Mercurial > repos > iuc > ucsc_maffetch
changeset 0:eb31f147bf4a draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/ucsc_tools/maftools commit b4d87499a5677fbf611eedfa06c1b3d5cdc23914
| author | iuc |
|---|---|
| date | Wed, 13 Aug 2025 21:16:21 +0000 |
| parents | |
| children | 3b8eea04d99d |
| files | mafFetch.xml test-data/componentFilter.txt test-data/filter_in.maf test-data/gorGor3.bed test-data/hg38.bed test-data/mafFetch.bed test-data/mafFrag_in.bed test-data/mafFrag_in12.bed test-data/mafIn.maf test-data/malformed.maf test-data/panTro4.bed test-data/ref.2bit test-data/ref.fa test-data/speciesFilter.txt |
| diffstat | 14 files changed, 154 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/mafFetch.xml Wed Aug 13 21:16:21 2025 +0000 @@ -0,0 +1,71 @@ +<tool id="ucsc_maffetch" name="mafFetch" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@" license="MIT"> + <description>Get overlapping records from an MAF using an index table</description> + <macros> + <token name="@TOOL_VERSION@">482</token> + <token name="@VERSION_SUFFIX@">0</token> + <token name="@PROFILE@">24.2</token> + </macros> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">ucsc-maffetch</requirement> + </requirements> + <command detect_errors="exit_code"> + <![CDATA[ + cp '$ucsc_db_connection' "\${HOME}/.hg.conf" && + chmod 600 "\${HOME}/.hg.conf" && + mafFetch '$genome' '$track' '$bed_file' out.maf + ]]> + </command> + <configfiles> + <configfile name="ucsc_db_connection"><![CDATA[ +#European MariaDB server +db.host=genome-euro-mysql.soe.ucsc.edu +db.user=genomep +db.password=password +central.db=hgcentral +central.host=genome-euro-mysql.soe.ucsc.edu +central.user=genomep +central.password=password +gbdbLoc1=http://hgdownload.soe.ucsc.edu/gbdb/ +forceTwoBit=on + ]]></configfile> + </configfiles> + <inputs> + <param name="bed_file" type="data" format="bed" label="Input BED file" help="Input BED file can be either BED6 or BED12"/> + <param name="genome" type="text" optional="false" label="Enter Genome database name" help="Name should match with the UCSC Table Browser Entries (For Eg. mm10, hg19, hg38)"/> + <param name="track" type="text" optional="false" label="Enter UCSC Table name for desired table of the above genome" help="Table name should match with the UCSC Table Browser Entries (For eg. knownGene, all_mrna)"/> + </inputs> + <outputs> + <data name="output" format="maf" from_work_dir="out.maf" label="${tool.name} on ${on_string}:Output MAF"/> + </outputs> + <tests> + <!-- Test 01: Testing with default options --> + <test expect_num_outputs="1"> + <param name="bed_file" value="mafFetch.bed"/> + <param name="genome" value="hg19"/> + <param name="track" value="multiz46way"/> + <output name="output" ftype="maf"> + <assert_contents> + <has_n_lines n="167"/> + <has_size value="17364"/> + </assert_contents> + </output> + </test> + </tests> + <help><![CDATA[ + +mafFetch is a command-line tool from the UCSC Genome Browser suite that extracts MAF records overlapping regions in a BED file (minimum 3 columns: chrom, start, end) from a specified UCSC database table (e.g., multiz46way for hg19). Outputs alignments to a MAF file using an indexed lookup for efficiency. + + ]]></help> + <citations> + <citation type="bibtex"> + @misc{mafFetch, + author = {Kent UCSC}, + title = {mafFetch: A tool for get overlapping records from an MAF using an index table}, + note = {Tool for get overlapping records from an MAF using an index table} + </citation> + </citations> + <creator> + <person givenName="Saim" familyName="Momin" url="https://github.com/SaimMomin12" identifier="https://orcid.org/0009-0003-9935-828X"/> + <organization name="Galaxy Europe" url="https://galaxyproject.org/eu/"/> + </creator> +</tool> \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/componentFilter.txt Wed Aug 13 21:16:21 2025 +0000 @@ -0,0 +1,3 @@ +human.chr1 +mouse.chr1 +dog.chr1 \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/filter_in.maf Wed Aug 13 21:16:21 2025 +0000 @@ -0,0 +1,32 @@ +##maf version=1 scoring=example +a score=1000.0 +s human.chr1 100 10 + 1000 ACGTACGTAC +s mouse.chr1 200 10 + 2000 ACGTACGTAC +s dog.chr1 300 10 + 3000 ACGTACGTAC + +a score=500.0 +s human.chr2 150 5 + 1000 ACGTA +s mouse.chr2 250 5 + 2000 ACGT- + +a score=200.0 +s human.chr3 200 15 + 1000 ACGTACGTACGTACG +s cat.chr3 350 15 + 4000 ACGTACGTACGTACG +s dog.chr3 450 15 + 5000 ACGTACGTACGTACG +s rat.chr3 550 15 + 6000 ACGTACGTACGTACG + +a score=50.0 +s human.chr4 110 10 + 1000 ACGTACGTAC +s mouse.chr4 210 10 + 2000 ACGTACGTAC + +a score=3000.0 +s human.chr5 105 10 + 1000 ACGTACGTAC +s mouse.chr5 205 10 + 2000 ACGTACGTAC +s dog.chr5 305 10 + 3000 ACGTACGTAC +s cat.chr5 405 10 + 4000 ACGTACGTAC +s rat.chr5 505 10 + 5000 ACGTACGTAC +s cow.chr5 605 10 + 6000 ACGTACGTAC + +a score=600.0 +s human.chr6 100 10 + 1000 ACGTACGTAC +s mouse.chr6 200 10 + 2000 ACGTACGTAC +s dog.chr6 300 10 + 3000 ACGTACGTAC \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gorGor3.bed Wed Aug 13 21:16:21 2025 +0000 @@ -0,0 +1,2 @@ +chr7 1006 1007 +chr7 1013 1014 \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/hg38.bed Wed Aug 13 21:16:21 2025 +0000 @@ -0,0 +1,2 @@ +chr7 1005 1006 +chr7 1010 1012 \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mafFetch.bed Wed Aug 13 21:16:21 2025 +0000 @@ -0,0 +1,1 @@ +chr17 7578370 7578550 \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mafFrag_in.bed Wed Aug 13 21:16:21 2025 +0000 @@ -0,0 +1,1 @@ +chr17 7571738 7590808 TP53 0 - \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mafFrag_in12.bed Wed Aug 13 21:16:21 2025 +0000 @@ -0,0 +1,1 @@ +chr17 7571738 7590808 TP53 0 - 7572926 7579912 0 11 1188,1741,1921,1025,1000,398,900,896,900,900,8201 0,1188,2929,4850,5875,6875,7273,8173,9069,9969,10869 \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mafIn.maf Wed Aug 13 21:16:21 2025 +0000 @@ -0,0 +1,5 @@ +##maf version=1 scoring=blastz +a score=1234 +s hg38.chr7 1000 20 + 248956422 ACGTACGTACGTACGTACGT +s panTro4.chr7 1000 20 + 159345973 ACGTAC-TAC-TACGTACGT +s gorGor3.chr7 1000 20 + 174310764 A-GTACGTAC-TACG-AC-T \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/malformed.maf Wed Aug 13 21:16:21 2025 +0000 @@ -0,0 +1,32 @@ +##maf version=1 scoring=example +a score=1000.0 +s human.chr1 100 10 + 1000 ACGTACGTAC +s mouse.chr1 200 10 + 2000 ACGTACGTAC +s dog.chr1 300 10 + 3000 ACGTACGTAC + +a score=500.0 +s human.chr2 150 5 + 1000 ACGTA +s mouse.chr2 250 5 + 2000 ACGT- + +a score=200.0 +s human.chr3 200 15 + 1000 ACGTACGTACGTACG +s cat.chr3 350 15 + 4000 ACGTACGTACGTACG +s dog.chr3 450 15 + 5000 ACGTACGTACGTACG +s rat.chr3 550 15 + 6000 ACGTACGTACGTACG + +a score=50.0 +s human.chr4 110 10 + 1000 ACGTACGTAC +s mouse.chr4 210 10 + 2000 ACGTACGTAC + +a score=3000.0 +s human.chr5 105 10 + 1000 ACGTACGTAC +s mouse.chr5 205 10 + 2000 ACGTACGTAC +s dog.chr5 305 10 + 3000 ACGTACGTAC +s cat.chr5 405 10 + 4000 ACGTACGTAC +s rat.chr5 505 10 + 5000 ACGTACGTAC +s cow.chr5 605 10 + 6000 ACGTACGTAC + +a score=600.0 +s human.chr6 100 10 + 1000 ACGTACGTAC +s mouse.chr6 200 10 + 2000 ACGTACGTAC +s dog.chr6 \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/panTro4.bed Wed Aug 13 21:16:21 2025 +0000 @@ -0,0 +1,1 @@ +chr7 1007 1008 \ No newline at end of file
