7
|
1 <tool id="gsnap" name="GSNAP" version="2.0.0">
|
|
2 <description>Genomic Short-read Nucleotide Alignment Program</description>
|
|
3 <requirements>
|
|
4 <requirement type="binary">gsnap</requirement>
|
|
5 <!-- proposed tag for added datatype dependencies -->
|
|
6 <requirement type="datatype">gmapdb</requirement>
|
|
7 <requirement type="datatype">gmapsnpindex</requirement>
|
|
8 <requirement type="datatype">splicesites.iit</requirement>
|
|
9 <requirement type="datatype">introns.iit</requirement>
|
|
10 </requirements>
|
|
11 <version_string>gsnap --version</version_string>
|
|
12 <command>
|
|
13 #import os.path, re
|
|
14 gsnap
|
|
15 --nthreads="4" --ordered
|
|
16 #if $refGenomeSource.genomeSource == "gmapdb":
|
|
17 #set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0]
|
|
18 --dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name
|
|
19 #else:
|
|
20 --dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value)
|
|
21 #end if
|
|
22 #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2:
|
|
23 --kmer=$refGenomeSource.kmer
|
|
24 #end if
|
|
25 #if $refGenomeSource.use_splicing.src == 'gmapdb':
|
|
26 #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0:
|
|
27 -s $refGenomeSource.use_splicing.splicemap.value
|
|
28 #end if
|
|
29 #elif $refGenomeSource.use_splicing.src == 'history':
|
|
30 #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0:
|
|
31 -S $os.path.dirname($refGenomeSource.use_splicing.splicemap) -s $os.path.basename($refGenomeSource.use_splicing.splicemap)
|
|
32 #end if
|
|
33 #end if
|
|
34 #if $refGenomeSource.use_snps.src == 'gmapdb':
|
|
35 #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0:
|
|
36 -v $refGenomeSource.use_snps.snpindex.value
|
|
37 #end if
|
|
38 #elif $refGenomeSource.use_snps.src == 'history':
|
|
39 #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0:
|
|
40 -V $refGenomeSource.use_snps.snpindex.extra_files_path -v $refGenomeSource.use_snps.snpindex.metadata.snps_name
|
|
41 #end if
|
|
42 #end if
|
|
43 #if $refGenomeSource.mode.__str__ != '':
|
|
44 --mode=$refGenomeSource.mode
|
|
45 #end if
|
|
46 #if $mapq_unique_score.__str__ != '':
|
|
47 --mapq-unique-score=$mapq_unique_score
|
|
48 #end if
|
|
49 #if $computation.options == "advanced":
|
|
50 #if $computation.max_mismatches.__str__ != '':
|
|
51 --max-mismatches=$computation.max_mismatches
|
|
52 #end if
|
|
53 $computation.query_unk_mismatch
|
|
54 $computation.genome_unk_mismatch
|
|
55 #if $computation.terminal_threshold.__str__ != '':
|
|
56 --terminal-threshold=$computation.terminal_threshold
|
|
57 #end if
|
|
58 #if $computation.indel_penalty.__str__ != '':
|
|
59 --indel-penalty=$computation.indel_penalty
|
|
60 #end if
|
|
61 #if $computation.indel_endlength.__str__ != '':
|
|
62 --indel-endlength=$computation.indel_endlength
|
|
63 #end if
|
|
64 #if $computation.max_middle_insertions.__str__ != '':
|
|
65 --max-middle-insertions=$computation.max_middle_insertions
|
|
66 #end if
|
|
67 #if $computation.max_middle_deletions.__str__ != '':
|
|
68 --max-middle-deletions=$computation.max_middle_deletions
|
|
69 #end if
|
|
70 #if $computation.max_end_insertions.__str__ != '':
|
|
71 --max-end-insertions=$computation.max_end_insertions
|
|
72 #end if
|
|
73 #if $computation.max_end_deletions.__str__ != '':
|
|
74 --max-end-deletions=$computation.max_end_deletions
|
|
75 #end if
|
|
76 #if $computation.suboptimal_levels.__str__ != '':
|
|
77 --suboptimal-levels=$computation.suboptimal_levels
|
|
78 #end if
|
|
79 #if $computation.adapter_strip.__str__ != '':
|
|
80 --adapter-strip=$computation.adapter_strip
|
|
81 #end if
|
|
82 #if $computation.trim_mismatch_score.__str__ != '':
|
|
83 --trim-mismatch-score=$computation.trim_mismatch_score
|
|
84 #end if
|
|
85 ## TODO - do we need these options (Is it tally XOR runlength?):
|
|
86 ## --tallydir= --use-tally=tally
|
|
87 ## --runlengthdir --use-runlength=runlength
|
|
88 #if $computation.use_tally != None and len($computation.use_tally.__str__) > 0:
|
|
89 ##--tallydir $os.path.dirname($computation.use_tally) --use-tally $os.path.basename($computation.use_tally)
|
|
90 --use-tally=$computation.use_tally
|
|
91 #end if
|
|
92 ## gmap options
|
|
93 #if $computation.gmap_mode.__str__ != '' and $computation.gmap_mode.__str__ != 'None':
|
|
94 --gmap-mode='$computation.gmap_mode'
|
|
95 #end if
|
|
96 #if $computation.trigger_score_for_gmap.__str__ != '':
|
|
97 --trigger-score-for-gmap=$computation.trigger_score_for_gmap
|
|
98 #end if
|
|
99 #if $computation.max_gmap_pairsearch.__str__ != '' and $re.search("pairsearch",$computation.gmap_mode):
|
|
100 --max-gmap-pairsearch=$computation.max_gmap_pairsearch
|
|
101 #end if
|
|
102 #if $computation.max_gmap_terminal.__str__ != '' and $re.search("terminal",$computation.gmap_mode):
|
|
103 --max-gmap-terminal=$computation.max_gmap_terminal
|
|
104 #end if
|
|
105 #if $computation.max_gmap_improvement.__str__ != '' and $re.search("improv",$computation.gmap_mode):
|
|
106 --max-gmap-improvement=$computation.max_gmap_improvement
|
|
107 #end if
|
|
108 #if $computation.microexon_spliceprob.__str__ != '':
|
|
109 --microexon-spliceprob=$computation.microexon_spliceprob
|
|
110 #end if
|
|
111 #end if
|
|
112 #if $splicing.options == "advanced":
|
|
113 $splicing.novelsplicing
|
|
114 #if $splicing.localsplicedist.__str__ != '':
|
|
115 --localsplicedist=$splicing.localsplicedist
|
|
116 #end if
|
|
117 #if $splicing.local_splice_penalty.__str__ != '':
|
|
118 --local-splice-penalty=$splicing.local_splice_penalty
|
|
119 #end if
|
|
120 #if $splicing.distant_splice_penalty.__str__ != '':
|
|
121 --distant-splice-penalty=$splicing.distant_splice_penalty
|
|
122 #end if
|
|
123 #if $splicing.local_splice_endlength.__str__ != '':
|
|
124 --local-splice-endlength=$splicing.local_splice_endlength
|
|
125 #end if
|
|
126 #if $splicing.distant_splice_endlength.__str__ != '':
|
|
127 --distant-splice-endlength=$splicing.distant_splice_endlength
|
|
128 #end if
|
|
129 #if $splicing.distant_splice_identity.__str__ != '':
|
|
130 --distant-splice-identity=$splicing.distant_splice_identity
|
|
131 #end if
|
|
132 #end if
|
|
133 #if $output.options == "advanced":
|
|
134 #if $output.npath.__str__ != '':
|
|
135 --npath=$output.npath
|
|
136 #end if
|
|
137 $output.quiet_if_excessive
|
|
138 $output.show_refdiff
|
|
139 $output.clip_overlap
|
|
140 #end if
|
|
141 #if $result.format == "sam":
|
|
142 --format=sam
|
|
143 $result.no_sam_headers
|
|
144 #if $result.read_group_id.__str__.strip != '':
|
|
145 --read-group-id='$result.read_group_id'
|
|
146 #end if
|
|
147 #if $result.read_group_name.__str__ != '':
|
|
148 --read-group-name='$result.read_group_name'
|
|
149 #end if
|
|
150 #if $result.read_group_library.__str__ != '':
|
|
151 --read-group-library='$result.read_group_library'
|
|
152 #end if
|
|
153 #if $result.read_group_platform.__str__ != '':
|
|
154 --read-group-platform='$result.read_group_platform'
|
|
155 #end if
|
|
156 #if $result.quality_shift.__str__ != '':
|
|
157 --quality-shift=$result.quality_shift
|
|
158 #end if
|
|
159 #elif $result.format == "goby":
|
|
160 #if $result.goby_output.__str__ != '':
|
|
161 --goby-output='$result.goby_output'
|
|
162 #end if
|
|
163 #if $result.creads_window_start.__str__ != '':
|
|
164 --creads-window-start=$result.creads_window_start
|
|
165 #end if
|
|
166 #if $result.creads_window_end.__str__ != '':
|
|
167 --creads-window-end=$result.creads_window_end
|
|
168 #end if
|
|
169 $result.creads_complement
|
|
170 #end if
|
|
171 #if $results.split_output == 'yes':
|
|
172 --split-output=gsnap_out
|
|
173 #if $results.fails.choice == 'nofails':
|
|
174 --nofails
|
|
175 #elif $results.fails.choice == 'failsonly':
|
|
176 --failsonly
|
|
177 #end if
|
|
178 $results.fails_as_input
|
|
179 #else
|
|
180 #if $results.fails.choice == 'nofails':
|
|
181 --nofails
|
|
182 #elif $results.fails.choice == 'failsonly':
|
|
183 --failsonly
|
|
184 $results.fails.fails_as_input
|
|
185 #end if
|
|
186 #end if
|
|
187 #if $seq.format == "gsnap_fasta":
|
|
188 $seq.circularinput $seq.gsnap
|
|
189 #else if $seq.format == "fastq":
|
|
190 #if $seq.barcode_length.__str__ != '':
|
|
191 --barcode-length=$seq.barcode_length
|
|
192 #end if
|
|
193 #if $seq.fastq_id_start.__str__ != '':
|
|
194 --fastq-id-start=$seq.fastq_id_start
|
|
195 #end if
|
|
196 #if $seq.fastq_id_end.__str__ != '':
|
|
197 --fastq-id-end=$seq.fastq_id_end
|
|
198 #end if
|
|
199 #if $seq.filter_chastity.__str__ != 'off':
|
|
200 --filter-chastity=$seq.filter_chastity
|
|
201 #end if
|
|
202 #if $seq.paired.ispaired.__str__ == 'yes':
|
|
203 #if $seq.paired.pairmax_dna.__str__ != '':
|
|
204 --pairmax-dna=$seq.paired.pairmax_dna
|
|
205 #end if
|
|
206 #if $seq.paired.pairmax_rna.__str__ != '':
|
|
207 --pairmax-rna=$seq.paired.pairmax_rna
|
|
208 #end if
|
|
209 $seq.fastq $seq.paired.fastq
|
|
210 #else
|
|
211 $seq.fastq
|
|
212 #end if
|
|
213 #end if
|
|
214 #if $results.split_output == 'yes':
|
|
215 2> $gsnap_stderr
|
|
216 #else:
|
|
217 #if $results.fails.choice.__str__ == 'failsonly' and $results.fails.fails_as_input.__str__ != '':
|
|
218 2> $gsnap_stderr > $gsnap_fq
|
|
219 #else
|
|
220 2> $gsnap_stderr > $gsnap_out
|
|
221 #end if
|
|
222 #end if
|
|
223
|
|
224 </command>
|
|
225 <inputs>
|
|
226 <!-- Input data -->
|
|
227 <conditional name="seq">
|
|
228 <param name="format" type="select" label="<H2>Input Sequences</H2>Select the input format" help="">
|
|
229 <option value="fastq">Fastq</option>
|
|
230 <!--
|
|
231 <option value="goby">Goby compact-reads</option>
|
|
232 -->
|
|
233 <option value="gsnap_fasta">GNSAP fasta</option>
|
|
234 </param>
|
|
235 <when value="fastq">
|
|
236 <param name="fastq" type="data" format="fastq" label="Select a fastq dataset" />
|
|
237 <conditional name="paired">
|
|
238 <param name="ispaired" type="boolean" truevalue="yes" falsevalue="no" checked="false" label="Use Paired Reads?"/>
|
|
239 <when value="no"/>
|
|
240 <when value="yes">
|
|
241 <param name="fastq" type="data" format="fastq" label="Select the paired reads reverse dataset" />
|
|
242 <param name="orientation" type="select" label="Orientation of paired-end reads" help="">
|
|
243 <option value="FR">fwd-rev, typical Illumina default</option>
|
|
244 <option value="RF">rev-fwd, for circularized inserts</option>
|
|
245 <option value="FF">fwd-fwd, same strand</option>
|
|
246 </param>
|
|
247 <param name="pairmax_dna" type="integer" value="" optional="true" label="Max total genomic length for DNA-Seq paired reads, or other reads without splicing (default 1000)." help="Used if no splice file is provided and novelsplicing is off."/>
|
|
248 <param name="pairmax_rna" type="integer" value="" optional="true" label="Max total genomic length for RNA-Seq paired reads, or other reads that could have a splice (default 200000)." help="Used novelspliceing is specified or a splice file is provided. Should probably match the value for localsplicedist."/>
|
|
249 </when>
|
|
250 </conditional>
|
|
251 <param name="barcode_length" type="integer" value="" optional="true" label="Amount of barcode to remove from start of read (default 0)" />
|
|
252 <param name="fastq_id_start" type="integer" value="" optional="true" label="Starting field of identifier in FASTQ header, whitespace-delimited, starting from 1" />
|
|
253 <param name="fastq_id_end" type="integer" value="" optional="true" label="Ending field of identifier in FASTQ header, whitespace-delimited, starting from 1"
|
|
254 help="Examples:
|
|
255 <br>@HWUSI-EAS100R:6:73:941:1973#0/1
|
|
256 <br> . start=1, end=1 (default) => identifier is HWUSI-EAS100R:6:73:941:1973#0/1
|
|
257 <br>@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
|
|
258 <br> . start=1, end=1 => identifier is SRR001666.1
|
|
259 <br> . start=2, end=2 => identifier is 071112_SLXA-EAS1_s_7:5:1:817:345
|
|
260 <br> . start=1, end=2 => identifier is SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345"
|
|
261 />
|
|
262 <param name="filter_chastity" type="select" label="Skip reads marked by the Illumina chastity program"
|
|
263 help="String after the accession having a 'Y' after the first colon, like this:
|
|
264 <br>@accession 1:Y:0:CTTGTA
|
|
265 <br>where the 'Y' signifies filtering by chastity.
|
|
266 <br> For 'either', a 'Y' on either end of a paired-end read will be filtered.
|
|
267 <br> For 'both', a 'Y' is required on both ends of a paired-end read (or on the only end of a single-end read)"
|
|
268 >
|
|
269 <option value="off">off - no filtering</option>
|
|
270 <option value="either">either - a 'Y' on either end of a paired-end read</option>
|
|
271 <option value="both">both - a 'Y' is required on both ends of a paired-end read or the only end of a single-end read</option>
|
|
272 </param>
|
|
273 </when>
|
|
274 <!--
|
|
275 <when value="goby">
|
|
276 </when>
|
|
277 -->
|
|
278 <when value="gsnap_fasta">
|
|
279 <param name="gsnap" type="data" format="fasta" label="Select a single-end dataset" help="GSNAP fasta must have the sequence entirely on one line, a second line is interpreted as the paired-end sequence"/>
|
|
280 <param name="circularinput" type="boolean" checked="false" truevalue="--circular-input=true" falsevalue="" label="Circular-end data (paired reads are on same strand)"/>
|
|
281 </when>
|
|
282
|
|
283 </conditional>
|
|
284 <param name="mapq_unique_score" type="integer" value="" optional="true" label="MAPQ score threshold"
|
|
285 help="For multiple results, consider as a unique result if only one of the results has a MAPQ score equal or greater than this
|
|
286 (if not selected, then reports all multiple results, up to npaths)" />
|
|
287
|
|
288 <!-- GMAPDB for alignment -->
|
|
289 <conditional name="refGenomeSource">
|
|
290 <param name="genomeSource" type="select" label="<HR><H2>Align To</H2>Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
|
|
291 <option value="indexed">Use a built-in index</option>
|
|
292 <option value="gmapdb">Use a gmapdb from your history</option>
|
|
293 </param>
|
|
294 <when value="indexed">
|
|
295 <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team">
|
|
296 <options from_file="gmap_indices.loc">
|
|
297 <column name="uid" index="0" />
|
|
298 <column name="dbkey" index="1" />
|
|
299 <column name="name" index="2" />
|
|
300 <column name="kmers" index="3" />
|
|
301 <column name="maps" index="4" />
|
|
302 <column name="snps" index="5" />
|
|
303 <column name="value" index="6" />
|
|
304 </options>
|
|
305 </param>
|
|
306
|
|
307 <param name="kmer" type="select" data_ref="gmapindex" label="kmer size" help="Defaults to highest available kmer size">
|
|
308 <options from_file="gmap_indices.loc">
|
|
309 <column name="name" index="3"/>
|
|
310 <column name="value" index="3"/>
|
|
311 <filter type="param_value" ref="gmapindex" column="6"/>
|
|
312 <filter type="multiple_splitter" column="3" separator=","/>
|
|
313 <filter type="add_value" name="" value=""/>
|
|
314 <filter type="sort_by" column="3"/>
|
|
315 </options>
|
|
316 </param>
|
|
317
|
|
318 <param name="mode" type="select" label="Alignment mode" help="Assumes cmetindex and atoiindex were run on the gmap datatbase.">
|
|
319 <option value="">standard</option>
|
|
320 <option value="cmet-stranded">cmet-stranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option>
|
|
321 <option value="cmet-nonstranded">cmet-nonstranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option>
|
|
322 <option value="atoi-stranded">atoi-stranded for RNA-editing tolerance (A-to-G changes)</option>
|
|
323 <option value="atoi-nonstranded">atoi-nonstranded for RNA-editing tolerance (A-to-G changes)</option>
|
|
324 </param>
|
|
325
|
|
326 <conditional name="use_splicing">
|
|
327 <param name="src" type="select" label="<HR>Known Splicesite and Introns"
|
|
328 help="Look for splicing involving known sites or known introns at short or long distances
|
|
329 See README instructions for the distinction between known sites and known introns">
|
|
330 <option value="none" selected="true">None</option>
|
|
331 <option value="gmapdb">From the GMAP Database</option>
|
|
332 <option value="history">A Map in your history</option>
|
|
333 </param>
|
|
334 <when value="none"/>
|
|
335 <when value="history">
|
|
336 <param name="splicemap" type="data" format="splicesites.iit,introns.iit" metadata_name="dbkey" label="Select a splicesite map"
|
|
337 help="built with GMAP IIT"/>
|
|
338 </when>
|
|
339 <when value="gmapdb">
|
|
340 <param name="splicemap" type="select" data_ref="gmapindex" label="Use map for splicing involving known sites or known introns" help="">
|
|
341 <options from_file="gmap_indices.loc">
|
|
342 <column name="name" index="4"/>
|
|
343 <column name="value" index="4"/>
|
|
344 <filter type="param_value" ref="gmapindex" column="6"/>
|
|
345 <filter type="multiple_splitter" column="4" separator=","/>
|
|
346 <filter type="add_value" name="" value=""/>
|
|
347 <filter type="sort_by" column="4"/>
|
|
348 </options>
|
|
349 </param>
|
|
350 </when>
|
|
351 </conditional>
|
|
352
|
|
353 <conditional name="use_snps">
|
|
354 <param name="src" type="select" label="<HR>Known SNPs" help="for SNP tolerant alignments">
|
|
355 <option value="none" selected="true">None</option>
|
|
356 <option value="gmapdb">From the GMAP Database</option>
|
|
357 <option value="history">A SNP Index in your history</option>
|
|
358 </param>
|
|
359 <when value="none"/>
|
|
360 <when value="history">
|
|
361 <param name="snpindex" type="data" format="gmapsnpindex" metadata_name="dbkey" label="Select a snpindex"
|
|
362 help="built with GMAP SNP Index"/>
|
|
363 </when>
|
|
364 <when value="gmapdb">
|
|
365 <param name="snpindex" type="select" data_ref="gmapindex" label="Use database containing known SNPs" help="">
|
|
366 <options from_file="gmap_indices.loc">
|
|
367 <column name="name" index="5"/>
|
|
368 <column name="value" index="5"/>
|
|
369 <filter type="param_value" ref="gmapindex" column="6"/>
|
|
370 <filter type="multiple_splitter" column="5" separator=","/>
|
|
371 <filter type="add_value" name="" value=""/>
|
|
372 <filter type="sort_by" column="5"/>
|
|
373 </options>
|
|
374 </param>
|
|
375 </when>
|
|
376 </conditional>
|
|
377
|
|
378 </when>
|
|
379 <when value="gmapdb">
|
|
380 <param name="gmapdb" type="data" format="gmapdb" metadata_name="dbkey" label="Select a gmapdb"
|
|
381 help="A GMAP database built with GMAP Build"/>
|
|
382 <param name="kmer" type="select" data_ref="gmapdb" label="kmer size" help="Defaults to highest available kmer size">
|
|
383 <options>
|
|
384 <filter type="data_meta" ref="gmapdb" key="kmers" multiple="True" separator=","/>
|
|
385 </options>
|
|
386 </param>
|
|
387
|
|
388 <param name="mode" type="select" label="Alignment mode" help="Assumes cmetindex and atoiindex were run on the gmap datatbase.">
|
|
389 <option value="">standard</option>
|
|
390 <option value="cmet-stranded">cmet-stranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option>
|
|
391 <option value="cmet-nonstranded">cmet-nonstranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option>
|
|
392 <option value="atoi-stranded">atoi-stranded for RNA-editing tolerance (A-to-G changes)</option>
|
|
393 <option value="atoi-nonstranded">atoi-nonstranded for RNA-editing tolerance (A-to-G changes)</option>
|
|
394 </param>
|
|
395
|
|
396 <conditional name="use_splicing">
|
|
397 <param name="src" type="select" label="<HR>Known Splicesite and Introns"
|
|
398 help="Look for splicing involving known sites or known introns at short or long distances
|
|
399 See README instructions for the distinction between known sites and known introns">
|
|
400 <option value="none" selected="true">None</option>
|
|
401 <option value="gmapdb">From the GMAP Database</option>
|
|
402 <option value="history">A Map in your history</option>
|
|
403 </param>
|
|
404 <when value="none"/>
|
|
405 <when value="history">
|
|
406 <param name="splicemap" type="data" format="splicesites.iit,introns.iit" metadata_name="dbkey" label="Select a splicesite map"
|
|
407 help="built with GMAP IIT"/>
|
|
408 </when>
|
|
409 <when value="gmapdb">
|
|
410 <param name="splicemap" type="select" data_ref="gmapdb" label="Use map for splicing involving known sites or known introns" help="">
|
|
411 <options>
|
|
412 <filter type="data_meta" ref="gmapdb" key="maps" multiple="True"/>
|
|
413 </options>
|
|
414 </param>
|
|
415 </when>
|
|
416 </conditional>
|
|
417
|
|
418 <conditional name="use_snps">
|
|
419 <param name="src" type="select" label="<HR>Known SNPs" help="for SNP tolerant alignments">
|
|
420 <option value="none" selected="true">None</option>
|
|
421 <option value="gmapdb">From the GMAP Database</option>
|
|
422 <option value="history">A SNP Index in your history</option>
|
|
423 </param>
|
|
424 <when value="none"/>
|
|
425 <when value="history">
|
|
426 <param name="snpindex" type="data" format="gmapsnpindex" metadata_name="dbkey" label="Select a snpindex"
|
|
427 help="built with GMAP SNP Index"/>
|
|
428 </when>
|
|
429 <when value="gmapdb">
|
|
430 <param name="snpindex" type="select" data_ref="gmapdb" label="Use database containing known SNPs" help="">
|
|
431 <options>
|
|
432 <filter type="data_meta" ref="gmapdb" key="snps" multiple="True" separator=","/>
|
|
433 </options>
|
|
434 </param>
|
|
435 </when>
|
|
436 </conditional>
|
|
437
|
|
438 </when>
|
|
439 </conditional>
|
|
440
|
|
441 <!-- Computation options -->
|
|
442 <conditional name="computation">
|
|
443 <param name="options" type="select" label="<HR>Computational Settings" help="">
|
|
444 <option value="default">Use default settings</option>
|
|
445 <option value="advanced">Set Computation Options</option>
|
|
446 </param>
|
|
447 <when value="default"/>
|
|
448 <when value="advanced">
|
|
449 <param name="max_mismatches" type="float" value="" optional="true" label="Maximum number of mismatches allowed (uses default when negative)"
|
|
450 help="Defaults to the ultrafast level of ((readlength+2)/12 - 2)).
|
|
451 If specified between 0.0 and 1.0, then treated as a fraction
|
|
452 of each read length. Otherwise, treated as an integral number
|
|
453 of mismatches (including indel and splicing penalties)
|
|
454 For RNA-Seq, you may need to increase this value slightly
|
|
455 to align reads extending past the ends of an exon.">
|
|
456 <validator type="in_range" message="The mismatches must >= 0." min="0."/>
|
|
457 </param>
|
|
458 <param name="query_unk_mismatch" type="boolean" checked="false" truevalue="--query-unk-mismatch=1" falsevalue="" label="Count unknown (N) characters in the query as a mismatch"/>
|
|
459 <param name="genome_unk_mismatch" type="boolean" checked="true" truevalue="" falsevalue="--genome-unk-mismatch=0" label="Count unknown (N) characters in the genome as a mismatch"/>
|
|
460 <param name="terminal_threshold" type="integer" value="" optional="true" label="Threshold for searching for a terminal alignment (default 3)"
|
|
461 help="(from one end of the read to the best possible position at the other end). To turn off terminal alignments, set this to a high value." />
|
|
462 <param name="indel_penalty" type="integer" value="" optional="true" label="Penalty for an indel (default 2)"
|
|
463 help="Counts against mismatches allowed. To find indels, make indel-penalty less than or equal to max-mismatches. A value < 2 can lead to false positives at read ends" />
|
|
464 <param name="indel_endlength" type="integer" value="" optional="true" label="Minimum length at end required for indel alignments (default 4)" />
|
|
465 <param name="max_middle_insertions" type="integer" value="" optional="true" label="Maximum number of middle insertions allowed (default 9)" />
|
|
466 <param name="max_middle_deletions" type="integer" value="" optional="true" label="Maximum number of middle deletions allowed (default 30)" />
|
|
467 <param name="max_end_insertions" type="integer" value="" optional="true" label="Maximum number of end insertions allowed (default 3)" />
|
|
468 <param name="max_end_deletions" type="integer" value="" optional="true" label="Maximum number of end deletions allowed (default 6)" />
|
|
469 <param name="suboptimal_levels" type="integer" value="" optional="true" label="Report suboptimal hits beyond best hit (default 0)"
|
|
470 help="All hits with best score plus suboptimal-levels are reported" />
|
|
471 <param name="adapter_strip" type="select" label="Method for removing adapters from reads"
|
|
472 help="paired removes adapters from paired-end reads if a concordant or paired alignment cannot be found from the original read">
|
|
473 <option value="paired" selected="true">paired</option>
|
|
474 <option value="off">off</option>
|
|
475 </param>
|
|
476 <param name="trim_mismatch_score" type="integer" value="" optional="true" label="Score to use for mismatches when trimming at ends (default is -3)"
|
|
477 help="to turn off trimming, specify 0"/>
|
|
478 <param name="use_tally" type="data" format="tally.iit" optional="true" metadata_name="dbkey" label="Select a tally IIT file to resolve concordant multiple results"
|
|
479 help="generated by gsnap_tally and iit_store"/>
|
|
480
|
|
481 <!--
|
|
482 tallydir=STRING Directory for tally IIT file to resolve concordant multiple results (default is
|
|
483 location of genome index files specified using -D and -d). Note: can
|
|
484 just give full path name to use-tally instead.
|
|
485 use-tally=STRING Use this tally IIT file to resolve concordant multiple results
|
|
486 runlengthdir=STRING Directory for runlength IIT file to resolve concordant multiple results (default is
|
|
487 location of genome index files specified using -D and -d). Note: can
|
|
488 just give full path name to use-runlength instead.
|
|
489 use-runlength=STRING Use this runlength IIT file to resolve concordant multiple results
|
|
490 -->
|
|
491
|
|
492 <!-- Options for GMAP alignment within GSNAP -->
|
|
493 <param name="gmap_mode" type="select" multiple="true" optional="true" display="checkboxes" label="Cases to use GMAP for complex alignments containing multiple splices or indels"
|
|
494 help="Default: pairsearch,terminal,improve">
|
|
495 <option value="pairsearch" selected="true">pairsearch</option>
|
|
496 <option value="terminal" selected="true">terminal</option>
|
|
497 <option value="improve" selected="true">improve</option>
|
|
498 </param>
|
|
499 <param name="trigger_score_for_gmap" type="integer" value="" optional="true" label="GMAP pairsearch threshold (default 5)"
|
|
500 help="Try GMAP pairsearch on nearby genomic regions if best score (the total of both ends if paired-end) exceeds this value (default 5)" />
|
|
501 <param name="max_gmap_pairsearch" type="integer" value="" optional="true" label="GMAP pairsearch threshold (default 3)"
|
|
502 help="Perform GMAP pairsearch on nearby genomic regions up to this many candidate ends (default 3)." />
|
|
503 <param name="max_gmap_terminal" type="integer" value="" optional="true" label="GMAP terminal threshold (default 3)"
|
|
504 help="Perform GMAP terminal on nearby genomic regions up to this many candidate ends (default 3)." />
|
|
505 <param name="max_gmap_improvement" type="integer" value="" optional="true" label="GMAP improvement threshold (default 3)"
|
|
506 help="Perform GMAP improvement on nearby genomic regions up to this many candidate ends (default 3)." />
|
|
507 <param name="microexon_spliceprob" type="float" value="" optional="true" label="GMAP microexons threshold (default .90)"
|
|
508 help="Allow microexons only if one of the splice site probabilities is greater than this value." >
|
|
509 <validator type="in_range" message="The microexons probability must be between 0. and 1." min="0." max="1."/>
|
|
510 </param>
|
|
511 </when>
|
|
512 </conditional>
|
|
513
|
|
514 <conditional name="splicing">
|
|
515 <param name="options" type="select" label="<HR>Splicing options for RNA-Seq" help="">
|
|
516 <option value="default">Use default settings</option>
|
|
517 <option value="advanced">Set Splicing Options</option>
|
|
518 </param>
|
|
519 <when value="default"/>
|
|
520 <when value="advanced">
|
|
521 <!-- Splicing options for RNA-Seq -->
|
|
522 <!-- use-splicing This should be either a select list from the gmapdb maps or a data type using splicesdir and use-splicing -->
|
|
523 <!-- Neither novel splicing (-N) nor known splicing (-s) turned on => assume reads are DNA-Seq (genomic) -->
|
|
524 <param name="novelsplicing" type="boolean" checked="false" truevalue="--novelsplicing=1" falsevalue="" label="Look for novel splicing "/>
|
|
525 <param name="localsplicedist" type="integer" value="" optional="true" label="Definition of local novel splicing event (default 200000)"/>
|
|
526 <param name="local_splice_penalty" type="integer" value="" optional="true" label="Penalty for a local splice (default 0). Counts against mismatches allowed"/>
|
|
527 <param name="distant_splice_penalty" type="integer" value="" optional="true" label="Penalty for a distant splice (default 3). Counts against mismatches allowed"
|
|
528 help="A distant splice is one where the intron length exceeds the value of localsplicedist or is an
|
|
529 inversion, scramble, or translocation between two different chromosomes. Counts against mismatches allowed"/>
|
|
530 <param name="distant_splice_endlength" type="integer" value="" optional="true" label="Minimum length at end required for distant spliced alignments"
|
|
531 help="(default 16, min is the kmer length)"/>
|
|
532 <param name="shortend_splice_endlength" type="integer" value="" optional="true" label="Minimum length at end required for short-end spliced alignments"
|
|
533 help="(default 2, but unless known splice sites are provided, GSNAP may still need the end length to be the value of kmer size to find a given splice"/>
|
|
534 <param name="distant_splice_identity" type="float" value="" optional="true" label="Minimum identity at end required for distant spliced alignments (default 0.95)"/>
|
|
535 <param name="antistranded_penalty" type="integer" value="" optional="true" label="Penalty for antistranded splicing when using stranded RNA-Seq protocols"
|
|
536 help="A positive value, such as 1, expects antisense on the first read and sense on the second read.
|
|
537 Default is 0, which treats sense and antisense equally well"/>
|
|
538 </when>
|
|
539 </conditional>
|
|
540
|
|
541 <!-- Output data -->
|
|
542 <conditional name="output">
|
|
543 <param name="options" type="select" label="<HR><H2>Output</H2>Output options for RNA-Seq" help="">
|
|
544 <option value="default">Use default settings</option>
|
|
545 <option value="advanced">Set Output Options</option>
|
|
546 </param>
|
|
547 <when value="default"/>
|
|
548 <when value="advanced">
|
|
549 <param name="npath" type="integer" value="" optional="true" label="Maximum number of paths to print (default 100)"/>
|
|
550 <param name="quiet_if_excessive" type="boolean" checked="false" truevalue="--quiet-if-excessive" falsevalue="" label="Quiet if Excessive"
|
|
551 help="If more than maximum number of paths are found, then nothing is printed."/>
|
|
552 <param name="show_refdiff" type="boolean" checked="false" truevalue="--show-refdiff" falsevalue="" label="Show SNP-tolerant alignment"
|
|
553 help="For GSNAP output in SNP-tolerant alignment, shows all differences relative to the reference genome as lower case (otherwise, it shows all differences relative to both the reference and alternate genome)"/>
|
|
554 <param name="clip_overlap" type="boolean" checked="false" truevalue="--clip-overlap" falsevalue="" label="Clip Overlap"
|
|
555 help="For paired-end reads whose alignments overlap, clip the overlapping region."/>
|
|
556 </when>
|
|
557 </conditional>
|
|
558 <conditional name="result">
|
|
559 <param name="format" type="select" label="Select the output format" help="">
|
|
560 <option value="sam">SAM</option>
|
|
561 <!-- goby should only be an option if the input is in goby format
|
|
562 <option value="goby">Goby</option>
|
|
563 -->
|
|
564 <option value="gsnap">GSNAP default output</option>
|
|
565 </param>
|
|
566 <when value="gsnap">
|
|
567 </when>
|
|
568 <when value="sam">
|
|
569 <param name="no_sam_headers" type="boolean" truevalue="--no-sam-headers" falsevalue="" checked="false" label="Do not print headers beginning with '@'"/>
|
|
570 <param name="read_group_id" type="text" value="" optional="true" label="Value to put into read-group id (RG-ID) field"/>
|
|
571 <param name="read_group_name" type="text" value="" optional="true" label="Value to put into read-group name (RG-SM) field"/>
|
|
572 <param name="read_group_library" type="text" value="" optional="true" label="Value to put into read-group library (RG-LB) field"/>
|
|
573 <param name="read_group_platform" type="text" value="" optional="true" label="Value to put into read-group library platform (RG-PL) field"/>
|
|
574 <param name="quality_shift" type="integer" value="" optional="true" label="Shift FASTQ quality scores by this amount in SAM output (default -31)"/>
|
|
575 </when>
|
|
576 <!--
|
|
577 <when value="goby">
|
|
578 <param name="goby_output" type="text" value="" label="Basename for Goby output files"/>
|
|
579 <param name="creads_window_start" type="integer" value="" optional="true" label="Compact reads window start (default: 0=start of file)"/>
|
|
580 <param name="creads_window_end" type="integer" value="" optional="true" label="Compact reads window end (default: 0=end of file)"/>
|
|
581 <param name="creads_complement" type="boolean" truevalue="-\-creads-complement" falsevalue="" checked="false" label="Complement read sequences (without reversing)"/>
|
|
582 </when>
|
|
583 -->
|
|
584 </conditional>
|
|
585 <!-- TODO combine fails and split_output -->
|
|
586
|
|
587 <conditional name="results">
|
|
588 <param name="split_output" type="select" label="<HR>Split outputs"
|
|
589 help="Separate outputs for: nomapping, halfmapping_uniq, halfmapping_mult, unpaired_uniq, unpaired_mult, paired_uniq, paired_mult, concordant_uniq, and concordant_mult results">
|
|
590 <option value="no">no</option>
|
|
591 <option value="yes">yes</option>
|
|
592 </param>
|
|
593 <when value="no">
|
|
594 <conditional name="fails">
|
|
595 <param name="choice" type="select" label="How to deal with fails" help="">
|
|
596 <option value="default">default - include them in results</option>
|
|
597 <option value="nofails">nofails - exclude fails from results</option>
|
|
598 <option value="failsonly">failsonly - only output failing results</option>
|
|
599 </param>
|
|
600 <when value="default"/>
|
|
601 <when value="nofails"/>
|
|
602 <when value="failsonly">
|
|
603 <param name="fails_as_input" type="boolean" truevalue="--fails-as-input" falsevalue="" checked="false" label="Print completely failed alignments as input FASTA or FASTQ format"
|
|
604 help=""/>
|
|
605 </when>
|
|
606 </conditional>
|
|
607 </when>
|
|
608 <when value="yes">
|
|
609 <conditional name="fails">
|
|
610 <param name="choice" type="select" label="How to deal with fails" help="">
|
|
611 <option value="default">default - include them in results</option>
|
|
612 <option value="nofails">nofails - exclude fails from results</option>
|
|
613 <option value="failsonly">failsonly - only output failing results</option>
|
|
614 </param>
|
|
615 <when value="default"/>
|
|
616 <when value="nofails"/>
|
|
617 <when value="failsonly"/>
|
|
618 </conditional>
|
|
619 <param name="fails_as_input" type="boolean" truevalue="--fails-as-input" falsevalue="" checked="false" label="Print completely failed alignments as input FASTA or FASTQ format"
|
|
620 help=""/>
|
|
621 </when>
|
|
622 </conditional>
|
|
623
|
|
624 </inputs>
|
|
625 <outputs>
|
|
626 <data format="txt" name="gsnap_stderr" label="${tool.name} on ${on_string}: gsnap.log"/>
|
|
627
|
|
628 <data format="txt" name="gsnap_out" label="${tool.name} on ${on_string} ${result.format}" >
|
|
629 <filter>(results['split_output'] == 'no' and (results['fails']['choice'] != 'failsonly' or results['fails']['fails_as_input'] == False))</filter>
|
|
630 <change_format>
|
|
631 <when input="result['format']" value="sam" format="sam"/>
|
|
632 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
633 </change_format>
|
|
634 </data>
|
|
635
|
|
636 <data format="fastq" name="gsnap_fq" label="${tool.name} on ${on_string} fails.fq" >
|
|
637 <filter>(results['split_output'] == 'no' and results['fails']['choice'] == 'failsonly' and results['fails']['fails_as_input'] == True)</filter>
|
|
638 </data>
|
|
639
|
|
640 <!-- nomapping, halfmapping_uniq, halfmapping_mult, unpaired_uniq, unpaired_mult, paired_uniq, paired_mult, concordant_uniq, concordant_mult -->
|
|
641
|
|
642 <data format="txt" name="unpaired_mult" label="${tool.name} on ${on_string} unpaired_mult.${result.format}" from_work_dir="gsnap_out.unpaired_mult">
|
|
643 <filter>(results['split_output'] == 'yes')</filter>
|
|
644 <change_format>
|
|
645 <when input="result['format']" value="sam" format="sam"/>
|
|
646 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
647 </change_format>
|
|
648 </data>
|
|
649 <data format="txt" name="unpaired_uniq" label="${tool.name} on ${on_string} unpaired_uniq.${result.format}" from_work_dir="gsnap_out.unpaired_uniq">
|
|
650 <filter>(results['split_output'] == 'yes')</filter>
|
|
651 <change_format>
|
|
652 <when input="result['format']" value="sam" format="sam"/>
|
|
653 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
654 </change_format>
|
|
655 </data>
|
|
656 <data format="txt" name="unpaired_transloc" label="${tool.name} on ${on_string} unpaired_transloc.${result.format}" from_work_dir="gsnap_out.unpaired_transloc">
|
|
657 <filter>(results['split_output'] == 'yes')</filter>
|
|
658 <change_format>
|
|
659 <when input="result['format']" value="sam" format="sam"/>
|
|
660 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
661 </change_format>
|
|
662 </data>
|
|
663 <data format="txt" name="halfmapping_mult" label="${tool.name} on ${on_string} halfmapping_mult.${result.format}" from_work_dir="gsnap_out.halfmapping_mult">
|
|
664 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
|
|
665 <change_format>
|
|
666 <when input="result['format']" value="sam" format="sam"/>
|
|
667 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
668 </change_format>
|
|
669 </data>
|
|
670 <data format="txt" name="halfmapping_uniq" label="${tool.name} on ${on_string} halfmapping_uniq.${result.format}" from_work_dir="gsnap_out.halfmapping_uniq">
|
|
671 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
|
|
672 <change_format>
|
|
673 <when input="result['format']" value="sam" format="sam"/>
|
|
674 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
675 </change_format>
|
|
676 </data>
|
|
677 <data format="txt" name="halfmapping_transloc" label="${tool.name} on ${on_string} halfmapping_transloc.${result.format}" from_work_dir="gsnap_out.halfmapping_transloc">
|
|
678 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
|
|
679 <change_format>
|
|
680 <when input="result['format']" value="sam" format="sam"/>
|
|
681 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
682 </change_format>
|
|
683 </data>
|
|
684 <data format="txt" name="paired_mult" label="${tool.name} on ${on_string} paired_mult.${result.format}" from_work_dir="gsnap_out.paired_mult">
|
|
685 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
|
|
686 <change_format>
|
|
687 <when input="result['format']" value="sam" format="sam"/>
|
|
688 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
689 </change_format>
|
|
690 </data>
|
|
691 <data format="txt" name="paired_uniq" label="${tool.name} on ${on_string} paired_uniq.${result.format}" from_work_dir="gsnap_out.paired_uniq">
|
|
692 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
|
|
693 <change_format>
|
|
694 <when input="result['format']" value="sam" format="sam"/>
|
|
695 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
696 </change_format>
|
|
697 </data>
|
|
698 <data format="txt" name="paired_transloc" label="${tool.name} on ${on_string} paired_transloc.${result.format}" from_work_dir="gsnap_out.paired_transloc">
|
|
699 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
|
|
700 <change_format>
|
|
701 <when input="result['format']" value="sam" format="sam"/>
|
|
702 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
703 </change_format>
|
|
704 </data>
|
|
705
|
|
706 <data format="txt" name="concordant_mult" label="${tool.name} on ${on_string} concordant_mult.${result.format}" from_work_dir="gsnap_out.concordant_mult">
|
|
707 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
|
|
708 <change_format>
|
|
709 <when input="result['format']" value="sam" format="sam"/>
|
|
710 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
711 </change_format>
|
|
712 </data>
|
|
713 <data format="txt" name="concordant_uniq" label="${tool.name} on ${on_string} concordant_uniq.${result.format}" from_work_dir="gsnap_out.concordant_uniq">
|
|
714 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
|
|
715 <change_format>
|
|
716 <when input="result['format']" value="sam" format="sam"/>
|
|
717 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
718 </change_format>
|
|
719 </data>
|
|
720 <data format="txt" name="concordant_transloc" label="${tool.name} on ${on_string} concordant_transloc.${result.format}" from_work_dir="gsnap_out.concordant_transloc">
|
|
721 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
|
|
722 <change_format>
|
|
723 <when input="result['format']" value="sam" format="sam"/>
|
|
724 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
725 </change_format>
|
|
726 </data>
|
|
727
|
|
728 <data format="txt" name="nomapping" label="${tool.name} on ${on_string} nomapping.${result.format}" from_work_dir="gsnap_out.nomapping">
|
|
729 <filter>(results['split_output'] == 'yes' and results['fails_as_input'] == False)</filter>
|
|
730 <change_format>
|
|
731 <when input="result['format']" value="sam" format="sam"/>
|
|
732 <when input="result['format']" value="gsnap" format="gsnap"/>
|
|
733 </change_format>
|
|
734 </data>
|
|
735
|
|
736 <data format="fastq" name="nomapping_fq" label="${tool.name} on ${on_string} nomapping.fq" from_work_dir="gsnap_out.nomapping.fq">
|
|
737 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == False)</filter>
|
|
738 </data>
|
|
739
|
|
740 <data format="fastq" name="nomapping_1_fq" label="${tool.name} on ${on_string} nomapping.1.fq" from_work_dir="gsnap_out.nomapping.1.fq">
|
|
741 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
|
|
742 </data>
|
|
743
|
|
744 <data format="fastq" name="nomapping_2_fq" label="${tool.name} on ${on_string} nomapping.2.fq" from_work_dir="gsnap_out.nomapping.2.fq">
|
|
745 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
|
|
746 </data>
|
|
747
|
|
748 <!-- Will problay need wrapper code to generate composite datatype for goby alignment
|
|
749 <data format="gobyalignment" name="goby_alignment" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.nomapping">
|
|
750 <filter>result['format'] == 'goby'</filter>
|
|
751 </data>
|
|
752 -->
|
|
753
|
|
754 </outputs>
|
|
755 <tests>
|
|
756 </tests>
|
|
757
|
|
758 <help>
|
|
759
|
|
760 **What it does**
|
|
761
|
|
762 GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc.
|
|
763 Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10.
|
|
764
|
|
765 .. _GSNAP: http://research-pub.gene.com/gmap/
|
|
766 .. _Publication: http://bioinformatics.oupjournals.org/cgi/content/full/26/7/873
|
|
767 http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2844994/?tool=pubmed
|
|
768
|
|
769 ------
|
|
770
|
|
771 **Know what you are doing**
|
|
772
|
|
773 .. class:: warningmark
|
|
774
|
|
775 You will want to read the README_
|
|
776
|
|
777 .. _README: http://research-pub.gene.com/gmap/src/README
|
|
778
|
|
779 ------
|
|
780
|
|
781 **Input formats**
|
|
782
|
|
783 Input to GSNAP should be either in FASTQ or FASTA format.
|
|
784
|
|
785 The FASTQ input may include quality scores, which will then be included in SAM
|
|
786 output, if that output format is selected.
|
|
787
|
|
788 For FASTA format, you should include one line per read (or end of a
|
|
789 paired-end read). The same FASTA file can have a mixture of
|
|
790 single-end and paired-end reads of varying lengths, if desired.
|
|
791
|
|
792 Single-end reads:
|
|
793
|
|
794 Each FASTA entry should contain one short read per line, like this
|
|
795
|
|
796 >Header information
|
|
797 AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA
|
|
798
|
|
799 Each short read can have a different length. However, the entire read
|
|
800 needs to be on a single line, and may not wrap around multiple lines.
|
|
801 If it extends to a second line, GSNAP will think that the read is
|
|
802 paired-end.
|
|
803
|
|
804
|
|
805 Paired-end reads:
|
|
806
|
|
807 Each FASTA entry should contain two short reads, one per line, like
|
|
808 this
|
|
809
|
|
810 >Header information
|
|
811 AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA
|
|
812 GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG
|
|
813
|
|
814 By default, the program assumes that the second end is in the reverse
|
|
815 complement direction compared with the first end. If they are in the
|
|
816 same direction, you may need to use the --circular-input (or -c) flag.
|
|
817
|
|
818 ( The Galaxy tool: "FASTA Width formatter" can be used to reformat fasta files to have single line sequences. )
|
|
819
|
|
820 ------
|
|
821
|
|
822 **Output formats in GSNAP**
|
|
823
|
|
824 SAM output format
|
|
825
|
|
826 Default GSNAP format
|
|
827 See the README_
|
|
828
|
|
829
|
|
830
|
|
831
|
|
832 </help>
|
|
833 </tool>
|
|
834
|