Mercurial > repos > mheinzl > fsd_regions
changeset 2:2631864873d7 draft
planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd_regions commit 29bc65d5627553741c83ce1f298223e2b266f7c8
| author | mheinzl |
|---|---|
| date | Tue, 15 May 2018 14:21:41 -0400 |
| parents | 9ce2b4089c1b |
| children | 85d870b8ae92 |
| files | fsd_regions.py fsd_regions.xml |
| diffstat | 2 files changed, 4 insertions(+), 4 deletions(-) [+] |
line wrap: on
line diff
--- a/fsd_regions.py Tue May 15 13:50:29 2018 -0400 +++ b/fsd_regions.py Tue May 15 14:21:41 2018 -0400 @@ -31,10 +31,10 @@ parser.add_argument('--inputName1') parser.add_argument('--ref_genome', help='TXT File with tags of reads that overlap the region.') + parser.add_argument('--output_pdf', default="data.pdf", type=str, + help='Name of the pdf and csv file.') parser.add_argument('--output_csv', default="data.csv", type=str, help='Name of the pdf and csv file.') - parser.add_argument('--output_pdf', default="data.pdf", type=str, - help='Name of the pdf and csv file.') parser.add_argument('--sep', default=",", help='Separator in the csv file.') return parser
--- a/fsd_regions.xml Tue May 15 13:50:29 2018 -0400 +++ b/fsd_regions.xml Tue May 15 14:21:41 2018 -0400 @@ -1,5 +1,5 @@ <?xml version="1.0" encoding="UTF-8"?> -<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.2"> +<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.3"> <requirements> <requirement type="package" version="2.7">python</requirement> <requirement type="package" version="1.4">matplotlib</requirement> @@ -37,7 +37,7 @@ +-----+----------------------------+----+ - In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. This file can obtained from a different tool. + In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. This file can obtained from a different tool. +-----------+------------------------------+ | 87_636 | AAATCAAAGTATGAATGAAGTTGCCT |