Mercurial > repos > nml > bio_hansel

comparison bio_hansel.xml @ 1:ba271365095e draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/phac-nml/bio_hansel commit a0204b99a722240fe9b03b78a0786b30aa8ecc96
author nml
date Wed, 11 Oct 2017 12:35:50 -0400
parents 9407a9eaad22
children 09ebaa5192ab
comparison
equal deleted inserted replaced
0:9407a9eaad22 1:ba271365095e
1 <tool id="bio_hansel" name="Hansel - Salmonella Subtyping" version="0.1.0"> 1 <tool id="bio_hansel" name="Salmonella Subtyping" version="0.1.2">
2 <description>Genome assemblies and/or whole-genome sequencing readset</description>
2 <requirements> 3 <requirements>
3 <requirement type="package" version="0.1.0">bio_hansel</requirement> 4 <requirement type="package" version="0.1.0">bio_hansel</requirement>
4 <requirement type="package" version="17.2.0">attrs</requirement> 5 <requirement type="package" version="17.2.0">attrs</requirement>
5 </requirements> 6 </requirements>
6 <command detect_errors="exit_code"><![CDATA[ 7 <command detect_errors="exit_code"><![CDATA[
7 ## Variables to be set.
8 #set outputResultsName = 'results.tab'
9 #set outputMatchResultsName = 'match_results.tab'
10 #set verboseDebuggingLevel = '-vvv'
11
12 ## Preparing file input. 8 ## Preparing file input.
13 #if $single_or_paired.type == "paired": 9 #if $data_type.type == "paired":
14 10
15 ln -s '$single_or_paired.fastq_input1' fast_q_paired_1.fastq && 11 ln -s '$data_type.fastq_input1' '$data_type.fastq_input1.name' &&
16 ln -s '$single_or_paired.fastq_input2' fast_q_paired_2.fastq && 12 ln -s '$data_type.fastq_input2' '$data_type.fastq_input2.name' &&
17 13
18 #elif $single_or_paired.type == "collection": 14 #elif $data_type.type == "collection":
19 15
20 ln -s '$single_or_paired.fastq_input1.forward' fast_q_paired_1.fastq && 16 ln -s '$data_type.fastq_input1.forward' '$data_type.fastq_input1.forward.name' &&
21 ln -s '$single_or_paired.fastq_input1.reverse' fast_q_paired_2.fastq && 17 ln -s '$data_type.fastq_input1.reverse' '$data_type.fastq_input1.reverse.name' &&
22 18
23 #elif $single_or_paired.type == "single": 19 #elif $data_type.type == "single":
24 20
25 #if $single_or_paired.fastq_input1.is_of_type('fastqsanger') or $single_or_paired.fastq_input1.is_of_type('fastq'): 21 #if $data_type.fastq_input1.is_of_type('fastqsanger') or $data_type.fastq_input1.is_of_type('fastq'):
26 ln -s '$single_or_paired.fastq_input1' fast_q_single.fastq && 22 ln -s '$data_type.fastq_input1' '$data_type.fastq_input1.name' &&
27 #end if 23 #end if
28 24
29 #if $single_or_paired.fastq_input1.is_of_type('fasta'): 25 #if $data_type.fastq_input1.is_of_type('fasta'):
30 ln -s '$single_or_paired.fastq_input1' fast_a_single.fasta && 26 ln -s '$data_type.fastq_input1' '$data_type.fastq_input1.name' &&
31 #end if 27 #end if
32 28
33 #end if 29 #end if
34 30
35 31
36 ## Checking for custom scheme. 32 ## Checking for custom scheme.
37 #if $type_of_scheme.scheme_type == "custom": 33 #if $type_of_scheme.scheme_type == "custom":
38 #if $type_of_scheme.scheme_input.is_of_type('fasta'): 34 #if $type_of_scheme.scheme_input.is_of_type('fasta'):
39 ln -s '$type_of_scheme.scheme_input' custom_scheme.fasta && 35 ln -s '$type_of_scheme.scheme_input' '$type_of_scheme.scheme_input.name' &&
40 #end if 36 #end if
41 #end if 37 #end if
42
43 38
44 ## Start the actual command here 39 ## Start the actual command here
45 hansel 40 hansel
46 41
47 42
51 #if $type_of_scheme.scheme_type == "heidelberg": 46 #if $type_of_scheme.scheme_type == "heidelberg":
52 heidelberg 47 heidelberg
53 #elif $type_of_scheme.scheme_type == "enteritidis": 48 #elif $type_of_scheme.scheme_type == "enteritidis":
54 enteritidis 49 enteritidis
55 #elif $type_of_scheme.scheme_type == "custom": 50 #elif $type_of_scheme.scheme_type == "custom":
56 custom_scheme.fasta 51 '$type_of_scheme.scheme_input.name'
57 #end if 52 #end if
58 53
59 54
60 #if $kmer_min 55 #if $kmer_min
61 --min-kmer-freq $kmer_min 56 --min-kmer-freq $kmer_min
64 #if $kmer_max 59 #if $kmer_max
65 --max-kmer-freq $kmer_max 60 --max-kmer-freq $kmer_max
66 #end if 61 #end if
67 62
68 ## Adding more parameters to the command. 63 ## Adding more parameters to the command.
69 $verboseDebuggingLevel -t "\${GALAXY_SLOTS:-1}" -o $outputResultsName -O $outputMatchResultsName 64 -vvv -t "\${GALAXY_SLOTS:-1}" -o results.tab -O match_results.tab
70 65
71 66
72 ## Entering the file inputs. 67 ## Entering the file inputs
73 #if $single_or_paired.type == "single": 68
74 69 #if $data_type.type == "single":
75 #if $single_or_paired.fastq_input1.is_of_type('fastqsanger') or $single_or_paired.fastq_input1.is_of_type('fastq'): 70 '$data_type.fastq_input1.name'
76 fast_q_single.fastq 71
77 #end if 72 #elif $data_type.type =="collection":
78 73 -p '$data_type.fastq_input1.forward.name' '$data_type.fastq_input1.reverse.name'
79 #if $single_or_paired.fastq_input1.is_of_type('fasta'): 74
80 fast_a_single.fasta 75 #elif $data_type.type =="paired":
81 #end if 76 -p '$data_type.fastq_input1.name' '$data_type.fastq_input2.name'
82 77
83 #else 78 #end if
84 79
85 ##use -p to declare using two files. 80
86 -p fast_q_paired_1.fastq fast_q_paired_2.fastq
87
88 #end if
89 ]]></command> 81 ]]></command>
90 <inputs> 82 <inputs>
91 <conditional name="single_or_paired"> 83 <conditional name="data_type">
92 <param name="type" type="select" label="Specify the read type."> 84 <param name="type" type="select" label="Specify the read type.">
93 <option value="single">Single-end Data</option> 85 <option value="single">Single-end Data</option>
94 <option value="paired">Paired-end Data</option> 86 <option value="paired">Paired-end Data</option>
95 <option value="collection">Collection Paired-end Data</option> 87 <option value="collection">Collection Paired-end Data</option>
96 </param> 88 </param>
124 <data format="tabular" name="results.tab" from_work_dir="results.tab" label="results.tab"/> 116 <data format="tabular" name="results.tab" from_work_dir="results.tab" label="results.tab"/>
125 <data format="tabular" name="match_results.tab" from_work_dir="match_results.tab" label="match_results.tab"/> 117 <data format="tabular" name="match_results.tab" from_work_dir="match_results.tab" label="match_results.tab"/>
126 </outputs> 118 </outputs>
127 <tests> 119 <tests>
128 <test> 120 <test>
129 <param name="single_or_paired" value="single"/> 121 <param name="type" value="single"/>
130 <param name="type_of_scheme" value="heidelberg"/> 122 <param name="type_of_scheme" value="heidelberg"/>
131 <param name="fastq_input1" value="SRR1002850_SMALL.fasta"/> 123 <param name="fastq_input1" value="SRR1002850_SMALL.fasta"/>
132 <output name="results.tab"> 124 <output name="results.tab">
133 <assert_contents> 125 <assert_contents>
134 <!-- Verifying that the columns are as expected. --> 126 <!-- Verifying that the columns are as expected. -->
142 <!-- This is the last line in the file, this assertion is to make sure that we have the correct number of items. --> 134 <!-- This is the last line in the file, this assertion is to make sure that we have the correct number of items. -->
143 <has_text_matching expression="negative4738855-1.1"/> 135 <has_text_matching expression="negative4738855-1.1"/>
144 </assert_contents> 136 </assert_contents>
145 </output> 137 </output>
146 </test> 138 </test>
139 <test>
140 <param name="type" value="paired"/>
141 <param name="type_of_scheme" value="heidelberg"/>
142 <param name="fastq_input1" value="SRR5646583_SMALL_1.fastq"/>
143 <param name="fastq_input2" value="SRR5646583_SMALL_2.fastq"/>
144 <output name="results.tab">
145 <assert_contents>
146 <!-- Verifying that the columns are as expected. -->
147 <has_text_matching expression="sample\s+scheme\s+subtype\s+all_subtypes\s+tiles_matching_subtype\s+are_subtypes_consistent\s+inconsistent_subtypes\s+n_tiles_matching_all\s+n_tiles_matching_all_total\s+n_tiles_matching_positive\s+n_tiles_matching_positive_total\s+n_tiles_matching_subtype\s+n_tiles_matching_subtype_total\s+file_path"/>
148 <!-- Verifying that the output of running the test file is expected. This is done via REGEX because the name and path of the file outputted to results.tab changes each test. -->
149 <has_text_matching expression="(heidelberg)\s+(2.2.1.1.1.1)\s+(2;)\s+(2.2;)\s+(2.2.1;)\s+(2.2.1.1;)\s+(2.2.1.1.1;)\s+(2.2.1.1.1.1)\s+(1983064-2.2.1.1.1.1;)\s+(4211912-2.2.1.1.1.1)\s+(True)\s+(202)\s+(202)\s+(20)\s+(20)\s+(2)\s+(2)"/>
150 </assert_contents>
151 </output>
152 </test>
147 </tests> 153 </tests>
148 <help><![CDATA[ 154 <help><![CDATA[
149 *********************************************************** 155 ***********************************************************
150 bio_hansel - Heidelberg And eNteritidis Snp ELucidation 156 bio_hansel - Heidelberg And eNteritidis Snp ELucidation
151 *********************************************************** 157 ***********************************************************
152 158
153 Subtype *Salmonella enterica* subsp. enterica serovar Heidelberg and Enteritidis genomes using *in-silico* 33 bp k-mer SNP subtyping schemes developed by Genevieve Labbe et al. 159 Subtype *Salmonella enterica* subsp. enterica serovar Heidelberg and Enteritidis genomes using *in-silico* 33 bp k-mer SNP subtyping schemes developed by Genevieve Labbe et al.
154 Subtype *Salmonella* genome assemblies (FASTA files) and/or whole-genome sequencing reads (FASTQ files)! 160 Subtype *Salmonella* genome assemblies (FASTA files) and/or whole-genome sequencing reads (FASTQ files)!
155
156 Github
157 ========
158 https://github.com/phac-nml/bio_hansel
159
160 Citation
161 ========
162
163 If you find this tool useful, please cite as:
164
165 .. epigraph::
166
167 A robust genotyping scheme for *Salmonella enterica* serovar Heidelberg clones circulating in North America.
168 Geneviève Labbé, James Robertson, Peter Kruczkiewicz, Chad R. Laing, Kim Ziebell, Aleisha R. Reimer, Lorelee Tschetter, Gary Van Domselaar, Sadjia Bekal, Kimberley A. MacDonald, Linda Hoang, Linda Chui, Danielle Daignault, Durda Slavic, Frank Pollari, E. Jane Parmley, Philip Mabon, Elissa Giang, Lok Kan Lee, Jonathan Moffat, Marisa Rankin, Joanne MacKinnon, Roger Johnson, John H.E. Nash.
169 [Manuscript in preparation]
170 161
171 Usage 162 Usage
172 ===== 163 =====
173 Enter your FASTQ/FASTA read files, select which scheme you would like to use (e.g. heidelberg, enteritidis, etc...) or specify your own. Finally, click execute. 164 1) Enter your FASTA/FASTQ file(s)
165 2) Select which scheme you would like to use (e.g. heidelberg, enteritidis, or specify your own)
166 3) Click Execute
167
168 For more information visit `https://github.com/phac-nml/bio_hansel`
174 169
175 170
176 Example Usage 171 Example Usage
177 ============= 172 =============
178 173
180 ------------------------------- 175 -------------------------------
181 176
182 177
183 Contents of ``results.tab``: 178 Contents of ``results.tab``:
184 179
185 sample scheme subtype all_subtypes tiles_matching_subtype are_subtypes_consistent inconsistent_subtypes n_tiles_matching_all n_tiles_matching_all_total n_tiles_matching_positive n_tiles_matching_positive_total n_tiles_matching_subtype n_tiles_matching_subtype_total file_path 180 +------------+------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------+
186 181 | sample | scheme | subtype | all_subtypes | tiles_matching_subtype | are_subtypes_consistent | inconsistent_subtypes | n_tiles_matching_all | n_tiles_matching_all_total | n_tiles_matching_positive | n_tiles_matching_positive_total | n_tiles_matching_subtype | n_tiles_matching_subtype_total | file_path |
187 SRR1002850 heidelberg 2.2.2.2.1.4 2; 2.2; 2.2.2; 2.2.2.2; 2.2.2.2.1; 2.2.2.2.1.4 1037658-2.2.2.2.1.4; 2154958-2.2.2.2.1.4; 3785187-2.2.2.2.1.4 True 202 202 17 17 3 3 SRR1002850.fasta 182 +------------+------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------+
183 | file.fasta | heidelberg | 2.2.2.2.1.4 | 2; 2.2; 2.2.2; 2.2.2.2; 2.2.2.2.1; 2.2.2.2.1.4 | 1037658-2.2.2.2.1.4; 2154958-2.2.2.2.1.4; 3785187-2.2.2.2.1.4 | True | | 202 | 202 | 17 | 17 | 3 | 3 | file.fasta |
184 +------------+------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------+
185
188 186
189 187
190 Contents of ``match_results.tab``: 188 Contents of ``match_results.tab``:
191 189
192 tilename stitle pident length mismatch gapopen qstart qend sstart send evalue bitscore qlen slen seq coverage is_trunc refposition subtype is_pos_tile sample file_path scheme 190 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
193 191 | tilename | stitle | pident | length | mismatch | gapopen | qstart | qend | sstart | send | evalue | bitscore | qlen | slen | seq | coverage | is_trunc | refposition | subtype | is_pos_tile | sample | file_path | scheme |
194 775920-2.2.2.2 NODE_2_length_512016_cov_46.4737_ID_3 100.0 33 0 0 1 33 474875 474907 2.0000000000000002e-11 62.1 33 512016 GTTCAGGTGCTACCGAGGATCGTTTTTGGTGCG 1.0 False 775920 2.2.2.2 192 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
195 193 | 775920-2.2.2.2 | NODE_2_length_512016_cov_46.4737_ID_3 | 100 | 33 | 0 | 0 | 1 | 33 | 474875 | 474907 | 2E-11 | 62.1 | 33 | 512016 | GTTCAGGTGCTACCGAGGATCGTTTTTGGTGCG | 1 | False | 775920 | 2.2.2.2 | True | out | file.fasta | heidelberg |
196 True SRR1002850 SRR1002850.fasta heidelberg 194 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
197 195 | negative3305400-2.1.1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 276235 | 276267 | 2E-11 | 62.1 | 33 | 427905 | CATCGTGAAGCAGAACAGACGCGCATTCTTGCT | 1 | False | negative3305400 | 2.1.1.1 | False | out | file.fasta | heidelberg |
198 negative3305400-2.1.1.1 NODE_3_length_427905_cov_48.1477_ID_5 100.0 33 0 0 1 33 276235 276267 2.0000000000000002e-11 62.1 33 427905 CATCGTGAAGCAGAACAGACGCGCATTCTTGCT 1.0 False 196 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
199 197 | negative3200083-2.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 170918 | 170950 | 2E-11 | 62.1 | 33 | 427905 | ACCCGGTCTACCGCAAAATGGAAAGCGATATGC | 1 | False | negative3200083 | 2.1 | False | out | file.fasta | heidelberg |
200 negative3305400 2.1.1.1 False SRR1002850 SRR1002850.fasta heidelberg 198 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
201 199 | negative3204925-2.2.3.1.5 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 175760 | 175792 | 2E-11 | 62.1 | 33 | 427905 | CTCGCTGGCAAGCAGTGCGGGTACTATCGGCGG | 1 | False | negative3204925 | 2.2.3.1.5 | False | out | file.fasta | heidelberg |
202 negative3200083-2.1 NODE_3_length_427905_cov_48.1477_ID_5 100.0 33 0 0 1 33 170918 170950 2.0000000000000002e-11 62.1 33 427905 ACCCGGTCTACCGCAAAATGGAAAGCGATATGC 1.0 False 200 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
203 201 | negative3230678-2.2.2.1.1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 201513 | 201545 | 2E-11 | 62.1 | 33 | 427905 | AGCGGTGCGCCAAACCACCCGGAATGATGAGTG | 1 | False | negative3230678 | 2.2.2.1.1.1 | False | out | file.fasta | heidelberg |
204 negative3200083 2.1 False SRR1002850 SRR1002850.fasta heidelberg 202 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
205 203 | negative3233869-2.1.1.1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 204704 | 204736 | 2E-11 | 62.1 | 33 | 427905 | CAGCGCTGGTATGTGGCTGCACCATCGTCATTA | 1 | False | negative3233869 | 2.1.1.1.1 | False | out | file.fasta | heidelberg |
206 negative3204925-2.2.3.1.5 NODE_3_length_427905_cov_48.1477_ID_5 100.0 33 0 0 1 33 175760 175792 2.0000000000000002e-11 62.1 33 427905 CTCGCTGGCAAGCAGTGCGGGTACTATCGGCGG 1.0 False 204 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
207 205 | negative3254229-2.2.3.1.3 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 225064 | 225096 | 2E-11 | 62.1 | 33 | 427905 | CGCCACCACGCGGTTAGCGTCACGCTGACATTC | 1 | False | negative3254229 | 2.2.3.1.3 | False | out | file.fasta | heidelberg |
208 negative3204925 2.2.3.1.5 False SRR1002850 SRR1002850.fasta heidelberg 206 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
209 207 | negative3257074-2.2.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 227909 | 227941 | 2E-11 | 62.1 | 33 | 427905 | CGGCAACCAGACCGACTACGCCGCCAAGCAGAC | 1 | False | negative3257074 | 2.2.1 | False | out | file.fasta | heidelberg |
210 negative3230678-2.2.2.1.1.1 NODE_3_length_427905_cov_48.1477_ID_5 100.0 33 0 0 1 33 201513 201545 2.0000000000000002e-11 62.1 33 427905 AGCGGTGCGCCAAACCACCCGGAATGATGAGTG 1.0 False 208 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
211 209 | negative3264474-2.2.2.1.1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 235309 | 235341 | 2E-11 | 62.1 | 33 | 427905 | AATGGCGCCGATCGTCGCCAGATAACCGTTGCC | 1 | False | negative3264474 | 2.2.2.1.1.1 | False | out | file.fasta | heidelberg |
212 negative3230678 2.2.2.1.1.1 False SRR1002850 SRR1002850.fasta heidelberg 210 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
213 211 | negative3267927-2.2.2.2.2.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 238762 | 238794 | 2E-11 | 62.1 | 33 | 427905 | AAAGAGAAATATGATGCCAGGCTGATACATGAC | 1 | False | negative3267927 | 2.2.2.2.2.1 | False | out | file.fasta | heidelberg |
214 negative3233869-2.1.1.1.1 NODE_3_length_427905_cov_48.1477_ID_5 100.0 33 0 0 1 33 204704 204736 2.0000000000000002e-11 62.1 33 427905 CAGCGCTGGTATGTGGCTGCACCATCGTCATTA 1.0 False 212 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
215 213 | negative3278067-1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 248902 | 248934 | 2E-11 | 62.1 | 33 | 427905 | TGTGAGTAAGTTGCGCGATATTCTGCTGGATTC | 1 | False | negative3278067 | 1.1 | False | out | file.fasta | heidelberg |
216 [Next 196 lines omitted.] 214 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
215 | negative3299717-2.2.3.1.4 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 270552 | 270584 | 2E-11 | 62.1 | 33 | 427905 | ATGCCGGACAGCAGGCGAAACTCGAACCGGATA | 1 | False | negative3299717 | 2.2.3.1.4 | False | out | file.fasta | heidelberg |
216 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
217 | negative3373069-2.2.2.2.1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100 | 33 | 0 | 0 | 1 | 33 | 344011 | 344043 | 2E-11 | 62.1 | 33 | 427905 | CTCTCCAGAAGATGAAGCCCGTGATGCGGCGCA | 1 | False | negative3373069 | 2.2.2.2.1.1 | False | out | file.fasta | heidelberg |
218 +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
219
220 Next 196 lines omitted.
221
217 222
218 223
219 Analysis of a single FASTQ readset 224 Analysis of a single FASTQ readset
220 ---------------------------------- 225 ----------------------------------
221 226
222 Contents of ``results.tab``: 227 Contents of ``results.tab``:
223 228
224 sample scheme subtype all_subtypes tiles_matching_subtype are_subtypes_consistent inconsistent_subtypes n_tiles_matching_all n_tiles_matching_all_total n_tiles_matching_positive n_tiles_matching_positive_total n_tiles_matching_subtype n_tiles_matching_subtype_total file_path 229 +--------+------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------------------------------------+
225 230 | sample | scheme | subtype | all_subtypes | tiles_matching_subtype | are_subtypes_consistent | inconsistent_subtypes | n_tiles_matching_all | n_tiles_matching_all_total | n_tiles_matching_positive | n_tiles_matching_positive_total | n_tiles_matching_subtype | n_tiles_matching_subtype_total | file_path |
226 SRR5646583 heidelberg 2.2.1.1.1.1 2; 2.2; 2.2.1; 2.2.1.1; 2.2.1.1.1; 2.2.1.1.1.1 1983064-2.2.1.1.1.1; 4211912-2.2.1.1.1.1 True 202 202 20 20 2 2 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 231 +--------+------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------------------------------------+
232 | 564 | heidelberg | 2.2.1.1.1.1 | 2; 2.2; 2.2.1; 2.2.1.1; 2.2.1.1.1; 2.2.1.1.1.1 | 1983064-2.2.1.1.1.1; 4211912-2.2.1.1.1.1 | True | | 202 | 202 | 20 | 20 | 2 | 2 | forward.fastqsanger; reverse.fastqsanger |
233 +--------+------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------------------------------------+
227 234
228 235
229 Contents of ``match_results.tab``: 236 Contents of ``match_results.tab``:
230 237
231 seq freq sample file_path tilename is_pos_tile subtype refposition is_kmer_freq_okay scheme 238 +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
232 239 | seq | freq | sample | file_path | tilename | is_pos_tile | subtype | refposition | is_kmer_freq_okay | scheme |
233 ACGGTAAAAGAGGACTTGACTGGCGCGATTTGC 68 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 21097-2.2.1.1.1 True 2.2.1.1.1 21097 True heidelberg 240 +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
234 241 | ACGGTAAAAGAGGACTTGACTGGCGCGATTTGC | 68 | 564 | forward.fastqsanger; reverse.fastqsanger | 21097-2.2.1.1.1 | True | 2.2.1.1.1 | 21097 | True | heidelberg |
235 AACCGGCGGTATTGGCTGCGGTAAAAGTACCGT 77 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 157792-2.2.1.1.1 True 2.2.1.1.1 157792 True heidelberg 242 +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
236 243 | AACCGGCGGTATTGGCTGCGGTAAAAGTACCGT | 77 | 564 | forward.fastqsanger; reverse.fastqsanger | 157792-2.2.1.1.1 | True | 2.2.1.1.1 | 157792 | True | heidelberg |
237 CCGCTGCTTTCTGAAATCGCGCGTCGTTTCAAC 67 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 293728-2.2.1.1 True 2.2.1.1 293728 True heidelberg 244 +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
238 245 | CCGCTGCTTTCTGAAATCGCGCGTCGTTTCAAC | 67 | 564 | forward.fastqsanger; reverse.fastqsanger | 293728-2.2.1.1 | True | 2.2.1.1 | 293728 | True | heidelberg |
239 GAATAACAGCAAAGTGATCATGATGCCGCTGGA 91 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 607438-2.2.1 True 2.2.1 607438 True heidelberg 246 +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
240 247 | GAATAACAGCAAAGTGATCATGATGCCGCTGGA | 91 | 564 | forward.fastqsanger; reverse.fastqsanger | 607438-2.2.1 | True | 2.2.1 | 607438 | True | heidelberg |
241 CAGTTTTACATCCTGCGAAATGCGCAGCGTCAA 87 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 691203-2.2.1.1 True 2.2.1.1 691203 True heidelberg 248 +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
242 249 | CAGTTTTACATCCTGCGAAATGCGCAGCGTCAA | 87 | 564 | forward.fastqsanger; reverse.fastqsanger | 691203-2.2.1.1 | True | 2.2.1.1 | 691203 | True | heidelberg |
243 CAGGAGAAAGGATGCCAGGGTCAACACGTAAAC 33 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 944885-2.2.1.1.1 True 2.2.1.1.1 944885 True heidelberg 250 +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
244 251 | CAGGAGAAAGGATGCCAGGGTCAACACGTAAAC | 33 | 564 | forward.fastqsanger; reverse.fastqsanger | 944885-2.2.1.1.1 | True | 2.2.1.1.1 | 944885 | True | heidelberg |
245 [Next 200 lines omitted.] 252 +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
246 253
247 254 Next 200 lines omitted.
248 Wrapper written by Matthew Gopez at the Public Health Agency of Canada, National Microbiology Laboratory. 255
256 Galaxy wrapper written by Matthew Gopez at the Public Health Agency of Canada, National Microbiology Laboratory.
257
249 ]]></help> 258 ]]></help>
250 <citations> 259 <citations>
260 <citation type="bibtex">@ARTICLE{a1,
261 title = {A robust genotyping scheme for *Salmonella enterica* serovar Heidelberg clones circulating in North America.},
262 author = {Geneviève Labbé, James Robertson, Peter Kruczkiewicz, Chad R. Laing, Kim Ziebell, Aleisha R. Reimer, Lorelee Tschetter, Gary Van Domselaar, Sadjia Bekal, Kimberley A. MacDonald, Linda Hoang, Linda Chui, Danielle Daignault, Durda Slavic, Frank Pollari, E. Jane Parmley, Philip Mabon, Elissa Giang, Lok Kan Lee, Jonathan Moffat, Marisa Rankin, Joanne MacKinnon, Roger Johnson, John H.E. Nash.},
263 url = {https://github.com/phac-nml/bio_hansel}
264 }
265 }</citation>
251 </citations> 266 </citations>
252 </tool> 267 </tool>