BsϊA(mEך-;=5TuV)81ճ(T"u!$ٽa+jxUu^u Lo e_UngN8>|gԳs>=s)r8^j-Rօqي('@k/Bj~%jBTMꪽ$X^LS9VF>ó2r{V$[\G5*W^f]6-G#^m>/ZNx ݸlLN-xɃUcvvScH83$C95L6*_}VҒA-Wa1W׺c6Evngxe*,V |:Wy!_VyŘ{Izzg~'dRVՙsп`S[s3!q)+ lK CˑckmR݋j+(Tz= ڒ 25;5]~p33GW[CsδR={՗Oe=JTGKK&9[ٻ9 mrف.q,UY.Epwztg w~p'V1#f-yl3wڟDL:̟O}1ir3YvNS#C!It v{fuJpIɕ9~QL/>0YrΏ7V gZeO518dlQə:OBpYݡJ0/9|˘ᵷSm.s8!wjpox&6gj,VaԙK UP) }S-g1CYc JF1϶{ ]۹cSVV83嬶z,Ŋɲ{53jFҎoe-z{*LX%HH{2 \۳=o9`nTM;Bk jޯ_g3㞿h-;Y,LVWl4} \uf߳s9c6+lN}=Ut} zf_4S!}7ͼkL4ҝo[0Vz(wTxtK0 ($Ϻ.bJ9ix,gA, vkEFؾCJ҄wvby.9'- YGG^߮ofo( ZϮ8*9t~ǟ ib>, Z],l)oc寖*Gctmd8f+R&뉮X>7w8>ҩ>fV}tjR>Hןy֝_MQL\3!:oiAI~/߉V S˗6!2–,6n h9Pz z.o=,Z hj]:JE3֫ލnn?AX1Db T(@ T EA D'D$U bA@DKQFT"@Z0E,AX'`@ `@! $R A En(`F `i(U`E1(H$@( VhJ  @H& @P!bA@V$RP(hJhJJEP( D`% E% H!BP@+BP P BP)@ X4E)!@? *#DQ*#B DmUQ* AQ;QDAQAQPTGB TF *#O*#?/DD"1@ZD"@A" ,D@*#TG4 OTGTGuOTG*#TFTG "*#Dz0UAOQ肢>AQ*#"  AQ  ADx AQ*#D TGh*#D@TF"TGDiD *#DDv?TGh*#*#(PTF*#DqD%hh%JihYe(6[-*)&ٶRaii f̀Vf)fIIYYeJIdMR`fa%(ie)fY`JHiimi)ٶfa mdHH)e6IiiXff&`lYfI$ZZRfeHiٴH֥)`U*%)eJIe((ii6IR%edf́**VVZZ%i͔٩lZZIlUaeeiZRiZ)!%)iiR)&Viiih6fHR*i)XfffH%(fXYJiͅa!f(TRffckYDFDAH VS,V*ŀ`*0DlD@H*#DpAQ@TG*# D`4?PVIsD<+訕VAٙV Pm0J0%L&dTjy=&C#AL12hi&Ihd& RIjn1Dv"ӑ+KjNb;٦"cN勿jH'=X^RR뉤)ۏ.E@q1wuWh hxixe%<޴̓~fnQQ^V3!xG kdA+[XS=Ղvd93@t < 3 KH/S \__RǷwܙT8Pe8|>W[݌egxY\oϊ^kTAwFMî]yϗd~:xx_G\f N0t@Uf>~J6䘄npD}l\9VZ0ʩոT*`}^wiՅpYe"mX dKH h H4Q1"O9]Plu\h~C0ř}j6c]Ja,M\x.8i΁ md#_ϼ!sm}ݱ״s>/qgq"{D+]JyEYj+f]i+/a-T% LIt+ڴ{܏b[mq6blA:0#OTL>-tXgx~驕y=(3*NUTDĭE iwHWL u;^v#^@x#qp#nOl{ 5ڻ "~'ӔF {u9yYxb Y@Zbeˋ?d}  9rױz)R쪊n Q5紹jlf; Ä!}26ƵڴvUm:Hq~YR-7_UF_{Ab?-TI5gA|2Er3~.R>1Ne#R jq.$o3CӍq^0U} Q6+^f-hņ6&{IBlN9)s*&>O :pO:'BeʼM}Dw'"{w'bkD|xԝI}]O:R}dNzIURt*L''2s'ILsȚ'>'2}̝ xjN8#y Y̬c%J&O19 '9 0MrE8PF