annotate bio_hansel.xml @ 0:9407a9eaad22 draft

planemo upload for repository https://github.com/phac-nml/bio_hansel commit c35a4502f95471e22dea2d77f36b92c47424cecc

<tool id="bio_hansel" name="Hansel - Salmonella Subtyping" version="0.1.0">
    <requirements>
        <requirement type="package" version="0.1.0">bio_hansel</requirement>
        <requirement type="package" version="17.2.0">attrs</requirement>
    </requirements>
    <command detect_errors="exit_code"><![CDATA[
        ## Variables to be set.
        #set outputResultsName = 'results.tab'
        #set outputMatchResultsName = 'match_results.tab'
        #set verboseDebuggingLevel = '-vvv'

        ## Preparing file input.
        #if $single_or_paired.type == "paired":

            ln -s '$single_or_paired.fastq_input1' fast_q_paired_1.fastq &&
            ln -s '$single_or_paired.fastq_input2' fast_q_paired_2.fastq &&

        #elif $single_or_paired.type == "collection":

            ln -s '$single_or_paired.fastq_input1.forward' fast_q_paired_1.fastq &&
            ln -s '$single_or_paired.fastq_input1.reverse' fast_q_paired_2.fastq &&

        #elif $single_or_paired.type == "single":

            #if $single_or_paired.fastq_input1.is_of_type('fastqsanger') or $single_or_paired.fastq_input1.is_of_type('fastq'):
                ln -s '$single_or_paired.fastq_input1' fast_q_single.fastq &&
            #end if

            #if $single_or_paired.fastq_input1.is_of_type('fasta'):
                ln -s '$single_or_paired.fastq_input1' fast_a_single.fasta &&
            #end if

        #end if


        ## Checking for custom scheme.
        #if $type_of_scheme.scheme_type == "custom":
            #if $type_of_scheme.scheme_input.is_of_type('fasta'):
                ln -s '$type_of_scheme.scheme_input' custom_scheme.fasta &&
            #end if
        #end if


        ## Start the actual command here
        hansel 


        ## Select the scheme
        -s

        #if $type_of_scheme.scheme_type == "heidelberg":
            heidelberg
        #elif $type_of_scheme.scheme_type == "enteritidis":
            enteritidis
        #elif $type_of_scheme.scheme_type == "custom":
            custom_scheme.fasta
        #end if


        #if $kmer_min
            --min-kmer-freq $kmer_min
        #end if

        #if $kmer_max
            --max-kmer-freq $kmer_max
        #end if

        ## Adding more parameters to the command.
        $verboseDebuggingLevel -t "\${GALAXY_SLOTS:-1}" -o $outputResultsName -O $outputMatchResultsName 


        ## Entering the file inputs.
        #if $single_or_paired.type == "single":

            #if $single_or_paired.fastq_input1.is_of_type('fastqsanger') or $single_or_paired.fastq_input1.is_of_type('fastq'):
                fast_q_single.fastq
            #end if

            #if $single_or_paired.fastq_input1.is_of_type('fasta'):
                fast_a_single.fasta
            #end if

        #else

            ##use -p to declare using two files.
            -p fast_q_paired_1.fastq  fast_q_paired_2.fastq

        #end if
    ]]></command>
    <inputs>
        <conditional name="single_or_paired">
            <param name="type" type="select" label="Specify the read type.">
                <option value="single">Single-end Data</option>
                <option value="paired">Paired-end Data</option>
                <option value="collection">Collection Paired-end Data</option>
            </param>
            <when value="single">
                <param name="fastq_input1" type="data" format="fastqsanger, fastq, fasta" label="Single end read file(s)"/>
            </when>
            <when value="paired">
                <param name="fastq_input1" type="data" format="fastqsanger, fastq" label="Forward paired-end read file"/>
                <param name="fastq_input2" type="data" format="fastqsanger, fastq" label="Reverse paired-end read file"/>
            </when>
            <when value="collection">
                <param name="fastq_input1" type="data_collection" label="Paired-end reads collection" optional="false" format="fastqsanger, fastq" collection_type="paired" />
            </when>
        </conditional>
        <conditional name="type_of_scheme">
            <param name="scheme_type" type="select" label="Specify scheme to use. (Heidelberg is default)">
                <option value="heidelberg">Heidelberg scheme</option>
                <option value="enteritidis">Enteritidis scheme</option>
                <option value="custom">Specify your own custom scheme</option>
            </param>
            <when value="heidelberg"/>
            <when value="enteritidis"/>
            <when value="custom">
                <param name="scheme_input" type="data" format="fasta" label="Scheme Input"/>
            </when>
        </conditional>
        <param name="kmer_min" argument="--min-kmer-freq" optional="True" type="integer" min="0" label="Min k-mer freq/coverage" value="10" help="default = 10"/>
        <param name="kmer_max" argument="--max-kmer-freq" optional="True" type="integer" min="1" label="Max k-mer freq/coverage" value="200" help="default = 200"/>
    </inputs>
    <outputs>
        <data format="tabular" name="results.tab" from_work_dir="results.tab" label="results.tab"/>
        <data format="tabular" name="match_results.tab" from_work_dir="match_results.tab" label="match_results.tab"/>
    </outputs>
    <tests>
        <test>
            <param name="single_or_paired" value="single"/>
            <param name="type_of_scheme" value="heidelberg"/>
            <param name="fastq_input1" value="SRR1002850_SMALL.fasta"/>
            <output name="results.tab">
                <assert_contents>
                    <!-- Verifying that the columns are as expected. -->
                    <has_text_matching expression="sample\s+scheme\s+subtype\s+all_subtypes\s+tiles_matching_subtype\s+are_subtypes_consistent\s+inconsistent_subtypes\s+n_tiles_matching_all\s+n_tiles_matching_all_total\s+n_tiles_matching_positive\s+n_tiles_matching_positive_total\s+n_tiles_matching_subtype\s+n_tiles_matching_subtype_total\s+file_path"/>
                    <!-- Verifying that the output of running the test file is expected. This is done via REGEX because the name and path of the file outputted to results.tab changes each test. -->
                    <has_text_matching expression="(heidelberg)\s+(2.2.2.2.1.4)\s+(2;)\s+(2.2;)\s+(2.2.2;)\s+(2.2.2.2;)\s+(2.2.2.2.1;)\s+(2.2.2.2.1.4)\s+(1037658-2.2.2.2.1.4;)\s+(2154958-2.2.2.2.1.4;)\s+(3785187-2.2.2.2.1.4)\s+(True)\s+(202)\s+(202)\s+(17)\s+(17)\s+(3)\s+(3)"/>
                </assert_contents>
            </output>
            <output name="match_results.tab">
                <assert_contents>
                    <!-- This is the last line in the file, this assertion is to make sure that we have the correct number of items. -->
                    <has_text_matching expression="negative4738855-1.1"/>
                </assert_contents>
            </output>
        </test>
    </tests>
    <help><![CDATA[
***********************************************************
  bio_hansel - Heidelberg And eNteritidis Snp ELucidation
***********************************************************

Subtype *Salmonella enterica* subsp. enterica serovar Heidelberg and Enteritidis genomes using *in-silico* 33 bp k-mer SNP subtyping schemes developed by Genevieve Labbe et al.
Subtype *Salmonella* genome assemblies (FASTA files) and/or whole-genome sequencing reads (FASTQ files)!

Github
========
https://github.com/phac-nml/bio_hansel

Citation
========

If you find this tool useful, please cite as:

    .. epigraph::

        A robust genotyping scheme for *Salmonella enterica* serovar Heidelberg clones circulating in North America.
        Geneviève Labbé, James Robertson, Peter Kruczkiewicz, Chad R. Laing, Kim Ziebell, Aleisha R. Reimer, Lorelee Tschetter, Gary Van Domselaar, Sadjia Bekal, Kimberley A. MacDonald, Linda Hoang, Linda Chui, Danielle Daignault, Durda Slavic, Frank Pollari, E. Jane Parmley, Philip Mabon, Elissa Giang, Lok Kan Lee, Jonathan Moffat, Marisa Rankin, Joanne MacKinnon, Roger Johnson, John H.E. Nash.
        [Manuscript in preparation]
 
Usage
=====
Enter your FASTQ/FASTA read files, select which scheme you would like to use (e.g. heidelberg, enteritidis, etc...) or specify your own. Finally, click execute.


Example Usage
=============

Analysis of a single FASTA file
-------------------------------


Contents of ``results.tab``:

    sample  scheme  subtype all_subtypes    tiles_matching_subtype  are_subtypes_consistent inconsistent_subtypes   n_tiles_matching_all    n_tiles_matching_all_total  n_tiles_matching_positive   n_tiles_matching_positive_total n_tiles_matching_subtype    n_tiles_matching_subtype_total  file_path

    SRR1002850  heidelberg  2.2.2.2.1.4 2; 2.2; 2.2.2; 2.2.2.2; 2.2.2.2.1; 2.2.2.2.1.4  1037658-2.2.2.2.1.4; 2154958-2.2.2.2.1.4; 3785187-2.2.2.2.1.4   True        202 202 17  17  3   3   SRR1002850.fasta


Contents of ``match_results.tab``:

    tilename    stitle  pident  length  mismatch    gapopen qstart  qend    sstart  send    evalue  bitscore    qlen    slen    seq coverage    is_trunc    refposition subtype is_pos_tile sample  file_path   scheme

    775920-2.2.2.2  NODE_2_length_512016_cov_46.4737_ID_3   100.0   33  0   0   1   33  474875  474907  2.0000000000000002e-11  62.1    33  512016  GTTCAGGTGCTACCGAGGATCGTTTTTGGTGCG   1.0 False   775920  2.2.2.2 

    True    SRR1002850  SRR1002850.fasta   heidelberg

    negative3305400-2.1.1.1 NODE_3_length_427905_cov_48.1477_ID_5   100.0   33  0   0   1   33  276235  276267  2.0000000000000002e-11  62.1    33  427905  CATCGTGAAGCAGAACAGACGCGCATTCTTGCT   1.0 False   

    negative3305400 2.1.1.1 False   SRR1002850  SRR1002850.fasta   heidelberg

    negative3200083-2.1 NODE_3_length_427905_cov_48.1477_ID_5   100.0   33  0   0   1   33  170918  170950  2.0000000000000002e-11  62.1    33  427905  ACCCGGTCTACCGCAAAATGGAAAGCGATATGC   1.0 False   

    negative3200083 2.1 False   SRR1002850  SRR1002850.fasta   heidelberg

    negative3204925-2.2.3.1.5   NODE_3_length_427905_cov_48.1477_ID_5   100.0   33  0   0   1   33  175760  175792  2.0000000000000002e-11  62.1    33  427905  CTCGCTGGCAAGCAGTGCGGGTACTATCGGCGG   1.0 False   

    negative3204925 2.2.3.1.5   False   SRR1002850  SRR1002850.fasta   heidelberg

    negative3230678-2.2.2.1.1.1 NODE_3_length_427905_cov_48.1477_ID_5   100.0   33  0   0   1   33  201513  201545  2.0000000000000002e-11  62.1    33  427905  AGCGGTGCGCCAAACCACCCGGAATGATGAGTG   1.0 False   

    negative3230678 2.2.2.1.1.1 False   SRR1002850  SRR1002850.fasta   heidelberg

    negative3233869-2.1.1.1.1   NODE_3_length_427905_cov_48.1477_ID_5   100.0   33  0   0   1   33  204704  204736  2.0000000000000002e-11  62.1    33  427905  CAGCGCTGGTATGTGGCTGCACCATCGTCATTA   1.0 False   

    [Next 196 lines omitted.]


Analysis of a single FASTQ readset
----------------------------------

Contents of ``results.tab``:

    sample  scheme  subtype all_subtypes    tiles_matching_subtype  are_subtypes_consistent inconsistent_subtypes   n_tiles_matching_all    n_tiles_matching_all_total  n_tiles_matching_positive   n_tiles_matching_positive_total n_tiles_matching_subtype    n_tiles_matching_subtype_total  file_path

    SRR5646583  heidelberg  2.2.1.1.1.1 2; 2.2; 2.2.1; 2.2.1.1; 2.2.1.1.1; 2.2.1.1.1.1  1983064-2.2.1.1.1.1; 4211912-2.2.1.1.1.1    True        202 202 20  20  2   2   SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger


Contents of ``match_results.tab``:

    seq freq    sample  file_path   tilename    is_pos_tile subtype refposition is_kmer_freq_okay   scheme

    ACGGTAAAAGAGGACTTGACTGGCGCGATTTGC   68  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    21097-2.2.1.1.1 True    2.2.1.1.1   21097   True    heidelberg

    AACCGGCGGTATTGGCTGCGGTAAAAGTACCGT   77  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    157792-2.2.1.1.1    True    2.2.1.1.1   157792  True    heidelberg

    CCGCTGCTTTCTGAAATCGCGCGTCGTTTCAAC   67  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    293728-2.2.1.1  True    2.2.1.1 293728  True    heidelberg

    GAATAACAGCAAAGTGATCATGATGCCGCTGGA   91  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    607438-2.2.1    True    2.2.1   607438  True    heidelberg

    CAGTTTTACATCCTGCGAAATGCGCAGCGTCAA   87  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    691203-2.2.1.1  True    2.2.1.1 691203  True    heidelberg

    CAGGAGAAAGGATGCCAGGGTCAACACGTAAAC   33  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    944885-2.2.1.1.1    True    2.2.1.1.1   944885  True    heidelberg

    [Next 200 lines omitted.]
    

Wrapper written by Matthew Gopez at the Public Health Agency of Canada, National Microbiology Laboratory.
    ]]></help>
    <citations>
    </citations>
</tool>