32
+ − 1 <!DOCTYPE html>
+ − 2 <html>
+ − 3 <head>
+ − 4 <meta charset="UTF-8">
+ − 5 <meta name=generator content="blast2html; see ...">
+ − 6
+ − 7 <title>Blast output</title>
+ − 8
+ − 9 <style>
+ − 10 body {
+ − 11 color: #333333;
+ − 12 font-family: Arial,Sans-Serif;
+ − 13 }
+ − 14
+ − 15 :link {
+ − 16 color: #336699;
+ − 17 }
+ − 18
+ − 19 .right {
+ − 20 float: right;
+ − 21 }
+ − 22
+ − 23 /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/
+ − 24 #strip_html_warning {
+ − 25 display: none;
+ − 26 }
+ − 27
+ − 28 #content {
+ − 29 margin: 0 2em;
+ − 30 padding: 0.5em;
+ − 31 border: 1px solid #888888;
+ − 32 background-color: #d3dff5;
+ − 33 }
+ − 34
+ − 35 h1, h2, h3, h4, h5, h6 {
+ − 36 color: #2A6979;
+ − 37 font-family: arial,verdana,sans-serif;
+ − 38 letter-spacing: -1px;
+ − 39 margin: 1.2em 0 0.3em;
+ − 40 }
+ − 41
+ − 42 h1 {
+ − 43 border-bottom: 1px solid #CCCCCC;
+ − 44 font-size: 150%;
+ − 45 padding-bottom: 0.1em;
+ − 46 }
+ − 47
+ − 48 h2 {
+ − 49 font-size: 120%;
+ − 50 font-weight: bold;
+ − 51 }
+ − 52
+ − 53 h4.darkHeader {
+ − 54 color: #4D4D4D;
+ − 55 letter-spacing: 0;
+ − 56 font-weight: bold;
+ − 57 }
+ − 58
+ − 59 #nodata {
+ − 60 font-weight: bold;
+ − 61 }
+ − 62
+ − 63 .index {
+ − 64 margin-bottom: 3em;
+ − 65 }
+ − 66 .index div.indexentry {
+ − 67 margin: 1.2em 1.6em;
+ − 68 font-weight: bold;
+ − 69 font-size: 100%;
+ − 70 }
+ − 71
+ − 72 .headerdata {
+ − 73 font-size: 90%;
+ − 74 }
+ − 75 .headerdata .param {
+ − 76 font-weight: bold;
+ − 77 text-align: right;
+ − 78 padding: 0 1em;
+ − 79 }
+ − 80
+ − 81 .grey {
+ − 82 background-color: #eeeeee;
+ − 83 border: 1px solid #cccccc;
+ − 84 padding: 1em;
+ − 85 }
+ − 86
+ − 87 .white {
+ − 88 background-color: white;
+ − 89 border: 1px solid #cccccc;
+ − 90 padding: 1.5em 2%;
+ − 91 }
+ − 92
+ − 93 .graphicrow {
+ − 94 clear: left;
+ − 95 width: 100%;
+ − 96 }
+ − 97
+ − 98 .graphicitem {
+ − 99 float: left;
+ − 100 }
+ − 101
+ − 102
+ − 103
+ − 104 .graphics .grey {
+ − 105 text-align: center;
+ − 106 }
+ − 107
+ − 108 .graphic {
+ − 109 background-color: white;
+ − 110 border: 2px solid black;
+ − 111 padding: 1.5em;
+ − 112 margin: auto;
+ − 113 }
+ − 114
+ − 115 .centered, .defline, div.legend, div.tablewrapper {
+ − 116 margin-left: auto;
+ − 117 margin-right: auto;
+ − 118 }
+ − 119
+ − 120 .defline {
+ − 121 background-color: white;
+ − 122 border: 1px solid black;
+ − 123 margin: .5em auto;
+ − 124 padding-left: .2em;
+ − 125 padding-right: .2em;
+ − 126 max-width: 50em;
+ − 127 text-align: left;
+ − 128 height: 2.8em;
+ − 129 overflow-y: hidden;
+ − 130 }
+ − 131
+ − 132 div.legend {
+ − 133 max-width: 40em;
+ − 134 }
+ − 135 div.legend div {
+ − 136 width: 100%;
+ − 137 color: white;
+ − 138 font-weight: bold;
+ − 139 border-spacing: 0;
+ − 140 }
+ − 141 div.legend div .graphicitem {
+ − 142 width: 20%;
+ − 143 padding: 0;
+ − 144 margin: 0;
+ − 145 border: none;
+ − 146 }
+ − 147
+ − 148 div.tablewrapper {
+ − 149 width: 50%;
+ − 150 min-width: 60em;
+ − 151 }
+ − 152
+ − 153 /* For small widths we give the graphic 100% */
+ − 154 @media (max-width: 72.5em) {
+ − 155 div.tablewrapper {
+ − 156 width: 100%;
+ − 157 min-width: 0px;
+ − 158 }
+ − 159 }
+ − 160
+ − 161 .scale {
+ − 162 width: 100%;
+ − 163 margin: .5em 0;
+ − 164 font-weight: bold;
+ − 165 }
+ − 166 .scale div {
+ − 167 color: red;
+ − 168 text-align: left;
+ − 169 }
+ − 170 .scale .graphicrow {
+ − 171 margin: .5em 0 .5em 0;
+ − 172 color: white;
+ − 173 }
+ − 174 .scale .graphicitem {
+ − 175 position: relative;
+ − 176 }
+ − 177 .scale .graphicitem div {
+ − 178 margin: 0 1px;
+ − 179 padding: 0 2px;
+ − 180 text-align: right;
+ − 181 background-color: red;
+ − 182 color: white;
+ − 183 }
+ − 184 .scale .graphicitem:first-child div {
+ − 185 margin-left: 0px;
+ − 186 }
+ − 187 .scale .graphicitem:last-child div {
+ − 188 margin-right: 0px;
+ − 189 }
+ − 190 .scale .graphicitem .lastlabel {
+ − 191 position: absolute;
+ − 192 top: 0px;
+ − 193 left: 100%;
+ − 194 background-color: transparent;
+ − 195 color: red;
+ − 196 }
+ − 197
+ − 198 a.matchresult {
+ − 199 display: block;
+ − 200 margin: 0;
+ − 201 padding: 0;
+ − 202 }
+ − 203 div.matchrow {
+ − 204 margin-top: 4px;
+ − 205 }
+ − 206 div.matchrow, div.matchitem {
+ − 207 height: 4px;
+ − 208 }
+ − 209
+ − 210
+ − 211 table.descriptiontable {
+ − 212 font-size: 85%;
+ − 213 border: 1px solid #97b0c8;
+ − 214 border-spacing: 0;
+ − 215 color: #222222;
+ − 216 line-height: 1.3em;
+ − 217 background-color: white;
+ − 218 }
+ − 219 table.descriptiontable col:first-child {
+ − 220 width: 100%;
+ − 221 }
+ − 222 table.descriptiontable tr:hover {
+ − 223 background-color: #D5DEE3;
+ − 224 }
+ − 225 table.descriptiontable th {
+ − 226 color: #14376C;
+ − 227 font-weight: normal;
+ − 228 background-color: #F0F0F0;
+ − 229 background: linear-gradient(#FFFFFF, #F0F0F0);
+ − 230 border-bottom: 1px solid #D4DFE9;
+ − 231 border-right: 1px solid #CFCFCF;
+ − 232 border-left: 0px solid black;
+ − 233 border-top: 0px solid black;
+ − 234 }
+ − 235 table.descriptiontable td {
+ − 236 overflow: hidden;
+ − 237 text-align: center;
+ − 238 padding: .4em .8em;
+ − 239 }
+ − 240 table.descriptiontable td div {
+ − 241 width: 1em;
+ − 242 overflow: visible;
+ − 243 white-space: nowrap;
+ − 244 text-align: left;
+ − 245 }
+ − 246
+ − 247
+ − 248
+ − 249 .alignments .white {
+ − 250 padding: 1.5em 1em;
+ − 251 }
+ − 252
+ − 253 .alignment {
+ − 254 border-top: 1px solid black;
+ − 255 padding-left: 1em;
+ − 256 padding-right: 1em;
+ − 257 }
+ − 258
+ − 259 div.linkheader {
+ − 260 padding-top: .2em;
+ − 261 font-size: 85%;
+ − 262 color: #14376C;
+ − 263 }
+ − 264 div.linkheader a.linkheader {
+ − 265 margin-right: 1em;
+ − 266 }
+ − 267 div.linkheader .right a {
+ − 268 text-decoration: none;
+ − 269 }
+ − 270
+ − 271 .title .hittitle {
+ − 272 color: #222222;
+ − 273 margin-bottom: .3em;
+ − 274 }
+ − 275 .title .titleinfo {
+ − 276 font-size: 80%;
+ − 277 margin-top: 0;
+ − 278 margin-bottom: .3em;
+ − 279 }
+ − 280 .title .titleinfo .b {
+ − 281 color: #606060;
+ − 282 font-weight: bold;
+ − 283 font-size: 90%;
+ − 284 }
+ − 285
+ − 286 .moretitles {
+ − 287 margin: 1.2em;
+ − 288 }
+ − 289 .moretitles .titleinfo {
+ − 290 margin: 0;
+ − 291 padding: 0;
+ − 292 }
+ − 293 .moretitles .hittitle {
+ − 294 margin: .4em 0 .2em 0;
+ − 295 padding: 0;
+ − 296 }
+ − 297
+ − 298 a.showmoretitles {
+ − 299 font-size: 75%;
+ − 300 color: #336699;
+ − 301 font-weight: bold;
+ − 302 margin-top: 0;
+ − 303 }
+ − 304 a.showmoretitles:hover {
+ − 305 }
+ − 306
+ − 307 .hotspot {
+ − 308 color: #606060;
+ − 309 font-family: verdana, arial, sans-serif;
+ − 310 margin-bottom: 2.5em;
+ − 311 }
+ − 312
+ − 313 .hotspot p.range {
+ − 314 font-size: 70%;
+ − 315 margin-top: 0;
+ − 316 margin-top: 1em;
+ − 317 margin-bottom: .2em;
+ − 318 }
+ − 319 .hotspot p.range span.range {
+ − 320 font-weight: bold;
+ − 321 }
+ − 322 .hotspot p.range a.range {
+ − 323 margin-left: .5em;
+ − 324 }
+ − 325
+ − 326 table.hotspotstable {
+ − 327 border-top: 1px solid;
+ − 328 border-bottom: 1px solid;
+ − 329 text-align: left;
+ − 330 border-collapse: collapse;
+ − 331 }
+ − 332 table.hotspotstable th, table.hotspotstable td {
+ − 333 padding: .1em 1em;
+ − 334 }
+ − 335 table.hotspotstable th {
+ − 336 font-size: 70%;
+ − 337 }
+ − 338 table.hotspotstable td {
+ − 339 min-width: 7em;
+ − 340 color: #222222;
+ − 341 font-size: 80%;
+ − 342 }
+ − 343
+ − 344 pre.alignmentgraphic {
+ − 345 color: #222222;
+ − 346 }
+ − 347
+ − 348 footer {
+ − 349 text-align: center;
+ − 350 color: #cccccc;
+ − 351 font-size: 70%;
+ − 352 margin-top: 1em;
+ − 353 }
+ − 354 footer :link {
+ − 355 color: #5588cc;
+ − 356 }
+ − 357
+ − 358 </style>
+ − 359
+ − 360 <script type="text/javascript">
+ − 361 function toggle_visibility(id) {
+ − 362 var e = document.getElementById(id);
+ − 363 if(e.style.display != 'block')
+ − 364 e.style.display = 'block';
+ − 365 else
+ − 366 e.style.display = 'none';
+ − 367 }
+ − 368 </script>
+ − 369
+ − 370 </head>
+ − 371
+ − 372
+ − 373 <body>
+ − 374
+ − 375 <div id="strip_html_warning">
+ − 376 <!-- This div should be hidden by the header css block. Galaxy
+ − 377 strips all css, breaking this page but making this warning
+ − 378 visible. This warning contains some ugly old skool tabular html
+ − 379 layout that is not stripped. -->
+ − 380 <table bgcolor="#FFE5C9"><tr><td><font color="red"><b>
+ − 381 <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font>
+ − 382 Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy.
+ − 383 </b></font></td></tr></table>
+ − 384 </div>
+ − 385
+ − 386 <div id=content>
+ − 387
+ − 388
+ − 389 <section class=index>
+ − 390 <h1>Queries</h1>
+ − 391
+ − 392 <div class=indexentry><a href="#match1">
+ − 393 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+ − 394 (20 letters, 0 hits)
+ − 395 </a></div>
+ − 396 <div class=indexentry><a href="#match2">
+ − 397 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+ − 398 (20 letters, 0 hits)
+ − 399 </a></div>
+ − 400 <div class=indexentry><a href="#match3">
+ − 401 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+ − 402 (20 letters, 1 hits)
+ − 403 </a></div>
+ − 404 <div class=indexentry><a href="#match4">
+ − 405 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+ − 406 (20 letters, 0 hits)
+ − 407 </a></div>
+ − 408 <div class=indexentry><a href="#match5">
+ − 409 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+ − 410 (20 letters, 0 hits)
+ − 411 </a></div>
+ − 412 <div class=indexentry><a href="#match6">
+ − 413 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+ − 414 (20 letters, 1 hits)
+ − 415 </a></div>
+ − 416 <div class=indexentry><a href="#match7">
+ − 417 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+ − 418 (20 letters, 0 hits)
+ − 419 </a></div>
+ − 420 <div class=indexentry><a href="#match8">
+ − 421 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+ − 422 (20 letters, 0 hits)
+ − 423 </a></div>
+ − 424 <div class=indexentry><a href="#match9">
+ − 425 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+ − 426 (20 letters, 0 hits)
+ − 427 </a></div>
+ − 428 <div class=indexentry><a href="#match10">
+ − 429 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+ − 430 (20 letters, 0 hits)
+ − 431 </a></div>
+ − 432 <div class=indexentry><a href="#match11">
+ − 433 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+ − 434 (20 letters, 0 hits)
+ − 435 </a></div>
+ − 436 <div class=indexentry><a href="#match12">
+ − 437 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+ − 438 (20 letters, 0 hits)
+ − 439 </a></div>
+ − 440 <div class=indexentry><a href="#match13">
+ − 441 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+ − 442 (20 letters, 0 hits)
+ − 443 </a></div>
+ − 444 <div class=indexentry><a href="#match14">
+ − 445 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+ − 446 (20 letters, 0 hits)
+ − 447 </a></div>
+ − 448 <div class=indexentry><a href="#match15">
+ − 449 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+ − 450 (20 letters, 0 hits)
+ − 451 </a></div>
+ − 452 <div class=indexentry><a href="#match16">
+ − 453 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+ − 454 (20 letters, 0 hits)
+ − 455 </a></div>
+ − 456 <div class=indexentry><a href="#match17">
+ − 457 Query_3: Probe|NOST-Spec_(Genetic_ID)
+ − 458 (20 letters, 0 hits)
+ − 459 </a></div>
+ − 460 <div class=indexentry><a href="#match18">
+ − 461 Query_3: Probe|NOST-Spec_(Genetic_ID)
+ − 462 (20 letters, 1 hits)
+ − 463 </a></div>
+ − 464 <div class=indexentry><a href="#match19">
+ − 465 Query_3: Probe|NOST-Spec_(Genetic_ID)
+ − 466 (20 letters, 1 hits)
+ − 467 </a></div>
+ − 468 <div class=indexentry><a href="#match20">
+ − 469 Query_3: Probe|NOST-Spec_(Genetic_ID)
+ − 470 (20 letters, 0 hits)
+ − 471 </a></div>
+ − 472 <div class=indexentry><a href="#match21">
+ − 473 Query_3: Probe|NOST-Spec_(Genetic_ID)
+ − 474 (20 letters, 0 hits)
+ − 475 </a></div>
+ − 476 <div class=indexentry><a href="#match22">
+ − 477 Query_3: Probe|NOST-Spec_(Genetic_ID)
+ − 478 (20 letters, 1 hits)
+ − 479 </a></div>
+ − 480 <div class=indexentry><a href="#match23">
+ − 481 Query_3: Probe|NOST-Spec_(Genetic_ID)
+ − 482 (20 letters, 0 hits)
+ − 483 </a></div>
+ − 484 <div class=indexentry><a href="#match24">
+ − 485 Query_3: Probe|NOST-Spec_(Genetic_ID)
+ − 486 (20 letters, 0 hits)
+ − 487 </a></div>
+ − 488 <div class=indexentry><a href="#match25">
+ − 489 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 490 (24 letters, 0 hits)
+ − 491 </a></div>
+ − 492 <div class=indexentry><a href="#match26">
+ − 493 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 494 (24 letters, 0 hits)
+ − 495 </a></div>
+ − 496 <div class=indexentry><a href="#match27">
+ − 497 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 498 (24 letters, 0 hits)
+ − 499 </a></div>
+ − 500 <div class=indexentry><a href="#match28">
+ − 501 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 502 (24 letters, 0 hits)
+ − 503 </a></div>
+ − 504 <div class=indexentry><a href="#match29">
+ − 505 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 506 (24 letters, 0 hits)
+ − 507 </a></div>
+ − 508 <div class=indexentry><a href="#match30">
+ − 509 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 510 (24 letters, 0 hits)
+ − 511 </a></div>
+ − 512 <div class=indexentry><a href="#match31">
+ − 513 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 514 (24 letters, 0 hits)
+ − 515 </a></div>
+ − 516 <div class=indexentry><a href="#match32">
+ − 517 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 518 (24 letters, 0 hits)
+ − 519 </a></div>
+ − 520 <div class=indexentry><a href="#match33">
+ − 521 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 522 (20 letters, 0 hits)
+ − 523 </a></div>
+ − 524 <div class=indexentry><a href="#match34">
+ − 525 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 526 (20 letters, 0 hits)
+ − 527 </a></div>
+ − 528 <div class=indexentry><a href="#match35">
+ − 529 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 530 (20 letters, 0 hits)
+ − 531 </a></div>
+ − 532 <div class=indexentry><a href="#match36">
+ − 533 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 534 (20 letters, 0 hits)
+ − 535 </a></div>
+ − 536 <div class=indexentry><a href="#match37">
+ − 537 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 538 (20 letters, 0 hits)
+ − 539 </a></div>
+ − 540 <div class=indexentry><a href="#match38">
+ − 541 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 542 (20 letters, 0 hits)
+ − 543 </a></div>
+ − 544 <div class=indexentry><a href="#match39">
+ − 545 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 546 (20 letters, 0 hits)
+ − 547 </a></div>
+ − 548 <div class=indexentry><a href="#match40">
+ − 549 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 550 (20 letters, 0 hits)
+ − 551 </a></div>
+ − 552 <div class=indexentry><a href="#match41">
+ − 553 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+ − 554 (25 letters, 0 hits)
+ − 555 </a></div>
+ − 556 <div class=indexentry><a href="#match42">
+ − 557 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+ − 558 (25 letters, 0 hits)
+ − 559 </a></div>
+ − 560 <div class=indexentry><a href="#match43">
+ − 561 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+ − 562 (25 letters, 0 hits)
+ − 563 </a></div>
+ − 564 <div class=indexentry><a href="#match44">
+ − 565 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+ − 566 (25 letters, 0 hits)
+ − 567 </a></div>
+ − 568 <div class=indexentry><a href="#match45">
+ − 569 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+ − 570 (25 letters, 0 hits)
+ − 571 </a></div>
+ − 572 <div class=indexentry><a href="#match46">
+ − 573 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+ − 574 (25 letters, 0 hits)
+ − 575 </a></div>
+ − 576 <div class=indexentry><a href="#match47">
+ − 577 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+ − 578 (25 letters, 1 hits)
+ − 579 </a></div>
+ − 580 <div class=indexentry><a href="#match48">
+ − 581 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+ − 582 (25 letters, 1 hits)
+ − 583 </a></div>
+ − 584 <div class=indexentry><a href="#match49">
+ − 585 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+ − 586 (74 letters, 0 hits)
+ − 587 </a></div>
+ − 588 <div class=indexentry><a href="#match50">
+ − 589 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+ − 590 (74 letters, 0 hits)
+ − 591 </a></div>
+ − 592 <div class=indexentry><a href="#match51">
+ − 593 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+ − 594 (74 letters, 0 hits)
+ − 595 </a></div>
+ − 596 <div class=indexentry><a href="#match52">
+ − 597 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+ − 598 (74 letters, 0 hits)
+ − 599 </a></div>
+ − 600 <div class=indexentry><a href="#match53">
+ − 601 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+ − 602 (74 letters, 0 hits)
+ − 603 </a></div>
+ − 604 <div class=indexentry><a href="#match54">
+ − 605 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+ − 606 (74 letters, 0 hits)
+ − 607 </a></div>
+ − 608 <div class=indexentry><a href="#match55">
+ − 609 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+ − 610 (74 letters, 1 hits)
+ − 611 </a></div>
+ − 612 <div class=indexentry><a href="#match56">
+ − 613 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+ − 614 (74 letters, 1 hits)
+ − 615 </a></div>
+ − 616
+ − 617 </section>
+ − 618
+ − 619
+ − 620 <section class=match id=match1>
+ − 621
+ − 622 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 623
+ − 624 <section class=header>
+ − 625
+ − 626 <table class=headerdata>
+ − 627 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 628 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 629 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 630 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 631 <tr><td class=param>Database:</td><td></td></tr>
+ − 632 </table>
+ − 633
+ − 634 </section>
+ − 635
+ − 636 <section>
+ − 637 <h2>No Hits</h2>
+ − 638 <div class=grey>
+ − 639 <table class=headerdata>
+ − 640 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 641 </table>
+ − 642 </div>
+ − 643 </section>
+ − 644 </section>
+ − 645
+ − 646 <section class=match id=match2>
+ − 647
+ − 648 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 649
+ − 650 <section class=header>
+ − 651
+ − 652 <table class=headerdata>
+ − 653 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 654 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 655 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 656 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 657 <tr><td class=param>Database:</td><td></td></tr>
+ − 658 </table>
+ − 659
+ − 660 </section>
+ − 661
+ − 662 <section>
+ − 663 <h2>No Hits</h2>
+ − 664 <div class=grey>
+ − 665 <table class=headerdata>
+ − 666 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 667 </table>
+ − 668 </div>
+ − 669 </section>
+ − 670 </section>
+ − 671
+ − 672 <section class=match id=match3>
+ − 673
+ − 674 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 675
+ − 676 <section class=header>
+ − 677
+ − 678 <table class=headerdata>
+ − 679 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 680 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 681 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 682 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 683 <tr><td class=param>Database:</td><td></td></tr>
+ − 684 </table>
+ − 685
+ − 686 </section>
+ − 687
+ − 688
+ − 689 <section class=graphics>
+ − 690 <h2>Graphic Summary</h2>
+ − 691
+ − 692 <div class=grey>
+ − 693 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+ − 694
+ − 695 <div class=defline id=defline3>
+ − 696 Mouse-over to show defline and scores, click to show alignments
+ − 697 </div>
+ − 698
+ − 699 <div class=graphic>
+ − 700 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 701 <div class=legend><div class=graphicrow>
+ − 702 <div class=graphicitem style="background-color: black"><40</div>
+ − 703 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 704 <div class=graphicitem style="background-color: green">50–80</div>
+ − 705 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 706 <div class=graphicitem style="background-color: red">200≤</div>
+ − 707 </div></div>
+ − 708 <div style="clear: left"></div>
+ − 709
+ − 710 <div class=tablewrapper>
+ − 711
+ − 712 <div class=scale>
+ − 713 <div>query:</div>
+ − 714 <div class=graphicrow>
+ − 715 <div>
+ − 716 <div class=graphicitem style="width: 10.0%">
+ − 717 <div>2</div>
+ − 718 </div>
+ − 719 <div class=graphicitem style="width: 10.0%">
+ − 720 <div>4</div>
+ − 721 </div>
+ − 722 <div class=graphicitem style="width: 10.0%">
+ − 723 <div>6</div>
+ − 724 </div>
+ − 725 <div class=graphicitem style="width: 10.0%">
+ − 726 <div>8</div>
+ − 727 </div>
+ − 728 <div class=graphicitem style="width: 10.0%">
+ − 729 <div>10</div>
+ − 730 </div>
+ − 731 <div class=graphicitem style="width: 10.0%">
+ − 732 <div>12</div>
+ − 733 </div>
+ − 734 <div class=graphicitem style="width: 10.0%">
+ − 735 <div>14</div>
+ − 736 </div>
+ − 737 <div class=graphicitem style="width: 10.0%">
+ − 738 <div>16</div>
+ − 739 </div>
+ − 740 <div class=graphicitem style="width: 10.0%">
+ − 741 <div>18</div>
+ − 742 </div>
+ − 743 <div class=graphicitem style="width: 10.0%">
+ − 744 <div>20</div>
+ − 745 </div>
+ − 746 </div>
+ − 747 </div>
+ − 748 <div style="clear: left"></div>
+ − 749 </div>
+ − 750
+ − 751 <a class=matchresult
+ − 752 href="#hit1"
+ − 753 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+ − 754 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 755 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+ − 756 <div class="matchrow graphicrow">
+ − 757 <div class="matchitem graphicitem"
+ − 758 style="background-color: black; width: 100.0%"></div>
+ − 759 </div>
+ − 760 </a>
+ − 761
+ − 762 </div>
+ − 763 </div>
+ − 764 </div>
+ − 765 </section>
+ − 766
+ − 767
+ − 768
+ − 769 <section class=descriptions>
+ − 770 <h2>Descriptions</h2>
+ − 771
+ − 772 <div class=grey><div class=white>
+ − 773 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 774
+ − 775 <table class=descriptiontable>
+ − 776 <col/><col/><col/><col/><col/><col/><col/>
+ − 777 <tr>
+ − 778 <th>Description</th>
+ − 779 <th>Max score</th>
+ − 780 <th>Total score</th>
+ − 781 <th>Query cover</th>
+ − 782 <th>E value</th>
+ − 783 <th>Ident</th>
+ − 784 <th>Accession</th>
+ − 785 </tr>
+ − 786 <tr>
+ − 787 <td><div><a href="#hit1"
+ − 788 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+ − 789 id="description1">
+ − 790 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+ − 791 </a></div></td>
+ − 792 <td>37.4</td>
+ − 793 <td>37.4</td>
+ − 794 <td>100%</td>
+ − 795 <td>7.011e-08</td>
+ − 796 <td>100%</td>
+ − 797 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a></td>
+ − 798 </tr>
+ − 799 </table>
+ − 800
+ − 801 </div></div>
+ − 802 </section>
+ − 803
+ − 804
+ − 805
+ − 806 <section class=alignments>
+ − 807 <h2>Alignments</h2>
+ − 808
+ − 809 <div class=grey><div class=white>
+ − 810 <div class=alignment id=hit1>
+ − 811
+ − 812 <div class=linkheader>
+ − 813 <div class=right><a href="#description1">Descriptions</a></div>
+ − 814 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">GenBank</a>
+ − 815 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&log$=nuclalign">Graphics</a>
+ − 816 </div>
+ − 817
+ − 818 <div class=title>
+ − 819 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+ − 820 <p class=titleinfo>
+ − 821 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a>
+ − 822 <span class=b>Length:</span> 323
+ − 823 <span class=b>Number of Matches:</span> 1
+ − 824 </p>
+ − 825 </div>
+ − 826
+ − 827
+ − 828 <div class=hotspot>
+ − 829 <p class=range>
+ − 830 <span class=range>Range 1: 200 to 219</span>
+ − 831 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign&from=200&to=219">GenBank</a>
+ − 832 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&log$=nuclalign&from=200&to=219">Graphics</a>
+ − 833 </p>
+ − 834
+ − 835 <table class=hotspotstable>
+ − 836 <tr>
+ − 837 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 838 </tr>
+ − 839 <tr>
+ − 840 <td>37.4 bits(40)</td>
+ − 841 <td>0.0</td>
+ − 842 <td>20/20(100%)</td>
+ − 843 <td>0/20(0%)</td>
+ − 844 <td>Plus/Plus</td>
+ − 845 </tr>
+ − 846 </table>
+ − 847
+ − 848 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20
+ − 849 ||||||||||||||||||||
+ − 850 Subject 200 AGCGCGCAAACTAGGATAAA 219</pre>
+ − 851 </div>
+ − 852
+ − 853 </div>
+ − 854
+ − 855 </div></div>
+ − 856 </section>
+ − 857 </section>
+ − 858
+ − 859 <section class=match id=match4>
+ − 860
+ − 861 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 862
+ − 863 <section class=header>
+ − 864
+ − 865 <table class=headerdata>
+ − 866 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 867 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 868 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 869 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 870 <tr><td class=param>Database:</td><td></td></tr>
+ − 871 </table>
+ − 872
+ − 873 </section>
+ − 874
+ − 875 <section>
+ − 876 <h2>No Hits</h2>
+ − 877 <div class=grey>
+ − 878 <table class=headerdata>
+ − 879 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 880 </table>
+ − 881 </div>
+ − 882 </section>
+ − 883 </section>
+ − 884
+ − 885 <section class=match id=match5>
+ − 886
+ − 887 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 888
+ − 889 <section class=header>
+ − 890
+ − 891 <table class=headerdata>
+ − 892 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 893 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 894 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 895 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 896 <tr><td class=param>Database:</td><td></td></tr>
+ − 897 </table>
+ − 898
+ − 899 </section>
+ − 900
+ − 901 <section>
+ − 902 <h2>No Hits</h2>
+ − 903 <div class=grey>
+ − 904 <table class=headerdata>
+ − 905 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 906 </table>
+ − 907 </div>
+ − 908 </section>
+ − 909 </section>
+ − 910
+ − 911 <section class=match id=match6>
+ − 912
+ − 913 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 914
+ − 915 <section class=header>
+ − 916
+ − 917 <table class=headerdata>
+ − 918 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 919 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 920 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 921 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 922 <tr><td class=param>Database:</td><td></td></tr>
+ − 923 </table>
+ − 924
+ − 925 </section>
+ − 926
+ − 927
+ − 928 <section class=graphics>
+ − 929 <h2>Graphic Summary</h2>
+ − 930
+ − 931 <div class=grey>
+ − 932 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+ − 933
+ − 934 <div class=defline id=defline6>
+ − 935 Mouse-over to show defline and scores, click to show alignments
+ − 936 </div>
+ − 937
+ − 938 <div class=graphic>
+ − 939 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 940 <div class=legend><div class=graphicrow>
+ − 941 <div class=graphicitem style="background-color: black"><40</div>
+ − 942 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 943 <div class=graphicitem style="background-color: green">50–80</div>
+ − 944 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 945 <div class=graphicitem style="background-color: red">200≤</div>
+ − 946 </div></div>
+ − 947 <div style="clear: left"></div>
+ − 948
+ − 949 <div class=tablewrapper>
+ − 950
+ − 951 <div class=scale>
+ − 952 <div>query:</div>
+ − 953 <div class=graphicrow>
+ − 954 <div>
+ − 955 <div class=graphicitem style="width: 10.0%">
+ − 956 <div>2</div>
+ − 957 </div>
+ − 958 <div class=graphicitem style="width: 10.0%">
+ − 959 <div>4</div>
+ − 960 </div>
+ − 961 <div class=graphicitem style="width: 10.0%">
+ − 962 <div>6</div>
+ − 963 </div>
+ − 964 <div class=graphicitem style="width: 10.0%">
+ − 965 <div>8</div>
+ − 966 </div>
+ − 967 <div class=graphicitem style="width: 10.0%">
+ − 968 <div>10</div>
+ − 969 </div>
+ − 970 <div class=graphicitem style="width: 10.0%">
+ − 971 <div>12</div>
+ − 972 </div>
+ − 973 <div class=graphicitem style="width: 10.0%">
+ − 974 <div>14</div>
+ − 975 </div>
+ − 976 <div class=graphicitem style="width: 10.0%">
+ − 977 <div>16</div>
+ − 978 </div>
+ − 979 <div class=graphicitem style="width: 10.0%">
+ − 980 <div>18</div>
+ − 981 </div>
+ − 982 <div class=graphicitem style="width: 10.0%">
+ − 983 <div>20</div>
+ − 984 </div>
+ − 985 </div>
+ − 986 </div>
+ − 987 <div style="clear: left"></div>
+ − 988 </div>
+ − 989
+ − 990 <a class=matchresult
+ − 991 href="#hit1"
+ − 992 onmouseover='document.getElementById("defline6").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+ − 993 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 994 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+ − 995 <div class="matchrow graphicrow">
+ − 996 <div class="matchitem graphicitem"
+ − 997 style="background-color: black; width: 100.0%"></div>
+ − 998 </div>
+ − 999 </a>
+ − 1000
+ − 1001 </div>
+ − 1002 </div>
+ − 1003 </div>
+ − 1004 </section>
+ − 1005
+ − 1006
+ − 1007
+ − 1008 <section class=descriptions>
+ − 1009 <h2>Descriptions</h2>
+ − 1010
+ − 1011 <div class=grey><div class=white>
+ − 1012 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 1013
+ − 1014 <table class=descriptiontable>
+ − 1015 <col/><col/><col/><col/><col/><col/><col/>
+ − 1016 <tr>
+ − 1017 <th>Description</th>
+ − 1018 <th>Max score</th>
+ − 1019 <th>Total score</th>
+ − 1020 <th>Query cover</th>
+ − 1021 <th>E value</th>
+ − 1022 <th>Ident</th>
+ − 1023 <th>Accession</th>
+ − 1024 </tr>
+ − 1025 <tr>
+ − 1026 <td><div><a href="#hit1"
+ − 1027 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+ − 1028 id="description1">
+ − 1029 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+ − 1030 </a></div></td>
+ − 1031 <td>37.4</td>
+ − 1032 <td>37.4</td>
+ − 1033 <td>100%</td>
+ − 1034 <td>7.011e-08</td>
+ − 1035 <td>100%</td>
+ − 1036 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a></td>
+ − 1037 </tr>
+ − 1038 </table>
+ − 1039
+ − 1040 </div></div>
+ − 1041 </section>
+ − 1042
+ − 1043
+ − 1044
+ − 1045 <section class=alignments>
+ − 1046 <h2>Alignments</h2>
+ − 1047
+ − 1048 <div class=grey><div class=white>
+ − 1049 <div class=alignment id=hit1>
+ − 1050
+ − 1051 <div class=linkheader>
+ − 1052 <div class=right><a href="#description1">Descriptions</a></div>
+ − 1053 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">GenBank</a>
+ − 1054 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&log$=nuclalign">Graphics</a>
+ − 1055 </div>
+ − 1056
+ − 1057 <div class=title>
+ − 1058 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+ − 1059 <p class=titleinfo>
+ − 1060 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a>
+ − 1061 <span class=b>Length:</span> 2457
+ − 1062 <span class=b>Number of Matches:</span> 1
+ − 1063 </p>
+ − 1064 </div>
+ − 1065
+ − 1066
+ − 1067 <div class=hotspot>
+ − 1068 <p class=range>
+ − 1069 <span class=range>Range 1: 2119 to 2138</span>
+ − 1070 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign&from=2119&to=2138">GenBank</a>
+ − 1071 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&log$=nuclalign&from=2119&to=2138">Graphics</a>
+ − 1072 </p>
+ − 1073
+ − 1074 <table class=hotspotstable>
+ − 1075 <tr>
+ − 1076 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 1077 </tr>
+ − 1078 <tr>
+ − 1079 <td>37.4 bits(40)</td>
+ − 1080 <td>0.0</td>
+ − 1081 <td>20/20(100%)</td>
+ − 1082 <td>0/20(0%)</td>
+ − 1083 <td>Plus/Plus</td>
+ − 1084 </tr>
+ − 1085 </table>
+ − 1086
+ − 1087 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20
+ − 1088 ||||||||||||||||||||
+ − 1089 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre>
+ − 1090 </div>
+ − 1091
+ − 1092 </div>
+ − 1093
+ − 1094 </div></div>
+ − 1095 </section>
+ − 1096 </section>
+ − 1097
+ − 1098 <section class=match id=match7>
+ − 1099
+ − 1100 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1101
+ − 1102 <section class=header>
+ − 1103
+ − 1104 <table class=headerdata>
+ − 1105 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1106 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1107 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1108 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1109 <tr><td class=param>Database:</td><td></td></tr>
+ − 1110 </table>
+ − 1111
+ − 1112 </section>
+ − 1113
+ − 1114 <section>
+ − 1115 <h2>No Hits</h2>
+ − 1116 <div class=grey>
+ − 1117 <table class=headerdata>
+ − 1118 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1119 </table>
+ − 1120 </div>
+ − 1121 </section>
+ − 1122 </section>
+ − 1123
+ − 1124 <section class=match id=match8>
+ − 1125
+ − 1126 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1127
+ − 1128 <section class=header>
+ − 1129
+ − 1130 <table class=headerdata>
+ − 1131 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1132 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1133 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1134 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1135 <tr><td class=param>Database:</td><td></td></tr>
+ − 1136 </table>
+ − 1137
+ − 1138 </section>
+ − 1139
+ − 1140 <section>
+ − 1141 <h2>No Hits</h2>
+ − 1142 <div class=grey>
+ − 1143 <table class=headerdata>
+ − 1144 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1145 </table>
+ − 1146 </div>
+ − 1147 </section>
+ − 1148 </section>
+ − 1149
+ − 1150 <section class=match id=match9>
+ − 1151
+ − 1152 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1153
+ − 1154 <section class=header>
+ − 1155
+ − 1156 <table class=headerdata>
+ − 1157 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1158 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1159 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1160 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1161 <tr><td class=param>Database:</td><td></td></tr>
+ − 1162 </table>
+ − 1163
+ − 1164 </section>
+ − 1165
+ − 1166 <section>
+ − 1167 <h2>No Hits</h2>
+ − 1168 <div class=grey>
+ − 1169 <table class=headerdata>
+ − 1170 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1171 </table>
+ − 1172 </div>
+ − 1173 </section>
+ − 1174 </section>
+ − 1175
+ − 1176 <section class=match id=match10>
+ − 1177
+ − 1178 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1179
+ − 1180 <section class=header>
+ − 1181
+ − 1182 <table class=headerdata>
+ − 1183 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1184 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1185 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1186 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1187 <tr><td class=param>Database:</td><td></td></tr>
+ − 1188 </table>
+ − 1189
+ − 1190 </section>
+ − 1191
+ − 1192 <section>
+ − 1193 <h2>No Hits</h2>
+ − 1194 <div class=grey>
+ − 1195 <table class=headerdata>
+ − 1196 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1197 </table>
+ − 1198 </div>
+ − 1199 </section>
+ − 1200 </section>
+ − 1201
+ − 1202 <section class=match id=match11>
+ − 1203
+ − 1204 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1205
+ − 1206 <section class=header>
+ − 1207
+ − 1208 <table class=headerdata>
+ − 1209 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1210 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1211 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1212 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1213 <tr><td class=param>Database:</td><td></td></tr>
+ − 1214 </table>
+ − 1215
+ − 1216 </section>
+ − 1217
+ − 1218 <section>
+ − 1219 <h2>No Hits</h2>
+ − 1220 <div class=grey>
+ − 1221 <table class=headerdata>
+ − 1222 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1223 </table>
+ − 1224 </div>
+ − 1225 </section>
+ − 1226 </section>
+ − 1227
+ − 1228 <section class=match id=match12>
+ − 1229
+ − 1230 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1231
+ − 1232 <section class=header>
+ − 1233
+ − 1234 <table class=headerdata>
+ − 1235 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1236 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1237 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1238 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1239 <tr><td class=param>Database:</td><td></td></tr>
+ − 1240 </table>
+ − 1241
+ − 1242 </section>
+ − 1243
+ − 1244 <section>
+ − 1245 <h2>No Hits</h2>
+ − 1246 <div class=grey>
+ − 1247 <table class=headerdata>
+ − 1248 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1249 </table>
+ − 1250 </div>
+ − 1251 </section>
+ − 1252 </section>
+ − 1253
+ − 1254 <section class=match id=match13>
+ − 1255
+ − 1256 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1257
+ − 1258 <section class=header>
+ − 1259
+ − 1260 <table class=headerdata>
+ − 1261 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1262 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1263 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1264 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1265 <tr><td class=param>Database:</td><td></td></tr>
+ − 1266 </table>
+ − 1267
+ − 1268 </section>
+ − 1269
+ − 1270 <section>
+ − 1271 <h2>No Hits</h2>
+ − 1272 <div class=grey>
+ − 1273 <table class=headerdata>
+ − 1274 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1275 </table>
+ − 1276 </div>
+ − 1277 </section>
+ − 1278 </section>
+ − 1279
+ − 1280 <section class=match id=match14>
+ − 1281
+ − 1282 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1283
+ − 1284 <section class=header>
+ − 1285
+ − 1286 <table class=headerdata>
+ − 1287 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1288 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1289 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1290 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1291 <tr><td class=param>Database:</td><td></td></tr>
+ − 1292 </table>
+ − 1293
+ − 1294 </section>
+ − 1295
+ − 1296 <section>
+ − 1297 <h2>No Hits</h2>
+ − 1298 <div class=grey>
+ − 1299 <table class=headerdata>
+ − 1300 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1301 </table>
+ − 1302 </div>
+ − 1303 </section>
+ − 1304 </section>
+ − 1305
+ − 1306 <section class=match id=match15>
+ − 1307
+ − 1308 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1309
+ − 1310 <section class=header>
+ − 1311
+ − 1312 <table class=headerdata>
+ − 1313 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1314 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1315 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1316 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1317 <tr><td class=param>Database:</td><td></td></tr>
+ − 1318 </table>
+ − 1319
+ − 1320 </section>
+ − 1321
+ − 1322 <section>
+ − 1323 <h2>No Hits</h2>
+ − 1324 <div class=grey>
+ − 1325 <table class=headerdata>
+ − 1326 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1327 </table>
+ − 1328 </div>
+ − 1329 </section>
+ − 1330 </section>
+ − 1331
+ − 1332 <section class=match id=match16>
+ − 1333
+ − 1334 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1335
+ − 1336 <section class=header>
+ − 1337
+ − 1338 <table class=headerdata>
+ − 1339 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1340 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1341 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1342 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1343 <tr><td class=param>Database:</td><td></td></tr>
+ − 1344 </table>
+ − 1345
+ − 1346 </section>
+ − 1347
+ − 1348 <section>
+ − 1349 <h2>No Hits</h2>
+ − 1350 <div class=grey>
+ − 1351 <table class=headerdata>
+ − 1352 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1353 </table>
+ − 1354 </div>
+ − 1355 </section>
+ − 1356 </section>
+ − 1357
+ − 1358 <section class=match id=match17>
+ − 1359
+ − 1360 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1361
+ − 1362 <section class=header>
+ − 1363
+ − 1364 <table class=headerdata>
+ − 1365 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1366 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1367 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1368 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1369 <tr><td class=param>Database:</td><td></td></tr>
+ − 1370 </table>
+ − 1371
+ − 1372 </section>
+ − 1373
+ − 1374 <section>
+ − 1375 <h2>No Hits</h2>
+ − 1376 <div class=grey>
+ − 1377 <table class=headerdata>
+ − 1378 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1379 </table>
+ − 1380 </div>
+ − 1381 </section>
+ − 1382 </section>
+ − 1383
+ − 1384 <section class=match id=match18>
+ − 1385
+ − 1386 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1387
+ − 1388 <section class=header>
+ − 1389
+ − 1390 <table class=headerdata>
+ − 1391 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1392 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1393 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1394 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1395 <tr><td class=param>Database:</td><td></td></tr>
+ − 1396 </table>
+ − 1397
+ − 1398 </section>
+ − 1399
+ − 1400
+ − 1401 <section class=graphics>
+ − 1402 <h2>Graphic Summary</h2>
+ − 1403
+ − 1404 <div class=grey>
+ − 1405 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+ − 1406
+ − 1407 <div class=defline id=defline18>
+ − 1408 Mouse-over to show defline and scores, click to show alignments
+ − 1409 </div>
+ − 1410
+ − 1411 <div class=graphic>
+ − 1412 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 1413 <div class=legend><div class=graphicrow>
+ − 1414 <div class=graphicitem style="background-color: black"><40</div>
+ − 1415 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 1416 <div class=graphicitem style="background-color: green">50–80</div>
+ − 1417 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 1418 <div class=graphicitem style="background-color: red">200≤</div>
+ − 1419 </div></div>
+ − 1420 <div style="clear: left"></div>
+ − 1421
+ − 1422 <div class=tablewrapper>
+ − 1423
+ − 1424 <div class=scale>
+ − 1425 <div>query:</div>
+ − 1426 <div class=graphicrow>
+ − 1427 <div>
+ − 1428 <div class=graphicitem style="width: 10.0%">
+ − 1429 <div>2</div>
+ − 1430 </div>
+ − 1431 <div class=graphicitem style="width: 10.0%">
+ − 1432 <div>4</div>
+ − 1433 </div>
+ − 1434 <div class=graphicitem style="width: 10.0%">
+ − 1435 <div>6</div>
+ − 1436 </div>
+ − 1437 <div class=graphicitem style="width: 10.0%">
+ − 1438 <div>8</div>
+ − 1439 </div>
+ − 1440 <div class=graphicitem style="width: 10.0%">
+ − 1441 <div>10</div>
+ − 1442 </div>
+ − 1443 <div class=graphicitem style="width: 10.0%">
+ − 1444 <div>12</div>
+ − 1445 </div>
+ − 1446 <div class=graphicitem style="width: 10.0%">
+ − 1447 <div>14</div>
+ − 1448 </div>
+ − 1449 <div class=graphicitem style="width: 10.0%">
+ − 1450 <div>16</div>
+ − 1451 </div>
+ − 1452 <div class=graphicitem style="width: 10.0%">
+ − 1453 <div>18</div>
+ − 1454 </div>
+ − 1455 <div class=graphicitem style="width: 10.0%">
+ − 1456 <div>20</div>
+ − 1457 </div>
+ − 1458 </div>
+ − 1459 </div>
+ − 1460 <div style="clear: left"></div>
+ − 1461 </div>
+ − 1462
+ − 1463 <a class=matchresult
+ − 1464 href="#hit1"
+ − 1465 onmouseover='document.getElementById("defline18").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"'
+ − 1466 onmouseout='document.getElementById("defline18").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 1467 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000">
+ − 1468 <div class="matchrow graphicrow">
+ − 1469 <div class="matchitem graphicitem"
+ − 1470 style="background-color: transparent; width: 15.0%"></div>
+ − 1471 <div class="matchitem graphicitem"
+ − 1472 style="background-color: black; width: 85.0%"></div>
+ − 1473 </div>
+ − 1474 </a>
+ − 1475
+ − 1476 </div>
+ − 1477 </div>
+ − 1478 </div>
+ − 1479 </section>
+ − 1480
+ − 1481
+ − 1482
+ − 1483 <section class=descriptions>
+ − 1484 <h2>Descriptions</h2>
+ − 1485
+ − 1486 <div class=grey><div class=white>
+ − 1487 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 1488
+ − 1489 <table class=descriptiontable>
+ − 1490 <col/><col/><col/><col/><col/><col/><col/>
+ − 1491 <tr>
+ − 1492 <th>Description</th>
+ − 1493 <th>Max score</th>
+ − 1494 <th>Total score</th>
+ − 1495 <th>Query cover</th>
+ − 1496 <th>E value</th>
+ − 1497 <th>Ident</th>
+ − 1498 <th>Accession</th>
+ − 1499 </tr>
+ − 1500 <tr>
+ − 1501 <td><div><a href="#hit1"
+ − 1502 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"
+ − 1503 id="description1">
+ − 1504 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000
+ − 1505 </a></div></td>
+ − 1506 <td>31.9</td>
+ − 1507 <td>31.9</td>
+ − 1508 <td>85%</td>
+ − 1509 <td>2.981e-06</td>
+ − 1510 <td>100%</td>
+ − 1511 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">Subject_2</a></td>
+ − 1512 </tr>
+ − 1513 </table>
+ − 1514
+ − 1515 </div></div>
+ − 1516 </section>
+ − 1517
+ − 1518
+ − 1519
+ − 1520 <section class=alignments>
+ − 1521 <h2>Alignments</h2>
+ − 1522
+ − 1523 <div class=grey><div class=white>
+ − 1524 <div class=alignment id=hit1>
+ − 1525
+ − 1526 <div class=linkheader>
+ − 1527 <div class=right><a href="#description1">Descriptions</a></div>
+ − 1528 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">GenBank</a>
+ − 1529 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=graph&log$=nuclalign">Graphics</a>
+ − 1530 </div>
+ − 1531
+ − 1532 <div class=title>
+ − 1533 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p>
+ − 1534 <p class=titleinfo>
+ − 1535 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">Subject_2</a>
+ − 1536 <span class=b>Length:</span> 1045
+ − 1537 <span class=b>Number of Matches:</span> 1
+ − 1538 </p>
+ − 1539 </div>
+ − 1540
+ − 1541
+ − 1542 <div class=hotspot>
+ − 1543 <p class=range>
+ − 1544 <span class=range>Range 1: 2 to 18</span>
+ − 1545 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign&from=2&to=18">GenBank</a>
+ − 1546 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=graph&log$=nuclalign&from=2&to=18">Graphics</a>
+ − 1547 </p>
+ − 1548
+ − 1549 <table class=hotspotstable>
+ − 1550 <tr>
+ − 1551 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 1552 </tr>
+ − 1553 <tr>
+ − 1554 <td>31.9 bits(34)</td>
+ − 1555 <td>0.0</td>
+ − 1556 <td>17/17(100%)</td>
+ − 1557 <td>0/17(0%)</td>
+ − 1558 <td>Plus/Plus</td>
+ − 1559 </tr>
+ − 1560 </table>
+ − 1561
+ − 1562 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20
+ − 1563 |||||||||||||||||
+ − 1564 Subject 2 GCGCGGTGTCATCTATG 18</pre>
+ − 1565 </div>
+ − 1566
+ − 1567 </div>
+ − 1568
+ − 1569 </div></div>
+ − 1570 </section>
+ − 1571 </section>
+ − 1572
+ − 1573 <section class=match id=match19>
+ − 1574
+ − 1575 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1576
+ − 1577 <section class=header>
+ − 1578
+ − 1579 <table class=headerdata>
+ − 1580 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1581 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1582 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1583 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1584 <tr><td class=param>Database:</td><td></td></tr>
+ − 1585 </table>
+ − 1586
+ − 1587 </section>
+ − 1588
+ − 1589
+ − 1590 <section class=graphics>
+ − 1591 <h2>Graphic Summary</h2>
+ − 1592
+ − 1593 <div class=grey>
+ − 1594 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+ − 1595
+ − 1596 <div class=defline id=defline19>
+ − 1597 Mouse-over to show defline and scores, click to show alignments
+ − 1598 </div>
+ − 1599
+ − 1600 <div class=graphic>
+ − 1601 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 1602 <div class=legend><div class=graphicrow>
+ − 1603 <div class=graphicitem style="background-color: black"><40</div>
+ − 1604 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 1605 <div class=graphicitem style="background-color: green">50–80</div>
+ − 1606 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 1607 <div class=graphicitem style="background-color: red">200≤</div>
+ − 1608 </div></div>
+ − 1609 <div style="clear: left"></div>
+ − 1610
+ − 1611 <div class=tablewrapper>
+ − 1612
+ − 1613 <div class=scale>
+ − 1614 <div>query:</div>
+ − 1615 <div class=graphicrow>
+ − 1616 <div>
+ − 1617 <div class=graphicitem style="width: 10.0%">
+ − 1618 <div>2</div>
+ − 1619 </div>
+ − 1620 <div class=graphicitem style="width: 10.0%">
+ − 1621 <div>4</div>
+ − 1622 </div>
+ − 1623 <div class=graphicitem style="width: 10.0%">
+ − 1624 <div>6</div>
+ − 1625 </div>
+ − 1626 <div class=graphicitem style="width: 10.0%">
+ − 1627 <div>8</div>
+ − 1628 </div>
+ − 1629 <div class=graphicitem style="width: 10.0%">
+ − 1630 <div>10</div>
+ − 1631 </div>
+ − 1632 <div class=graphicitem style="width: 10.0%">
+ − 1633 <div>12</div>
+ − 1634 </div>
+ − 1635 <div class=graphicitem style="width: 10.0%">
+ − 1636 <div>14</div>
+ − 1637 </div>
+ − 1638 <div class=graphicitem style="width: 10.0%">
+ − 1639 <div>16</div>
+ − 1640 </div>
+ − 1641 <div class=graphicitem style="width: 10.0%">
+ − 1642 <div>18</div>
+ − 1643 </div>
+ − 1644 <div class=graphicitem style="width: 10.0%">
+ − 1645 <div>20</div>
+ − 1646 </div>
+ − 1647 </div>
+ − 1648 </div>
+ − 1649 <div style="clear: left"></div>
+ − 1650 </div>
+ − 1651
+ − 1652 <a class=matchresult
+ − 1653 href="#hit1"
+ − 1654 onmouseover='document.getElementById("defline19").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+ − 1655 onmouseout='document.getElementById("defline19").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 1656 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+ − 1657 <div class="matchrow graphicrow">
+ − 1658 <div class="matchitem graphicitem"
+ − 1659 style="background-color: black; width: 100.0%"></div>
+ − 1660 </div>
+ − 1661 </a>
+ − 1662
+ − 1663 </div>
+ − 1664 </div>
+ − 1665 </div>
+ − 1666 </section>
+ − 1667
+ − 1668
+ − 1669
+ − 1670 <section class=descriptions>
+ − 1671 <h2>Descriptions</h2>
+ − 1672
+ − 1673 <div class=grey><div class=white>
+ − 1674 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 1675
+ − 1676 <table class=descriptiontable>
+ − 1677 <col/><col/><col/><col/><col/><col/><col/>
+ − 1678 <tr>
+ − 1679 <th>Description</th>
+ − 1680 <th>Max score</th>
+ − 1681 <th>Total score</th>
+ − 1682 <th>Query cover</th>
+ − 1683 <th>E value</th>
+ − 1684 <th>Ident</th>
+ − 1685 <th>Accession</th>
+ − 1686 </tr>
+ − 1687 <tr>
+ − 1688 <td><div><a href="#hit1"
+ − 1689 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+ − 1690 id="description1">
+ − 1691 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+ − 1692 </a></div></td>
+ − 1693 <td>37.4</td>
+ − 1694 <td>37.4</td>
+ − 1695 <td>100%</td>
+ − 1696 <td>7.011e-08</td>
+ − 1697 <td>100%</td>
+ − 1698 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a></td>
+ − 1699 </tr>
+ − 1700 </table>
+ − 1701
+ − 1702 </div></div>
+ − 1703 </section>
+ − 1704
+ − 1705
+ − 1706
+ − 1707 <section class=alignments>
+ − 1708 <h2>Alignments</h2>
+ − 1709
+ − 1710 <div class=grey><div class=white>
+ − 1711 <div class=alignment id=hit1>
+ − 1712
+ − 1713 <div class=linkheader>
+ − 1714 <div class=right><a href="#description1">Descriptions</a></div>
+ − 1715 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">GenBank</a>
+ − 1716 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&log$=nuclalign">Graphics</a>
+ − 1717 </div>
+ − 1718
+ − 1719 <div class=title>
+ − 1720 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+ − 1721 <p class=titleinfo>
+ − 1722 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a>
+ − 1723 <span class=b>Length:</span> 323
+ − 1724 <span class=b>Number of Matches:</span> 1
+ − 1725 </p>
+ − 1726 </div>
+ − 1727
+ − 1728
+ − 1729 <div class=hotspot>
+ − 1730 <p class=range>
+ − 1731 <span class=range>Range 1: 224 to 243</span>
+ − 1732 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign&from=224&to=243">GenBank</a>
+ − 1733 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&log$=nuclalign&from=224&to=243">Graphics</a>
+ − 1734 </p>
+ − 1735
+ − 1736 <table class=hotspotstable>
+ − 1737 <tr>
+ − 1738 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 1739 </tr>
+ − 1740 <tr>
+ − 1741 <td>37.4 bits(40)</td>
+ − 1742 <td>0.0</td>
+ − 1743 <td>20/20(100%)</td>
+ − 1744 <td>0/20(0%)</td>
+ − 1745 <td>Plus/Plus</td>
+ − 1746 </tr>
+ − 1747 </table>
+ − 1748
+ − 1749 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20
+ − 1750 ||||||||||||||||||||
+ − 1751 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre>
+ − 1752 </div>
+ − 1753
+ − 1754 </div>
+ − 1755
+ − 1756 </div></div>
+ − 1757 </section>
+ − 1758 </section>
+ − 1759
+ − 1760 <section class=match id=match20>
+ − 1761
+ − 1762 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1763
+ − 1764 <section class=header>
+ − 1765
+ − 1766 <table class=headerdata>
+ − 1767 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1768 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1769 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1770 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1771 <tr><td class=param>Database:</td><td></td></tr>
+ − 1772 </table>
+ − 1773
+ − 1774 </section>
+ − 1775
+ − 1776 <section>
+ − 1777 <h2>No Hits</h2>
+ − 1778 <div class=grey>
+ − 1779 <table class=headerdata>
+ − 1780 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1781 </table>
+ − 1782 </div>
+ − 1783 </section>
+ − 1784 </section>
+ − 1785
+ − 1786 <section class=match id=match21>
+ − 1787
+ − 1788 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1789
+ − 1790 <section class=header>
+ − 1791
+ − 1792 <table class=headerdata>
+ − 1793 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1794 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1795 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1796 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1797 <tr><td class=param>Database:</td><td></td></tr>
+ − 1798 </table>
+ − 1799
+ − 1800 </section>
+ − 1801
+ − 1802 <section>
+ − 1803 <h2>No Hits</h2>
+ − 1804 <div class=grey>
+ − 1805 <table class=headerdata>
+ − 1806 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1807 </table>
+ − 1808 </div>
+ − 1809 </section>
+ − 1810 </section>
+ − 1811
+ − 1812 <section class=match id=match22>
+ − 1813
+ − 1814 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1815
+ − 1816 <section class=header>
+ − 1817
+ − 1818 <table class=headerdata>
+ − 1819 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1820 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1821 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1822 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1823 <tr><td class=param>Database:</td><td></td></tr>
+ − 1824 </table>
+ − 1825
+ − 1826 </section>
+ − 1827
+ − 1828
+ − 1829 <section class=graphics>
+ − 1830 <h2>Graphic Summary</h2>
+ − 1831
+ − 1832 <div class=grey>
+ − 1833 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+ − 1834
+ − 1835 <div class=defline id=defline22>
+ − 1836 Mouse-over to show defline and scores, click to show alignments
+ − 1837 </div>
+ − 1838
+ − 1839 <div class=graphic>
+ − 1840 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 1841 <div class=legend><div class=graphicrow>
+ − 1842 <div class=graphicitem style="background-color: black"><40</div>
+ − 1843 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 1844 <div class=graphicitem style="background-color: green">50–80</div>
+ − 1845 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 1846 <div class=graphicitem style="background-color: red">200≤</div>
+ − 1847 </div></div>
+ − 1848 <div style="clear: left"></div>
+ − 1849
+ − 1850 <div class=tablewrapper>
+ − 1851
+ − 1852 <div class=scale>
+ − 1853 <div>query:</div>
+ − 1854 <div class=graphicrow>
+ − 1855 <div>
+ − 1856 <div class=graphicitem style="width: 10.0%">
+ − 1857 <div>2</div>
+ − 1858 </div>
+ − 1859 <div class=graphicitem style="width: 10.0%">
+ − 1860 <div>4</div>
+ − 1861 </div>
+ − 1862 <div class=graphicitem style="width: 10.0%">
+ − 1863 <div>6</div>
+ − 1864 </div>
+ − 1865 <div class=graphicitem style="width: 10.0%">
+ − 1866 <div>8</div>
+ − 1867 </div>
+ − 1868 <div class=graphicitem style="width: 10.0%">
+ − 1869 <div>10</div>
+ − 1870 </div>
+ − 1871 <div class=graphicitem style="width: 10.0%">
+ − 1872 <div>12</div>
+ − 1873 </div>
+ − 1874 <div class=graphicitem style="width: 10.0%">
+ − 1875 <div>14</div>
+ − 1876 </div>
+ − 1877 <div class=graphicitem style="width: 10.0%">
+ − 1878 <div>16</div>
+ − 1879 </div>
+ − 1880 <div class=graphicitem style="width: 10.0%">
+ − 1881 <div>18</div>
+ − 1882 </div>
+ − 1883 <div class=graphicitem style="width: 10.0%">
+ − 1884 <div>20</div>
+ − 1885 </div>
+ − 1886 </div>
+ − 1887 </div>
+ − 1888 <div style="clear: left"></div>
+ − 1889 </div>
+ − 1890
+ − 1891 <a class=matchresult
+ − 1892 href="#hit1"
+ − 1893 onmouseover='document.getElementById("defline22").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+ − 1894 onmouseout='document.getElementById("defline22").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 1895 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+ − 1896 <div class="matchrow graphicrow">
+ − 1897 <div class="matchitem graphicitem"
+ − 1898 style="background-color: black; width: 100.0%"></div>
+ − 1899 </div>
+ − 1900 </a>
+ − 1901
+ − 1902 </div>
+ − 1903 </div>
+ − 1904 </div>
+ − 1905 </section>
+ − 1906
+ − 1907
+ − 1908
+ − 1909 <section class=descriptions>
+ − 1910 <h2>Descriptions</h2>
+ − 1911
+ − 1912 <div class=grey><div class=white>
+ − 1913 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 1914
+ − 1915 <table class=descriptiontable>
+ − 1916 <col/><col/><col/><col/><col/><col/><col/>
+ − 1917 <tr>
+ − 1918 <th>Description</th>
+ − 1919 <th>Max score</th>
+ − 1920 <th>Total score</th>
+ − 1921 <th>Query cover</th>
+ − 1922 <th>E value</th>
+ − 1923 <th>Ident</th>
+ − 1924 <th>Accession</th>
+ − 1925 </tr>
+ − 1926 <tr>
+ − 1927 <td><div><a href="#hit1"
+ − 1928 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+ − 1929 id="description1">
+ − 1930 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+ − 1931 </a></div></td>
+ − 1932 <td>37.4</td>
+ − 1933 <td>37.4</td>
+ − 1934 <td>100%</td>
+ − 1935 <td>7.011e-08</td>
+ − 1936 <td>100%</td>
+ − 1937 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a></td>
+ − 1938 </tr>
+ − 1939 </table>
+ − 1940
+ − 1941 </div></div>
+ − 1942 </section>
+ − 1943
+ − 1944
+ − 1945
+ − 1946 <section class=alignments>
+ − 1947 <h2>Alignments</h2>
+ − 1948
+ − 1949 <div class=grey><div class=white>
+ − 1950 <div class=alignment id=hit1>
+ − 1951
+ − 1952 <div class=linkheader>
+ − 1953 <div class=right><a href="#description1">Descriptions</a></div>
+ − 1954 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">GenBank</a>
+ − 1955 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&log$=nuclalign">Graphics</a>
+ − 1956 </div>
+ − 1957
+ − 1958 <div class=title>
+ − 1959 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+ − 1960 <p class=titleinfo>
+ − 1961 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a>
+ − 1962 <span class=b>Length:</span> 2457
+ − 1963 <span class=b>Number of Matches:</span> 1
+ − 1964 </p>
+ − 1965 </div>
+ − 1966
+ − 1967
+ − 1968 <div class=hotspot>
+ − 1969 <p class=range>
+ − 1970 <span class=range>Range 1: 2143 to 2162</span>
+ − 1971 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign&from=2143&to=2162">GenBank</a>
+ − 1972 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&log$=nuclalign&from=2143&to=2162">Graphics</a>
+ − 1973 </p>
+ − 1974
+ − 1975 <table class=hotspotstable>
+ − 1976 <tr>
+ − 1977 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 1978 </tr>
+ − 1979 <tr>
+ − 1980 <td>37.4 bits(40)</td>
+ − 1981 <td>0.0</td>
+ − 1982 <td>20/20(100%)</td>
+ − 1983 <td>0/20(0%)</td>
+ − 1984 <td>Plus/Plus</td>
+ − 1985 </tr>
+ − 1986 </table>
+ − 1987
+ − 1988 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20
+ − 1989 ||||||||||||||||||||
+ − 1990 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre>
+ − 1991 </div>
+ − 1992
+ − 1993 </div>
+ − 1994
+ − 1995 </div></div>
+ − 1996 </section>
+ − 1997 </section>
+ − 1998
+ − 1999 <section class=match id=match23>
+ − 2000
+ − 2001 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 2002
+ − 2003 <section class=header>
+ − 2004
+ − 2005 <table class=headerdata>
+ − 2006 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2007 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2008 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2009 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2010 <tr><td class=param>Database:</td><td></td></tr>
+ − 2011 </table>
+ − 2012
+ − 2013 </section>
+ − 2014
+ − 2015 <section>
+ − 2016 <h2>No Hits</h2>
+ − 2017 <div class=grey>
+ − 2018 <table class=headerdata>
+ − 2019 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2020 </table>
+ − 2021 </div>
+ − 2022 </section>
+ − 2023 </section>
+ − 2024
+ − 2025 <section class=match id=match24>
+ − 2026
+ − 2027 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 2028
+ − 2029 <section class=header>
+ − 2030
+ − 2031 <table class=headerdata>
+ − 2032 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2033 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2034 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2035 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2036 <tr><td class=param>Database:</td><td></td></tr>
+ − 2037 </table>
+ − 2038
+ − 2039 </section>
+ − 2040
+ − 2041 <section>
+ − 2042 <h2>No Hits</h2>
+ − 2043 <div class=grey>
+ − 2044 <table class=headerdata>
+ − 2045 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2046 </table>
+ − 2047 </div>
+ − 2048 </section>
+ − 2049 </section>
+ − 2050
+ − 2051 <section class=match id=match25>
+ − 2052
+ − 2053 <h1>Nucleotide Sequence (24 letters)</h1>
+ − 2054
+ − 2055 <section class=header>
+ − 2056
+ − 2057 <table class=headerdata>
+ − 2058 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2059 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2060 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2061 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2062 <tr><td class=param>Database:</td><td></td></tr>
+ − 2063 </table>
+ − 2064
+ − 2065 </section>
+ − 2066
+ − 2067 <section>
+ − 2068 <h2>No Hits</h2>
+ − 2069 <div class=grey>
+ − 2070 <table class=headerdata>
+ − 2071 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2072 </table>
+ − 2073 </div>
+ − 2074 </section>
+ − 2075 </section>
+ − 2076
+ − 2077 <section class=match id=match26>
+ − 2078
+ − 2079 <h1>Nucleotide Sequence (24 letters)</h1>
+ − 2080
+ − 2081 <section class=header>
+ − 2082
+ − 2083 <table class=headerdata>
+ − 2084 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2085 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2086 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2087 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2088 <tr><td class=param>Database:</td><td></td></tr>
+ − 2089 </table>
+ − 2090
+ − 2091 </section>
+ − 2092
+ − 2093 <section>
+ − 2094 <h2>No Hits</h2>
+ − 2095 <div class=grey>
+ − 2096 <table class=headerdata>
+ − 2097 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2098 </table>
+ − 2099 </div>
+ − 2100 </section>
+ − 2101 </section>
+ − 2102
+ − 2103 <section class=match id=match27>
+ − 2104
+ − 2105 <h1>Nucleotide Sequence (24 letters)</h1>
+ − 2106
+ − 2107 <section class=header>
+ − 2108
+ − 2109 <table class=headerdata>
+ − 2110 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2111 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2112 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2113 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2114 <tr><td class=param>Database:</td><td></td></tr>
+ − 2115 </table>
+ − 2116
+ − 2117 </section>
+ − 2118
+ − 2119 <section>
+ − 2120 <h2>No Hits</h2>
+ − 2121 <div class=grey>
+ − 2122 <table class=headerdata>
+ − 2123 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2124 </table>
+ − 2125 </div>
+ − 2126 </section>
+ − 2127 </section>
+ − 2128
+ − 2129 <section class=match id=match28>
+ − 2130
+ − 2131 <h1>Nucleotide Sequence (24 letters)</h1>
+ − 2132
+ − 2133 <section class=header>
+ − 2134
+ − 2135 <table class=headerdata>
+ − 2136 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2137 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2138 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2139 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2140 <tr><td class=param>Database:</td><td></td></tr>
+ − 2141 </table>
+ − 2142
+ − 2143 </section>
+ − 2144
+ − 2145 <section>
+ − 2146 <h2>No Hits</h2>
+ − 2147 <div class=grey>
+ − 2148 <table class=headerdata>
+ − 2149 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2150 </table>
+ − 2151 </div>
+ − 2152 </section>
+ − 2153 </section>
+ − 2154
+ − 2155 <section class=match id=match29>
+ − 2156
+ − 2157 <h1>Nucleotide Sequence (24 letters)</h1>
+ − 2158
+ − 2159 <section class=header>
+ − 2160
+ − 2161 <table class=headerdata>
+ − 2162 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2163 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2164 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2165 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2166 <tr><td class=param>Database:</td><td></td></tr>
+ − 2167 </table>
+ − 2168
+ − 2169 </section>
+ − 2170
+ − 2171 <section>
+ − 2172 <h2>No Hits</h2>
+ − 2173 <div class=grey>
+ − 2174 <table class=headerdata>
+ − 2175 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2176 </table>
+ − 2177 </div>
+ − 2178 </section>
+ − 2179 </section>
+ − 2180
+ − 2181 <section class=match id=match30>
+ − 2182
+ − 2183 <h1>Nucleotide Sequence (24 letters)</h1>
+ − 2184
+ − 2185 <section class=header>
+ − 2186
+ − 2187 <table class=headerdata>
+ − 2188 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2189 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2190 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2191 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2192 <tr><td class=param>Database:</td><td></td></tr>
+ − 2193 </table>
+ − 2194
+ − 2195 </section>
+ − 2196
+ − 2197 <section>
+ − 2198 <h2>No Hits</h2>
+ − 2199 <div class=grey>
+ − 2200 <table class=headerdata>
+ − 2201 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2202 </table>
+ − 2203 </div>
+ − 2204 </section>
+ − 2205 </section>
+ − 2206
+ − 2207 <section class=match id=match31>
+ − 2208
+ − 2209 <h1>Nucleotide Sequence (24 letters)</h1>
+ − 2210
+ − 2211 <section class=header>
+ − 2212
+ − 2213 <table class=headerdata>
+ − 2214 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2215 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2216 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2217 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2218 <tr><td class=param>Database:</td><td></td></tr>
+ − 2219 </table>
+ − 2220
+ − 2221 </section>
+ − 2222
+ − 2223 <section>
+ − 2224 <h2>No Hits</h2>
+ − 2225 <div class=grey>
+ − 2226 <table class=headerdata>
+ − 2227 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2228 </table>
+ − 2229 </div>
+ − 2230 </section>
+ − 2231 </section>
+ − 2232
+ − 2233 <section class=match id=match32>
+ − 2234
+ − 2235 <h1>Nucleotide Sequence (24 letters)</h1>
+ − 2236
+ − 2237 <section class=header>
+ − 2238
+ − 2239 <table class=headerdata>
+ − 2240 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2241 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2242 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2243 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2244 <tr><td class=param>Database:</td><td></td></tr>
+ − 2245 </table>
+ − 2246
+ − 2247 </section>
+ − 2248
+ − 2249 <section>
+ − 2250 <h2>No Hits</h2>
+ − 2251 <div class=grey>
+ − 2252 <table class=headerdata>
+ − 2253 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2254 </table>
+ − 2255 </div>
+ − 2256 </section>
+ − 2257 </section>
+ − 2258
+ − 2259 <section class=match id=match33>
+ − 2260
+ − 2261 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 2262
+ − 2263 <section class=header>
+ − 2264
+ − 2265 <table class=headerdata>
+ − 2266 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2267 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2268 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2269 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2270 <tr><td class=param>Database:</td><td></td></tr>
+ − 2271 </table>
+ − 2272
+ − 2273 </section>
+ − 2274
+ − 2275 <section>
+ − 2276 <h2>No Hits</h2>
+ − 2277 <div class=grey>
+ − 2278 <table class=headerdata>
+ − 2279 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2280 </table>
+ − 2281 </div>
+ − 2282 </section>
+ − 2283 </section>
+ − 2284
+ − 2285 <section class=match id=match34>
+ − 2286
+ − 2287 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 2288
+ − 2289 <section class=header>
+ − 2290
+ − 2291 <table class=headerdata>
+ − 2292 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2293 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2294 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2295 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2296 <tr><td class=param>Database:</td><td></td></tr>
+ − 2297 </table>
+ − 2298
+ − 2299 </section>
+ − 2300
+ − 2301 <section>
+ − 2302 <h2>No Hits</h2>
+ − 2303 <div class=grey>
+ − 2304 <table class=headerdata>
+ − 2305 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2306 </table>
+ − 2307 </div>
+ − 2308 </section>
+ − 2309 </section>
+ − 2310
+ − 2311 <section class=match id=match35>
+ − 2312
+ − 2313 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 2314
+ − 2315 <section class=header>
+ − 2316
+ − 2317 <table class=headerdata>
+ − 2318 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2319 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2320 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2321 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2322 <tr><td class=param>Database:</td><td></td></tr>
+ − 2323 </table>
+ − 2324
+ − 2325 </section>
+ − 2326
+ − 2327 <section>
+ − 2328 <h2>No Hits</h2>
+ − 2329 <div class=grey>
+ − 2330 <table class=headerdata>
+ − 2331 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2332 </table>
+ − 2333 </div>
+ − 2334 </section>
+ − 2335 </section>
+ − 2336
+ − 2337 <section class=match id=match36>
+ − 2338
+ − 2339 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 2340
+ − 2341 <section class=header>
+ − 2342
+ − 2343 <table class=headerdata>
+ − 2344 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2345 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2346 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2347 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2348 <tr><td class=param>Database:</td><td></td></tr>
+ − 2349 </table>
+ − 2350
+ − 2351 </section>
+ − 2352
+ − 2353 <section>
+ − 2354 <h2>No Hits</h2>
+ − 2355 <div class=grey>
+ − 2356 <table class=headerdata>
+ − 2357 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2358 </table>
+ − 2359 </div>
+ − 2360 </section>
+ − 2361 </section>
+ − 2362
+ − 2363 <section class=match id=match37>
+ − 2364
+ − 2365 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 2366
+ − 2367 <section class=header>
+ − 2368
+ − 2369 <table class=headerdata>
+ − 2370 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2371 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2372 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2373 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2374 <tr><td class=param>Database:</td><td></td></tr>
+ − 2375 </table>
+ − 2376
+ − 2377 </section>
+ − 2378
+ − 2379 <section>
+ − 2380 <h2>No Hits</h2>
+ − 2381 <div class=grey>
+ − 2382 <table class=headerdata>
+ − 2383 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2384 </table>
+ − 2385 </div>
+ − 2386 </section>
+ − 2387 </section>
+ − 2388
+ − 2389 <section class=match id=match38>
+ − 2390
+ − 2391 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 2392
+ − 2393 <section class=header>
+ − 2394
+ − 2395 <table class=headerdata>
+ − 2396 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2397 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2398 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2399 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2400 <tr><td class=param>Database:</td><td></td></tr>
+ − 2401 </table>
+ − 2402
+ − 2403 </section>
+ − 2404
+ − 2405 <section>
+ − 2406 <h2>No Hits</h2>
+ − 2407 <div class=grey>
+ − 2408 <table class=headerdata>
+ − 2409 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2410 </table>
+ − 2411 </div>
+ − 2412 </section>
+ − 2413 </section>
+ − 2414
+ − 2415 <section class=match id=match39>
+ − 2416
+ − 2417 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 2418
+ − 2419 <section class=header>
+ − 2420
+ − 2421 <table class=headerdata>
+ − 2422 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2423 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2424 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2425 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2426 <tr><td class=param>Database:</td><td></td></tr>
+ − 2427 </table>
+ − 2428
+ − 2429 </section>
+ − 2430
+ − 2431 <section>
+ − 2432 <h2>No Hits</h2>
+ − 2433 <div class=grey>
+ − 2434 <table class=headerdata>
+ − 2435 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2436 </table>
+ − 2437 </div>
+ − 2438 </section>
+ − 2439 </section>
+ − 2440
+ − 2441 <section class=match id=match40>
+ − 2442
+ − 2443 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 2444
+ − 2445 <section class=header>
+ − 2446
+ − 2447 <table class=headerdata>
+ − 2448 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2449 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2450 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2451 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2452 <tr><td class=param>Database:</td><td></td></tr>
+ − 2453 </table>
+ − 2454
+ − 2455 </section>
+ − 2456
+ − 2457 <section>
+ − 2458 <h2>No Hits</h2>
+ − 2459 <div class=grey>
+ − 2460 <table class=headerdata>
+ − 2461 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2462 </table>
+ − 2463 </div>
+ − 2464 </section>
+ − 2465 </section>
+ − 2466
+ − 2467 <section class=match id=match41>
+ − 2468
+ − 2469 <h1>Nucleotide Sequence (25 letters)</h1>
+ − 2470
+ − 2471 <section class=header>
+ − 2472
+ − 2473 <table class=headerdata>
+ − 2474 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2475 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2476 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2477 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2478 <tr><td class=param>Database:</td><td></td></tr>
+ − 2479 </table>
+ − 2480
+ − 2481 </section>
+ − 2482
+ − 2483 <section>
+ − 2484 <h2>No Hits</h2>
+ − 2485 <div class=grey>
+ − 2486 <table class=headerdata>
+ − 2487 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2488 </table>
+ − 2489 </div>
+ − 2490 </section>
+ − 2491 </section>
+ − 2492
+ − 2493 <section class=match id=match42>
+ − 2494
+ − 2495 <h1>Nucleotide Sequence (25 letters)</h1>
+ − 2496
+ − 2497 <section class=header>
+ − 2498
+ − 2499 <table class=headerdata>
+ − 2500 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2501 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2502 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2503 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2504 <tr><td class=param>Database:</td><td></td></tr>
+ − 2505 </table>
+ − 2506
+ − 2507 </section>
+ − 2508
+ − 2509 <section>
+ − 2510 <h2>No Hits</h2>
+ − 2511 <div class=grey>
+ − 2512 <table class=headerdata>
+ − 2513 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2514 </table>
+ − 2515 </div>
+ − 2516 </section>
+ − 2517 </section>
+ − 2518
+ − 2519 <section class=match id=match43>
+ − 2520
+ − 2521 <h1>Nucleotide Sequence (25 letters)</h1>
+ − 2522
+ − 2523 <section class=header>
+ − 2524
+ − 2525 <table class=headerdata>
+ − 2526 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2527 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2528 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2529 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2530 <tr><td class=param>Database:</td><td></td></tr>
+ − 2531 </table>
+ − 2532
+ − 2533 </section>
+ − 2534
+ − 2535 <section>
+ − 2536 <h2>No Hits</h2>
+ − 2537 <div class=grey>
+ − 2538 <table class=headerdata>
+ − 2539 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2540 </table>
+ − 2541 </div>
+ − 2542 </section>
+ − 2543 </section>
+ − 2544
+ − 2545 <section class=match id=match44>
+ − 2546
+ − 2547 <h1>Nucleotide Sequence (25 letters)</h1>
+ − 2548
+ − 2549 <section class=header>
+ − 2550
+ − 2551 <table class=headerdata>
+ − 2552 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2553 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2554 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2555 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2556 <tr><td class=param>Database:</td><td></td></tr>
+ − 2557 </table>
+ − 2558
+ − 2559 </section>
+ − 2560
+ − 2561 <section>
+ − 2562 <h2>No Hits</h2>
+ − 2563 <div class=grey>
+ − 2564 <table class=headerdata>
+ − 2565 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2566 </table>
+ − 2567 </div>
+ − 2568 </section>
+ − 2569 </section>
+ − 2570
+ − 2571 <section class=match id=match45>
+ − 2572
+ − 2573 <h1>Nucleotide Sequence (25 letters)</h1>
+ − 2574
+ − 2575 <section class=header>
+ − 2576
+ − 2577 <table class=headerdata>
+ − 2578 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2579 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2580 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2581 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2582 <tr><td class=param>Database:</td><td></td></tr>
+ − 2583 </table>
+ − 2584
+ − 2585 </section>
+ − 2586
+ − 2587 <section>
+ − 2588 <h2>No Hits</h2>
+ − 2589 <div class=grey>
+ − 2590 <table class=headerdata>
+ − 2591 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2592 </table>
+ − 2593 </div>
+ − 2594 </section>
+ − 2595 </section>
+ − 2596
+ − 2597 <section class=match id=match46>
+ − 2598
+ − 2599 <h1>Nucleotide Sequence (25 letters)</h1>
+ − 2600
+ − 2601 <section class=header>
+ − 2602
+ − 2603 <table class=headerdata>
+ − 2604 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2605 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2606 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2607 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2608 <tr><td class=param>Database:</td><td></td></tr>
+ − 2609 </table>
+ − 2610
+ − 2611 </section>
+ − 2612
+ − 2613 <section>
+ − 2614 <h2>No Hits</h2>
+ − 2615 <div class=grey>
+ − 2616 <table class=headerdata>
+ − 2617 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 2618 </table>
+ − 2619 </div>
+ − 2620 </section>
+ − 2621 </section>
+ − 2622
+ − 2623 <section class=match id=match47>
+ − 2624
+ − 2625 <h1>Nucleotide Sequence (25 letters)</h1>
+ − 2626
+ − 2627 <section class=header>
+ − 2628
+ − 2629 <table class=headerdata>
+ − 2630 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2631 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2632 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2633 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2634 <tr><td class=param>Database:</td><td></td></tr>
+ − 2635 </table>
+ − 2636
+ − 2637 </section>
+ − 2638
+ − 2639
+ − 2640 <section class=graphics>
+ − 2641 <h2>Graphic Summary</h2>
+ − 2642
+ − 2643 <div class=grey>
+ − 2644 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+ − 2645
+ − 2646 <div class=defline id=defline47>
+ − 2647 Mouse-over to show defline and scores, click to show alignments
+ − 2648 </div>
+ − 2649
+ − 2650 <div class=graphic>
+ − 2651 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 2652 <div class=legend><div class=graphicrow>
+ − 2653 <div class=graphicitem style="background-color: black"><40</div>
+ − 2654 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 2655 <div class=graphicitem style="background-color: green">50–80</div>
+ − 2656 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 2657 <div class=graphicitem style="background-color: red">200≤</div>
+ − 2658 </div></div>
+ − 2659 <div style="clear: left"></div>
+ − 2660
+ − 2661 <div class=tablewrapper>
+ − 2662
+ − 2663 <div class=scale>
+ − 2664 <div>query:</div>
+ − 2665 <div class=graphicrow>
+ − 2666 <div>
+ − 2667 <div class=graphicitem style="width: 12.0%">
+ − 2668 <div>3</div>
+ − 2669 </div>
+ − 2670 <div class=graphicitem style="width: 12.0%">
+ − 2671 <div>6</div>
+ − 2672 </div>
+ − 2673 <div class=graphicitem style="width: 12.0%">
+ − 2674 <div>9</div>
+ − 2675 </div>
+ − 2676 <div class=graphicitem style="width: 12.0%">
+ − 2677 <div>12</div>
+ − 2678 </div>
+ − 2679 <div class=graphicitem style="width: 12.0%">
+ − 2680 <div>15</div>
+ − 2681 </div>
+ − 2682 <div class=graphicitem style="width: 12.0%">
+ − 2683 <div>18</div>
+ − 2684 </div>
+ − 2685 <div class=graphicitem style="width: 12.0%">
+ − 2686 <div>21</div>
+ − 2687 </div>
+ − 2688 <div class=graphicitem style="width: 12.0%">
+ − 2689 <div>24</div>
+ − 2690 </div>
+ − 2691 <div class=graphicitem style="width: 4.0%">
+ − 2692 <div>25</div>
+ − 2693 </div>
+ − 2694 </div>
+ − 2695 </div>
+ − 2696 <div style="clear: left"></div>
+ − 2697 </div>
+ − 2698
+ − 2699 <a class=matchresult
+ − 2700 href="#hit1"
+ − 2701 onmouseover='document.getElementById("defline47").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+ − 2702 onmouseout='document.getElementById("defline47").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 2703 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+ − 2704 <div class="matchrow graphicrow">
+ − 2705 <div class="matchitem graphicitem"
+ − 2706 style="background-color: black; width: 100.0%"></div>
+ − 2707 </div>
+ − 2708 </a>
+ − 2709
+ − 2710 </div>
+ − 2711 </div>
+ − 2712 </div>
+ − 2713 </section>
+ − 2714
+ − 2715
+ − 2716
+ − 2717 <section class=descriptions>
+ − 2718 <h2>Descriptions</h2>
+ − 2719
+ − 2720 <div class=grey><div class=white>
+ − 2721 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 2722
+ − 2723 <table class=descriptiontable>
+ − 2724 <col/><col/><col/><col/><col/><col/><col/>
+ − 2725 <tr>
+ − 2726 <th>Description</th>
+ − 2727 <th>Max score</th>
+ − 2728 <th>Total score</th>
+ − 2729 <th>Query cover</th>
+ − 2730 <th>E value</th>
+ − 2731 <th>Ident</th>
+ − 2732 <th>Accession</th>
+ − 2733 </tr>
+ − 2734 <tr>
+ − 2735 <td><div><a href="#hit1"
+ − 2736 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+ − 2737 id="description1">
+ − 2738 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+ − 2739 </a></div></td>
+ − 2740 <td>37.4</td>
+ − 2741 <td>37.4</td>
+ − 2742 <td>100%</td>
+ − 2743 <td>9.338e-08</td>
+ − 2744 <td>92%</td>
+ − 2745 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a></td>
+ − 2746 </tr>
+ − 2747 </table>
+ − 2748
+ − 2749 </div></div>
+ − 2750 </section>
+ − 2751
+ − 2752
+ − 2753
+ − 2754 <section class=alignments>
+ − 2755 <h2>Alignments</h2>
+ − 2756
+ − 2757 <div class=grey><div class=white>
+ − 2758 <div class=alignment id=hit1>
+ − 2759
+ − 2760 <div class=linkheader>
+ − 2761 <div class=right><a href="#description1">Descriptions</a></div>
+ − 2762 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">GenBank</a>
+ − 2763 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&log$=nuclalign">Graphics</a>
+ − 2764 </div>
+ − 2765
+ − 2766 <div class=title>
+ − 2767 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+ − 2768 <p class=titleinfo>
+ − 2769 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a>
+ − 2770 <span class=b>Length:</span> 4180
+ − 2771 <span class=b>Number of Matches:</span> 1
+ − 2772 </p>
+ − 2773 </div>
+ − 2774
+ − 2775
+ − 2776 <div class=hotspot>
+ − 2777 <p class=range>
+ − 2778 <span class=range>Range 1: 1541 to 1565</span>
+ − 2779 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign&from=1541&to=1565">GenBank</a>
+ − 2780 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&log$=nuclalign&from=1541&to=1565">Graphics</a>
+ − 2781 </p>
+ − 2782
+ − 2783 <table class=hotspotstable>
+ − 2784 <tr>
+ − 2785 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 2786 </tr>
+ − 2787 <tr>
+ − 2788 <td>37.4 bits(40)</td>
+ − 2789 <td>0.0</td>
+ − 2790 <td>23/25(92%)</td>
+ − 2791 <td>0/25(0%)</td>
+ − 2792 <td>Plus/Plus</td>
+ − 2793 </tr>
+ − 2794 </table>
+ − 2795
+ − 2796 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25
+ − 2797 |||||||||||||| ||||||| ||
+ − 2798 Subject 1541 ACATGAACAGCGCCCTGACCACCGC 1565</pre>
+ − 2799 </div>
+ − 2800
+ − 2801 </div>
+ − 2802
+ − 2803 </div></div>
+ − 2804 </section>
+ − 2805 </section>
+ − 2806
+ − 2807 <section class=match id=match48>
+ − 2808
+ − 2809 <h1>Nucleotide Sequence (25 letters)</h1>
+ − 2810
+ − 2811 <section class=header>
+ − 2812
+ − 2813 <table class=headerdata>
+ − 2814 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2815 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 2816 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 2817 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 2818 <tr><td class=param>Database:</td><td></td></tr>
+ − 2819 </table>
+ − 2820
+ − 2821 </section>
+ − 2822
+ − 2823
+ − 2824 <section class=graphics>
+ − 2825 <h2>Graphic Summary</h2>
+ − 2826
+ − 2827 <div class=grey>
+ − 2828 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+ − 2829
+ − 2830 <div class=defline id=defline48>
+ − 2831 Mouse-over to show defline and scores, click to show alignments
+ − 2832 </div>
+ − 2833
+ − 2834 <div class=graphic>
+ − 2835 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 2836 <div class=legend><div class=graphicrow>
+ − 2837 <div class=graphicitem style="background-color: black"><40</div>
+ − 2838 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 2839 <div class=graphicitem style="background-color: green">50–80</div>
+ − 2840 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 2841 <div class=graphicitem style="background-color: red">200≤</div>
+ − 2842 </div></div>
+ − 2843 <div style="clear: left"></div>
+ − 2844
+ − 2845 <div class=tablewrapper>
+ − 2846
+ − 2847 <div class=scale>
+ − 2848 <div>query:</div>
+ − 2849 <div class=graphicrow>
+ − 2850 <div>
+ − 2851 <div class=graphicitem style="width: 12.0%">
+ − 2852 <div>3</div>
+ − 2853 </div>
+ − 2854 <div class=graphicitem style="width: 12.0%">
+ − 2855 <div>6</div>
+ − 2856 </div>
+ − 2857 <div class=graphicitem style="width: 12.0%">
+ − 2858 <div>9</div>
+ − 2859 </div>
+ − 2860 <div class=graphicitem style="width: 12.0%">
+ − 2861 <div>12</div>
+ − 2862 </div>
+ − 2863 <div class=graphicitem style="width: 12.0%">
+ − 2864 <div>15</div>
+ − 2865 </div>
+ − 2866 <div class=graphicitem style="width: 12.0%">
+ − 2867 <div>18</div>
+ − 2868 </div>
+ − 2869 <div class=graphicitem style="width: 12.0%">
+ − 2870 <div>21</div>
+ − 2871 </div>
+ − 2872 <div class=graphicitem style="width: 12.0%">
+ − 2873 <div>24</div>
+ − 2874 </div>
+ − 2875 <div class=graphicitem style="width: 4.0%">
+ − 2876 <div>25</div>
+ − 2877 </div>
+ − 2878 </div>
+ − 2879 </div>
+ − 2880 <div style="clear: left"></div>
+ − 2881 </div>
+ − 2882
+ − 2883 <a class=matchresult
+ − 2884 href="#hit1"
+ − 2885 onmouseover='document.getElementById("defline48").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+ − 2886 onmouseout='document.getElementById("defline48").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 2887 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+ − 2888 <div class="matchrow graphicrow">
+ − 2889 <div class="matchitem graphicitem"
+ − 2890 style="background-color: black; width: 100.0%"></div>
+ − 2891 </div>
+ − 2892 </a>
+ − 2893
+ − 2894 </div>
+ − 2895 </div>
+ − 2896 </div>
+ − 2897 </section>
+ − 2898
+ − 2899
+ − 2900
+ − 2901 <section class=descriptions>
+ − 2902 <h2>Descriptions</h2>
+ − 2903
+ − 2904 <div class=grey><div class=white>
+ − 2905 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 2906
+ − 2907 <table class=descriptiontable>
+ − 2908 <col/><col/><col/><col/><col/><col/><col/>
+ − 2909 <tr>
+ − 2910 <th>Description</th>
+ − 2911 <th>Max score</th>
+ − 2912 <th>Total score</th>
+ − 2913 <th>Query cover</th>
+ − 2914 <th>E value</th>
+ − 2915 <th>Ident</th>
+ − 2916 <th>Accession</th>
+ − 2917 </tr>
+ − 2918 <tr>
+ − 2919 <td><div><a href="#hit1"
+ − 2920 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+ − 2921 id="description1">
+ − 2922 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+ − 2923 </a></div></td>
+ − 2924 <td>37.4</td>
+ − 2925 <td>37.4</td>
+ − 2926 <td>100%</td>
+ − 2927 <td>9.338e-08</td>
+ − 2928 <td>92%</td>
+ − 2929 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a></td>
+ − 2930 </tr>
+ − 2931 </table>
+ − 2932
+ − 2933 </div></div>
+ − 2934 </section>
+ − 2935
+ − 2936
+ − 2937
+ − 2938 <section class=alignments>
+ − 2939 <h2>Alignments</h2>
+ − 2940
+ − 2941 <div class=grey><div class=white>
+ − 2942 <div class=alignment id=hit1>
+ − 2943
+ − 2944 <div class=linkheader>
+ − 2945 <div class=right><a href="#description1">Descriptions</a></div>
+ − 2946 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">GenBank</a>
+ − 2947 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&log$=nuclalign">Graphics</a>
+ − 2948 </div>
+ − 2949
+ − 2950 <div class=title>
+ − 2951 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+ − 2952 <p class=titleinfo>
+ − 2953 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a>
+ − 2954 <span class=b>Length:</span> 4983
+ − 2955 <span class=b>Number of Matches:</span> 1
+ − 2956 </p>
+ − 2957 </div>
+ − 2958
+ − 2959
+ − 2960 <div class=hotspot>
+ − 2961 <p class=range>
+ − 2962 <span class=range>Range 1: 2344 to 2368</span>
+ − 2963 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign&from=2344&to=2368">GenBank</a>
+ − 2964 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&log$=nuclalign&from=2344&to=2368">Graphics</a>
+ − 2965 </p>
+ − 2966
+ − 2967 <table class=hotspotstable>
+ − 2968 <tr>
+ − 2969 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 2970 </tr>
+ − 2971 <tr>
+ − 2972 <td>37.4 bits(40)</td>
+ − 2973 <td>0.0</td>
+ − 2974 <td>23/25(92%)</td>
+ − 2975 <td>0/25(0%)</td>
+ − 2976 <td>Plus/Plus</td>
+ − 2977 </tr>
+ − 2978 </table>
+ − 2979
+ − 2980 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25
+ − 2981 |||||||||||||| ||||||| ||
+ − 2982 Subject 2344 ACATGAACAGCGCCCTGACCACCGC 2368</pre>
+ − 2983 </div>
+ − 2984
+ − 2985 </div>
+ − 2986
+ − 2987 </div></div>
+ − 2988 </section>
+ − 2989 </section>
+ − 2990
+ − 2991 <section class=match id=match49>
+ − 2992
+ − 2993 <h1>Nucleotide Sequence (74 letters)</h1>
+ − 2994
+ − 2995 <section class=header>
+ − 2996
+ − 2997 <table class=headerdata>
+ − 2998 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 2999 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 3000 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 3001 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 3002 <tr><td class=param>Database:</td><td></td></tr>
+ − 3003 </table>
+ − 3004
+ − 3005 </section>
+ − 3006
+ − 3007 <section>
+ − 3008 <h2>No Hits</h2>
+ − 3009 <div class=grey>
+ − 3010 <table class=headerdata>
+ − 3011 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 3012 </table>
+ − 3013 </div>
+ − 3014 </section>
+ − 3015 </section>
+ − 3016
+ − 3017 <section class=match id=match50>
+ − 3018
+ − 3019 <h1>Nucleotide Sequence (74 letters)</h1>
+ − 3020
+ − 3021 <section class=header>
+ − 3022
+ − 3023 <table class=headerdata>
+ − 3024 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 3025 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 3026 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 3027 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 3028 <tr><td class=param>Database:</td><td></td></tr>
+ − 3029 </table>
+ − 3030
+ − 3031 </section>
+ − 3032
+ − 3033 <section>
+ − 3034 <h2>No Hits</h2>
+ − 3035 <div class=grey>
+ − 3036 <table class=headerdata>
+ − 3037 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 3038 </table>
+ − 3039 </div>
+ − 3040 </section>
+ − 3041 </section>
+ − 3042
+ − 3043 <section class=match id=match51>
+ − 3044
+ − 3045 <h1>Nucleotide Sequence (74 letters)</h1>
+ − 3046
+ − 3047 <section class=header>
+ − 3048
+ − 3049 <table class=headerdata>
+ − 3050 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 3051 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 3052 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 3053 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 3054 <tr><td class=param>Database:</td><td></td></tr>
+ − 3055 </table>
+ − 3056
+ − 3057 </section>
+ − 3058
+ − 3059 <section>
+ − 3060 <h2>No Hits</h2>
+ − 3061 <div class=grey>
+ − 3062 <table class=headerdata>
+ − 3063 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 3064 </table>
+ − 3065 </div>
+ − 3066 </section>
+ − 3067 </section>
+ − 3068
+ − 3069 <section class=match id=match52>
+ − 3070
+ − 3071 <h1>Nucleotide Sequence (74 letters)</h1>
+ − 3072
+ − 3073 <section class=header>
+ − 3074
+ − 3075 <table class=headerdata>
+ − 3076 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 3077 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 3078 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 3079 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 3080 <tr><td class=param>Database:</td><td></td></tr>
+ − 3081 </table>
+ − 3082
+ − 3083 </section>
+ − 3084
+ − 3085 <section>
+ − 3086 <h2>No Hits</h2>
+ − 3087 <div class=grey>
+ − 3088 <table class=headerdata>
+ − 3089 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 3090 </table>
+ − 3091 </div>
+ − 3092 </section>
+ − 3093 </section>
+ − 3094
+ − 3095 <section class=match id=match53>
+ − 3096
+ − 3097 <h1>Nucleotide Sequence (74 letters)</h1>
+ − 3098
+ − 3099 <section class=header>
+ − 3100
+ − 3101 <table class=headerdata>
+ − 3102 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 3103 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 3104 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 3105 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 3106 <tr><td class=param>Database:</td><td></td></tr>
+ − 3107 </table>
+ − 3108
+ − 3109 </section>
+ − 3110
+ − 3111 <section>
+ − 3112 <h2>No Hits</h2>
+ − 3113 <div class=grey>
+ − 3114 <table class=headerdata>
+ − 3115 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 3116 </table>
+ − 3117 </div>
+ − 3118 </section>
+ − 3119 </section>
+ − 3120
+ − 3121 <section class=match id=match54>
+ − 3122
+ − 3123 <h1>Nucleotide Sequence (74 letters)</h1>
+ − 3124
+ − 3125 <section class=header>
+ − 3126
+ − 3127 <table class=headerdata>
+ − 3128 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 3129 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 3130 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 3131 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 3132 <tr><td class=param>Database:</td><td></td></tr>
+ − 3133 </table>
+ − 3134
+ − 3135 </section>
+ − 3136
+ − 3137 <section>
+ − 3138 <h2>No Hits</h2>
+ − 3139 <div class=grey>
+ − 3140 <table class=headerdata>
+ − 3141 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 3142 </table>
+ − 3143 </div>
+ − 3144 </section>
+ − 3145 </section>
+ − 3146
+ − 3147 <section class=match id=match55>
+ − 3148
+ − 3149 <h1>Nucleotide Sequence (74 letters)</h1>
+ − 3150
+ − 3151 <section class=header>
+ − 3152
+ − 3153 <table class=headerdata>
+ − 3154 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 3155 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 3156 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 3157 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 3158 <tr><td class=param>Database:</td><td></td></tr>
+ − 3159 </table>
+ − 3160
+ − 3161 </section>
+ − 3162
+ − 3163
+ − 3164 <section class=graphics>
+ − 3165 <h2>Graphic Summary</h2>
+ − 3166
+ − 3167 <div class=grey>
+ − 3168 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+ − 3169
+ − 3170 <div class=defline id=defline55>
+ − 3171 Mouse-over to show defline and scores, click to show alignments
+ − 3172 </div>
+ − 3173
+ − 3174 <div class=graphic>
+ − 3175 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 3176 <div class=legend><div class=graphicrow>
+ − 3177 <div class=graphicitem style="background-color: black"><40</div>
+ − 3178 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 3179 <div class=graphicitem style="background-color: green">50–80</div>
+ − 3180 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 3181 <div class=graphicitem style="background-color: red">200≤</div>
+ − 3182 </div></div>
+ − 3183 <div style="clear: left"></div>
+ − 3184
+ − 3185 <div class=tablewrapper>
+ − 3186
+ − 3187 <div class=scale>
+ − 3188 <div>query:</div>
+ − 3189 <div class=graphicrow>
+ − 3190 <div>
+ − 3191 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3192 <div>8</div>
+ − 3193 </div>
+ − 3194 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3195 <div>16</div>
+ − 3196 </div>
+ − 3197 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3198 <div>24</div>
+ − 3199 </div>
+ − 3200 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3201 <div>32</div>
+ − 3202 </div>
+ − 3203 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3204 <div>40</div>
+ − 3205 </div>
+ − 3206 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3207 <div>48</div>
+ − 3208 </div>
+ − 3209 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3210 <div>56</div>
+ − 3211 </div>
+ − 3212 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3213 <div>64</div>
+ − 3214 </div>
+ − 3215 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3216 <div>72</div>
+ − 3217 </div>
+ − 3218 <div class=graphicitem style="width: 2.7027027027027026%">
+ − 3219 <div> </div>
+ − 3220 <div class=lastlabel>74</div>
+ − 3221 </div>
+ − 3222 </div>
+ − 3223 </div>
+ − 3224 <div style="clear: left"></div>
+ − 3225 </div>
+ − 3226
+ − 3227 <a class=matchresult
+ − 3228 href="#hit1"
+ − 3229 onmouseover='document.getElementById("defline55").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+ − 3230 onmouseout='document.getElementById("defline55").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 3231 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+ − 3232 <div class="matchrow graphicrow">
+ − 3233 <div class="matchitem graphicitem"
+ − 3234 style="background-color: green; width: 100.0%"></div>
+ − 3235 </div>
+ − 3236 </a>
+ − 3237
+ − 3238 </div>
+ − 3239 </div>
+ − 3240 </div>
+ − 3241 </section>
+ − 3242
+ − 3243
+ − 3244
+ − 3245 <section class=descriptions>
+ − 3246 <h2>Descriptions</h2>
+ − 3247
+ − 3248 <div class=grey><div class=white>
+ − 3249 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 3250
+ − 3251 <table class=descriptiontable>
+ − 3252 <col/><col/><col/><col/><col/><col/><col/>
+ − 3253 <tr>
+ − 3254 <th>Description</th>
+ − 3255 <th>Max score</th>
+ − 3256 <th>Total score</th>
+ − 3257 <th>Query cover</th>
+ − 3258 <th>E value</th>
+ − 3259 <th>Ident</th>
+ − 3260 <th>Accession</th>
+ − 3261 </tr>
+ − 3262 <tr>
+ − 3263 <td><div><a href="#hit1"
+ − 3264 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+ − 3265 id="description1">
+ − 3266 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+ − 3267 </a></div></td>
+ − 3268 <td>89.7</td>
+ − 3269 <td>89.7</td>
+ − 3270 <td>100%</td>
+ − 3271 <td>6.629e-23</td>
+ − 3272 <td>86%</td>
+ − 3273 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a></td>
+ − 3274 </tr>
+ − 3275 </table>
+ − 3276
+ − 3277 </div></div>
+ − 3278 </section>
+ − 3279
+ − 3280
+ − 3281
+ − 3282 <section class=alignments>
+ − 3283 <h2>Alignments</h2>
+ − 3284
+ − 3285 <div class=grey><div class=white>
+ − 3286 <div class=alignment id=hit1>
+ − 3287
+ − 3288 <div class=linkheader>
+ − 3289 <div class=right><a href="#description1">Descriptions</a></div>
+ − 3290 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">GenBank</a>
+ − 3291 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&log$=nuclalign">Graphics</a>
+ − 3292 </div>
+ − 3293
+ − 3294 <div class=title>
+ − 3295 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+ − 3296 <p class=titleinfo>
+ − 3297 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a>
+ − 3298 <span class=b>Length:</span> 4180
+ − 3299 <span class=b>Number of Matches:</span> 1
+ − 3300 </p>
+ − 3301 </div>
+ − 3302
+ − 3303
+ − 3304 <div class=hotspot>
+ − 3305 <p class=range>
+ − 3306 <span class=range>Range 1: 1516 to 1589</span>
+ − 3307 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign&from=1516&to=1589">GenBank</a>
+ − 3308 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&log$=nuclalign&from=1516&to=1589">Graphics</a>
+ − 3309 </p>
+ − 3310
+ − 3311 <table class=hotspotstable>
+ − 3312 <tr>
+ − 3313 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 3314 </tr>
+ − 3315 <tr>
+ − 3316 <td>89.7 bits(98)</td>
+ − 3317 <td>0.0</td>
+ − 3318 <td>64/74(86%)</td>
+ − 3319 <td>0/74(0%)</td>
+ − 3320 <td>Plus/Plus</td>
+ − 3321 </tr>
+ − 3322 </table>
+ − 3323
+ − 3324 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA 74
+ − 3325 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||
+ − 3326 Subject 1516 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA 1589</pre>
+ − 3327 </div>
+ − 3328
+ − 3329 </div>
+ − 3330
+ − 3331 </div></div>
+ − 3332 </section>
+ − 3333 </section>
+ − 3334
+ − 3335 <section class=match id=match56>
+ − 3336
+ − 3337 <h1>Nucleotide Sequence (74 letters)</h1>
+ − 3338
+ − 3339 <section class=header>
+ − 3340
+ − 3341 <table class=headerdata>
+ − 3342 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 3343 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 3344 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 3345 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 3346 <tr><td class=param>Database:</td><td></td></tr>
+ − 3347 </table>
+ − 3348
+ − 3349 </section>
+ − 3350
+ − 3351
+ − 3352 <section class=graphics>
+ − 3353 <h2>Graphic Summary</h2>
+ − 3354
+ − 3355 <div class=grey>
+ − 3356 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+ − 3357
+ − 3358 <div class=defline id=defline56>
+ − 3359 Mouse-over to show defline and scores, click to show alignments
+ − 3360 </div>
+ − 3361
+ − 3362 <div class=graphic>
+ − 3363 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 3364 <div class=legend><div class=graphicrow>
+ − 3365 <div class=graphicitem style="background-color: black"><40</div>
+ − 3366 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 3367 <div class=graphicitem style="background-color: green">50–80</div>
+ − 3368 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 3369 <div class=graphicitem style="background-color: red">200≤</div>
+ − 3370 </div></div>
+ − 3371 <div style="clear: left"></div>
+ − 3372
+ − 3373 <div class=tablewrapper>
+ − 3374
+ − 3375 <div class=scale>
+ − 3376 <div>query:</div>
+ − 3377 <div class=graphicrow>
+ − 3378 <div>
+ − 3379 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3380 <div>8</div>
+ − 3381 </div>
+ − 3382 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3383 <div>16</div>
+ − 3384 </div>
+ − 3385 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3386 <div>24</div>
+ − 3387 </div>
+ − 3388 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3389 <div>32</div>
+ − 3390 </div>
+ − 3391 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3392 <div>40</div>
+ − 3393 </div>
+ − 3394 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3395 <div>48</div>
+ − 3396 </div>
+ − 3397 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3398 <div>56</div>
+ − 3399 </div>
+ − 3400 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3401 <div>64</div>
+ − 3402 </div>
+ − 3403 <div class=graphicitem style="width: 10.81081081081081%">
+ − 3404 <div>72</div>
+ − 3405 </div>
+ − 3406 <div class=graphicitem style="width: 2.7027027027027026%">
+ − 3407 <div> </div>
+ − 3408 <div class=lastlabel>74</div>
+ − 3409 </div>
+ − 3410 </div>
+ − 3411 </div>
+ − 3412 <div style="clear: left"></div>
+ − 3413 </div>
+ − 3414
+ − 3415 <a class=matchresult
+ − 3416 href="#hit1"
+ − 3417 onmouseover='document.getElementById("defline56").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+ − 3418 onmouseout='document.getElementById("defline56").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 3419 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+ − 3420 <div class="matchrow graphicrow">
+ − 3421 <div class="matchitem graphicitem"
+ − 3422 style="background-color: green; width: 100.0%"></div>
+ − 3423 </div>
+ − 3424 </a>
+ − 3425
+ − 3426 </div>
+ − 3427 </div>
+ − 3428 </div>
+ − 3429 </section>
+ − 3430
+ − 3431
+ − 3432
+ − 3433 <section class=descriptions>
+ − 3434 <h2>Descriptions</h2>
+ − 3435
+ − 3436 <div class=grey><div class=white>
+ − 3437 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 3438
+ − 3439 <table class=descriptiontable>
+ − 3440 <col/><col/><col/><col/><col/><col/><col/>
+ − 3441 <tr>
+ − 3442 <th>Description</th>
+ − 3443 <th>Max score</th>
+ − 3444 <th>Total score</th>
+ − 3445 <th>Query cover</th>
+ − 3446 <th>E value</th>
+ − 3447 <th>Ident</th>
+ − 3448 <th>Accession</th>
+ − 3449 </tr>
+ − 3450 <tr>
+ − 3451 <td><div><a href="#hit1"
+ − 3452 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+ − 3453 id="description1">
+ − 3454 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+ − 3455 </a></div></td>
+ − 3456 <td>89.7</td>
+ − 3457 <td>89.7</td>
+ − 3458 <td>100%</td>
+ − 3459 <td>6.629e-23</td>
+ − 3460 <td>86%</td>
+ − 3461 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a></td>
+ − 3462 </tr>
+ − 3463 </table>
+ − 3464
+ − 3465 </div></div>
+ − 3466 </section>
+ − 3467
+ − 3468
+ − 3469
+ − 3470 <section class=alignments>
+ − 3471 <h2>Alignments</h2>
+ − 3472
+ − 3473 <div class=grey><div class=white>
+ − 3474 <div class=alignment id=hit1>
+ − 3475
+ − 3476 <div class=linkheader>
+ − 3477 <div class=right><a href="#description1">Descriptions</a></div>
+ − 3478 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">GenBank</a>
+ − 3479 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&log$=nuclalign">Graphics</a>
+ − 3480 </div>
+ − 3481
+ − 3482 <div class=title>
+ − 3483 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+ − 3484 <p class=titleinfo>
+ − 3485 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a>
+ − 3486 <span class=b>Length:</span> 4983
+ − 3487 <span class=b>Number of Matches:</span> 1
+ − 3488 </p>
+ − 3489 </div>
+ − 3490
+ − 3491
+ − 3492 <div class=hotspot>
+ − 3493 <p class=range>
+ − 3494 <span class=range>Range 1: 2319 to 2392</span>
+ − 3495 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign&from=2319&to=2392">GenBank</a>
+ − 3496 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&log$=nuclalign&from=2319&to=2392">Graphics</a>
+ − 3497 </p>
+ − 3498
+ − 3499 <table class=hotspotstable>
+ − 3500 <tr>
+ − 3501 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 3502 </tr>
+ − 3503 <tr>
+ − 3504 <td>89.7 bits(98)</td>
+ − 3505 <td>0.0</td>
+ − 3506 <td>64/74(86%)</td>
+ − 3507 <td>0/74(0%)</td>
+ − 3508 <td>Plus/Plus</td>
+ − 3509 </tr>
+ − 3510 </table>
+ − 3511
+ − 3512 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA 74
+ − 3513 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||
+ − 3514 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA 2392</pre>
+ − 3515 </div>
+ − 3516
+ − 3517 </div>
+ − 3518
+ − 3519 </div></div>
+ − 3520 </section>
+ − 3521 </section>
+ − 3522
+ − 3523 </div>
+ − 3524
+ − 3525 <footer>
+ − 3526 This page was generated by <a href="...">blast2html</a>.
+ − 3527 </footer>
+ − 3528 </body>
+ − 3529 </html>
+ − 3530
