changeset 0:d025a40bbff1 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/ucsc-tools/twobittofa commit 454df102c5630d90af25d1b9ff8050a6c7b82ffc

Binary file test-data/input.2bit has changed

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output.fasta	Fri Aug 19 06:30:41 2016 -0400
@@ -0,0 +1,6 @@
+>s1
+ATGCATGCATGCATGCATGCATGCATGCATGCATGC
+>s2
+ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT
+GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
+ATGCATGC

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/twobittofa.xml	Fri Aug 19 06:30:41 2016 -0400
@@ -0,0 +1,85 @@
+<tool id="ucsc-twobittofa" name="twoBitToFa" version="@WRAPPER_VERSION@">
+    <macros>
+        <token name="@WRAPPER_VERSION@">332</token>
+    </macros>
+
+    <description>Convert all or part of .2bit file to fasta</description>
+
+    <requirements>
+        <requirement type="package" version="@WRAPPER_VERSION@">ucsc-twobittofa</requirement>
+    </requirements>
+
+    <version_command><![CDATA[ echo "@WRAPPER_VERSION@" ]]></version_command>
+
+    <command>
+<![CDATA[
+        twoBitToFa
+            '$twobit_input'
+            '$fasta_output'
+
+            #if $seq
+              -seq='$seq'
+            #end if
+
+            #if $start
+              -start=$start
+            #end if
+
+            #if $end
+              -end=$end
+            #end if
+
+            #if $seqList
+              -seqList='$seqList'
+            #end if
+
+            $noMask
+]]>
+    </command>
+
+    <inputs>
+        <param name="twobit_input" type="data" format="twobit"
+          label="Input TwoBit file" help=""/>
+
+        <param argument="-seq" type="text" label="Restrict this to just one sequence
+           (Optional)" help="" optional="True"/>
+
+        <param argument="-start" type="integer" label="Start at given position in
+          sequence (Optional)" help="Zero-based" optional="True"/>
+
+        <param argument="-end" type="integer" label="End at given position in
+          sequence (Optional)" help="Non-inclusive" optional="True"/>
+
+        <param argument="-seqList" type="data" format="txt"
+          label="File containing list of the desired sequence names (Optional)"
+          help="It must be in the format seqSpec[:start-end], e.g. chr1 or chr1:0-189
+          where coordinates are half-open zero-based, i.e. [start,end)"
+          optional="True"/>
+
+        <param argument="-noMask" type="boolean" truevalue="-noMask" falsevalue=""
+          checked="false" label="Convert sequence to all upper case?" help=""/>
+    </inputs>
+
+    <outputs>
+        <data format="fasta" name="fasta_output"/>
+    </outputs>
+
+    <tests>
+        <test>
+            <param name="twobit_input" value="input.2bit"/>
+            <output name="fasta_output" file="output.fasta" />
+        </test>
+    </tests>
+
+    <help><![CDATA[
+**What it does**
+
+twoBitToFa is a tool to convert all or part of .2bit file to fasta.
+
+For more information, check the `user manual <https://genome.ucsc.edu/goldenpath/help/twoBit.html/>`_.
+
+    ]]></help>
+
+    <citations>
+    </citations>
+</tool>