changeset 1:ba271365095e draft

planemo upload for repository https://github.com/phac-nml/bio_hansel commit a0204b99a722240fe9b03b78a0786b30aa8ecc96
author nml
date Wed, 11 Oct 2017 12:35:50 -0400
parents 9407a9eaad22
children 09ebaa5192ab
files bio_hansel.xml test-data/SRR5646583_SMALL_1.fastq test-data/SRR5646583_SMALL_2.fastq
diffstat 3 files changed, 40112 insertions(+), 97 deletions(-) [+]
line wrap: on
line diff
--- a/bio_hansel.xml	Wed Sep 27 11:50:41 2017 -0400
+++ b/bio_hansel.xml	Wed Oct 11 12:35:50 2017 -0400
@@ -1,33 +1,29 @@
-<tool id="bio_hansel" name="Hansel - Salmonella Subtyping" version="0.1.0">
+<tool id="bio_hansel" name="Salmonella Subtyping" version="0.1.2">
+    <description>Genome assemblies and/or whole-genome sequencing readset</description>
     <requirements>
         <requirement type="package" version="0.1.0">bio_hansel</requirement>
         <requirement type="package" version="17.2.0">attrs</requirement>
     </requirements>
     <command detect_errors="exit_code"><![CDATA[
-        ## Variables to be set.
-        #set outputResultsName = 'results.tab'
-        #set outputMatchResultsName = 'match_results.tab'
-        #set verboseDebuggingLevel = '-vvv'
+        ## Preparing file input.
+        #if $data_type.type == "paired":
 
-        ## Preparing file input.
-        #if $single_or_paired.type == "paired":
+            ln -s '$data_type.fastq_input1' '$data_type.fastq_input1.name' &&
+            ln -s '$data_type.fastq_input2' '$data_type.fastq_input2.name' &&
+
+        #elif $data_type.type == "collection":
 
-            ln -s '$single_or_paired.fastq_input1' fast_q_paired_1.fastq &&
-            ln -s '$single_or_paired.fastq_input2' fast_q_paired_2.fastq &&
-
-        #elif $single_or_paired.type == "collection":
+            ln -s '$data_type.fastq_input1.forward' '$data_type.fastq_input1.forward.name' &&
+            ln -s '$data_type.fastq_input1.reverse' '$data_type.fastq_input1.reverse.name' &&
 
-            ln -s '$single_or_paired.fastq_input1.forward' fast_q_paired_1.fastq &&
-            ln -s '$single_or_paired.fastq_input1.reverse' fast_q_paired_2.fastq &&
+        #elif $data_type.type == "single":
 
-        #elif $single_or_paired.type == "single":
-
-            #if $single_or_paired.fastq_input1.is_of_type('fastqsanger') or $single_or_paired.fastq_input1.is_of_type('fastq'):
-                ln -s '$single_or_paired.fastq_input1' fast_q_single.fastq &&
+            #if $data_type.fastq_input1.is_of_type('fastqsanger') or $data_type.fastq_input1.is_of_type('fastq'):
+                ln -s '$data_type.fastq_input1' '$data_type.fastq_input1.name' &&
             #end if
 
-            #if $single_or_paired.fastq_input1.is_of_type('fasta'):
-                ln -s '$single_or_paired.fastq_input1' fast_a_single.fasta &&
+            #if $data_type.fastq_input1.is_of_type('fasta'):
+                ln -s '$data_type.fastq_input1' '$data_type.fastq_input1.name' &&
             #end if
 
         #end if
@@ -36,11 +32,10 @@
         ## Checking for custom scheme.
         #if $type_of_scheme.scheme_type == "custom":
             #if $type_of_scheme.scheme_input.is_of_type('fasta'):
-                ln -s '$type_of_scheme.scheme_input' custom_scheme.fasta &&
+                ln -s '$type_of_scheme.scheme_input' '$type_of_scheme.scheme_input.name' &&
             #end if
         #end if
 
-
         ## Start the actual command here
         hansel 
 
@@ -53,7 +48,7 @@
         #elif $type_of_scheme.scheme_type == "enteritidis":
             enteritidis
         #elif $type_of_scheme.scheme_type == "custom":
-            custom_scheme.fasta
+            '$type_of_scheme.scheme_input.name'
         #end if
 
 
@@ -66,29 +61,26 @@
         #end if
 
         ## Adding more parameters to the command.
-        $verboseDebuggingLevel -t "\${GALAXY_SLOTS:-1}" -o $outputResultsName -O $outputMatchResultsName 
+        -vvv -t "\${GALAXY_SLOTS:-1}" -o results.tab -O match_results.tab 
 
 
-        ## Entering the file inputs.
-        #if $single_or_paired.type == "single":
+        ## Entering the file inputs
 
-            #if $single_or_paired.fastq_input1.is_of_type('fastqsanger') or $single_or_paired.fastq_input1.is_of_type('fastq'):
-                fast_q_single.fastq
-            #end if
+        #if $data_type.type == "single":
+            '$data_type.fastq_input1.name'
 
-            #if $single_or_paired.fastq_input1.is_of_type('fasta'):
-                fast_a_single.fasta
-            #end if
-
-        #else
-
-            ##use -p to declare using two files.
-            -p fast_q_paired_1.fastq  fast_q_paired_2.fastq
+        #elif $data_type.type =="collection":
+            -p '$data_type.fastq_input1.forward.name'  '$data_type.fastq_input1.reverse.name'
+        
+        #elif $data_type.type =="paired":
+            -p '$data_type.fastq_input1.name'  '$data_type.fastq_input2.name'
 
         #end if
+
+
     ]]></command>
     <inputs>
-        <conditional name="single_or_paired">
+        <conditional name="data_type">
             <param name="type" type="select" label="Specify the read type.">
                 <option value="single">Single-end Data</option>
                 <option value="paired">Paired-end Data</option>
@@ -126,7 +118,7 @@
     </outputs>
     <tests>
         <test>
-            <param name="single_or_paired" value="single"/>
+            <param name="type" value="single"/>
             <param name="type_of_scheme" value="heidelberg"/>
             <param name="fastq_input1" value="SRR1002850_SMALL.fasta"/>
             <output name="results.tab">
@@ -144,6 +136,20 @@
                 </assert_contents>
             </output>
         </test>
+        <test>
+            <param name="type" value="paired"/>
+            <param name="type_of_scheme" value="heidelberg"/>
+            <param name="fastq_input1" value="SRR5646583_SMALL_1.fastq"/>
+            <param name="fastq_input2" value="SRR5646583_SMALL_2.fastq"/>
+            <output name="results.tab">
+                <assert_contents>
+                    <!-- Verifying that the columns are as expected. -->
+                    <has_text_matching expression="sample\s+scheme\s+subtype\s+all_subtypes\s+tiles_matching_subtype\s+are_subtypes_consistent\s+inconsistent_subtypes\s+n_tiles_matching_all\s+n_tiles_matching_all_total\s+n_tiles_matching_positive\s+n_tiles_matching_positive_total\s+n_tiles_matching_subtype\s+n_tiles_matching_subtype_total\s+file_path"/>
+                    <!-- Verifying that the output of running the test file is expected. This is done via REGEX because the name and path of the file outputted to results.tab changes each test. -->
+                    <has_text_matching expression="(heidelberg)\s+(2.2.1.1.1.1)\s+(2;)\s+(2.2;)\s+(2.2.1;)\s+(2.2.1.1;)\s+(2.2.1.1.1;)\s+(2.2.1.1.1.1)\s+(1983064-2.2.1.1.1.1;)\s+(4211912-2.2.1.1.1.1)\s+(True)\s+(202)\s+(202)\s+(20)\s+(20)\s+(2)\s+(2)"/>
+                </assert_contents>
+            </output>
+        </test>
     </tests>
     <help><![CDATA[
 ***********************************************************
@@ -152,25 +158,14 @@
 
 Subtype *Salmonella enterica* subsp. enterica serovar Heidelberg and Enteritidis genomes using *in-silico* 33 bp k-mer SNP subtyping schemes developed by Genevieve Labbe et al.
 Subtype *Salmonella* genome assemblies (FASTA files) and/or whole-genome sequencing reads (FASTQ files)!
-
-Github
-========
-https://github.com/phac-nml/bio_hansel
-
-Citation
-========
-
-If you find this tool useful, please cite as:
-
-    .. epigraph::
-
-        A robust genotyping scheme for *Salmonella enterica* serovar Heidelberg clones circulating in North America.
-        Geneviève Labbé, James Robertson, Peter Kruczkiewicz, Chad R. Laing, Kim Ziebell, Aleisha R. Reimer, Lorelee Tschetter, Gary Van Domselaar, Sadjia Bekal, Kimberley A. MacDonald, Linda Hoang, Linda Chui, Danielle Daignault, Durda Slavic, Frank Pollari, E. Jane Parmley, Philip Mabon, Elissa Giang, Lok Kan Lee, Jonathan Moffat, Marisa Rankin, Joanne MacKinnon, Roger Johnson, John H.E. Nash.
-        [Manuscript in preparation]
  
 Usage
 =====
-Enter your FASTQ/FASTA read files, select which scheme you would like to use (e.g. heidelberg, enteritidis, etc...) or specify your own. Finally, click execute.
+1) Enter your FASTA/FASTQ file(s)
+2) Select which scheme you would like to use (e.g. heidelberg, enteritidis, or specify your own)
+3) Click Execute
+
+For more information visit `https://github.com/phac-nml/bio_hansel`
 
 
 Example Usage
@@ -182,38 +177,48 @@
 
 Contents of ``results.tab``:
 
-    sample  scheme  subtype all_subtypes    tiles_matching_subtype  are_subtypes_consistent inconsistent_subtypes   n_tiles_matching_all    n_tiles_matching_all_total  n_tiles_matching_positive   n_tiles_matching_positive_total n_tiles_matching_subtype    n_tiles_matching_subtype_total  file_path
+    +------------+------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------+
+    | sample     | scheme     | subtype     | all_subtypes                                   | tiles_matching_subtype                                        | are_subtypes_consistent | inconsistent_subtypes | n_tiles_matching_all | n_tiles_matching_all_total | n_tiles_matching_positive | n_tiles_matching_positive_total | n_tiles_matching_subtype | n_tiles_matching_subtype_total | file_path  |
+    +------------+------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------+
+    | file.fasta | heidelberg | 2.2.2.2.1.4 | 2; 2.2; 2.2.2; 2.2.2.2; 2.2.2.2.1; 2.2.2.2.1.4 | 1037658-2.2.2.2.1.4; 2154958-2.2.2.2.1.4; 3785187-2.2.2.2.1.4 | True                    |                       | 202                  | 202                        | 17                        | 17                              | 3                        | 3                              | file.fasta |
+    +------------+------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------+
 
-    SRR1002850  heidelberg  2.2.2.2.1.4 2; 2.2; 2.2.2; 2.2.2.2; 2.2.2.2.1; 2.2.2.2.1.4  1037658-2.2.2.2.1.4; 2154958-2.2.2.2.1.4; 3785187-2.2.2.2.1.4   True        202 202 17  17  3   3   SRR1002850.fasta
 
 
 Contents of ``match_results.tab``:
 
-    tilename    stitle  pident  length  mismatch    gapopen qstart  qend    sstart  send    evalue  bitscore    qlen    slen    seq coverage    is_trunc    refposition subtype is_pos_tile sample  file_path   scheme
-
-    775920-2.2.2.2  NODE_2_length_512016_cov_46.4737_ID_3   100.0   33  0   0   1   33  474875  474907  2.0000000000000002e-11  62.1    33  512016  GTTCAGGTGCTACCGAGGATCGTTTTTGGTGCG   1.0 False   775920  2.2.2.2 
-
-    True    SRR1002850  SRR1002850.fasta   heidelberg
-
-    negative3305400-2.1.1.1 NODE_3_length_427905_cov_48.1477_ID_5   100.0   33  0   0   1   33  276235  276267  2.0000000000000002e-11  62.1    33  427905  CATCGTGAAGCAGAACAGACGCGCATTCTTGCT   1.0 False   
-
-    negative3305400 2.1.1.1 False   SRR1002850  SRR1002850.fasta   heidelberg
-
-    negative3200083-2.1 NODE_3_length_427905_cov_48.1477_ID_5   100.0   33  0   0   1   33  170918  170950  2.0000000000000002e-11  62.1    33  427905  ACCCGGTCTACCGCAAAATGGAAAGCGATATGC   1.0 False   
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | tilename                    | stitle                                | pident | length | mismatch | gapopen | qstart | qend | sstart | send   | evalue | bitscore | qlen | slen   | seq                               | coverage | is_trunc | refposition     | subtype     | is_pos_tile | sample | file_path  | scheme     |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | 775920-2.2.2.2              | NODE_2_length_512016_cov_46.4737_ID_3 | 100    | 33     | 0        | 0       | 1      | 33   | 474875 | 474907 | 2E-11  | 62.1     | 33   | 512016 | GTTCAGGTGCTACCGAGGATCGTTTTTGGTGCG | 1        | False    | 775920          | 2.2.2.2     | True        | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3305400-2.1.1.1     | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 276235 | 276267 | 2E-11  | 62.1     | 33   | 427905 | CATCGTGAAGCAGAACAGACGCGCATTCTTGCT | 1        | False    | negative3305400 | 2.1.1.1     | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3200083-2.1         | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 170918 | 170950 | 2E-11  | 62.1     | 33   | 427905 | ACCCGGTCTACCGCAAAATGGAAAGCGATATGC | 1        | False    | negative3200083 | 2.1         | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3204925-2.2.3.1.5   | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 175760 | 175792 | 2E-11  | 62.1     | 33   | 427905 | CTCGCTGGCAAGCAGTGCGGGTACTATCGGCGG | 1        | False    | negative3204925 | 2.2.3.1.5   | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3230678-2.2.2.1.1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 201513 | 201545 | 2E-11  | 62.1     | 33   | 427905 | AGCGGTGCGCCAAACCACCCGGAATGATGAGTG | 1        | False    | negative3230678 | 2.2.2.1.1.1 | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3233869-2.1.1.1.1   | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 204704 | 204736 | 2E-11  | 62.1     | 33   | 427905 | CAGCGCTGGTATGTGGCTGCACCATCGTCATTA | 1        | False    | negative3233869 | 2.1.1.1.1   | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3254229-2.2.3.1.3   | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 225064 | 225096 | 2E-11  | 62.1     | 33   | 427905 | CGCCACCACGCGGTTAGCGTCACGCTGACATTC | 1        | False    | negative3254229 | 2.2.3.1.3   | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3257074-2.2.1       | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 227909 | 227941 | 2E-11  | 62.1     | 33   | 427905 | CGGCAACCAGACCGACTACGCCGCCAAGCAGAC | 1        | False    | negative3257074 | 2.2.1       | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3264474-2.2.2.1.1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 235309 | 235341 | 2E-11  | 62.1     | 33   | 427905 | AATGGCGCCGATCGTCGCCAGATAACCGTTGCC | 1        | False    | negative3264474 | 2.2.2.1.1.1 | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3267927-2.2.2.2.2.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 238762 | 238794 | 2E-11  | 62.1     | 33   | 427905 | AAAGAGAAATATGATGCCAGGCTGATACATGAC | 1        | False    | negative3267927 | 2.2.2.2.2.1 | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3278067-1.1         | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 248902 | 248934 | 2E-11  | 62.1     | 33   | 427905 | TGTGAGTAAGTTGCGCGATATTCTGCTGGATTC | 1        | False    | negative3278067 | 1.1         | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3299717-2.2.3.1.4   | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 270552 | 270584 | 2E-11  | 62.1     | 33   | 427905 | ATGCCGGACAGCAGGCGAAACTCGAACCGGATA | 1        | False    | negative3299717 | 2.2.3.1.4   | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
+    | negative3373069-2.2.2.2.1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 344011 | 344043 | 2E-11  | 62.1     | 33   | 427905 | CTCTCCAGAAGATGAAGCCCGTGATGCGGCGCA | 1        | False    | negative3373069 | 2.2.2.2.1.1 | False       | out    | file.fasta | heidelberg |
+    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
 
-    negative3200083 2.1 False   SRR1002850  SRR1002850.fasta   heidelberg
-
-    negative3204925-2.2.3.1.5   NODE_3_length_427905_cov_48.1477_ID_5   100.0   33  0   0   1   33  175760  175792  2.0000000000000002e-11  62.1    33  427905  CTCGCTGGCAAGCAGTGCGGGTACTATCGGCGG   1.0 False   
-
-    negative3204925 2.2.3.1.5   False   SRR1002850  SRR1002850.fasta   heidelberg
+    Next 196 lines omitted.
 
-    negative3230678-2.2.2.1.1.1 NODE_3_length_427905_cov_48.1477_ID_5   100.0   33  0   0   1   33  201513  201545  2.0000000000000002e-11  62.1    33  427905  AGCGGTGCGCCAAACCACCCGGAATGATGAGTG   1.0 False   
-
-    negative3230678 2.2.2.1.1.1 False   SRR1002850  SRR1002850.fasta   heidelberg
-
-    negative3233869-2.1.1.1.1   NODE_3_length_427905_cov_48.1477_ID_5   100.0   33  0   0   1   33  204704  204736  2.0000000000000002e-11  62.1    33  427905  CAGCGCTGGTATGTGGCTGCACCATCGTCATTA   1.0 False   
-
-    [Next 196 lines omitted.]
 
 
 Analysis of a single FASTQ readset
@@ -221,32 +226,42 @@
 
 Contents of ``results.tab``:
 
-    sample  scheme  subtype all_subtypes    tiles_matching_subtype  are_subtypes_consistent inconsistent_subtypes   n_tiles_matching_all    n_tiles_matching_all_total  n_tiles_matching_positive   n_tiles_matching_positive_total n_tiles_matching_subtype    n_tiles_matching_subtype_total  file_path
-
-    SRR5646583  heidelberg  2.2.1.1.1.1 2; 2.2; 2.2.1; 2.2.1.1; 2.2.1.1.1; 2.2.1.1.1.1  1983064-2.2.1.1.1.1; 4211912-2.2.1.1.1.1    True        202 202 20  20  2   2   SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger
+    +--------+------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------------------------------------+
+    | sample | scheme     | subtype     | all_subtypes                                   | tiles_matching_subtype                   | are_subtypes_consistent | inconsistent_subtypes | n_tiles_matching_all | n_tiles_matching_all_total | n_tiles_matching_positive | n_tiles_matching_positive_total | n_tiles_matching_subtype | n_tiles_matching_subtype_total | file_path                                |
+    +--------+------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------------------------------------+
+    | 564    | heidelberg | 2.2.1.1.1.1 | 2; 2.2; 2.2.1; 2.2.1.1; 2.2.1.1.1; 2.2.1.1.1.1 | 1983064-2.2.1.1.1.1; 4211912-2.2.1.1.1.1 | True                    |                       | 202                  | 202                        | 20                        | 20                              | 2                        | 2                              | forward.fastqsanger; reverse.fastqsanger |
+    +--------+------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------------------------------------+
 
 
 Contents of ``match_results.tab``:
 
-    seq freq    sample  file_path   tilename    is_pos_tile subtype refposition is_kmer_freq_okay   scheme
-
-    ACGGTAAAAGAGGACTTGACTGGCGCGATTTGC   68  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    21097-2.2.1.1.1 True    2.2.1.1.1   21097   True    heidelberg
-
-    AACCGGCGGTATTGGCTGCGGTAAAAGTACCGT   77  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    157792-2.2.1.1.1    True    2.2.1.1.1   157792  True    heidelberg
-
-    CCGCTGCTTTCTGAAATCGCGCGTCGTTTCAAC   67  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    293728-2.2.1.1  True    2.2.1.1 293728  True    heidelberg
+    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
+    | seq                               | freq | sample | file_path                                | tilename         | is_pos_tile | subtype   | refposition | is_kmer_freq_okay | scheme     |
+    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
+    | ACGGTAAAAGAGGACTTGACTGGCGCGATTTGC | 68   | 564    | forward.fastqsanger; reverse.fastqsanger | 21097-2.2.1.1.1  | True        | 2.2.1.1.1 | 21097       | True              | heidelberg |
+    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
+    | AACCGGCGGTATTGGCTGCGGTAAAAGTACCGT | 77   | 564    | forward.fastqsanger; reverse.fastqsanger | 157792-2.2.1.1.1 | True        | 2.2.1.1.1 | 157792      | True              | heidelberg |
+    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
+    | CCGCTGCTTTCTGAAATCGCGCGTCGTTTCAAC | 67   | 564    | forward.fastqsanger; reverse.fastqsanger | 293728-2.2.1.1   | True        | 2.2.1.1   | 293728      | True              | heidelberg |
+    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
+    | GAATAACAGCAAAGTGATCATGATGCCGCTGGA | 91   | 564    | forward.fastqsanger; reverse.fastqsanger | 607438-2.2.1     | True        | 2.2.1     | 607438      | True              | heidelberg |
+    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
+    | CAGTTTTACATCCTGCGAAATGCGCAGCGTCAA | 87   | 564    | forward.fastqsanger; reverse.fastqsanger | 691203-2.2.1.1   | True        | 2.2.1.1   | 691203      | True              | heidelberg |
+    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
+    | CAGGAGAAAGGATGCCAGGGTCAACACGTAAAC | 33   | 564    | forward.fastqsanger; reverse.fastqsanger | 944885-2.2.1.1.1 | True        | 2.2.1.1.1 | 944885      | True              | heidelberg |
+    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
 
-    GAATAACAGCAAAGTGATCATGATGCCGCTGGA   91  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    607438-2.2.1    True    2.2.1   607438  True    heidelberg
-
-    CAGTTTTACATCCTGCGAAATGCGCAGCGTCAA   87  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    691203-2.2.1.1  True    2.2.1.1 691203  True    heidelberg
+    Next 200 lines omitted.
 
-    CAGGAGAAAGGATGCCAGGGTCAACACGTAAAC   33  SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger    944885-2.2.1.1.1    True    2.2.1.1.1   944885  True    heidelberg
+Galaxy wrapper written by Matthew Gopez at the Public Health Agency of Canada, National Microbiology Laboratory.
 
-    [Next 200 lines omitted.]
-    
-
-Wrapper written by Matthew Gopez at the Public Health Agency of Canada, National Microbiology Laboratory.
     ]]></help>
     <citations>
+        <citation type="bibtex">@ARTICLE{a1,
+            title = {A robust genotyping scheme for *Salmonella enterica* serovar Heidelberg clones circulating in North America.},
+            author = {Geneviève Labbé, James Robertson, Peter Kruczkiewicz, Chad R. Laing, Kim Ziebell, Aleisha R. Reimer, Lorelee Tschetter, Gary Van Domselaar, Sadjia Bekal, Kimberley A. MacDonald, Linda Hoang, Linda Chui, Danielle Daignault, Durda Slavic, Frank Pollari, E. Jane Parmley, Philip Mabon, Elissa Giang, Lok Kan Lee, Jonathan Moffat, Marisa Rankin, Joanne MacKinnon, Roger Johnson, John H.E. Nash.},
+            url = {https://github.com/phac-nml/bio_hansel}
+            }
+        }</citation>
     </citations>
 </tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/SRR5646583_SMALL_1.fastq	Wed Oct 11 12:35:50 2017 -0400
@@ -0,0 +1,20000 @@
+@32927/1
+GTGAGTAAGTTGCGCGATATTCTGCTGGATTCGGTAGTAACCAGCTCTATTGTTCTCTTACTGGTCGGCTGCTCAATGGGAATGTCATGGGCGATGACCAATGCCGATGTTCCTGAACTGATTAATGAAATGATTACCAGCGTGTCCGAAA
++
+AAA?ADD5F5BFGGGCCFFGGGGHHGHHHGFFFHGHGHHGCHHHHFHGHHGHEGHFHHHHHFHHHG?AEGGGEHHFGFGHGHFHFFFHHHHHGGGCHHHFGHFHHGCGFFGFGHHHHHGHHHHHBGFHHHHHGFHHFFHGHFED<FFD?ED
+@351952/1
+GGATTACCAGGAAGTGCTGGAAGAGTTTAACGAACATCGTAATGAGCCTGTTGATACTAACGACTTTATTGAGGCGATTGAGCGAAGTAAACGTCGCTTCCATGTTGTTGAAAATGAACAGGAGCTACTGCAAATGCTCAATGCGCCA
++
+CCCCCFFFBFCBFGFGFGGGGGHHHHHHHHHGGFGGGHGHHHDHHHHHHHHHHHGHHHHHHFFGGGHHHHGHFHGGGGHGHGHGGGGFGHHHGHHGGGGGGHHHHHHHHHHHHHHHGHHHHHHGHHHHHHHHHHHGHGGHHHHGGGGG
+@37856/1
+GCGCAGGAACGTATCGGCTTACCGTACCGGTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCGCAGGTCCAGGTATCCTGTCTGCCGATTGTCCGTTATGCCAG
++
+CCCCCCCCFFCBG5GGGGGGGGHGGHGGGGGGGHHHHGGGGHHGHHHHHHHHGHHHGGGGGGGHHHHHHHHHHHHHHHHHGGGGGGGGGGHHHHHGGGGGGGGHGGGGGGGGGGHHHHHGGHHHHHHHHHHHHGGGGGHHHGHHGHHHHHF
+@844740/2
+GATCATGATTAGTCGTGCTCAAAGCGGGCCCCCACTCTACAAGTTGCAAAATTTGTTACGGGTAACTGTTATCGGTAACATTGTCCAACCGCACCATTCACGACGCAATGACCATTCGTGCCAAAAGTGAATAAGTGTGAGCTACTTCAAA
++
+BBBBBFFFFFFFGGFGGGGGGGGHGGGFGGGGGCFCGHHHCHHHHFFGHHFHFHHFFFHGGGEEHHHHHHHFHHGAHGHHGHFHHHHHHGGGGFFAGHFFFEGGGGCCFFFGHHHFHFFFGHHHHEHGHFFHFFF1GDFF<GHHEHFHEGG
+@1034303/1
+CCTGAATATTCATCATCAAACTACCGTCGCCGGAAAAACACAGCACCTTGTTGCCCGGATTCGCCAGCGCCGCGCCAATCGCCGCGGGCAGACCAAACCCCATGGTGCCCAGCCCGCCGGAAGTCAGCCACTGACGCGGACGGTTGAGCGG
++
+CCCCCFFFFFFFGGGGGGGGGGHHHGGGGGGGGGGGHHGHHHHHHHHHHHHHHHHHGGGGGGGGGGGGGGGGGGGGGGHHGGGGGGGGGGGGHHHHGHGGGGHGHFGFHHHHHGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFF
+@79331/2
+CCCTGGTATTCGACGTAGAGCTGCTGGATATCAAACCAGCGCCGAAAGCGGATGCTAAACCTGCCGATGCGGCTGACGCTAAAGCCGCAGATGCTGCTAAAAAATAAAAACTGAGAGCCGCCGCTTGTAATAGCGGCGGTTTTTTTTTTTT
++
+AAABCCFFFFFFGGGGGGGGGGHGHGGHGHHHHHHGGHHHGGGGGGGGHGGGGGGHHHHHFHHHHGGGGGGGGGGFHGGGGGHHHHGGGGGHHEGHHHHHHHHGHHHHHHGHHHHHHHHGGGGGGGGHHEHHHGGGGGG-;AEGGGAFF--
+@234915/1
+CACCTAATTTAACGGTCTGGTGACCAGAACCGACCGCACGCAAAAGCTTCTGAACCGATGAGGATGCTATGGGAAACACAACAATACAAACACAGAGTTTTCGTGCTGTGGATGCAGAGCAAAGCAAAAGCAAGCGCTACATTATTCCATT
++
+DDCDCFFFFFFFGGGGGGGGGGHHHGHHHHHGGGGGGGGGGGGGHHHHHHHHHHHHGGGGHHHHHHHHHHHHHHHHHHHHGGHHHHHHHHGHHHHHHHHHHHGHGGGHHHHHHHHHHHHHHHHGHHHHHHHHHHHFGGGGHHHHHHHHHHH
+@238890/1
+GTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCGCAGGTCCAGGTATCCTGTCTGCCGATTGTCCGTTATGCCAGCGCGCGTCTGATGATTGACGCCCCTGCG
++
+BBCCCFFCCBCCGFGGGGGGGGHHHHHGGGGGGGHHHHHHHHHHHHHHHHHGGGGGGGGGGHGHHHGGGGGGGGHGGGGGGGGGGHHHHHHHHHHHHHHHHHHHGGGGGHHHGGHGHHHHHHGGGGGGGGGGHHHHHHFHHFGGGGGGGG
+@238964/2
+ATCGGCAGACAGGATACCTGGACCTGCGCGGCGGCATCGCCGGATTGCAGCGTAACGGTAAAAGAGGACTTGACTGGCGCGATTTGCATCTCATCATTCGCCAGTACCGGTACGGTAAGCCGATACGTTCCTGCGCTAAGATCGCTTATTG
++
+AAA3AB?DBFBFCGGGGGFBFFHHHHFFGGGGGCFGGHGGGGGGGGHHHGHGGGGGGGG/CGHHGHGHHHHHHGHHHHFGGFCHGHGEHGHHHHHGGEFFDGGGCFHFGC<-CAGBAEFHGG?@CCGHHH/GFECGCBCFGGF.DACEFF0
+@135672/1
+GAATACGGTCATATTGATATTCTGGTGAATAACGCGGGTTTGATCCGTCGTGAAGATGCGATTGATTTCACGGAAAAAGACTGGGATGACGTCATGAACCTGAACATCAAGAGCGTGTTCTTTATGTCTCAGGCGGCGGCAAAACTTTTTA
++
+BA@AAFBAFB?FGGGGFGGGGGHHFB4FGGFHGGGGGGEFGDHHHGHFGGGGHGHFFHHGGHHGGHFFHHHHGGGGGFGGHHHHEHHGHHGFEFHGGHHFFHHGFHHHFFFFHHC/CEFHHHHGHHHHBGHHHGCCCD-@DCAFEG0GG0.
+@1027688/2
+GTCTTCTATGTTACCGTCAATCAACCCGGAACTGGCCCGTATCGCTCCCGGCTTTCGTGCATTAATTATTAATGTTATTGCCGCTCCGATTCGCGATGCGCAGGTCGGAGCAATCGCGCTAAAAGAGGCCTGTCAGGCCGTATTTAACGGG
++
+>A11>333F33DEGGGFE1EF111BAAA000A1B0FBEEAEFG//0/A//A/EA01/0??EF211222B2222BGFH2@111/E///?EE/1>?//<<E/////0B<B@?/<0FHEECCC?CHG1.0<.<1.0/00CHC-<<.:CFHH.@.
+@278520/1
+GTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCGCAGGTCCAGGTATCCTGTCTGCCGATTGTCCGTTATGCCAGCGCGCGTCTGATGATTGACGCCCCTGCG
++
+BABBBFFBBBBBGGGGGGGGGGHHHHHGGGGGGGHHGHHHHHHHHHHHHHHGGGGGFGGGGHHHHHGGGGGGGGHGGGGGGGGGGHHHHHHFGHHHGHHHHHHGGCGGGHHHGGFDEHHHHHGGGGGGGGGGHHHHHHHHHGGGGGGGGG
+@1088790/2
+GCTCCGGCGTGGTAACGGCATTCGCCTGCTCGCTGGTCCGCGTCGCGGCAAGCCACGGGAAAACGGTCGCATCACACTGGTCTGGTAAAGGCAGATCCGCAGTATCCTGCGGCATCACGTTGAGCCACAGCTTGCGCCAGAGCGGCGTTTG
++
+BCBBCBCBCCCCGGGGCGGGGGHHGGGHHHHGGGGGHGHGGGGGFGGGGGFGHGGHGGGGGHHHGGEEGGGGGHHHHHHHHHHHHHGHHHHHHGGHHHHGGGFGGGHHHHGGGFGHHHGHFHHHHHHGHHGFHGHGGGGGGGGGGGFDDFD
+@778546/2
+GTTGCAGACTATCCTGTTTGAAAAGCAGGGTATTAAGCCGTTGAAGAAAACGCCTGGCGGCGCGCCGTCAACGTCGGAAGAGGTGCTGGAAGAGCTGGCGCTGGACTATCCGCTGCCGAAAGTGATTTTGGAGTATCGTGGTCTGGCGAAG
++
+>>AAAFFFFFFFGFGGGGGGB5FFFGFHHGEHHHHHHHGGEGGHHHGHHEHG?EH1GH?EFCEGCEGEFGGGGHGFGGGGHEEHGHGHHAFHHGHFHFDDGCG@HFFF1?FFGGGGHGF?-ADGGFGFFHFHGCF00AGHC.FHHHHG?FF
+@433509/1
+TCTTAGCGCAGGAACGTATCGGCTTACCGTACCGGTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCGCAGGTCCAGGTATCCTGTCTGCCGATTGTCCGTTAT
++
+DDDDCFFDDCCCGGGGGGGGGGGGGHHHGGHGGGGGGGHHHHGGGGHHHHHHHHHHHHHHHGGGGGGGHHHHHHHHHHHHHHHHHGGGGGGGGGGHHHHHGGGGGGGGHGGGGGGGGGGHHHHHGHHHHHHGHHHHHHFGGGGHHHGGGGE
+@1375159/2
+GTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGTTCGTCGGTTGTGAACTGGTCACGCCAATGGCGCCGGAAATTAAAAAAGCG
++
+BABBCFFFBCCCGGGGGGGGGGHGHHGGGGGBFHGGHGGGGGGGGGGHHHHHHHGHHHHHHHHHHHHHHHGHBGGHHHHHGHGHHHHHHHG?GEBFFGGHHGGGFEGCFGGGFFHHHGFHHFHGHGGGHHHHGGGGGGC?GHHHHHHGGED
+@1302196/2
+CCGGAGAGTTCCAGCATTGATTGCCAGATAAGTTTGTTTGACTCGCCGGTCGCGGCCGCCAGCTTCGTCACCAACTGATTCAACGTATTATGTTCAGCAGGCAATAATGGCCGATCCGTTGCCGGACGTTGCTGCGGCTGCGGAATGGAAA
++
+BBBBBBB@FFFDFFGGGGGFGGGHHHHHGHHHHHHHGHCGHHHHGGGGGGGGG0EFGGGGGGGHHH@HGHGHFHGEHFHHHHBGEFGGHHHHHHHHHHHHGGHGFGGFFFHHGGGGGHGGGGHGGCCGGEHGHHFC?F?-CDG-AGFGGGF
+@311343/2
+GAGCAGAAGGAGTGGGTGGCGCTGTGTCGCTTTTGCGGCGATTTGCACTGCAAAAAGCAGAGTGATTTTTTCGATATTATCGGTTTCAAGCAGTATTTGTTTGAACAAACCGAGATGAGCCATGGCACGGTGCGGGAATATGTCGTGCGTT
++
+AABBAF4CFFFAGGGGGGGGGGGGGHHHGHGHGHHHGGGGEGHGHHGHHHGHHFHHGHHHHHGHHHHHHHGHGFHHGHHHHHGGGGHHGHHHHFHHHHHGHHHHHHHHHHGGGGCGEFHEGGHGHGFGGGFHGGGG?CFHGHHFEEGEDGG
+@640997/1
+GGCCAGAATAGCGTTGCCGATAAGCCCGGAAAACGTCGAGGCGGCAGAGGCGCGCAACAGGATCTGTTGCTGCTCCGGCGTCATATTTTGTACCAGCTCAAACAGGCCAGCGCTGCCTGCCAGATGTTCTCCTTCACTGAGTTGCGCGATT
++
+AAABBBFFFFFFGGGGGGGGGGFHHHHGGGGGHHGHHGGCFGGGGGGG11EEGGGFGGHHFGGFHEFHHHHHHHHGGGGGGGGHEHHHHHHHHHHHGHHHHGHHHCEFFCECGFGGHHHHFBCFFHHHHHGHHHHGHHGGGFFFGCGGGAG
+@1148471/1
+TCATGGGCGTGAGCGTCAAAGAGACGACGGCGGAGATTAAAATCGCTACCGCCAACGTCACCGCAAATTCGCGGAACAGTCGACCAACAATATCGCCCATAAAGAGCAACGGGATCAGCACCGCAATCAGGGAAAAGGTGAGGGAAATAAT
++
+CCCCBFCFCCCCGGFGCEGGFGHHHGGGGGGGGGF@GGHHFHHHFGHGEFEGGGGGGHHG?HGG??EGGGFGGGGCGHGHHGACFGHGGHHHHHGGGGGHHGHHGFHHHEGCDDGGHHHHHHGGGGGGGGFGEGEFGD:CFFGDEGGGFGG
+@701914/2
+GCGTAACGGTAAAAGAGGACTTGACTGGCGCGATTTGCATCTCATCATTCGCCAGTACCGGTACGGTAAGCCGATACGTTCCTGCGCTAAGATCGCTTATTGTCAGAACCTCTCCCCACTCACCGACAAAGCGCCGGGTTTCGCCGGCAGG
++
+ABBBCBBCCCCCGGGGGGGGGGHHHHGHHGGGGGHGGHHHHHHHHHHHHHGGGGGHHHHGGGGGGGHHGGHHGGGGGGHHHHHHHGGGGGHGHHHGHHGHHHHHHGHHHHHHHHHHGHGHHHHHGGGGGHHHGGGGGGGGGHGGGGGGGGG
+@714304/1
+GGCATAACGGACAATCGGCAGACAGGATACCTGGACCTGCGCGGCGGCATCGCCGGATTGCAGCGTAACGGTAAAAGAGGACTTGACTGGCGCGATTTGCATCTCATCATTCGCCAGTACCGGTACGGTAAGCCGATACGTTCCTGCGCTA
++
+BBBBBFFFBBBBGFGGGGGGGGHHHGHGHHHHHHHHHHHHGGGGGGGGGGHGGGGGGGGHHHGHGGGGGGGGHGHHHGHHGHHHHHHHHHHGGGCGHGHHHHHHHHHHHHHGHGGGGHHHHGGGGGGGHHGHHHGGGGGGBFGGGGGGGGC
+@510703/2
+GTACTGCGCAACACAAACTTTGAAGGTCTGCAAACTATCACGACGCGGCGCAAGAGTTTGTTATCAACTTATAACAGCCATGTTACCTGCTTATACCAGCAATACCATGCCTGTCTGCTATGCTTTTTGGTTATGTAGTGTATCAATCTTT
++
+3>>AAFFAD22@GC42F4GGDGFFFE45GGGC3GHHHHHGHEG2?EGG?EGEEEHE@F@F?F@G44FFHHHHHHFGGH/0GFGHE4FHHGFBEGHHHHGHB0FDGFHFF1?FFGHFHHH1FGHHHHHF/<C/1DDGH11?<1GFFGHED1F
+@747636/1
+GGCGTCAATCATCAGACGCGCGCTGGCATAACGGACAATCGGCAGACAGGATACCTGGACCTGCGCGGCGGCATCGCCGGATTGCAGCGTAACGGTAAAAGAGGACTTGACTGGCGCGATTTGCATCTCATCATTCGCCAGTACCGGTACG
++
+CCCCCCBCFFFFGGGGGGGGGGGGGGGHHHHHGGGGGHHHGGGGGGHHHGHHHHHHHHHHHHHHGGGGGGGGGGHGGGGGGGGHHHHHGGGGGGGGHGHHHGHHHHHHHHHHHHHGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGFFFFF
+@607380/2
+TCGGTATCCAGATCGAGTTCGCGAAAGTGATCCTGGCTGGCGAAGTCACTACTCCGGTAACTGTTCGTGGCCTGCGTGTTACTAAAGGCGCTCGTGCTGCTATCGAAGCTGCTGGCGGTAAAATCGAGGAATAAGTAGCAGATGGCTAAA
++
+CCBBBBCFFFFFGGGEGGGGGGGGGGGHHHHGHHHGGGFDFGGGGFGHHHHHHHHGG>EGHHHGHGGGGCEHHGHGGGEHGGFHHHGHHGGGGGGHGGHGHHGHGHHFFHHHHHGG?C><FGG11><.@-G11F1=FGFFD/<0<CCDGD
+@787987/2
+GTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCGCAGGTCCAGGTATCCTGTCTGCCGATTGTCCGTTATGCCAGCGCGCGTCTGATGATTGACGCCCCTGCG
++
+BBCCCFFCCBCCGGGGGGGGGGFGGHHGGGGGGGHHHHHHHHHHHHHHHHHGGGGGGGGGGHHHHEGCEGGGGGHGGGGGGGGGGHHHGHHHHHHHHHHHHHHGGCGCFHHHGHGGHHHGHHGGGGGGGGGGHHHHHHHHHGGGGGGGGF
+@100118/2
+CCCTGAAGCCAGGAAATTGCTGGATTACACCATAGAAGTGATTGAGAAATACTTCTGGAGTGAAGAAGAGCAGATGTGCCTGGAGTCCTGGGACGAAGCCTTTAGCAAAACCGAAGATTACCGTGGCGGTAACGCCAATATGAACGCCGT
++
+AAAAAFF11B1FGCGGGA1EEBHF1GHBGDGHGGFBGHEGGHHFBFGBFBDFHHDGHG101B12DBFGGHBFHGBF21D1FGEEEGFHHEEEFF//EA@FGHEFEH1F1F0/E@EEEHHGHF?FF?//<BCAGGC///1<<11?<GC/->
+@1348663/1
+TCGCCATACAGATAAATAACGGTCGCGCCATCACAGGCGTTGGCTACCCGTTGCCCCAGGTCTAGCGTCGCCTGTTCGTCAGGTAGCGGAATTACTCGATTCATCATGGTTTACGTCAATCACATCAGGGTTAACAATACGCCGCAGCGTA
++
+BBBBBBAFFFFFGGGGGGGGGGGGGGGGGGGHHHHHGGGGGGGHHHHHHGGHGGHHGGGGHHHHHHGFFGGGGHHHHGGGHGGHHHGGGGGGHHHHGGHHGHHHHHHHHHGHHHGHHGGHGHHHHHHHHHHHHHHFHHGHHGGGGGGGGE?
+@552822/1
+CAGTACATCATTCCAGCACACCAAACATAATTAGTGTGATCCACTAATTAGTTTGCGTATCATTTGTATAATAACCTATTGATCAGGCTAATAACCGCAGTCTATATCAGGGTAAGTCTTTTCGGCGCGTTTTGATATACGCGCTCATACG
++
+CCDCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGGGGHHHHHHHHHGHHHHHHHHHHHHCEGGGGGGGGHGHHHHHHGGGGGGHHHH
+@833288/1
+GTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCGCAGGTCCAGGTATCCTGTCTGCCGATTGTCCGTTATGCCAGCGCGCGTCTGATGATTGACGCCCCTGCG
++
+AABBBFFBBBDDFFGGGGFGGGHHFHFFFGGCGGHHHFHGHHHHHHHHHHHDGGGGFDEGGHFHFHG?FGEGEGHGGGECEGEGGGHHHGB2BFGFHHHHHHFHG/CDFFDGGHFGCGHHHEFFF@@C<@:.0<GCCHHEHDGGGGGGGA
+@189851/2
+GTTTTATCCTATATGGGGCCAGCCTTTGTCGGCATTATTACCGGCTCAATGGTGATTGAAACTATTTATGGCTTACCGGGCATTGGGCAGCTTTTCGTTAATGGCGCGCTCAACCGCGATTACTCGCTGGTGTTAAGTTTGACCATTTTAG
++
+BBCCCFFFFFFFGGGGGGGGGGGGHHHHHGGGGGGHHHHHHHGGGGGGHHHHGFHHHHHHHHFFHHHHHGHHHHHGHGGGGGHHHHHHHGGHHHHHGHHHGFGHGGGGGGGGHHHGGGFGHGGGHGGGGGFHHGGGHHHHHHHHHHHHHHF
+@824439/2
+GGTCTGGTAAAGGCAGATCCGCAGTATCCTGCGGCATCACGTTGAGCCACAGCTTGCGCCAGAGCGGCGTTTGCCGCTCGCCCTGATATTCCTGCAATTCAACCAGCGTGGTCAGTGGCCCGCCGCCGCGCAGCCCGGTACGATAGCCTTT
++
+CCBBCFFFFFFFFGGGGGGGGGGGGHHHHHHHGGGGGHHHGHHHHHHHHHHHHGGEHGGGGGHHGGGGGGGGGHHGGGCGGGGGHHHHHHHHHHHGHHHHHHHHGHHGGGGCHHHHHGGFHGGGGGGGGGGFCGHGGGAGGGGGGGGGFGG
+@961756/2
+ATGTGTGGGATGTGTGGCTCACGGCGCGGCGGCGGACTTACTGGCAGCGCGTTATGGCGCTCGCGGCATGTTGGCGACCGATCTTTTTACTACGCTGCGGCGGATTGTTAACCCTGATGTGATTGACGTAAACCATGATGAATCGAGTAAT
++
+>AA>ABFAAAF@1BFGGG1B11BEACEGGGGGGGGCGGHFFFHHHGGGEEGBCGHHHGCCCGGGGG??@0GBGHGGCCCGGCCGHGHHEGFFGB@E?CG@@G-;@BFFFFFFFEFFF///BBFEFBFFAEFFFBEFFFFBFBFFF?EFFFB
+@61405/1
+CTGCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTGGATCACACTAATTATGTTTGGTGTGCTGGAATGATGTACTGAGTACTGCGAAGAATGGGGGATAAACAAAACGCCCACATAAGCGGGCGTTG
++
+A1A?A1ADAF3DFGGFFCGBFGHHHFFFHFFFHHC21F1F1E2AFEF/EGDGC1FGH2FFGFH0F1AGFHGHFHHB22F/GEG?GHFGHHFHHHB2BEGFFFFH1@GBB>E/ACGHB0EE/ECGHFHHHAECB@//</F1@<D@@@/@CCC
+@822236/1
+GCATCAGGCGTTGTGGCATTACGACAACGCGCCATCATCGCGCCAGCCGCAGACGCTAACGTTCATTCCGTGGTTTAGCTGGGCCAACCGTGGCGAGGGCGAAATGCGGATTTGGGTTAACGAGCGGTAATACTGTGCCGGATGGCGG
++
+DDDDDFFFFBABGGGGGGGGGGGGGGGHGGGGGGGHHGHHGGGGGGGGGGGGGHGGGGGHGHHHHHHHHHHGGHGHHHHHHHGHHGHGGGGHGGGGGGGGGGGGHHHGGGGGHHHGGGHHHGGGGGGEGGHHHGGFGFGGGGGGGGFG
+@872642/1
+GTTGTATTCATATTCCTTCGCCTTTTAATGCCATCCCGAAACGTATGAGCGCGTATATCAAAACGCGCCGAAAAGACTTACCCTGATATAGACTGCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTG
++
+AAAAAFFFFFFF66EGFBDGCE?EH4GGHHHHHGAFHGFECGGHEDEG532FEAAEHHFFF3HHGG?EGCEEEGGGHHFHHEGHFGFHFEGHHFHHGGGGE3FGF0?FHFHBG1FFBH1F1GFHHH2DGFGDGB21/CD/A0?FHHHGFDF
+@1289899/1
+ATTTACGCCCGCCACCGCATGGCTTTCCAGTTCAAGGATGTCCGCCTGAATCCGATGCAAAAGATTATCTGGCGTAATATCAACAAACGCATCCAGCTCCTGGCTGTTTTCCAGTTCAGATAGCAGGTAGATATAATCCCGTCCCAGTTTT
++
+3AAABF@BBBBBCGGGGGGGFGCHCHHHEHHHGHHHHHFHAGFGGGGHGHHEHGGGGGHHHHHGHHHHHFFBGGGEGFGHHHHGHHGFFGGGGHBGFGHHGBGAF/BFGEHFHFHHEBF3BGFHHHA0BGFHHHHHFF2GA<DDGHG<GGH
+@978847/2
+GGGGAGAGGTTCTGACAATAAGCGATCTTAGCGCAGGAACGTATCGGCTTACCGTACCGGTACTGGCGAATGATGTGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCGCAGGTCCAGGA
++
+BBBBBBBB@FFFGGGFG5GGGBFCGHGFHHHFGGCEGGFHCGHBHGGGACFGHDEHGGGGEEGGHHHGGGGGHHHFHHFGFBFFDDAFEEEFEHHHHHGHFHHHEHHFFHGGGCGEFGGDHHHHGFGCGGCFGHGCCC@CCCCCGBFFFG.
+@979828/2
+GGTTCTGACAATAAGCGATCTTAGCGCAGGAACGTATCGGCTTACCGTACCGGTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTGTTACCGTTACGCTGCAATACGGCGATGCCGCCGCGCAGGCCCAGGGATCCTGG
++
+1>1>A1B@DD@FGFGGEEAF13D31AAAA00BFE00FAEE?/F110/A/AFECE?FEG1/EEGEGGHHHH@1@1DFG11///EE/E>11BF2112B11BFE><<F<<A</<<<0<F11??/<//?/?<A-AC-<<A@.;.;..:CF?/0:/
+@826862/1
+CTCTGGAACTGCTGAAGCCGCTGCTGGAAGATGAAAAAGTGCGCAAAGTGGGGCAAAACCTCAAGTACGATCGCGGCGTCTTGCAAAATTACGGTATTGAGCTGCGCGGTATCGCCTTCGATACCATGCTTGAGTCTTACATTCTGAACAG
++
+BCCCCFFFFFFFGGGGGGGGGGGGGHHHHHHHHHHHHGGGFHGGGGGHHHHHGGGGHHHGHHHHHGHHGGHGGGGGGGGGGGHHHHHHHHHHGGFHGHHHHHGHHGGGGGGGHGGGGGHHHHHGHHGGHHHHHHHHHHHGHHHHHHHHHHG
+@391154/2
+CTGTTGTACAGATACCGCGCCACGCTGCGACAGCGAACGGGAACGCACGTGACGTTTAGAGACGGAGTCCAGCTCAGCTTCCCGCTGTTTGACGACCGACTGCGCGGCGCGCATTTCACTCTGGCGTTGCTCCAGCAAGGCACGGGCGGCG
++
+BCCBBFFFFFFFGGGGGGGGGGGGGGGGGGGGGHGGGGGGGGGGGGGGGHHHGGGGHHHHHHHGGGGGHHHHHHHHHHHHHHHGGGGEHHHHHGGGGGGGGGHGGGCGGGGGGGGHHHHGHGHHGGGGGGGGGGGGGGGGGGGGGDFFFFF
+@1243465/1
+GGGTTACGGCATACGCGTTACGTATAGTCAGAAATAGCGTCAGCGTTGTGGCTGACCAGCCAGCCGCTGAATTTTGAGAAAAAGGAGAGTCTGAATGCAAGCAACAGTAAAACGGCGGCTGACGAAGGTCGCTTTAGCATTAGTAGTTGC
++
+BCDBBCFCBBCBGGGGGGGGGGHHHHHHHHHHHHHHHHGGGGGHGGGGFGGHHGHHHHHHGHHGGGGGGGHHHHHHEFHHHHHGGHHHGHHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGHHGGGGGFHGGGHGHHHHHHHHHHGGHHH
+@336906/2
+GAATACTCAGGTATCGAATCTGGATACCCGCGTCACCAATATCGAAAACGGCATTGGCGATATCGTCACTACCGGTAGCACCAAGTACTTCAAGACCAACACCGATGGCGCAGATGCAAATGCCCAGGGTGCGGACAGCGTCGCGATTGG
++
+CBCBBFFFFFFFGGGGGGGGGGHHHHHHHGGGGGGGHHHHHHGGGHGGGGGGGGHHHHGGGGGHGHHHGHHHHGGGGGHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGHGGGGGHHHHHGHHHHHHGFGFFGGGGGGGHGGGGGGGCHGH
+@1133938/1
+GTATAACGAGCGCCGAGAATCAGATGCAGCGGGTCGGCCAGCGAAATGCGCGTAGCGGCATACAGCGATTTCATATGCGTGGTATCGTCCTGCGCCAGATTTTGTGGCGCCCAGTGGGTTTGGGGGAAATTACCGTTAAAGGCGCTGAAGT
++
+BBBBBFFBBBBBGGGGGFGGGCHHFFHHHHGGCGGGGGGGHGGGGGGHHF?EEFGGGFGGGHHHHHF@EGGFHHHHHHAFGCFGGHGHFGGHHCGGGGEGGHHFFC.CDDCGGHHHFE.CEGE?@DFD9F0FFBEGGGEGGGGGGGGFFBF
+@1026576/2
+GTATGTGGACTACCCTGACCATCTTCGGTTTATGCGGGATCCTGTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGTTCGTCGG
++
+BAABBFFFFFFFGGGGGGGGGGHGHHHGFFGHHHHGGGGGGHGHHHHHFHHGGGGGGHHHHHGEHHHHHGGGGGGGHGGGGGGGGGGGGGHHHFHHHHFHHHHHHHHHGHHHHHHHGGHGHHHHHHHHHEHFHGCGGCHHHFFHFHFGFGC
+@787717/1
+GTTTCATTCAGCGTAGCGCCGCAATACTGCTTGACCAGCCAGAACAGGGAATCGGTCACGATCGTGCAGCCAATGGCGCCGGAACCAATGGCAATCGCAATGATCTCCGGGCTGACGTCAGGATAGAGCGGCAGCATGGGCGCAACAATCG
++
+AABCCFFFFFFFGGGGGGGGGGGEGHHHHHHHHHHHHGHGHHHGHHHHGGHGHEFGGGHGGHHGFHGHHGFHGGHHHGGGGGGGGGHHFFHHHHHEGGGGGGHHHHHHGGGGGGGHGGGGGGHGH1GHHGGGGGGHFHHGHGCGCGHHFGE
+@423336/1
+GCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTGGATCACACTAATTATGTTTGGTGTGCTGGAATGATGTACTGAGTACTGCGAAGAATGGGGGATAAACAAAACGCCCACATAAGCGGGCGTTGTT
++
+AAAA>A11D3@1GA11DDFGF3FFAB1AEGF333GH1112F100AEE01BGGFFEADGDCGH0A10BGAGBB2AFG0CAFFE1EGGCG111B@D@B22BC1@1@@D?/>EAGDEFFFG//FGHBHHGHH?@CGFECFGG1@CGC/<><<..
+@1166605/2
+GGCATCACGGACAATCGGCAGACAGGATACCTGGACCTGCGCGGCGGCATCGCCGGATTGCAGCGTAACGGTAAAAGAGGACTTGACTGGCGCGATTTGCATCTCATCATTCGCCAGTACCGGTACGGTAAGCCGATACGTTCCTGCGCTA
++
+AAAAA1FF1>AD?1BGF?E0ECFFGFABEGHFHHGCF0FG?/AEEGCG@EHCE?E/E/EGHFFF?EGCGGGGH/DGFFHA0GGFFGHBGEECGC--<<1FFBFHFD1<D0<0GFC.@CF0DAC@CGG?CGG00C@@@A-9;;B/0;B@?--
+@889414/1
+CTATCCTGTTTGAAAAGCAGGGTATTAAGCCGTTGAAGAAAACGCCTGGCGGCGCGCCGTCAACGTCGGAAGAGGTGCTGGAAGAGCTGGCGCTGGACTATCCGCTGCCGAAAGTGATTTTGGAGTATCGTGGTCTGGCGAAGCTAAAAT
++
+1AAAAFFFFFFFBGGFCFGGGG0BGHHGFHGCECEHHHGHFBFEECHC/G?EGGGGGEEGGGGHCGGCGGG/GHGGGHEGGHHGGHHGHHC?C<@?FHEGHHHGGCCCHC-<-CGFHHHGHGCBC<<00ECCCHHEHGG?:@AGGGGBFF
+@1174815/2
+GGTTCTGACAATAAGCGATCTTAGCGCAGGAACGTATCGGCTTACCGTACCGGTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCGCAGGTCCAGGTATC
++
+CCBCAFFFFFFFGGGGGGGGGGGHHGCEGGGHHGHGHHGGGGGCHHGGHGGGFGGGHHHHGGGGGHHHHHHGHHHHFHHGGGGGGGHGHHHHHGHHHHHHHHGGGFGGGGGGGHHHHHGGGG@DGGHGGGGGGGGGGGHFHEFHFHH
+@1178063/1
+GTCGGTGAGTGGGGAGAGGTTCTGACAATAAGCGATCTTAGCGCAGGAACGTATCGGCTTACCGTACCGGTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCG
++
+BABBBDAAFFFBGGGGGGGGCGHHHGHHGFDEGGEE2FGFFFGGGGGGHHFHHHGGGGFGHHHGGGGGEEEGFGHHHG@EGHHGGFFFFHHFFFH3E/EGFGGCFGFFGFGHHHHHHHFFFGGGGGGGFDGHHHFE?-C-@AGHGGGGGG
+@54853/1
+ATCAGCCCCGCCTGCTGGAACATGATGTGCCCGGTCAACATGATGGTGCGAATACCGGTAATGCGTCGCAACAAGACGTAACAAATATTCAGCGCCAGCGCGAGCAACACCGCGTAGCCTACCCAACTATACGCATCACCCATCCGCTCGA
++
+ABBBAFFBBBBBGGGGGGGGGGHHHHCHHHHHGGEFGHHHHHGHHHHHHGGGGGGHFGFGGGGHGGGGGGGGHHHFHGGHHGHBHHHHHHFHFGGGGGGGGGGGGGEHHGG?DCADGGHHHHHHHHGGEFHHHGGGGHGHHEFFHFGGCG-
+@1333959/1
+CAACAGCAGCGGCGACTGCTTGCCCTGGTCATAAATATGATGCGCCGCATCACGGGCTTCATCTTCTGGAGAGAGCGCGAAATAGCAGATATTAGGGAAGCTACGTACCGTTTCCGGCTGGTTGAGCGCCAGCACGTTGAGCGGCGTGTTG
++
+BBBBACCFFFBDGGGE?AEGG3AAGHFHFGHGBGHHHHC5GFGAAEECCF@HFFE//>EGHFFFHDHF3FGBDEECEEEEE?/GFFEGFHHHFHGHFGACHFHHGHBCCDFGGFHFGG@DDCGDFHFCCCFCE/CA.;:GHHGGC?BBDGG
+@811100/1
+TACAACAGTGGTCGCGACAGGCCGAGCCAGAACAGGAAAAGCGGGTGACAAAGGCAGGTTCAGTGACGGTGATTTCTTTCATTACACAGGCTCCGGAATTAAAAAAGGCAGCTTTCGCTGCCTTGATTGTGTACCACGTGTCGGTGAATCA
++
+BBBBBFBFFFBDGGGGGGGGGGGGGGGGHHHHHHHHHHHHHHGGGGGHHGHHHHHHGGFHHHHBGGHGG?EFHHHHGGHHHHHHHHHHHHGHGGGG?CGHHHGGHCFDHHGGHHHHGGGGGHHHH<FGHGHHHHHHHGGHHHGGGGGHHHH
+@1232378/1
+GTAAAAGAGGACTTGACTGGCGCGATTTGCATCTCATCATTCGCCAGTACCGGTACGGTAAGCCGATACGTTCCTGCGCTAAGATCGCTTATTGTCAGAACCTCTCCCCACTCACCGACAAAGCGCCGGGTTTCGCCGGCAGGAAACAGCA
++
+CCCCCFFBFBFCGGGGGGGGGGGGGGHGHHHHHHHHHHHHHGDDGGGHHHHGGGGGGGHGGGHHGGGGGGHHHHHHHGGGGGGHHHHGGHGHHHHHHHHHGGHHGHHHGHGHHHHHGGGGGHHHGGGGGGCFGHGGD@CGGGGAGHHHGHF
+@1257580/1
+GGATACCTGGACCTGCGCGGCGGCATCGCCGGATTGCAGCGTAACGGTAAAAGAGGACTTGACTGGCGCGATTTGCATCTCATCATTCGCCAGTACCGGTACGGTAAGCCGATACGTTCCTGCGCTAAGATCGCTTATTGTCAGAACCT
++
+ABBCCFFFFFFFGGGGGGGGGGGGGGHGGGGGGGGHHHHHGGGGGGGGHGHHHGHHHHHHHHHHHHHGGGFGHGHHHHHHHHHHHGHHHGGGGHHHHGGGGGGGHHGHGHGGGGGGHHHHHGHGGGGGHHHHGGGGGGGGGGGGGGGGG
+@1279733/2
+GCGTAACGGTAAAAGAGGACTTGACTGGCGCGATTTGCATCTCATCATTCGCCAGTACCGGTACGGTAAGCCGATACGTTCCTGCGCTAAGATCGCTTATTGTCAGAACCTCTCCCCACTCACCGACAAAGCGCCGGGTTTCGCCGGCAGG
++
+BBBBBABADBAAGGFEGGGGGGGFHFFHHGGFEEHFHHGHHHHGFFHHHHHGFDGHHHHGGCFGGFFHGHHHGGGGGGFHBFHHHGGGGGHFHGHGHHGGHHHHHHHHHHHHHHGHGHGHHHHHGGGGGHHGGGGGGCGGGHGGGGGGFGG
+@1281298/2
+TACCTGGACCTGCGCGGCGGCATCGCCGGATTGCAGCGTAACGGTAAAAGAGGACTTGACTGGCGCGATTTGCATCTCATCATTCGCCAGTACCGGTACGGTAAGCCGATACGTTCCTGCGCTAAGATCGCTTATTGTCAGAACCTCTCC
++
+AAAAABFB1BCFFGEGC0E?EGGBECE??/EE>FG11EEEEEA//?FF2BF0GGHHHHEFHHHHGGGC@GFBFDHF1GFGHFHBG2A?AC1FGHCC/A/ACCGF1FFC?C<<CDCFH0GFCCC-::0:CCA.C90000;;;90/CBFFEF
+@140441/2
+TGCTAAACCTGCCGATGCGGCTGACGCTAAAGCCGCAGATGCTGCTAAAAAATAAAAACTGAGAGCCGCCGCTTGTAATAGCGGCGGTTTTTTTTTTTAATCCGGGTCGATTTCTTACCCTTAATTTATTTTTGGGTTAAGGCGCTTTCGG
++
+ABBBBFFCFFFFFEAAEGGGGGGGGGGGGGHHHHGGGGGHGHHHHHHHHHHGHHHFHHGHHHHFHHGCGEGGGGGBGHHHFGG?ECG///??@@--<<.00=0.--.--:.;.00009;/0//00;0000;90-9.9..000/9--.9/.-
+@11133/1
+GTCGTCGGTATTGTGCCGTGGAATTTCTCAATTATGATTGCTATCTGGAAACTGGCCGCAGCGCTGGTATGTGGCTGCACCATCGTCATTAAACCAAGTGAATATACCCCGCTGACACTGCTGCGAGTCGCTGAGCTGGCTAAAGAGGCAG
++
+A3AAAADBAAAFGFGFFEEE2AGDFGHHBGGGFGGDFDBGBFHF3GHGFBGFHFFGHGCEE0EEFEEHHHHHHHGHEEHFFHHEGHHHFHFB@GHHHHHHHHHHHHHHHFGGGGGEFEHHGGF1@@GGGCCGDGAHG10CHFHEHEHEDFD
+@928876/1
+GCTTTCATATTCCAGTTGTCGCCGCGACGACATTTCGCTAAAGTCACGCCCCTTCTTCACTGGCATGGGGATTTTAAGGTGTTTATAGGATTTGATTACGGTACGGCAAACTGCTCGGTCGCCATTATGCGCGACGGGCATCCACAGTTG
++
+BBBB@FFFFFFFGGGGGGGGGGGGGGGGGGGGGHGHHGGGGHHHHHHGHFGGHHGHHHHHHHHHHHHHGGGGHHHDHHHGGGGHHHGHHHHHHHHHHHHGGHHGGGGGGHHHHHGHGGGGGGGGGHHHHHGGGGGGGGGGHGHHHHHHHH
+@1128530/1
+GAATGAAAATATCGCAGAAAAATTCCGCGCTGATGGGGTTGCCAGGCCTAACTGGTCAGCCGTTTTTGCCGTGGCGTTTTGTGTCGCCTGCCTGATTACCGTTGAGTTTTTGCCCGTTAGTCTGTTGACGCCGATGGCGCAGGATCTGGGG
++
+BBCCBFFFFFFFGGGGGGGFGGHHHHHGGGGGGHHHHGGGGHHHHHHGHHHHHHHHHHHHHGEGHGGGHHGGECCGEGGGHHGGHFHGFHGHHHGHHHHHGFGGEHFHHHGGHHHGGHGGHHHHHHHHHGGGGGGGGHGGGGGGHHHHHHG
+@1382683/2
+ACCAAGCGCAGGGGCGTCAATCATCAGACGCGCGCTGGCATAACGGACAATCGGCAGACAGGATACCTGGACCTGCGCGGCGGCATCGCCGGATTGCAGCGTAACGGTAAAAGAGGACTTGACTGGCGCGATTTGCATCTCATCATTCGC
++
+>AAA34AA@BBB?EEGCEGCGGHHGGHFHEEECGGGG?EFGHFEEEGGG1BGFA@E@FHFHGHGGHHHFHGG0CBFCDG?CGGCDGHGGGGC-AAGFFCFCDGADDG9A.FFG.9.CEFFBFGBBEEGFB?BFA/FFFFEFFFF/FFF/A
+@1333706/2
+GGGTTGCTCAAGACGAAGGACGGCCAGCAGTTGAACCTCAATAATATCGGCAGTACGCCGCTGGCGGAAAAGGTGAAAACCAAAGCTTGCGATCTGGTGTTGCAGCAAGGGCTGAATTTCCTCTCCTGACTGCGTTTTTCTGACCGTGCG
++
+AAA>ADFFBFFFFFEEEEGGCEEEEEDAHFHFGAGE2CGFHHHHHHEEFEEEEFGGEEGCGGGCGFGC@GHFE3FDGHHHGGEAGF3D?CD/?/0BGBF?AGHHHFHFGED/GDGB1F111?GGCFFGHGHHEE.ADEEGD0DDGFDHGG
+@1390318/1
+GTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCGCAGGTCCAGGTATCCTGTCTGCCGATTGTCCGTTATGCCAGCGCGCGTCTGATGATTGACGCCCCTGCG
++
+BBBBBFFABBBBGGGFGGGGGGHHHGHGGGGGGGHHHHHGGHGHHHHHHHHGGGGGGGGGGHHHFHEFFEEGAEHEG/@EECECD0BGHGHGFFHHDGHHHFHHGGGGGGHHGGFFFHHGFF.@CCCCCGGGHHHEHHHHHGGGGGEE?B
+@970671/2
+CTGCCGCGCTGGATACGCCTATCGCCACCGGGGAAATGCTGACCAGTTTCCGGGAACACGAGCAGTTGATTCTGGGCAATGCCAGCGATTTCGTTCAGCCAGATGCGCCGCGTGTCGGCGGTATCTCTCCTTTCCTGAAGCTTATGGAT
++
+AAAA@?DDDDD0BBGB0EEGCGHCEEEEFCG////AFFF2A10B1FBGFEFE/E>@CGGC?EEEF@1BDGFHB2>FG0/E1B>1BFECGHGHH00G1FBGHG0DGGGGFG//<AE0EG@CG;::0:000:CG0:CCC0BB0:0;00/09
+@712072/1
+TCGTCAGACATACCGCGCGTCTCCACGCCCATCGCCTGTGCGATGCGAGCAAAACGCGCGACGGCGTTCGGACGGTTAAAGTTCTCGACAATTGGCAGCAGGATAGCGTTGCAGACGCCGTGCGGCAGATTGTGGGTTGCGCCCGGCTGGT
++
+>AAABBBFFFFFGGGGGGGGGGHHGHGFCEGFHGGGGHHHHGGHGGGGGGGHHGHGGGGGGGGGGGGGGGGCGCCCFGHHHHHHHHGGGGGHHGFHHGGGHHEHHHGGFGGGHHHHGGCCADG@@GGGEGGGGGGGGGBFBBFBBBBBBF/
+@383197/2
+ATCCCATTCCGTACGCAGCCTATCAACACCGTGCCGCCAGCAAACCAGGATCATGACGCGCCGCTATTGCAGCAGTATTTCTCCTGAGGATTTTCGCCCGGTGGCGGCTACGCCTTACCGGGCCTACAGTAAGCCGGATAAGCAAAGCGCA
++
+3A3A?FFDFFFFGGFGGGEGGCHHHCBGAECHFGHGGGGGGHHHHGHGEEHHHGHHHDGGGGGGGGGHFHHFHHHHHHHHHHHHHGFHGFHHGBFE?EGF/CCDH@DGDGHGGGGGHHF?CFDCECGHGHHHHGFG?C.CGFFHFFFHGGD
+@1460563/1
+GGAACGTATCGGCTTACCGTACCGGTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCGCAGGTCCAGGTATCCTGTCTGCCGATTGTCCGTTATGCCAGCGCG
++
+BBBBAB4CFFBBFGGGGGGFGGGGGGGGHGHHGGGGHHHHHHGFHFHHHGHGGFCGGGHHFHHHHHHHHHHHHHHGGGGGGGGGGHHHHHGGGCGGGGHCFGGGGGGGGGHHHHHHGHHHHHHHHFHHGCDGGHGHGHHGHHGHHHGCCG
+@77696/1
+GCCCCATATCGTCGCATGGGAGTCAATATCATTAGGTCTCCTGGTCGGATTGATACATTCCAACACCTTTTATTTTTCACGAAGTTGAGGTTTGAACCCCAAATTCTAGCAAAAATAGGCTTAAAAAGCACCTCAGGGAATAGTCTTAAT
++
+CCCCCCFFFFCFGGGGGGGGGGGHGHHHGHHHHHHHGHHHHHHHHHGGFGGHHHHHHHHHHHHHGGGHHHHHHHHHHHHHHGGGGHHGGHHHHGHHHHGGGGHHHHHHHHHHHHHHHFHHHHHHGHFGHHHHHHHHHHGHHHHHHHHHHH
+@1355201/2
+ATGTAGGGTTGCCAGTGGGCAGGGTAAATAAGGTCGATGATGCCCAGCGAAATATTGTTAATCTGCTCCTGATTATTCTCCCCAAACAGTCCCCAGCGGCGGGGGGTTCCCCCCAGACAGGGAAATTTCCGCAGCGCCCTTTTTGACGGCG
++
+AACABFFCFFCFGGGGGGGGGGGGHHHHHHHHHHHGGGHHHHHHHHHHGGGGHHHHHHHHFHHHHHHHHHHHHHHHHHHHHHGHGHHHHHHHHHHGH?EGGG<@-9--.:BF.:-...//...;.:B00:.9------:-;:F0-.:.9--
+@729633/1
+TTTCGGGGGCACCGTTGAAAATCCGTGTCCTTTTTCGCCGTTAGATTTCCAGGCGCCTCCCCTGCGTTTGCTGCACTGGCAGCCATCGGCGCAGGGGGGAGAAATAGCGCTGAAAACGTCCTGGGATGCGGTGCCGTCACTGTTTGTCCGG
++
+AAABAB?2AD@AGEGG?GGFGGHHFGFHHGHHHHGFGGGCGGGGHGGFHFFHFHGGGGEEGFHEFGGGGFHHGHFCGHEHFGGHGHGGGCCG/B@CCGGAB9AFFFFFB?EBFFFFFBFFF?FFEFFFF??AB?FBFBFFFFFFFFFFFF=
+@1499301/2
+CAATAAGCGATCTTAGCGCAGGAACGTATCGGCTTACCGTACCGGTACTGGCGAATGATGAGATGCAAATCGCGCCAGTCAAGTCCTCTTTTACCGTTACGCTGCAATCCGGCGATGCCGCCGCGCAGGTCCAGGTATCCTGTCTGCCGAT
++
+ABAABFFFCAABGGGGGGGGGGGHHGHHHGGGGGGHGHGGHGGGGFGGGFFHGGGGGGHFFEHFHHGGHFGGGGGGGGFGHFGGHHHHHGFHHHFGGEEGGGEGGHHHE2ACGGGGGGHGGGCDFGGGGHHHHGHHHHHHHHHHHGHHG-C
+@966510/1
+GTTCAAGCCAGTTCGGTACCGTCATGTTGAAAGACTCGATCATTTTCATGTCGAAGCCGCGGAAGAAGCCGCTCAACACAAACAGCAAAACGATGGCGACCATCATCACTTTGGTGACATGGTTCCAGCCGCTCTCTTCTACGCCTTTAC
++
+BABCCFFFCFFFGGGGFGGGGGGGHHHHHHHHHHHHHGHHHGHHHHHHGHHHHHGGGHGGGGGGGHHHHHGGGGGHHHGHGGHHHHHHHHHGGHGGHCGGGGHHHHHGHHHHHHHGHHHHHHGHHGHHHGCGGGHHHHHHHHGGGGGHHH
+@1302335/2
+GGTTCGCACACTGGCTGCTGTACGCGATGCAAAAGAAGCTGCGTAATCGCAGTTGTCTTTATCAAGCATTTGCTTACGTATAAACTTATTCTGATATTCAGGAACAATTTAAATGTCTATCACTAAAGATCAAATCATTGAAGCAGTATC
++
+BCBBCBCCCCFFGGGGGGGGGGHHGGGGGGHHHHHGHHHHHHGGGGGHGGGGEHHHHHHHHHHHHHHHHHHGHHHHHGHGHHHHHHHHHHHHHEHHHHHHHHHHHHHHHHHHFHHHHGHHHHHHHHHGHHHHGHHHHHHHGHHHHHHHHH
+@1353618/2
+CCCCTAATGAACCCTTCCATGCTGAACGCGACCCTACTAACAACTGCGCCATCTCGCGCAGTGGTCGTCGTGCGTGTGGTGGTGGTCGTCGGCAATGCGCCGTAGGGTCCGGAACACACACGATTCCACAACCCCGCCGGCGCAAACCGGG
++
+AABBBB4FF5FFGGGGGGFBDGHCHHGHDG2EEFHHHHHCHHHH3BGFCGEFHFHGGCCGGGHGHGG@?E>>FEFGAHEGF/E?EGHGEFF?CG/GHFADGG<AA?/?GHC<ACGFFHDEA@@CEGBF0/<ACGGGCG-9BFGG?;F.=CB
+@139916/1
+GTATTGTGCCGTGGAATTTCTCAATTATGATTGCTATCTGGAAACTGGCCGCAGCGCTGGTATGTGGCTGCACCATCGTCATTAAACCAAGTGAATATACCCCGCTGACACTGCTGCGAGTCGCTGAGCTGGCTAAAGAGGCAGGTTTCC
++
+BBBBBFFFFFDAEGEGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHGHHGGGGGGGGGGHHHHHGEHHGGHHHHHHGHHHHHHHHHHHHHGHHHHHHHHHHHGGGGGHGHHHHHHHGGFGHGGGGGHHHHHGHHGHHHHGGGGGFHHHH
+@1468344/2
+TATCCTACCAGCGCATTTAGCCCGCAGAAAATCAAACAGGCGAGCTGCCAGGCGATCAGTTGCGCTATCACCATCGGTTTTGCCAGCGGCAAGAGCGCTATTGTACATAAAGTGTACAGTAAAAACAGGATCTGCTGCGAGGCCAGACGT
++
+>A111BD111CAE1110AF3110AE000BFGBF1C1A00FF/E//B110B1//A///?@G21@EE@@EF2BF@1BAEE?E/0F111?E<E/EAGA0<BC<C2?F?FD221>?2@@>GD?G11?1?<C0G0<0G1D1<>C-<@-<...C-;
+@1375370/2
+GTCGGTAGGTTGGCCGACGAGGTGCAGCAGGTCGCCTGCCTGGATAATCGTCCCCGGCGACGGCACCATCAGCGTGTCATCGCGTTTCAGGCGTGAGCAAATGATTTTATCGCTGTTCAGGATCGGCACATCCTGGATAGCCATATTATTG
++
+BCCBCBBBBFFFGGGGGGGGGGGHGHHHHHHGFFGGGHHHHHCHHHFGGGHGGDHGGGGGCEGGGGGHHHGGHGGGGHHHHHGGCGGEFBFHGGGGGHHHHHHHGHHHHHHHGHDGHHFHGFHHGGGGGHHHHHGG/CFFHHHHHFHHHHB
+@883455/2
+TAGTTACCATAACATCCTCTTGTGTGAATAAAACAACCGGGCCCCATCGAGGAACGGAGCCCGGCGTCATATTAAAAGCCCGAAAATTTTACTGATTTCTGGGAAAAAAGCAATCAACATGTGATGAAGCTTGATTCCAGGGCGTGACCGT
++
+CCCBCFFFFFFFGGGGGGGGGGGHHHHHHHHHHHHHHGGGGGGGGGHGGHGGGHHGGGGGGGGGGGGGGHHHHHHHHGGFHGGGGEHHFHHHHHHHHHHHHGHHHGGHCFHHHGEHHGHHHDHEFHHHHHHHGHHHGHHGHGGGGGGGHGG
+@229141/1
+AAGCAGGTAACATGGCTGTTATAAGTTGATAACAAACTCTTGCGCCGCGTCGTGATAGTTTGCAGACCTTCAAAGTTTGTGTTGCGCAGTACGGTGATAATGTGCGGCGCACCAGGCCGCGTCACTTTTTGAACGATACGTGAAAGGAACA
++
+BBBBBFBFFFFFGGGCFGGGFGFHHGGHHFHHHHHGHHFHHHFGCEGGGGGEEEHFFGDGFFHFH@FGGHGHHHGGHHHHHHHHGGCEGGEFGG?GFGFHGHHGHGGFFGGGGHFGHGGCGCFGGHHHHHGGHGHFHFGE</EEHHACGCG
+@929450/1
+ACCAAAATGTTCCGCTATTGCGTTCAGGGCGGGCTGCCCTGGCTCAACCATCTGGCGCGCGATAATATCCGCGTCGATGACGGTTATTCCGAGGTCAGCGAAGGCATCAGCGACGGTACTTTTACCGCAGCCAATACCGCCGGTTAAGG
++
+AAAA1AAFDBFBFEGG1EGFG0BEFE3FABAE/EGGGHGGHCAFHHHHHG@FFGFFGG?EGGGGGHHGFFGGGCCCCGHBHC/CFCFHFHH?CGCGHBBCGCCGHHHHHHHCGGGC::EHGHEGGFB@G@@EFGGGGGGGA@?>BBFFF
+@1264553/2
+ATGTGGACTACCCTGACCATCTTCGGTTTATGCGGGATCCTGTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGTTCGTCGGTT
++
+3AAA3DFFFBFFGGGGGGCGFGCHGG2EEFHG5EFG2E2EHHHHFFHBGECEEFGHHFFHFHHBD@F?EAEEGEG?CFFGEFFGGGGGHHHFHDGEDGGHGHFGHH2?GBGFGFFFHF3FBGH2BCGHFEGCCGF01@1DBDFF?ED-@@D
+@790090/1
+ACGCCACTCCATAAGCCGCACTATGAGCAAGCAACAGGTTAGAGTGTCTATGTTTCGTAAAGTTCCGTTACGCATTTGTTTTTGTTTGTCATGTTGTAGACAGGTCTTATCTTCCATTATAAGTCTACAGATGCTGAACAACGCACTAT
++
+BCABBBBFFFFFGGGGGGGGGGHHHHHHGHHHHFHHHHHHGHFHHHHFHHHHHHHHGHHHHHHHFHGHHGGGGGGGHHHHHHGGGHHHHHGHHHHHHHHHHHGGHGHHHHHHHHHHHHHHHHGHHHHHHGHHGGHBGHHHHHGGFGGHH
+@1461942/1
+GCATAGACGCGCGACCATGAAATGGTATAACCGCGATCTTCAGCCCATTTCAGATAAGCGCCAGCGGATTCAAACGACTCATGGACAACAAAATGAACTCGCACGTTATTTTCTCCTGTTAGCGATTTAGCGCCTGATGGATATCAGCCG
++
+CCCBBFFFBCCCGGFGGGGGGGHHHFGHHGHHGGGGGGHHHHGDHGHHHHHHHHGHHHHGGGGGGGGGGGGHHHHGGGGGHHGFFHHFHHHHHHHHHHHHGGGGGGHHHHHGHHHHHHHHGHFG@HHFHHGGF?DHGHHFHHEHFHGHHF
+@58365/2
+GATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGATATTATCGCGCGCCAGATGGTTGAGCCAGGGCAGCCCGCCCTGAACGCAA
++
+BBCBCFFFFFFFGGGGGGGGGGHHHHHGGGGGEEGHHFFCFFGG1EFHHHGFBHFEE0EEFDHHGHHHHHCGEDGHHCAGEEGHHHE?/EEFGHHGGGGF/<DGHHHHHGCCCCGGGHHGHGHDBBBGGFFGGG?D.DACGB?F/:FGGGA
+@587498/1
+AGATCGAAGCGTGTCTGCGTGCGCAACCGACGCCCCATTACTCGCGCCCACTTCTCGCGTGGAAAGAGATCCAGCGCCGGTAACCCCATCTGAAAGGGTTTCGGTTCCGGACTTTCTCCGGCAAAAACAGCGGGTATCGGCGGCGCCGT
++
+CCCDCCCFCCCCGGGGGGGGGGGGGGGHGGGGGGGGGHHHHHHGGGGGGGGHHHHHGGGGGGGHHHHHHHHHHHHGGGGGGGGHHHGGHHHHGHHHHGHHGHGGGGGHGGGGGHHHHHHGGGGGHHHGHHHGGGGGGGGGGGFFFFFFC
+@596747/1
+CCATAAGCCGCACTATGAGCAAGCAACAGGTTAGAGTGTCTATGTTTCGTAAAGTTCCGTTACGCATTTGTTTTTGTTTGTCATGTTGTAGACAGGTCTTATCTTCCATTATAAGTCTACAGATGCTGAACAACGCACTATCTGTACAGAA
++
+AAAAAFDDFBDBGCGGFGFFGGHHHHHFHHHHGHGFGBFGDFHHGGFHGGHFHHGGFGGGHGGGGGGGHHHHHHGGGHHHGFHHGHHGHHHHHHHAGFHHGHHHGHBBFFFHEFBGFGFFFGHHFHHFGHFFHHGG<EDFHHHFHHHHHFF
+@108588/2
+TCTTTGTATGTTTAAAATTTAACCTTTTGATTATCAAACTAAAATTCCGGAAGCTGGAGATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCAT
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHGHHHHHFHHHHHHHHGHHHHGGGGGHHEFHHHHHHHHGHHHHHH?FH?FGGHHHFHGCEGGEFGHBDHHEFEGAEFHHGBGEF/FDFGGF?F2DGFHGHGGG/00FHGGCCFHH1G@EGGF
+@122271/1
+ACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGATATTATCGCGCGCCAGATGGTTGAGCCAGGGCAGCCCGCCCTGAACGCAATAGCGGAACATT
++
+CCCCCCCCFFFFGGGGGGGGE?FHFHFFFGGGFFGHHHHGHHDFEEGGGGHFHGHHGHGGGGHHGHGG?FFGHHHGGGFHHHHGGGGGCGCHHHHHGGGGGGGGGHHGHGHGFHHHGFHGGGFGHGCFGGGFBFGFG?GFFFG?F?B@BFF
+@1381268/2
+GTTTTCAGCGCTATTTCTCCCCCCTGCGTTTGCTGCACTGGCAGCCATCGGCGCAGGGGGGAGAAATAGCGCTGAAAACGTCCTGGGATGCGGTGCCGTCACTGTTTGTCCGGTTGGCCGAAAGCGAGATGAGCGTAAGTCGGTTTTCATT
++
+3>33>DF5DADBGGGGGGGGGCEGCGGGDGGGFGHFHHGHHHHGGGGHHGGGGGCE?EGGGCCGF1D0<GCCF?FHGGC@HE.DHFAGCEE@@:ABFGDB.DBFFFBFFFFG@@DBBBF?BB?FFFFB<.F/9/B:.AA/;ABB..EFFFF
+@187784/2
+GCCCTGGCTCAACCATCTGGCGCGCGATAATATCCGCGTCGATGACGGTTATTCCGAGGTCAGCGAAGGCATCAGCGACGGTACTTTTACCGCAGCCAATACCGCCGGTTAAGGCTACGGTATACCTCATATCTCCAGCTTCCGGAATTTT
++
+BCCCDFBFFFFFGGGGGGGGGGGGGGGGGGHHHHHGGGGGGGGHHHGGEFGHHHHHGGGGHHHHGGGGGHHHHHHHGGGGGGHGHHHHHHHGGGGGHHHHHHHGGGGG@EGGHHHGHHGGHGGHHHHHHHHHHHHHHHHHHHHGGFAEGGG
+@1245575/2
+ATCATAGACAGCATAACCAGAGGATATCGCAACAATCGGTTAAATGAACTTCTCTCTATACCGCTAACTACGTAGAATACCCATAATAATAAGAGAGGCTATTATGATTGAACGTGAACTGGGGAACTGGAAAGATTTTATCGAAGTCATG
++
+1AAAAF3DDF1A1BBGGGBGGAFFHGFBEE0EEHHFBFGEAEHFHFGFE1EFFHHHHBGHHFGGGGGFFFHGFFAFBGHFHBGFHFFFHHFFHH10>ECHBF@DGHHFFDGGBCFCGG1FD0?@/?F1GFHHEEH1FBFFGF/CC//@DG1
+@1112561/2
+TTAATAACCTGCAAAATAACCTCACCGTAACGGAAACCGGCAAAGATACCGGCGTTCTGAGCCTGACGTTCACGGGAGAGGATCGCGACCAGATCCGCGACATTCTCAACAGTATTACCCGTAACTATCAGCAACAGGATATTGCGCGGAA
++
+BBBBBFFFFFFFGGGGFFGGGFHHHHGGHGGGGGGEHHGGGFGHHGHHFHEGGGGGGGHHHGFFHHGGGEEFHEGGFGAFC0?3/>EE?FDHHBGHH/BDGGFHHDGGGFHHHHHGHFHGAEDGCDFFFHGHHGHEHG.GHHHFHGGGFAD
+@824142/1
+GGCCAACACCATGAATGAAGATCTTGTCCTGCCAGTAACCAATAAAGAGGCGGCGCAGAAGTTTGCCGCCAATGTGGAAGATGGCGTTCAGGGTTACGGCATACGCGTTACGTATAGTCAGAAATAGCGTCAGCGTTGTGGCTGACCAGC
++
+333AAAAAABAFBDGFDGFFBGFHHHHGFFGHHHHFGHHFHHHGHFFHHHGGCGGGFC0CGHHEGHHGGCFCHH4GHHHHHHGGHGGGGHHHA?GEHGD/<CGHHGGCCAFGHFBBH1<1FGDF1FDFC>CGDFFDEF.CDEGEHGFHHA
+@228705/2
+GGGCGGGCTGCCCTGGCTCAACCATCTGGCGCGCGATAATATCCGCGTCGATGACGGTTATTCCGAGGTCAGCGAAGGCATCAGCGACGGTACTTTTACCGCAGCCAATACCGCCGGTTAAGGCTACGGTATACCTCATATCTCCAGCTT
++
+A3ABBBBBDABFGFFGCBGFGGHGHHHGGCFFFEECFGGHHHDGAFCGGCEFFD3EE?FEHE?GGEGCAFFGHF@CCGHFHHGHHGGCCCFEFGFHHBFGFGGGAHHBCGGCEDCDGG.EGGEFF0/9E9EEFBFFFGFGG0;BBFF/:B
+@305619/1
+GAATAGTAGGTTAATGCTCAGAGCGTATCGTCTTTGTATGTTTAAAATTTAACCTTTTGATTATCAAACTAAAATTCCGGAAGCTGGAGATATGAGGTATACCGTAGCCTTAACCGGCGGAATTGGCTGCGGTAAAAGTACCGTCGCTGAT
++
+?AAA1D3DDFDFG1A31GGD111FEEEEFGHHHFHHFGHFGHGDF1FGGBHFHFHHE1FFGGHBAFEFGFHEHFHEFGB?//B/GGFHHHHEFFHFB0BBBFGECFEEFG1DFGHGGGGC/<FGBC01//B?/<FGHB?GBFECE@C...<
+@728250/1
+CTACCAGGGCGGTCACAACGCAGGCCATACTCTCGTAATCAACGGTGAAAAAACCGTTCTCCATCTTATTCCATCAGGTATTCTTCGCGAGAATGTAACCAGCATCATCGGTAACGGTGTTGTGCTGTCTCCGGCCGCGCTGATGAAAGAG
++
+CCCCCFFBBBCCFFCGGGGGGGEEEGHHHHHHGHGGGHGHHHHGGFHGHGHHCGGGEGHGHHHHFHHEHHHHHHHHGHFGHHHHHHHGGGGGGHHGGHHHHHHHHHGHHHGGGGHGGGHGGHHGHHGHHHHH?CGGGGGGGGGGHFFFHHB
+@639241/2
+GTCTGGCACGCGGCGCCTGCGCGCCAGTGCGTTCACACATCAACAGGGAACGTCGCTGGCGCTACGGCTATTGCCCGAGCGTTGTCCTGATCTGGCGGAAATCCAGACGCCGCCGATAGTACCCGCACTGCTTGCCAGCGAGAACGGA
++
+AAAA3>FFFBDB?EEGG?FGEGEEEEEFCG?E1FFGFHG3FHHGEFAEEGGGFHEGGGGEGG/@@EEEE/FDGBGFDCCCGGGGFGFFG1?FFGHHCGGGC1>C0DBF@CGD-CC-9-C0CFEFE?@-BB00;F?FBBE--9-ABD..
+@1182384/2
+CATCGTAAGGCATGTCTTCGATCGGGTTGATCTTAGAGATAACACCCTTGTTACCGTGGCGACCTGCCATCTTATCACCCGGCTGGATACGGCGTTTAACGGCCAGATAGACCTTCACGATCTTCAGCACGCCCGGCGCCAGATCGTCGC
++
+BCCCCAFFFFFFGGGGGGGGGGHGGGFFGGHHHHHHHHHCHHHHHGGHHHHHHHHGGHGGGGGGGHHHHHHHHHHHHHHHGGGGGGHHHHGGGGEGGHHHGGGGGHHHHHHHHHGHHHGGHHFHHFHGHHGGGGGGGGGGGCHHHHHHCC
+@1508449/2
+ATGAGTAACGGCGCCAGTAATTCCCTCACCTGCAGAAGTCTTTGAGGAAAGAATAAACTGACACAGCGCCTTATGCGGCCAGTATGTTAGAGGCCAGGCGACCAGCGCGGTAATAAATAGCACGATTGCGCCTGCCG
++
+CCCCCFFFFCCBGGGGGGGCGGHHHHHHHHHHHHHGGHHHHHHHFFHHHHHHHHHHGGHHFHHHHHHGGGGGHHHHGGGGGHHHHHHHHHHHHGGHGHGGGGGGGHGGGGEEGHHHHHHFHHHGCHHGHGGGGGHFC
+@701660/2
+AAACAGGGTTATCAACACTTCTTCGCCTTGCTGGGCGCGGCCAGCGCCGTCACGACCGGGCACCCTGAAGCCAGGAAATTGCTGGATTACACCATAGAAGTGATTGAGAAATACTTCTGGAGTGAAGAAGAGCAGATGTGCCTGGAGTC
++
+AAABBFAAFFBFGGGGGGGGGGHHHGGGGHHHGGGHCFGGGGGHGGGGGGGGGGGGGGGGGGGGGHHHHHHHGEHHGGGHHHHHFHHHHHHHGHHFHGHHFGHHGHHGHHHHHHHEHHHHHHHHHHHEHFHHHHHGHHGHHHHHHHHHH
+@400346/1
+ATTCCGAGGTCAGCGAAGGCATCAGCGACGGTACTTTTACCGCAGCCAATACCGCCGGTTAAGGCTACGGTATACCTCATATCTCCAGCTTCCGGAATTTTAGTTTGATAATCAAAAGGTTAAATTTTAAACATACAAAGACGATACGCT
++
+BBBBBFBBBBFFGGGCGGGGGGHHHHGGGECE1EGGHFGHHGGGGGHHHHHHHGGGGG>EEHGHHHHHGG2GFFGHGHHHHHHHHHHHHHHHHGG/BFFHHGHFHHHHHBFHHHHHHHGGGHHHFHHHFGHFHHHFHG1FHH?CGF@EGG
+@466572/2
+TTTCACGCCGGAGAGTTCCAGCATTGATTGCCAGATAAGTTTGTTTGACTCGCCGGTCGCGGCCGCCAGCTTCGTCACCAACTGATTCAACGTATTATGTTCAGCAGGCAATAATGGCCGATCCGTTGCCGGACGTTGCTGCGGCTGCGGA
++
+AB@BBFBFBBBDG?EGFGGGGGHHHFFFGFGHHHGHHGFBGFHHHHHHHHHGGGGGGGFGCEGGEGGGEGHHHGHGEGHHGGHHDHHHHHEFCFBHFHHGHHHHHHHEGHGHBDGHEFHC?FGGH.GDFHGGCG@EGFGHHHGGGGGGGG-
+@440629/2
+GGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGATATTATCGCGCGCCAGATGGTTGAGCCAGGGCAGCCCGCCCTGAACGCAATAGCGGAACATTTTGGTTCTGAACTTATCG
++
+>A33>D@FBFBAEA2E2GGCFGHFEFEGG2FG3GH3GHCGFAE1FGBFGG1FFBGHFGGGGFHHB?EE@EEEEHHHHDAE??/<EF?0D?C??DEHHE0CCD?AEGHGGCGGGHHFHHDC?EB0=ADG@C:BG0<C@GE0GHB0GHGGGF.
+@1463930/1
+CTTTCAAGCGAACAAACATGCGCGCGACGTTTTGCCCGTTCCCGCCAGGGCCGGAACCGACCGTCGAGAAGACCGACATAATGTTGTCTTTCTCATGGGTGAAGTAATAGTTTTCAACCTTTTCAACGACTTTCAGGGTCTGCTGTTGCGT
++
+AABBAFFFFCBCGGGGGGGGGGGGGGGGGGGGGFHHHGGHHHHGGGGGHGGGGGGGGGGGGGGGGGGGHGHHHHGGGGGHHHHGHHHHHHHHHHHHHHHGDGHHHHHHHHHHHHHHHHGHHHHHHHHGGGGGHHHHGHHHHHHHHHHHHGE
+@1206560/2
+GTTGTGAATATATCAATTTCCGCAATAAATTTCCTGTTGTAATGTGGGTTCATTCGCACAGATAGCAATCTGTAAACCGAACAATAAGCGCGACAACACAACATCACGGAGTACACCATCATGGCTAACTACTTTAATACACTGAATCTG
++
+AAABABFFFFFFGGGGGGGGGGGGGGHGHGHHHHHHHHHHHHGHHHGGGGHHHHHHGGGGEGHHHHHHHHHHHHHHHHGGGGGHHHHHGGGGGGGGGHGHGGHHHHHGGGGGHHHHHHHHHHHHHHHGHGHHHHHHGHHHHGHGFHHGHH
+@819662/2
+GAAATGTAGAGCGGATAAGCGCAGCGCCATCCGGCAAAATTACCAGGCGGTATGATACAGTTCGACAATGTCCGCCAGACTCGCTTCACGCGGATTGCCGCCCGTACAGACATCATCGAACGCCGCCTGCGCCAGCGCCGGGATATCCT
++
+BBBCBFFFFFFFGGGGGGGGGGGGGGGGGGHHGGGGGHHHHHHHHHGHGGGGGHHHHHHHHHHGHGGGHHHHHGGGGGHGHHGGGHGHHHHGGGGGHHHGGGGGGGGGGHHHHHBHHFCGHFGCGGGDHHGGGGGGGGGGGGADFGGFF
+@392205/1
+TTACTGAGGAAAGTCACCAATGAAAGCCGTTATTTTTGCCTATCACGATATGGGATGTCAGGGCGTGCAGGCCGTACTGGATGCAGGATATGAGATTGCCGCGATTTTCACTCATGCCGACAATCCTGCGGAAAACACCTTTTTTGGCTC
++
+CCCCCFFFCFFFGGGGGGGGGGHHHHHHGGGFHHHHHGHHHHHHHHGGHGGHHHHHGHHHHHHGGGGGHHHGGGGGGHHGHGHGHHHGHHHHHHHHHHHGGGGGGHGHHHGHGHGHHHGGGGGHHHHHHCGGGGHGHHGHHHHHCGCGFH
+@525228/2
+GATATTGTCTGGTCTGATGCCCAGGAGACCTTCGATCGGACGGTCGATACACACATCAAAACCCTGCGCGCTAAGCTACGCGCGATCAACCCGGATCTCTCGCCAATTAACACGCATCGTGGAATGGGATACAGCCTGAGGAGCGTCTGAT
++
+BBBBBFFFFFFBGGGGGG5GGGHHGFGHGGGHGDHHHGGGGGGGGGGGHGHHHGGHHHGFHHCGHFHGGGGEEAFHHHGGGGGG@EEFFHHGGCCGGHFFDDFGGGHEHEHFHGGGGGGGFFE0<GFFFCGHGHHEHH/CA0AECDGDEGF
+@572730/2
+GGCTCAACCATCTGGCGCGCGATAATATCGGCGTCGATGACTGTTATTCCGAGGTCAGCGAAGGCATCAGCGACGGTGCTTTTACCGCAGCCAATACCGCCGGTTAAGGCGACGGTATACCTCATATCCCCAGCATCCGGAACTTTAGTTT
++
+>1>>11@11>1@AF1FECEGCA??AF22D/AEAEEAE/2G12112D2DDGFG//EEB0FE>/>>/CF01F1EE//<//<11112BBA@C/<<CC?1?B/<<A/-C.1=B0-<A?-C..;CGBGHHHF:0:.:.:/=;C??.--000CCF09
+@593793/2
+GAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGATATTATCGCGCGCCAGATGGTTGAGCCAGGGCAGCCCGCCCTGAACGCAATAGCG
++
+B@3AAFFFFFBBGGGGGGGFGGGGCFGE2255DCBFAEGAFGHHFB55DEEE@0EE?FB@GHFHFEGG?HHHHGG?FFGFEGE??EH4GFCC/CC<B/1?11FGC//<-CAFHGBC0=D</<</;CE?CAEGGCFAC?A/BB..A?A0;C-
+@927780/1
+ATATGGATGCTCTCGGGCCGGGTGAAATGGTGGCGACATTACAGCGCCTGGCCGCACTTTACGGTCCTCGTTACGCGCCTTGTGAACAATTAGTGCGCATGGCGGAGCGCAGGGAGCATTTCTGGACGAATGGGGAAACTGACCAGGGAAA
++
+ABBBBFFFFFFFGGGGGGGGGGFFHHHHHHHHGHGGGGGHHHHHHGGGGHHHHGGGGGHHHHGGHGGHHGHGHGGGGGGGGHHHHHHHHHHHHHHHGGGGGHHGGGGGGGGGGGGGGHHHHHHHHHHGGGHHHHGGGGGGGGGGGGGG:FG
+@1430374/1
+GGTATAAGCAGGTAACATGGCTGTTATAAGTTGATAACAAACTCTTGCGCCGCGTCGTGATAGTTTGCAGACCTTCAAAGTTTGTGTTGCGCAGTACGGTGATAATGTGCGGCGCACCAGGCCGCGTCACTTTTTGAACGATACGTGAAAG
++
+BBBBBFFFFFFBFFFFGGFGGGEHGBHHHHHHGHGHCHHHHHHHHHHHG2ECGGGGEEEHHHHHHHHHFHFHCGHHFHFHGHHHHHGGEGGGFEGHHGGCGGHHFHH4BGGCGCGGGGHAFGG?CCGGGGHEHFHGGHHGACEFEHH.EFF
+@401043/1
+ATAGTAAACAGAATAACCGCTATTTTAGCGCCTGGGCGAACGTCTTTCCGGACGACATTGGCAACTTCAGCGCCTTTAACGGTAATTTCCCCCAAACCCACTGGGCGCCACAAAATCTGGCGCAGGACGATACCACGCATATGAAATCG
++
+BCCCBFFFFFFFGGGGGGGGGGGHHHHHGGGGGHHGHGGGGGHHHGHHHGGGGGGGGGHHGHHHHHHHHHHGGGGGHHHHGGGHGHHHHHHHGGGHHGGGGHHFEGGGGGGHHHHHHHHHGGGGGGGHGGGGGHHHGGGGGHHHHHHHG
+@684841/2
+CGATAATATCCGCGTCGATGACGGTTATTCCGAGGTCAGCGAAGGCATCAGCGACGGTACTTTTACCGCAGCCAATACCGCCGGTTAAGGCTACGGTATACCTCATATCTCCAGCTTCCGGAATTTTAGTTTGATAATCAAAAGGTTAAAT
++
+AB3AB@FFFFFBGGGGGFGGGGGGGGGHHHHHGGGGFHHHGGGGGHHHHHFHGCGGGGHGHHHHHHHGGGFGHHHHHHHGGGGGFDGHGGHHGGGGGHGHHHFGFHHHHHHGHHHHHHHGGGCFHHHGHHHFHGHHFHHHGF0GGHHHHHH
+@1342192/1
+AAACGTATGAGCGCGTATATCAAAACGCGACGAAAAGACTTACCCTGATATAGACTGCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTGGATCACACTAATTATGTTTGGTGTGCTGGAATGATGTA
++
+AAAA1111B3D111EA0A1F3DGFF0AA0/AA//B/B/G1FGBB0AGFG2FF2@BGF0BE/E/BFGFB1BGG1BDFFG11@GG12FHHHFGHBG12B1?<EE>FHHGFBDG2F0BBB<GH1@CFG2FBF22@CF//CAGEFB0GGB1DGFH
+@459568/2
+GCCATACGGCGTATCCGGTTCGAGTTTCGCCTGCTGTCCGGCATGGGCCAGATCGACGTTCACGCATACTGCGCCCGCATCCAGCGCGCCGAGCAGCGCATCACGCATAGGGTCGAGGATTTTGGTTAAATCCCAAACGTCTACTACGCGG
++
+CCCCCFFFCCBCGGGGGGGGGGHHHGHHGGGGHHHHHHHGGGGGHHHHHGHHGGHGGGGGHHHHHGGGHHHHGGGGGGGGGHHHHGGGGGGGGGGGHGGGGGHHGHGGGHHHHHGGGGGHHHHHGHHFHHHHHGHG.EDGGGGGGGGGGDF
+@9888/1
+TGTCGATGTTCTCCTACGGGATGTTAGAAGTTAACCGTCTGGCGGGCCGCGAACTGCCGGTGGACGGCGGTTTCGACGATAACGGTCAGTTGACCAAAGAACCGGGCGTGATCGAGAAAAATCGCCGCATTTTACCAATGGGTTACTGGAA
++
+AA>AAB?5BDFDFFFBGGGG?EEBFHHHFGBGHGBFEEAAFBFEF?EECEC/>>GH3FEGEGGAGEGGGGGCGBDFFDCCFGHGGFGCHFHHGF0GHAGFFHHCGCD@ABDGGFDGGGGF.9/EEAB??DFFBFFFFFFFFF/..:BFEB/
+@53421/2
+TACCAAACCTGCCGCGTTGATTCAGGGGTGGGGACCACAGCGCCACAACTGCGGCGAGCGCACCGCGCGCGGCTCGACTCTACTGGCGACCATTACCGGTAATGTCGGCATCAAAGGCGGTTGGGCTGCGGGTTACGGCGGCCGCGCCCA
++
+CCCCCFCCCFFFGGGGGGGGGGHFHHHGGGGGGGGGHHHHHGGGGGHHGHHHGGGGGGGGGGGGGGGGGGGGGCGDCGGGFHH1DGHCCFD@HHHHHGG@DEHFGGGGFDFFFGGGEEGG;>BFFEBDA>DF@EABEFA;D--------.
+@775116/1
+GTGTAGATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGATCTTGGATGCACTTCCAGCGGGTTGACGT
++
+BBBBBFFFDFFFFFGGGGGGGGFGGFGHHFHGGGGCEGGFGEHFHFGGGGGGGGGHHHGGGGFGHHHHHGHHGGGGGGGGCGGGGHHEHHHHGGEGFHGHHHEHHHHH0CDGGGGGGGGGGGGGGGGGBBFGGGGGGGGGGFFFBEDFFB.
+@864178/1
+GCCCTGGCTCAACCATCTGGCGCGCGATAATATCCGCGTCGATGACGGTTATTCCGAGGTCAGCGAAGGCATCAGCGACGGTACTTTTACCGCAGCCAATACCGCCGGTTAAGGCTACGGTATACCTCATATCTCCAGCTTCCGGAATTTT
++
+AABBBFBFFFFFGGGGGGGGGGGGGEAEGGHHHFFFGGEGEFFHHHGGEFGHHGGHGEGEFGHHGFGGGGFHHGHFGGGGGDHGFGHHGHFGGGGGHGGGHGHGGFGGFGGHHGHHHGGG<GFH0GGHHHHHHGFHEHHHGGHGGDGGGGF
+@864178/2
+TAGTAGGTTAATGCTCAGAGCGTATCGTCTTTGTATGTTTAAAATTTAACCTTTTGATTATCAAACTAAAATTCCGGAAGCTGGAGATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGGACCGTCGCTGATGC
++
+ABAAAFFFFFFFGGGGGCGFGEFGGHGHHHGHHHHHHHGGHHGHGEHHFHHHHHFHGHGHGHHHHHHHHHHHHEHHGCFGHHHFFHFHFFFHHHHHHHHHGFHGGHHHHFHDEGGGG>C/FHH?2/FDGEDFHGG/@0GD/?/->>.1>D
+@1325586/2
+ACATTACGCCGGAATTCGTGCGTGATGAAGTCGCCGCGGGCCGCGCGATTATTCCCGCCAACATCAACCACCCGGAATCGGAGCCGATGATTATCGGCCGCAACTTCCTGGTCAAAGTGAATGCCAACATCGGTAACTCGGCGGTGACCT
++
+ABBBBFFBBBBBGGFGGFCFGGGGGGHHFBGCF?EEEEECE?EC?GGGEEFHBGEHDGGGGGGGHHHBGGGEGGGCDEDFFGCGG??-<GFHFHHECGC-@-@DBGHHHHH/CGCCF0CF0FF0CBFG.C0:ADACFBFGGEAA--.9FF
+@1503485/2
+GCGATTTCTGTCACCTGTTGCTGTTCGATCTCTTTAATACGTACTTCACGCTCGGCCTCAACTTTCCTGGACCGTACTGCTTGCTCACGTTCGATCTCAGTCTCCTGGATCTGCCGCTCAGCAAGAATGCGCGTCTGTTCTGCTTCACGCG
++
+>11>1>A3D3@BBFGFFGGFGFFF1B003BF3DDEGBGFF0AB0AG121F0EE/EF?EHFHHBGFF11FF0GBEE/BF@FGGB>1B1G/F00//200B2@BD1B@F10EEG11>>EE/EC0FDG0BF11FE/<<//?FDGHFHHGFBGE0<
+@931164/1
+GAGCGTATCGTCTTTGTATGTTTAAAATTTAACCTTTTGATTATCAAACTAAAATTCCGGAAGCTGGAGATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAAT
++
+BBCCCAACFCFBGGGGGGGGGGHHHHGHHHHHHHHHHHHGFHHHHHHHHHHHHHHHHHHGGGGHHHHHHGHFHHGHHGHHHHHGGHEGHHHHHHHGGGGG>FGHGHGHGGGG/FGHHH2?FHDFFGGGFGHFFGFHGADD.CHGHHGGDGE
+@1389716/2
+GCCCCATACGGTGCCAAACAACCCGACGAAGGGGGAAATGGCGCCGATCGTCGCCAGATAACCGTTGCCTCGTCCCATGTAGCGGCCAACCGCTGCGACGCGACGTTCCAGACGGAAGCCGGTACGTTCTTTAATCCCTTCGTTATCTTCG
++
+CCCCCCFFFFCFCGGGGGGGGGGGGGCFEFGGGEGGGHHHHHGGGGGGGGHHGGGGGHHHHHGGFGGGHHHGEEGGGFHHHHHCGGGGHGGGGGGFGGGFGGGGGGGHHHHGGGFGGGFGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFF?
+@935746/2
+GGCATCAGCGACGGTACTTTTACCGCAGCCAATACCGCCGGTTAAGGCTACAGTATACCTCATATCTCCAGCTTCCGGAATTTTAGTTTGATAATCAAAAGGTTAAATTTTAAACATACAAAGACGATACGCTCTGAGCATTAACCTACTA
++
+AAA?AFFFFBBBGGGGGGGGGCHFGCEGGHHFHHHGGGGGGEGGEGFHEHH3BDFGHHHHGFHFGHHHHHHGHHHHG?EGGHHHGHHGFHFGHFGHH3F3?AGFHFHHHHHFFGGHHHHHHH2GGGCFGCGGEGHFBGHHHHHHGHHHHHE
+@834333/1
+TCCCTGGCTTGTCGCCTGCTCAATGAACCACGAGAGCGCGCCGCAGTGGGACGTATTTTTGACGCTGACGAAACCCAGCCCCGTCTCTCTCGCCAGACTAATAGCGTGGTCTGTCGCCTTTATCAGCGCGCAGTGTCCCATTCCATCATCA
++
+CCCCCFBFFFCFGGGGGGGGGGHHHHHHHHGGGGGGHGGGGGGGGGDHGHHHGGGHHHHHFGHGGGGGGGGGGGHGGHFGGGGGGHHHHHHGGGGGHGHHHHHHHGGGGHHHHHGGHGGGHHHHHHGGGGGGGGHHHHHHHHHHGHHHHGG
+@1520581/1
+GTCCCGGCGTGGCGCACGGTCAGAAAAACGCAGTCAGGAGAGGAAATTCAGCCCTTGCTGCAACACCAGATCGCAAGCTTTGGTTTTCACCTTTTCCGCCAGCGGCGTACTGCCGATATTATTGAGGTTCAACTGCTGGCCGTCCTTCGT
++
+>>>AA>ADBBDDFFGGGGGGGGCGHHBCEGGGGGCHFGCFHGGHH3GFHGFFBEHGHFFHFHHHHGGHHHHHGGF1EHHGGHF?GHGHHHHHHHGHGGGGGGGGGGCACGHHHHG<-ADBHHHHGHE<GGGB0D/FHHGDHC-AEGHFH;
+@1545126/2
+TCACTGTACTCTTTTGCCGTTTTCATCTTCACTACCTCACGGGTTCCTGACAGCCTAAGTATAGACCGTTGAGAAAACCAGCAAACACGCCGGCAAGGCGCTGTCAGACGCAGAAAATTGTTCTACACTGGCACAAAGCGACAGGAGGAAA
++
+AAA33FFFFFFFDGF5GG2AAGGHGGFHFFFHHHCGHFHH22EEFHFGBBHGFGHHGHHFHFHHFHEEEGGHGFGGGHGHFHHHHGHHGCGGCGEGGGE??@EFHHHHHC/BC?FHHHHDHH12>GHFBF0FG1GF0FC?ACCCFCFGC/G
+@911648/1
+GGCAACGATCGAGCGGATGGGTGATGCGTATAGTTGGGTAGGCTACGCGGTGTTGCTCGCGCTGGCGCTGAATATTTGTTACGTCTTGTTGCGACGCATTACCGGTATTCGCACCATCATGTTGACCGGGCACATCATGTTCCAGCAGGCG
++
+CCCCBCBCCBBCGGGFEGGGGFEDHHHGAEGHHGHHHGGHGGHHHHGGGGEGGGHHHHGGGGGGGGGGGGEHHHGHHHGHHHGGHHGHHHHHGGGGGGGGGFHGGGGGHHHGGGGHHHHHHHGHHFFGGGGGGGHHHHHHGEHHHHGGGGG
+@212929/1
+CTTAAAACCCTGCTGCTGTCGCCGGAGCGCGTGTACTCGCGTCAGCAATTGATGGATATTGTCTGGTCTGATGCCCAGGAGACCTTCGATCGGACGGTCGATACACACATCAAAACCCTGCGCGCTAAGCTACGCGCGATCAACCCGGAT
++
+BBBBABFFABFFGGGGGGFGCFGGCGGGGGGGGGHHHHGGGEEGGGHHHHHHHHHHGHHHHHHHHHGHHHHHGFHFHHFGGHGGHHHHHHHGGFGGGFFGCEHGHHHGGHHHHHHHGGHGGGGGGGGGGHFHGFCGGG@DGGGGGGGGGG
+@989142/2
+TTGGTCAACTGACCGTTATCGTCGAAACCGCCGTCCACCGGCAGTTCGCGGCCCGCCAGACGGTTAACTTCTAACATCCCGTAGGAGAACATCGACATCGACATATCTACCATCGTGATCGGCGTAGACGGGATGGCGACGATCAGCGGAT
++
+3A??AFFFFFFDGGGAEFGGGEFEEGGEHEEE2EEAEHHGGGGEHBBAE?@CCGGGG@E0/>//??EGHHHHHFHHFHGHG//CC10??CGFHGFGCDHCH@C?GHFHHGH1GHGHHFHFG?@C-<@<0AEGG.:CFG?B?BEADGFG@?-
+@66397/1
+GCCTATCACGATATGGGATGTCAGGGCGTGCAGGCCGTACTGGATGCAGGATATGAGATTGCCGCGATTTTCACTCATGCCGACAATCCTGCGGAAAACACCTTTTTTGGCTCCGTCTCCCGGCTGGCGGCAGGATTAGGGATTCCGGTTT
++
+ABCCAFFFFCCCGGGGGGGGGGHHGHGGGGGHHHGGGEGGHHHHHHHHHHGHHHHHHHHHHHHGGGGGHGGHHHHHHHHHHGGGGGHHHHHHGGGGGHHHHGHHHHHGGGHHHGGHHHHHHGGGGGGGGGGGGGFHHHHHHHHHHHHGGGG
+@1027794/2
+TTTCACGCCGGAGAGTTCCAGCATTGATTGCCAGATAAGTTTGTTTGACTCGCCGGTCGCGGCCGCCAGCTTCGTCACCAACTGATTCAACGTATTATGTTCAGCAGGCAATAATGGCCGATCCGTTGCCGGACGTTGCTGCGGCTGCGGA
++
+CCCCCFCFCBCCGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGGGGGGGGGHHHGHGHGHHGGHHHHHHHHHGGHHHHHHHHHHHHHHHGGHHHHHHHHHGGGGGHGHGGFGGGGGGGHFHHHGGG?DGGG:
+@1270490/2
+ATCAGCTGTTGCGCTATCTCACCGCCAGCACCGTTTACCACGTTAATTACGCCATCAGGGAAACCTGCCTCTTTAGCCAGCTCAGCGACTCGCAGCAGTGTCAGCGGGGTATATTCACTTGGTTTAATGACGATGGTGCAGCCACATACCA
++
+BBBBBFFFFFFFGGGGGGGGGFHGGFFGDHGHGHFGFH3ECEGGHGGFHFFGGGGHHGFFFGHBHHHEHHHGHHHHHHGHGFHHHBFEECGGGGGCGHBGHHHHBFGGG<CGFHHGHFHFHHGEHEBGFBHDEFGGGFHGFHCG/CFFFCG
+@597719/2
+GTACAGATACCGCGCCACGCTGCGACAGCGAACGGGAACGCACGTGACGTTTAGAGACGGAGTCCAGCTCAGCTTCCCGCTGTTTGACGACCGACTGCGCGGCGCGCATTTCACTCTGGCGTTGCTCCAGCAAGGCACGGGCGGCGGCAA
++
+CBBCCFFFFFFCGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGHGGFGGHHHGFEHGGGGEHHHHHHGHHEHGHHHGGGGFHHHHHGGGGGGGGGHDGGGGGCGGCGGGHHHHHHHHHGDFGGGGGGGGGFGGGGGGFAGFFFFCFFF
+@1048847/1
+ATTCCGGTACTGATGGGTCCGCATACCTTTAACTTTAAAGATATTTGCGCCCGTCTGGATCAGGCGAGCGGACTTATCACGATTACCGATGCGGCTACGCTGGCAAAAGAAGTTTCCTCTTTACTGACCGACGCTGATTATCGTAATTT
++
+CCCCCFCCCCFFGGGGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHFHGGGGGGGHGHHHHHGHHGGGGGGGGGHHHHHHGGHHGHHGGGGGGGGGGHGGGGGGHHHHHGHHHHHHHHHHHHHHHHEHHGGGGGGGGHHHHHHHGHGHG
+@641250/1
+GATTGGCTGCTTCGTGGGCACGATTGTCGGTCTGCTGCCGGGCCTGGGACCGATCAACGGCGTGGCAATCTTACTGCCGCTGGCCTTTGCGTTGCATCTGCCTGCGGAGTCGGCGCTAATTCTGCTGGCGACGGTGTACATTGGCTGTGAG
++
+BBBB@CFFBBFFGGGEGGGGGCAAAFHFCFGGGHHHFHGGGGGGGGGGHHGGEGGGGHGGGGEFGGHHGHHFHFFFBHGCECGGHGFFHHCDDCDGGHFGEG2FFFG/<EFGGGGG?DGHHHHHHHE/.@@D?D.CDGGFGGGBFF?CBBF
+@1109343/1
+GAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGATATTATCGCGCGCCAGATGGTTGAGCCAGGGCAGCCCGCCCTGAACGCAATAGCG
++
+CCCCCFFFFFCBGGGGGGGGGGGGGGGGGGHBHFHGGEE1EFHGFFGFHDFGGGGGGFDFGFHG1EGGGHHHHGG?FGHHFH?EEEHHFHGGG/CDGGHHHFFGGGGCGGACGFHHDGFHFFHHFHGFEDDHGGCGGCFFGGGGAFGGGGG
+@1139620/2
+GTTTAAAATTTAACCTTTTGATTATCAAACTAAAATTCCGGAAGCTGGAGATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGAT
++
+A>ABBFFFFFFFGGGGGGGGGGHHHHHCHHHHGHHHHHGHGGGGHHHHFHHHHHHHHEHFHHGGEFGGEHHHGHHG?EGGGEFFHGHGGFGFGEGFFHH3B?GGFGECDGCHFHHHHC/BCD/@GFFFGFGGFHHH@?AGHFHHF@?DG--
+@107595/2
+GTACTTCACGCTCGGCCTCAACTTTCCTGGACCGTACTGCTTGCTCACGTTCGATCTCCGTCTCCTGGATCTGCCGCTCAGCAAGAATGCGCGTCTGTTCTGCTTCACGATGGCGCTCGGCCTCAAAAGCGGCAATTTTAGCGTTTTGTT
++
+AABBAFFFFBFAGFEFGGGGGGHHHHHHHHHHGGGGFHHHHHHGHHHHHGHHGGHGGHHGHHHHGHHHFHHGHHHGGFGGHHHHFGHHHHGGGGFGGHHHHHHHGFHHHFHGGHGGGGC?FGDHHGHHFHGFGCFHHHHFFFGGGGGHHH
+@1195622/1
+GGCTCAACCATCTGGCGCGCGATAATATCCGCGTCGATGACGGTTATTCCGAGGTCAGCGAAGGCATCAGCGACGGTACTTTTACCGCAGCCAATACCGCAGGTTAAGGCTACGGTATACCTCATATCTCCAGCTTCCGGAATTTTAGTTT
++
+>A1>ACCBC1F111BGEEGGE0E0F2GHHFGGGGGC/FGHDAAA//1FBGGEGGGGGHE/>@///0BB1@BAE/EE<FE1>FGHHGGCGGCEHHHHFFFC/</F1FBG1?CF0<><F<DGFDF/<DG000DG//GHE/ACA-CGGGHG0:;
+@1212175/2
+GATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGATATTATCGCGCGCCAGATGGTTGAGCCAGGGCAGCCCGCCCTGAACGCAA
++
+BABCCFFFFFFFGGGGGGGGGGHHHGHGCGGGFGGHFHGFEFEGEDGHHFDGHHFFDECGGGGFHHHHHEGGCGHHHF/EEGGHHGGGEGGHHHHGFGGFCCDHHBGFHGFC@@CGGFFFH0=.CGGHE.EGGED?HFFBFAAAFFGFB-D
+@98163/2
+GGTTTGATCCGTCGTGAAGATGCGATTGATTTCACGGAAAAAGACTGGGATGACGTCATGAACCTGAACATCAAGAGCGTGTTCTTTATGTCTCAGGCGGCGGCAAAACTTTTTATTGCCCAGGGCAACGGCGGCAAAATTATTAATATCG
++
+BBABBBFFFFFBGGGGGGGGGGHGGHHGHHHHHHHHGGGGHHGGHHHHHHHGHHGFFGGHHHHHHHHHHHHHHHHHHHGFFGHHHHEHHHGFHHHHHHGEEECGGGHHHHHHHHHHHHHHHFHGGGGGHGGGGGCDDHHGGEGGGGGGGG.
+@1009785/2
+AGGCTATTCGCGTGGAGGGCGATACATTACCGTCCTCGAAAGGAGTGCTGTGATGAACGTCGTCATCCTTGACACCGGCTGCGCCAATTTAAGCTCGGTAAAATCCGCCGTGGCGCGCCACGGTTACACCCCGGTGGTCAGCCGCGAAGCG
++
+@AABBFFFFFBDGGGGGGGGGGGGGHHHHHHGGGGGHGGHGGGHHHHHHEHHHHHHEHHHGGEGGHHHHHEGHHHGGGGGGGGGGGGHHHHHHHHHGGDGGHHHHHGGFCGCCGGCGGCGGGGGGGHGHFGGGGCDGAGHHHHGGGGAGGG
+@1316047/2
+CTGACCAACTTCCTGGATAGCGGCCTGTACACCAGCCTGACCGAACGTCTGGTTGCCGCACAGCGCCACAATACTAATGAAGAGAAAGTACGCGACCATCTGAAAGACAGCTTTGAGGAGGGTGATAACAACCTGTTCAAACTGGGTGCGG
++
+CCCCCFFCCFFFGGGGGGGGGGGGGGGHGHHHHHHHGHHGHHGGGGGHHHGHHHGHHGGGGGHHGGGGGHHHHHHHHHHGHHHHHHHHGGHGGGGGGGHHHHHHGHHHHHHHHHHHGHHGGGAFHGHHHHHHGHHHHHHHHHHHHG<CEGG
+@186857/1
+CCTTTTATTCTGAGCCGACGTTCCGGGAAGGTGTCTTAAACAAAAAACCCCGCCCGGTTTGCGCCGGCGGGGTTTTGGAATCGTGTGTGTTCCGGACCCTACGGCGCATTGCCGACGACCACCACCACACGCACGACGACCACTGCGCGAG
++
+BBBBBFFFFFFFFGGGGGGGEFHHGGGGGGGHFGHHHHHHHHHHFHGGEGGGGGGGGCFEEHGFGGGGGGFG/AFGA@BGGG<<GGEFFHHFH.CDC@FGGFCFGGGADGGGGFGGACGFAEFEFFEEEDBD---ADFAAF-AFFFFFFFB
+@420499/2
+GTGAAAACCGATGGCCGCGCACAGGTGATCCCATTCCGTACGCAGCCTATCAACACCGTGCCGCCAGCAAACCAGGATCATGACGCGCCGCTATTGCAGCAGTATTTCTCCTGAGGATTTTCGCCCGGTGGCGGCTACGCCTTACCGGGC
++
+BBBBAFFFBBDBGGGGGGGGGGGHGGHHHHHHHHHHHHHHGGGGGGHGHHHHHHHGGGHHGHGGGGGGHHHHGHHGHHHHHHHHGGGGGGGGGGHHHHHHHHHHHHHGHHHHGFHGHGHGGHGGGGGGDGGH?FDGGHGGGGGGGGGGGG
+@1342348/2
+GCTCAGAGCGTATCGTCTTTGTATGTTTAAAATTTAACCTTTTGATTATCAAACTAAAATTCCGGAAGCTGGAGATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGGACCGTCGCTGATGCCTTCGCTGACCT
++
+CCCCCFFFFCACGGGGGGGGGGHHHHFHHHHHHGHHGHHHHGHHFHHHEHHFHGHHHHHHHHHHGDGFGHHHHHGHFHGHHHHFFHFFEGGGGFGHFHHHCECCGED/B4?C3FFDF/?FHFB/<F/<?//@A//111<GHB.EDG?GHF
+@1353639/1
+CATCTGGCGCGCGATAATATCCGCGTCGATGACGGTTATTCCGAGGTCAGCGAAGGCATCAGCGACGGTACTTTTACCGCAGCCAATACCGCCGGTTAAGGCTACGGTATACCTCATATCTCCAGCTTCCGGAATTTTAGTTTGATAATCA
++
+BABBBFBF@ABDGGFECFBFGGGFGCECEGB5GEGGCGHGHHFGCE>FF?BEFG?EFHBGEFEEGFCC/?EGFFFH3D<EB/<CFFFFHFD?@@/>/CFHBFGGGGC<.<FDFFHHHFHH00DGGHBDDGGGG-:GGHHHGFG0CFCCGFB
+@1354332/2
+GCTCAGAGCGTATCGTCTTTGTATGTTTAAAATTTAACCTTTTGATTATCAAACTAAAATTCCGGAAGCTGGAGATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATTCCTTCGCTGACCT
++
+AAA1A1F1FDAAGGGAFGGGGGBGHGFHHFFDGHHGEEHHHHHCEBFHHFDDBGGGGFBHFFFEE/AEEFBFF0EGFFFHFFHFHEHDEFHCGHHGHH1GE@GG?/?AGGFBFF//B//?DG11>@F/??BCAAC111?<?FCC<<CHG1
+@1535808/2
+ACAGATTGCTATCTGTGCGAATGAACCCACATTACAACAGGAAATTTATTGCGGAAATTGATATATTCACAACGTTATGTTGCGGTTTATGCAACGTCAAAAACCGGAGGTCTGTCTGTGGATTTACGCGATCTAAAAACATTCCTGCAT
++
+AAB3ADFFFFFF4GGGGGGG2FFHGCGDGGGCDGHH5CGFFFFG3GFFF5FFFCEEEHDDFFFHH5FFFF5GFCHHHHF@GFFE/1>E34BFGFB/??1EFGHDEEEE/><GFF4F4G1B01BFGG2?ACC//<DGHGHG/F1?G1GFCH
+@1059067/2
+GTCTTCGATCGGGTTGATCTTAGAGATAACACCCTTGTTACCGTGGCGACCTGCCATCTTATCACCCGGCTGGATACGGCGTTTAACGGCCAGATAGACCTTCACGATCTTCAGCACGCCCGGCGCCAGATCGTCGCCCTGGGTGATTTTA
++
+CBCCCFBBFFCBGGGGGGGGGGHHHHHHHHHHGGHGHHHHHGGGHGEGGGGGHHHHHHHHFHHHHHHGGGGGGHFBHGGGGEGGHHHGGFEGHHHHHHHHGHHHHHGHHHHHHHGECGGGGGCCGGGGGGHHHFGC?DGGHHG/;CGHHH0
+@1380527/1
+ACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGATATTATCGCGCGCCAGATGGTTGAGCCAGGGCAGCCCGCCCTGAACGCAATAGCGGAACATT
++
+AABBAABBFFFFGGGGGGGGGGGHHGHHGGGGFCFHHCGGGHEFDCCEEEFFHHHHHEGGGGHGHHGE?FFGGHHFEEECFEFEECDCCDGHFB>DGGGC?CC.-CFGH1DDHEFGFGHGG.ADHGCCCDCGGGGFGGFAFFG?ABABFGF
+@1383245/2
+GATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGGATAACCGTCATCGACGCGGATATTATCGCGCGCCAGCTGGTTGAGCCAGGGCAGCCCGCCCTGCACGCAA
++
+BBBBBFFBFFCFGGGCGGGFGCHHHHHGGCEGEEFFFFAF1A0A1EEFFFDF5GEF?0?AEAE44FDGH1AEEFFGFHGG/>EGBFE?EFG04BB@/B@C<@DHF<11??----<.A.0<C<GF//0C/.GG..:.CE--@A?F.FF?A-;
+@1363275/1
+CCAACTGATTCAACGTATTATGTTCAGCAGGCAATAATGGCCGATCCGTTGCCGGACGTTGCTGCGGCTGCGGAATGGAAAGTTGCCCCTGTTGCAGGAGCGTCAGCACGTTTTTGAGTTGATCGGGCGTAAGCTGGCTAAGCGCGGTTTG
++
+BBBBBFFFFDFFFGGGGGGGGGDGHHFDHFGAG4EGFHHGFHEEEEEFEHEGHFFGGCGGAEHHH?EEFGFFEC/?FFHHGHHHBGHHGHGGGHHHBGGEHFDEG/FFFCHHHGGG/FFHGHEGE?/A@CG?FBGGBEBD0<GGC--.;:C
+@808702/2
+GCCGTCACGACCGGGCACCCTGAAGCCAGGAAATTGCTGGATTACACCATAGAAGTGATTGAGAAATACTTCTGGAGTGAAGAAGAGCAGATGTGCCTGGAGTCCTGGGACGAAGCCTTTAGCAAAACCGAAGATTACCGTGGCGGGAACG
++
+A?AAA11>1ADD0EEGEG0AGEFHGHFFHAGBHHBHHHHHHHFHHHHHEHHFBGFDG2GFFFFGFBEFFHFHHFHFHHEHH1GFGF0F1FCGDDFH1BEAFAHH1B1B/0GGGGGGGEBGBFDGFHEHFGG/CEHFDBF?FCC/@C--<..
+@1410800/1
+ACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGATATTATCGCGCGCCAGATGGTTGAGCCAGGGCAGCCCGCCCTGAACGCAATAGCGGAACATT
++
+BBBBBBABFFFFGGGGCGGGEGAEHFFGGFEGEAFHH5BFGGEFGGGGGGH5BGFHC1F?EFHGBCFGEGEHHBCEEGCHFFGEEECDGGGHHHHFGFCD?@D.<<FB<<G</C0GH<CGGGDAGFCCGG?.BFFFDAA?FCFAC-A-BBF
+@1412234/1
+GTTTAAAATTTAACCTTTTGATTATCAAACTAAAATTCCGGAAGCTGGAGATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGAT
++
+BBBBBFBFFFFFGGGGGGGGAGH5GHHFGHHHHHHHHHHHGGGGHHHHHHHFHHHHGHHHFHFGGEHGEHHHHHHHGGGGG/EFHEFCGGGGCA?FGHFFEFGG?AEGGGGHHHHHHHADGCFFHHHGC/FGGHHHCGGDHBF0-@CCGG-
+@391642/2
+CCACTTTGGTATTCAGCGATTCCGCCATGCGTAAAATATCCGCGCTGGTCATTTTGTCCGTAATACCGCGCGGGTTTTCACCGTAAGAAC
++
+CCCCDFFFFCFFGGGGGGGGGGHHGGGGHHGGGGHHHHHHHGGGGGGGHHHHHHHHHHHGHHGGHHHGGGGGGGGGGGHHHHGHHGHHHH
+@1424511/1
+ATTGCGTTCAGGGCGGGCTGCCCTGGCTCAACCATCTGGCGCGCGATAATATCCGCGTCGATGACGGTTATTCCGAGGTCAGCGAAGGCATCAGCGACGGTACTTTTACCGCAGCCAATACCGCCGGTTAAGGCTACGGTATACCTCATAT
++
+BCCCCBCCCFFBGGGGGFGGGGGHHHHHGHHHHGHHHHHHGGGGGGGGGHHHHHGGGGGGEFHHHGGDGCHHHHHGCFCGHHHGFGGGHHGHHHHGGGGGDHGHHHHHHHGCGGGHHHHGGGGGGGG?EDFFGGGGFFFFFFFFFFFBFFF
+@1060167/1
+GTGCCGTATCGGTACCAATCCGCTGATCGTCGCCATCCCGTCTACGCCGATCACGATGGTAGATATGTCGATGTCGATGTTCTCCTACGGGATGTTAGAAGTTAACCGTCTGGCGGGCCGCGAACTGCCGGTGGACGGCGGTTTCGACGAT
++
+AABBBBBBFFCCGGGGGGGGCEGGGGHHGHHGGGGGHHHGHGHGHGGGGGGGGHGEHGGHHHGHHHHHHHHGHGHHAGHHHHHGHHHHGGGGGGHHHGGHHFHHHHHGDGHGGHGGGGGGGGGGGHHGHCGGGGGGGGGGF=BFFFFFFFE
+@1451442/2
+ATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGATATTATCGCGCGCCAGATGGTTGAGCCAGGGCAGCCCGCCCTGAACGCAATAGCGGAACA
++
+CCCCCCCCBCFFGGGGGGGGGGECCF5GFCFEGGAEDGHHFGFH?AEEEEG?FDGHFGG1AAEEGHFHGGAFFHHGHCEEFAGHGE?@CF<><DGFDG/C/><CF.AFGBGDDFFFHH/CEGCEADHG?CCF??909FG-@EFBB-9;?-/
+@1275334/2
+GCACTGCAAAAAGCAGAGTGATTTTTTCGATATTATCGGTTTCAAGCAGTATTTGTTTGAACAAACCGAGATGAGCCATGGCACGGTGCGGGAATATGTCGTGCGTTTACGACGTCTTGGCAACTACCTCAGCGAGCAAAACATTTCCCA
++
+BBBBBFFFFFFBGGGGGGGGFGHHHHGHGGHHGHHHHHGGGGHHHHHHHHGHHHHHHHHHHHHHHHGGFGGGHHHFHHHHGHHHGGGHGGGGGGHHHHHHHGGGGGGGHHGGGGGGGGFHHHFGHHHHHHHHHFGGGGHGHHHHHHHHGH
+@1515926/2
+CCACTAAGGAGGCATTCAGTGCGGATTCATATTCTCTTTGACCTCAATTTCCCTGGTCAGTTTCCCCATTCGTCCAGAAATGCTCCCTGCGCTCCGCCATGCGCACTAATTGTTCACAAGGCGCGTAACGAGGACCGTAAAGTGCGGCCAG
++
+ABCCCFFFFFCDGGGGGGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGGGHHHHHHHHHGHHHGGGGGGGGGGHHGGGGGGHHHHHHHHHHHHHHGGGGGGGGGGGGHHGGHAHHHHHGGGGGG
+@844326/2
+TAGAATACCCATAATAATAAGAGAGGCTATTATGATTGAACGTGAACTGGGGAACTGGAAAGATTTTATCGAAGTCATGCTTCGTAAATAAATGCCTGGAAGGCACCGCGCTCCCATAGGGGATAAGTAAAGGCGACTCAACGAAAGTCG
++
+?AABB55FFFFFGCGGGGGGG5AGEEDHFFFGDFGH6FGBGGGCAEFFFHHF2E2FFGFHHFFFHFEGFFEG3E1B555FFHHGHBFFGHFHHDD@4EAGHHEGHAEF/EEEFGFCGBC?0EAEGFB4BFG32?/BBDF222?/F/??FD
+@1498701/1
+TTGCCGCACAGCGCCACAATACTAATGAAGAGAAAGTACGCGACCATCTGAAAGACAGCTTTGAGGAGGGTGATAACAACCTGTTCAAACTGGGTGCGGAGAATATCTTCCTGGGCCGTAAAGCCGCTAACAAAGAAGAGGCGATTCGCTT
++
+BABB@DDBBBFB??GGGGGGCGHHHHHHGHHHGHHHHHHGGGGGGGHHHHHFHHHHHHGHHHHFFEHGGGBFGHHHHFHHGHHHHHHHGEHFGHGFGGGGGGHHHHHHHGGHGHFHGGGGGHHHHGGGGGGFGFHHHHFHHGGGGGHGDDH
+@897474/2
+GCGTCAACGTGCTGCTACGCCCCGTAAGCGCAGAGTCGCTGGAAAATCTGGTCACGACCTCAACGGCGCCGTTTATTTCTCGCGAGACCGCGCGTGCCGCCCAGTCGCTGAATAGCCCCGCTCCCGGCGGATTCCTGATCGCCAGCGATGA
++
+A?AAA?A1A>AAGGBGFG100ECC0EEHF?EGEGFFFAEEC/0GFBGC2211AGFCEGGCGHHG/>ECE>EG/FFFGEHHHEEEGCCAF/@CC/>@AG<C->ACCDACECGF00DCC/ECCCCBGBGG?@A@FFF//:BFFF--9E9@EBF
+@1528302/1
+AACTAAAATTCCGGAAGCTGGAGATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGTACCGTCGCTGATGCCTTCGCTGACCTCGGAATAACCGTCATCGACGCGGATATTATCGCGCGCCAGATGGTTGAGCCA
++
+BBBBBFFBFFFFGGGGGGGGGGHGHHHHHHHGCHHGFGGHGGHHHHHHHGGGGGEEFHFHFFFAEGAEGHHHBFEGEFGEGGGGHFFHHHFFEEDGEHHEEGDGGHHEHGGGGHHEFCCGGG?CADDGDGA.<ADGGGGEF0B0;.:BFG/
+@1035768/1
+CTTTTGCGGCGATTTGCACTGCAAAAAGCAGAGTGATTTTTTCGATATTATCGGTTTCAAGCAGTATTTGTTTGAACAAACCGAGATGAGCCATGGCACGGTGCGGGAATATGTCGTGCGTTTACGACGTCTTGGCAACTACCTCAGCGAG
++
+BBBBBFFBB@BDEGGGGGGGFGGHFHGE2BAGGEGBFGFEHEHGEHGFHHHHHGEEGHHHHHHFHHHHHHHGHHHHHHHHAFE?EECEHHHHHFHHGEFDGGEFCGGCFFCFHGBECGACF/AHHGGDCAGGGHHHGHHHHH/DGFHHDCC
+@140443/2
+TCCATGCTGAACGCGACCCTACTAACAACTGCGCCATCTCGCGCAGTGGTCGTCGTGCGTGTGGTGGTGGTCGTCGGCAATGCGCCGTAGGGTCCGGAACACACACGATTCCAAAACCCCGCCGGCGCAAACCGGGCGGGGTTTTTTGTTT
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHGHHHGHGGGGGGHHGFGGGGGGHHHGEFGEFGGFGEHGHGGEFGEGGEFGGGGFHHHGGGGGGGGGHHHGGGGGHHHGGGGGHGHHHHHHHGGGGGGGCGGGFFGGEGGGGFFFFFCFFFFBFFF
+@425728/2
+GTCATAAACAATCAGGAACGCTTCGACGGCGTGCATATTGGCGTTACCGCCACGGTAATCTTCGGTTTTGCTAAAGGCTTCGTCCCAGGACTCCAGGCACATCTGCTCTTCTTCACTCCAGAAGTATTTCTCAATCACTTCTATGGTGTAA
++
+AAABBFFFFFAFGGFCGGGGGGGGGHGGGGGGGGHHCHHFHGGDFGGHCGFGGCEFGGHHHHHHCFGGGGHHFGHHGEHHHGHGGGHHEHEFHFHHHGHGEHHHHFGHFHHHHGGHHHHHHBCHHHHHHEHHHHHGGFFHHHHHHHFFFD1
+@147280/2
+GTACTTTTACCGCAGCCAATACCGCCGGTTAAGGCTACGGTATACCTCATATCTCCAGCTTCCGGAATTTTAGTTTGATAATCAAAAGGTTAAATTTTAAACATACAAAGACGATACGCTCTGAGCATTAACCTACTATTCGCCAGGTAAA
++
+A3AAAFFFDFFAGGGGGA4GGBHFGCAAABED53CG3FAAAGAGBHFHFHFEGHAEG3CGFHG?EE?FFHGHHFHFFFHHHF4FCGDGEFFFHHFHFFHBEEGFHBGHHHHHG?FF//A/?FB1FHFFF1FEHBGCGEHE2C/?BCE1FDG
+@443384/1
+GTACTTTTACCGCAGCCAATACCGCCGGTTAAGGCTACGGTATACCTCATATCTCCAGCTTCCGGAATTTTAGTTTGATAATCAAAAGGTTAAATTTTAAACATACAAAGACGATACGCTCTGAGCATTAACCTACTATTCGCCAGGTAAA
++
+A>ABBFFFFFFBGGGGGGGGGGHGGGGGGEFHFFFHHHGGHHGHHHHHHHGHHHHHHHHHHHHGGGGGHHHHHGFHHFHHGHHHGEHHGHHHHFHHHHHHHHHHHHHGHGHHGGGGGGGGGHFHHHHHHHHHHGHHHHHHHHGFGGHHHHB
+@1254510/2
+GTACTTTTACCGCAGCCAATACCGCCGGTTAAGGCTACGGTATACCTCATATCTCCAGCTTCCGGAATTTTAGTTTGATAATCAAAAGGTTAAATTTTAAACATACAAAGACGATACGCTCTGAGCATTAACCTACTATTCGCCAGGTAAA
++
+AA?ABFFFFFFBGGCCGGFGBGHGGGGGGGGGHHHHHHGGGHGHFHHHHHHHHHHHGHHHHGHGGFEEHHHHHHGHHHHEHHHHHHHHGHHHHHHHHHGHHHGHHHGHHFFGGGGGGGEFDHHHDGHGHGHFHHBCGHHHHEGGGGH<G1G
+@1420294/2
+AATTTACCTGGCGAATAGTAGGATAATGCTCAGAGCGTATCGTCTTTGTATGTTTAAAATTTAACCTTTTGATTATCAAACTAAAATTCCGGAAGCTGGAGATATGAGGTATACCGTAGCCTTAACCGGCGGTATTGGCTGCGGTAAAAGT
++
+ABBBADF@5BFFECEECFGD6F4DFFGDHFHBCB33A2AECEBCFFHFFFGFB5DFGHFFHHHHBBFFF3FFGBGFFAB3@FGEG3BGHF3>?>ECBG21BG34FBFF3BE4BG4?FGGA3B33?B?///B?///>@F0?CC@CAD.GD=1
+@1046221/2
+GAGGAACGGAGCCCGGCGTCATATTAAAAGCCCGAAAATTTTACTGATTTCTGGGAAAAAAGCAATCAACATGTGATGAAGCTTGATTCCAGGGCGTGACCGTTGCAGCCAGTTTGGCGTCGGCGTGCGCGCAGAAGGCGGAGCGTACACG
++
+A3A?AFFBBAABGG2EEEFEGGFHHBBFFCCHHGCGGGHHHGHHEHHHHHGFHHG1FAFAEEHGHHGFHHHFF4@DGD@GHHFFHHFHHFHFHDGGFGGGFEEEDFHFGEHHCDFBFGGGC?CC@CCCCFCCCC?BGHHGCAFAGD.BDB9
+@196984/2
+CTTATTGTCGCTGCGCGAATACTCCTCAAGATTTACGCCCGCCACCGCATGGCTTTCCAGTTCAAGGATGTCCGCCTGAATCCGATGCAAAAGATTATCTGGCGTAATATCAACAAACGCATCCAGCTCCTGGCTGTTTTCCAGTTCAGAT
++
+ABBBBFFFFBAAGGGGGGEEFFFGHFGHHG3GGHHHEGCFGGGGGHGE0E1GCFHHGHFGFDGFHHH1GGBBDE?AEGGHHHGE?GEGGFHGFEBGFHHFGFHGA@B/GFHF3FBFFADF?DCF2DGFCGHCHEHGCFFHHGHHHBHBGD1
+@1053721/2
+GCGCAGGGCTGTGGGATGCAGGTGCAGGACGTTAACCGCCTTCTGAAACAGTTCGACGACATGCAGCGCATGATGAAGAAGATGAAGAAGGGCGGGATGGCGAAGATGATGCGGAGAATGAAGGGGATGATGCCGCCAGGCTTCCCGGGTA
++
+>1>1A11>>>A1ABAA10E11CBBGHG0ACEA0AFFDACEE/ABFFHFFH0FFEEA//>EE/CGFGFEE/EEHEFGFBDHFGFGFGFGGB0>?E<C@/FF0/<@?A1FGFDGC?<@-<<GGFGFG-C:E/<:0CC--?-EGGF/;/;AG9-
+@654776/1
+CATAAATGACGCTGATAATAAAAATACCGATAATGATTGCTGCGAACATAACGTCACTGTCCTTCTAAGAAAACCTCATCCCGGGATTTTCAGGCAACCCTCCCGGTGATGCCAAAGAGAAAAGTGTAGTTCGTTGACAATAAATTTACAT
++
+CCCCCFFFFFCCGGGGGGGGGGHHHHHHGGGGGHHHHHHHHHHGGGGGHHHHGHHGGHHHHHHHHHHHHHHHHHGHHHHHHHGGGGGHHHHHHHHHHGHGHHGGGGGGGHGHHHGHHFEHHGHHGGHHHHHHGGHHHHHGHHHHHHHHHHH
+@1485032/1
+GACGCTCACGAACGGGGATGCCACGGTCTTCCAGTTCTTTCATCTCTTTCATCAGCGCGGCCGGAGACAGCACAACACCGTTACCGATGATGCTGGTTACATTCTCGCGAAGAATACCTGATGGAATAAGATGGAGAACGGTTTTTTCAC
++
+AABBBBBBFAAAGGGGGGGCGFHHFGGGGHHHHHFFHHCHHHGFHHHHHGHH5FGHFGEGGGGGGGCGHFHHHHHGHGGCHGGGHG/BFBGFHHFHHHHFGHHHHHGGGGGGGFHHHHGFGHHHBFHHFHHHHHFHFHHGGAEGGGGHEG
+@485913/1
+CTACCGAATCCAGCAGAATATCGCGCAACTTACTCACATTAATTTCTCGATAAATGGCCGCCAGCGCCAGGCTATAGATTACCGCGATCGCAGAGGCCTCTGTTGGCGTAAATACGCCGCCGATAATGCCGCCGATAATAATAAATATCAG
++
+CCCCCCCCCCFFGGGGGGGGGGGGGGGGGHHHHHHGHHHHHGHHHHHHGHHHGHHHHHHGGGGGGGGGGGHHHHHHHGHHHHGGGGGGGGGGGGHGGGHHHGHHHHGGGGGHHHHHGGGGGGGGGGHHHHGGGGCGGFHHHHHHGHHGGGF
+@657063/2
+GTCCAGAATGGCGTCCATCACTGCCTGGTGTTGTTCCGTCAGCTTTGAGAATACGGGCGGAACGAGATACATACGCTGGCGACTCTGTTTGACGGAGGATTGCAGGACGTCGAAGAAACCGCGCATGGTTTGCAACAGCACCACATTGTG
++
+AAAA@FB1DBFF1EEEEGFGFCHHHHG0GH0EGHHCGCGFFGGH1DGFFAFHHHHG?EG?@EE?EFGEHFHGFGFAEE/E@/@EGFBGHHFFFGGCFGGHGFHH1CFF@E?/<FFGFHFH?CCG@EF.DDF<0CC0C;:CFCC::CGH<0
+@32891/1
+CTTGCGTGCCGTGCATTTCCGTTAGCATAATGCCGAACTTCACACCGCCCGCGTAATCCATCTGCGCGCTGATAATATTATTGTTCTCGTTGCAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGTGAATTCCAT
++
+11A11>>AA?A>FAGGFG33ABBAAFH2FFFFGC0AAECB22B2B/AEAAECEEC?FF21@1BGFEGG/>EFGFBBDFG2GDEGEG2B/?/G/B1F/?</B/B/<@GCHF1?11FF<G0@@-?:-:G/CC/:CGFGGFGG@9-.0CFB0;C
+@1277725/2
+CCCCACGAGAGCGTGATCTCTGCCGAGCGTGATCACATCGGCATTTCTTTAATCATTTATTTGCATTTTATTAACACAAAATACACACTTCGCTTCATCTGGTACGACCAGATCACCTTGTGGATTCAGGAGACTGACATGCTTTATAAAG
++
+BCCCCCCCCCCCGGGGGGGGGGHHGGFGGGGGHHHHHHHGGGGGFHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHGHHHGGGHGHHHHHHHHHGGGGGHHHHHHHHHHHHGHHHHHGGFFHGHHHHHHHHHHHGHHGG1
+@896426/2
+CTTGTGTGCCGTGCATTTCCGTTAGCATAATGCCGAACTTCACACCGCCCGCGTAATCCATCTGCGCGCTGATAATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGTGAATTCCAT
++
+ABBBBF>>FFBAGEFFGC5GE44EEHGHDBDFFFEECGDHGFHCHGCEE?EC0AEEFHHHHHHEHGGGGGGDFEGHBGHHEGH4FHHHHFHHGHGFFGGGCGGGGCFFG1GH1FGHHFE@D?@DCGHBGHHGFCGCCCCE@@B?000;CFF
+@75031/1
+TCACCGGACAGTCTGTGGATGCCCCGCTGCTTTCTGAAATCGCGCGTCGTTTCAACGTGAACAATAATATTATCAGCGCGCAGATGGATTACGCGGGCGGTGTGAAGTTCGGCATTATGCTAACGGAAATGCACGGCACACAAGAAGAGA
++
+CDCDDCCCDDDFGGGGGGGGGGHHGGGGGGHHHHHHHHHHHGGGGGGGGGGGHHHHGHHHGHHHHHHHHHHHHHHHHGGGGGGGHHHHHHHHGGGGGGGGGGGGGHHHHHGGGGGHHHHHHHHHGGGGGGGGGGGGGGGGGGFGGGGGGG
+@123726/1
+TGCCGATGCTGCGCATGGAATTCACCGGACAGTCTGTGGATGCCCCGCTGCTTTCTGAAATCGCGCGTCGTTTCAACGTGAACAATAATATTATCAGCGCGCAGATGGATTACGCGGGCGGTGTGAAGTTCGGCATTATGCTAACGGAAAT
++
+CCBCCBCCCFFFGGGGGGFGGGHHHHGGGGGGHHHHHGGHHFHHHGGGGGGHHHHHGHGHHHGGGGGGGGGGGHHHHGHHHGHHHHHHGHGHHGHHHHGGGGGGCFHHGHHHHGGGGGGGGFGGGHFFGGGGGGAGGGGGGFGGGGGGGGF
+@1301607/1
+ACAATGCACCCTGTTGCGCACACGGGCGTACGCAAACTCGCGGACCGACAGGCGGTAGAACAGTGGATGCGCGGGCGCAGCGAGCTTTGGGTACAACCAAAAGTGGATGGCGTAGCGGTAACACTGGTTTATCAAAACGGTAAACTGGCCA
++
+DCDCCFFFFFCCGGGGGGGGGGHGGGGGGGGGGGGGHHHGGGGGGGGGGGGGGGG>EEHHGGH4DGFFFGCDCCGGGGGGGC@CGGHHHHGAGHFGHGFGHGGCFHCGFGHGGGGGGG.:EGFFBFG0CFFFFBFFF?DFDFFFFFFFAF0
+@174662/1
+TCCTGCAGCCAGGCAATTGCGGCTTGCGTCTCTTCTTGTGTGCCGTGCATTTCCGTTAGCATAATGCCGAACTTCACACCGCCCGCGTAATCCATCTGCGCGCTGATAATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCA
++
+@AAAAB1CCAFFEA11BAFF0AE0E000EAE02F121AB100FGAEEEEHHBDFEGBEGE12BF2FFF@/E/>GGEGBCF//@/>EE//?A22<2>G>GECCCCC<G2FGHFHFBGGF1GD1/<FFHHGHF.--@-<--@:CGHHBFFCFC
+@406047/1
+CTCTCAATCAGTATTGCCTGGCACCGTCAGCGAGCAACAACCGTGCCAAAGCCGATGAGCAACGAGAATATCACCCACTCTTTTATCAGACAGTGATTTTATCCACAAGTTCAATGTAACACTGTGCATAATTTGCACAAATCTTGTGACA
++
+CCCCCFFFFFFFGGGGGGGGGGHHGGHGGGHGGGGGHHHHHGGGHGHHHHHHHGGGGHHHHHHGGGGGHHHHHHHHGGHHHHHHHHHHHHHHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHH
+@638928/1
+ACGCTCTCTTTTGATGAATTTATTTCGGCCTGCCAACGCCCGTTGCGCCGCAGTATACGCATCAATACGCTTAAAATATCCGTGGCTGATTTCCTTGCCCTAATCGCGCCCTACGGCTGGTCGCTCACGCCAATTCCGTGGTGTCATGAAG
++
+CCCCCCCFFFFFGGGGFGGGGGHHHHHGGGGGHHHHGGGGGGGHGGGGGGGGGGHHHHHGGGGHHHHHHGGGGHHHHGHHHGGGGGHGHHHHHHHHHHHHHHHHHGGGGGGGHHFGGGGGHHGGGHGHGHGGGHHGHGGGGCEHHDHHGHF
+@952606/2
+GTACGTAGCTTCCCTAATATCTGCTATTTCGCGCTCTCTCCAGAAGATGAAACCCGTGATGCGGCGCATCATATTTATGACCAGGGCAAGCAGTCGCCGCTGCTGTTGATCCCACGCAGCACGCTTGGCGATCGCGTGGCGAACGCCTTCA
++
+AAABBFFF@FFFGGGGFGGGGGHHHHHHHHHGGGGGHHHHHHHHHHHHHHF5BGFEGGEHHHGEGCGEGGHHFHHHGHHHHHHHGGGGGGHHHHHGGGGGGGGHHFHHFHHHHHHFCDGGHHGGGGGGHGCGGGCG@DGGGGGGGGGHGGG
+@202585/2
+CTGATAATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGTGAATTCCATGCGCAGCATCGGCACGCTGTCAGTTTCCGGCGACGCTTTCAAACGCGCCTGGTAATCTTCCGGAATGT
++
+BBCCCFFFFFFFGGGGGGGGGGHHHGHHGGGGGGGGGGHGHHHHHHHHHHHGG?EFGHHHHHHHHHHHHHHGGEGGHHHHHHHHGGGGGGHHHGGGGGGGGGGHHHHHHHHGGGGGGGGGGGHHHHHGGGGGGGGFFGGGGGGGGGGGGGF
+@1071535/2
+GTATGGTAAAGAGGTCTACCATCGCCCGTCGCGTTTCATCGGCGAACTGCCGGAGGAGTGCGTGGAAGAGGTCCGTCTGCGCGCCACCGTCAGTCGTCCGGTGAGCCATCAACGAATGGGAACGCCGCTGGCGGAAAACGACACAGGCTA
++
+AAAB@FFFBBF5EAFGBG5FGDHFDEEEAE2EEEEEGFFGHFEEGEEEFG30EEEEDFB?G/FE/?FHFHHCBGGHHFGBE?EDGDAGDCDDA2GGEGCGG@@CFFGHFFFBBDFGF1CCFGEAAC-@C-CFCGG??BBB???BGEE?AB
+@1109183/1
+GCGTCTATATGCGCCTGTGCCCACGTCGGTTGGCCGTTAATTACGGCCTGACAGGCCTCTTTTAGCGCGATTTCTACGACCTGCGCATCGCGAATCGGAGCGGCAATAACATTAATACTTAATGCACGAAAGCCGGGAGCGATACGGGCCA
++
+CCCBBBCFFFFFGGGGGGGGGGHGGHHGGGGGGHHGGGGGHHHHEGGGGGHHHHGGGHHHHHHHHHGGGGGHGHHHHGGGGGGHGGGGGGGGGGGGHGGGGGGGGGHGHHHHHGHHHHHHHGHHHHHGGGGGHHCGGGGGGGGGGGGGGG?
+@1538763/1
+GATGGCGGCTTTACCTTATCAGGCCTACATAAGCACTCGGCTGGTAGGCCTGATAAGCGCAGCGCCATCAGACATTGATTGGCAATTAAGCCTGTTTAGCAGCTTCTGCTGCTTTCACGATCACCGCGAAGGCGTCAGCTTTCAGAGAAG
++
+AAB?>F>>DDDFDDGGGCFGFACGDFHHHHHHHGHHHFF?A1EEHEFGHHHG2DGGHGGGGGCGGGGGHHHGHFHHHHFEHGFHFHHHHHHHHHHGGHHHHHHHHHHHHHHGHHHHHHFCGFGCFBDGGGGCFGGGGGHGHHHGHHFFGH
+@762408/2
+GCTGGAAGCCGATCAAGAAGCTATCCGACTGATCCTCAGTAACGATCCGCAGGCCACCCCGCTCGCTTATCAAAGAATGCGGGTCAACCAGGCGCATAACACGTTATTCAACTCGTTAAATCAGGCAATGCAGGAACCCGGATTCAATAC
++
+CCCCCFFFCFCDGGGGGGGGGGHHHHGGGGGHHHHHGHHHHHHGGHHGHGGGGGGHGHGGGGGGGGGHGHHHHHHHHHHHGGGGGGHHHGHGGGGGGGHHHHGGHHHHHHHHHHGHGHGHHHHHHHHHHHHHHHGHHGGGGGGGHGHHHH
+@448869/2
+GCTATGAAGAGGCTGCGGCGCAGGGCTTGCTCGCTGGTCTGAATGCCGCGCGTCTTTCCGCCGACAAAGAGGGCTGGGCGCCTGCGCGTTCTCAGGCTTATCTCGGCGTGCTGGTGGACGATCTCTGTACGCTGGGCACCAAAGAGCCGTA
++
+BBBBBFFFFBFAGGGGGGGGGGGGGGGHGHHHGGGGGHHFFHHHHGHCEGGGFGGEHHHGGGGGGGEGHHHGGDGDDGFCGGGHHGGGGGGEHHHGHGHHGHGHHEFGGGGGHHHCDHFDCFHGHHGFFFGDEDCGGGDGGGGFFFEFGGF
+@774699/2
+TCATCTAACTGTTGTACAGATACCGCGCCACGCTGCGACAGCGAACGGGAACGCACGTGACGTTTAGAGACGGAGTCCAGCTCAGCTTCCCGCTGTTTGACGACCGACTGCGCGGCGCGCATTTCACTCTCGCGTTGCTCCAGCAAGGCC
++
+BAABBFDF4FFFGGGFF6A5BFHHEEAE2EDGG?2E?AAAEGCEAEC11AEG?A?FFFGHGEFGGH4@GFFDFG//33FG3GFGHB4EGFFD?EFDBHFHHFFCCCFC/AG?DC-<@CFCCGEG:9;;CF099-:-AFFFFFFBFF/...
+@757306/1
+GCCTGATTACCGTTGAGTTTTTGCCCGTTAGTCTGTTGACGCCGATGGCGCAGGATCTGGGGATCTCCGAGGGCGTCGCCGGTCAGTCGGTCACCGTTACGGCGTTTGTCGCGATGTTTTCCAGCCTGTTCATTACCCAGATTATTCAGG
++
+BCCCCFFFFFFCGGGGGGGGGGGHHHGGHGGHHHHFHHHHGGGGGGGGHGGGGGGHHHHHHGGGGHHHGGGGGGGGGGGGGGGGGGHHGGGGGGHGHGGGGGGGGGGGHHGHGDGGHHHHHHGHHGHHHHHHHHHHHHHHGGGGGFGGFG
+@1158500/1
+TATTAAAAGCCCGAAAATTTTACTGATTTCTGGGAAAAAAGCAATCAACATGTGATGAAGCTTGATTCCAGGGCGTGACCGTTGCAGCCAGTTTGGCGTCGGCGTGCGCGCAGAAGGCGGAGCGTACACGCAGTACGTGTGCATTTATTC
++
+BAAAAFBFFFF?AECEEGBFAFFDG5GBD5FGHH23ACEA2BFHFHF3AGH3AA5555553FFFHFHFBFHHGGCGEGEH?EG?EBB3?G13BFD1@>/>E//>////@@/BCDFFGE/@DC--<.-.0.<--.00;;//.C0CG0:000
+@78476/2
+GATGATGATTCTGGATAGAGGTTCGCAAAAAATGGAATGCGGTTGGCGCTGGGTTTTTAATTTTTGTACTGTGAAACGATGATGCTATACGCCATTGACGTATAGATTATTTTCACTACTATAAGCCAATGGCGTATGGAATATGCAATTT
++
+BABABFFFFFFFGGBGGGGGGGHHGGGGGHGGGHFHHGFFEGGGGGHGGFEFGHGGGGHFFHFGHGGFHHHHGHHHHAGHGHHHGHGHGHGGGGGHHGFEEGHHGFHHHHHHHGGGHHHGFHHHEHGH2GH2CDBFGHFDGGHFHBGGGHD
+@405925/2
+GAATTCACCGGACAGTCTGTGGATGCCCCGCTGCTTTCTGAAATCGCGCGTCGTTTCAACGTGAACAATAATATTATCAGCGCGCAGATGGATTACGCGGGCGGTGTGAAGTTCGGCATTATGCTAACGGAAATGCACGGCACACAAGAAG
++
+>33>ADFB@AD?ECFFF5BGGEDFFGFHEEEGGCFHHHHFGCFEHG1EEAAEEEEF3GG51GHA1FHFEGFFGFFHGHDHHGGG/<EEFGFEFHHBCD@CGCGC<CACDDG0DD.<-;@GFHBFFHGHGG?.BFGF099-9A?9FA9FBBB
+@34459/2
+ATATGGAGGAGATCCTGCCGCCATACTCACAGCCAATGTACACCGTCGCCAGCAGAATTAGCGCCGACTCCGCAGGCAGATGCAACGCAAAGGCCAGCGGCAGTAAGATTGCCACGCCGTTGATCGGTCCCAGGCCCGGCAGCAGACCGA
++
+BBBBBFFFBAABGGGGGGGGGGGGFHHHHHHHHHHHHHHFGFHHGHGGGGGGGHHGHGHHFHGGGGGGGGHGGGGGGGGGHHHHHHGGGGF3FHHHHGGGGGGGHHHGHEHEGHHGGGGAEGHGHGGAECGHHGGGGGGGGGGFHGGGGG
+@561956/1
+AAACTTGCGCTTGTTAATATAGCCAATTTTATGGCCGGAAAAGAGAAATATGATGCCAGGCTGATACATGACCGGCGTGCGCGGCCCCGGTTCAACACCATACAACAGACGAATGCCCGCCAGCCGCTCGCTGATTATTTTATCATTATTT
++
+BBBBBFFFBBBBGGGGGGGGFGHHHGHGHFHHHGHGGGCEGFHGHFFHGGBBHHFGGHHHEGFGEHEHHFGGHGGG?EG?E?FGEGGGCGBGFFHHHFFHFHHGHHHFGHGCG?CGFHGCFG@FGGCCGCCGGDHHHGHHHGEGHHFFBHH
+@467427/1
+GGAGGAGACGCGAGGGGGAGCGACGAGGCGCAAAAAAACGCCTCTATTTGCGATAAGCACCACATTTTATTGGCATTATTGCTGCCTGTTATCGTTAATACTTGACATAGTTTCGGATTAAGACTATTCCCTGAGGTGCTTTTTAAGCCTA
++
+CCCDDDDDDCDCGGGGGGGGGGGGGGGGGGGGGGHHGGGGGGHGHHHHHHHGGHGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHFHGHHHHHHHHHHHHHHC
+@454575/1
+CTTTCTGAAATCGCGCGTCGTTTCAACGTGAACAATAATATTATCAGCGCGCAGATGGATTACGCGGGCGGTGTGAAGTTCGGCATTATGCTAACGGAAATGCACGGCACACAAGAAGAGACGCAAGCCGCAATTGCCTGGCTGCAGGAT
++
+CCCCCFFFFFFFGGGGGGGGGGGHHHHGHHHGHHHHHHHHHHHHHHHHGGGGGGGHHHHHHHHGGGGGGGGCFGGHHHHHHGGGGGHHHHGHHHHGGGGGHHHHHGGGGGHHGGHHHHHHHHGGGGGHGGGGFGGGGGGGGGGGGGGGGG
+@472716/2
+GTCTGTGGATGCCCCGCTGCTTTCTGAAATCGCGCGTCGTTTCAACGTGAACAATAATATTATCAGCGCGCAGATGGATTACGCGGGCGGTGTGAAGTTCGGCATTATGCTAACGGAAATGCACGGCACACAAGGAGAGACGCAAGCCGCA
++
+BBBBBFFFFFFFGGGGGGGGGGHHHHHHHHHGGGGGGGGGGGHHHHGHHGGHHHGHHGHHHHHHHGHGGGGGGCHGHHHHHHGGGGGGGGGGGGHHHHHHGGGGGHHHHHGGHHGGGGGHGHHHGGGGGGGGFGGGGEDGGGGGGGGGGFF
+@322259/1
+GCTTAACGCGCCTGCGGGCGGCAAAGGCTATCGTACCGGGCTGCGCGGCGGCGGGCCACTGACCACGCTGGTTGAATTGCAGGAATATCAGGGCGAGCGGCAAACGCCGCTCTGGCGCAAGCTGTGGCTCAACGTGATGCCGCAGGATA
++
+BBBCCFFCCCBBGGGGGGGGGGGGHGHHHHHHGHHHGGEGFGGGGGGGGFCGGGGGGGGHHGHHHHGGGGGHHGGGGGGGBFGAFFGGGGGGGGB@FAFFFFFFFFFFFFDFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEFFFFFFFF
+@482868/2
+CTCTGCACCTGGACATTCCGGAAGATTACCAGGCGCGTTTGAAAGCGTCGCCGGAAACTGACAGCGTGCCGATGCTGCGCATGGAATTCACCGGACAGTCTGTGGATGCCCCGCTGCTTTCTGAAATCGCGCGTCGTTTCAACGTGAACAA
++
+CBCCCFFFFFFFFGGGGGGGGGGGFHFHHHHGFHCGGGFGGHHHGGGGGGGFGGG?EFHHFHFHEGEEGHGGGGGHHHGFFGGHHHGHFHHHGGGGGGHGHHGHHHGHGCGFCGGGGGGHHGHFHGHHGGGGGFCGCGGHHGHGHGGGEFG
+@500588/1
+GTCTGTGGATGCCCCGCTGCTTTCTGAAATCGCGCGTCGTTTCAACGTGAACAATAATATTATCAGCGCGCAGATGGATTACGCGGGCGGTGTGAAGTTCGGCATTATGCTAACGGAAATGCACGGCACACAAGAAGAGACGCAAGCCGCA
++
+ABCCCFFFFFFFGGGGGGGGGGHHHHHHHHHGGGGGGGGGGGHHHHGHHHGHHHHHGHHHHHHHHGHGGGGGGEHHHHHHHHGGGGGGGGGGGGHHHHHHGCGGGHHHHHHHHHGGGGGGHHHHGGGGGFGGGGGGGGGGGGGGGGGGGGF
+@93278/2
+GGGTCGGCCAGCGAAATGCGCGTAGCGGCATACAGCGATTTCATATGCGTGGTATCGTCCTGCGCCAGATTTTGTGGCGCCCAGTGGGTTTGGGGGAAATTACCGTTAAAGGCGCTGAAGTTGCCAATGTCGTCCGGAAAGACGTTCGCC
++
+BCBABCBDBCCCGGGGGGGGGGGGGGGGGGGHHHHHGGGHGHHHHHHHGGGGHHHHGHHGGHHGGGGGFHHHHHHHGHGGGGGGHHHHGGGGGGCGGGHHHHHHGGGGGHHGHGGGGGGBGHHHHHEHGHHFGGGGGGGGHGGGGGGGGD
+@565047/2
+ATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGTGAATTCCATGCGCAGCATCGGCACGCTGTCAGTTTCCGGCGACGCTTTCAAACGCGCCTGGTAATCTTCCGGAATGTCCAGGT
++
+CCCCCFFFFFFFGGGGGGGGGGGGGGGGGGGGGGHHGHHHHHHHGGGG??EGGFGHHHHHHH@GFGGEEFBGHHHHHHHGGGGGHHHGGGGGGGGGGHHHHHHHHGGGGGGGGGGGHHHHHGGGGGGHGCBFGGGGGGDGGGGGGGGEGF9
+@698006/1
+CCATTGAGCCGGTAATAATGCCGACAAAGGCTGGCCCCATATAGGATAAAACCGGCAGCAGCGCAGGTTTTAACGCATGGCGGAAGATAATTCTGCGCATCGGTAATCCTTTTGCCCGCGCGGTACGAATAAAGTTCGAATGCAGAACTT
++
+BBBBBBDF4CADEEFFBDGFGGGCGGG2EGDHHGFHGGFHHF5GH3FDHHEEGGGGGFGHHHEGGGGG3FFHHHGGGGGGHGCGGGHHGBGGHBHHGGGFGG?/??DHFGGGGBFHGC/CCG@<.<A<<CCGHHGEGEEHHGHHHEB:;:
+@631316/2
+GATAATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGTGAATTCCATGCGCAGCATCGGCACGCTGTCAGTTTCCGGCGACGCTTTCAAACGCGCCTGGTAATCTTCCGGAATGTC
++
+BBCBCFFFFFFFGGGGGGGGGGHHHHGGGGGGGGGGHGHHHCHHHHHHHGGG?FFHHGHHHHHHHHHHGGGEFGGHHHHHHHHGGGGGHHHGGGGGGGGGDHHHGGHHHCFGGGGGGGGGHHHGHGGGGGGGGGFFGGGGGGGAGGGGGG
+@105529/1
+GTAATCTATAGCCTGGCGCTGGCGGCCATTTATCGAGAAATTAATGTGAGTAAGTTGCGCGATATTCTGCTGGATTCGGTAGTAACCAGCTCTATTGTTCTCTTACTGGTCGGCTGCTCAATGGGAATGTCATGGGCGATGACCAATGCCG
++
+BBBBBFFFFFFFGGGGGGGECE?EGGGGHHGHHHHHGHGHHHHHHFFGEBHHFEHHHHGGGGGGGHHHHFFHFHFHHGHFGFFGFFFHHHEHHHHGBEGHHHEHHHHB3GGF?DGGEHHFHHFGEFHHGHHHHH2FH?@DD1FCGEGHHFC
+@686521/1
+CTGATAATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGTGAATTCCATGCGCAGCATCGGCACGCTGTCAGTTTCCGGCGACGCTTTCAAACGCGCCTGGTAATCTTCCGGAATGT
++
+AAA?AFFB@FFFC33AAFGGGFHHHB1FFE?EGGCCGGHCGHHHFB1FFFG?AC>EE0>0BGFGHHE1FF1E/E/FGHHFHFDGFEE/<?GD1C//>/CCCG/FD11?1?1/<<>@CCCCGE0GHBCCCCCGFGC/B0CBFG09;-;;.;;
+@705539/1
+GTCTGTGGATGCCCCGCTGCTTTCTGAAATCGCGCGTCGTTTCAACGTGAACAATAATATTATCAGCGCGCAGATGGATTACGCGGGCGGTGTGAAGTTCGGCATTATGCTAACGGAAATGCACGGCACACAAGAAGAGACGCAAGCCGCA
++
+BAABBFFFFFFFGGGGGGGFGGHHHHGHGHHGGGGGGGGGGGHHHHGGEHGHHHGHHHHGHHHHHHHGGGGGGGHHGGHHHHGGGGGGGGGGGGHHHHGHGFGGGHHHGHHHHHGGGGGHBHHGGGGGGHGGGGGGGGGGGGGGGGGGGGF
+@718149/2
+CTTGTGTGCCGTGCATTTCCGTTAGCATAATGCCGAACTTCACACCGCCCGCGTAATCCATCTGCGCGCTGATAATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGTGAATTCCAT
++
+CBCCCFFFFFCCGGGGGGGGGGHGGHHHCHHHHHGGGGHHHGHHHGFGGGGGGGGGGHHHHHHHHGGGGGGGHHBGHHHHHHHHHHHHHHHGGFHHGGGGGGGGGCHGHHHGHHHHFHGGGDFGGHHHHHHFHHHHHHHGFGGGGGGGGGG
+@503271/1
+CTCCAGAAGATGAAGCCCGTGATGCGGCGCATCATATTTATGACCAGGGCAAGCAGTCGCCGCTGCTGTTGATCCCACGCAGCACGCTTGGCGATCGCGTGGCGAACGCCTTCACCCAAGAGTGGCAAAAACTGGGCGGCGGCATCGTGTT
++
+CCCCCFFFFFFFGGGGGGGGGGHGHGGGGGGGGHHHHHHHHHHHHHHGGGGGGHBHHHGGGGGGGGHHHHHHHHHHHHGGGGGHHGGGGGGHGGGGGGGGGGGGGGGGGGHGHGHHHGHHHHDHGGHHHHGGHHHHHGGGGGFFFFFFFAF
+@778911/2
+TTACGGCCCAGGAAGATATTCTCCGCACCCAGTTTGAACAGGTTGTTATCACCCTCCTCAAAGCTGTCTTTCAGATGGTCGCGTACTTTCTCTTCATTAGTATTGTGGCGCTGTGCGGCAACCAGACGTTCGGTCAGGCTGGTGTACAGG
++
+BBBBBBBBBBABGGGGGGGGGGHHGGGGGGGHHHHHHHHHHHHHHGHHHHHHHHHGGGHHHHHHHHHHHHHH5DGHHHHGGGGFGGHHHHHHHHHHHHHHHHHHHHFGHGGGGGHHGGGGGHHGHHGGGGHGGGGGGHHHHGFHHHHHGH
+@906377/2
+CGATGGTAGATATGTCGATGTCGATGTTCTCCTACGGGATGTTAGAAGTTAACCGTCTGGCGGGCCGCGAACTGCCGGTGGACGGCGGTTTCGACGATAACGGTCAGTTGACCAAAGAACCGGGCGTGATCGAGAAAAATCGCCGCATTTT
++
+AAA1A1BBDBDFEGDG1CFFFGAGEGHCFD3GF1GFGEAA0EFFHGGFAGFGHHGGGHAFFEG?/E/>EE@EEFBE<<ECCAFB/BC?CGCHGFA--.<<DA?E../0;C0:CGHAC/.C.-99AA-;A/9.....B-AFBBF?@=-9;BF
+@1382982/2
+GGCGATCAGGAACGGCAAAGCGTCGAAAACCCCGTCCGCATCTTCATTTTCCAGCCCGCCGCGCATCGACTGATAGGTGCCGACGCCAAGGAATACCGCATCGTAATCTTTCAGCAGATCTTCAAGCTGTACATCACGACCCACTTCGGTA
++
+CCCCCCCBFFFFGGGGGGGGGGGGGGGGGHGGGGGGGGGGGGHGHHHHHHHHHHHGGGGGGGGGGGGGHGGGGHGGHB?GHGCGGGGGGHGGHEHHHGGGGGGGHHGHHGHHHHHGHGFHHGHHHHHHHDGHHHHHHGGGGGHGHFHGGE?
+@1502853/1
+ATCCACGACCAGTCGTAAGGCGGCTGCCAGCTCAGGGTAAACATACTTTTCTCCTTTATTTGACCTTTCAGCATAAACGCTAATCGCACGTAACGCCTTGCTTTCATATTCCAGTTGTCGCCGCGACGACATTTCGCTAAAGTCACGCCC
++
+BCBCCBADBCBFGGGGGGGGGGGGFFGHHHGHHHHHC2GFBGFHHHHHGHHHHHHGGH5GGHHFHHHHHHHHHHGHHHDGGGGHHGGEGGHHHGGGGGGHHGHHHHHHHGEFH3GGHGFFH//<CCGGGGGG1FHHGGFAFHDDGHDGG;
+@1047428/2
+TCACCGGACAGTCTGTGGATGCCCCGCTGCTTTCTGAAATCGCGCGTCGTTTCAACGTGAACAATAATATTATCAGCGCGCAGATGGATTACGCGGGCGGTGTGAAGTTCGGCATTATGCTAACGGAAATGCACGGCACACAAGAAGAGA
++
+CCCCBBBCBBBFGGGGGGGGGGHHGGGGGGHHHHHHHHHHHGGGGGGGGEGGHHHHGHHHGHHHHHHHGHHHHHHHGGGGGGFGGHHHHGHHGGGGGGGCCDDGHHHHFHGGGGGGGHHHGHHHGGGGGGGGGGGGGGGGGGGGGGGGGG
+@291163/2
+CTGTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGTTCGTCGGTTGTGAACTGGTCACGCCAATGGCGCCGGAAATTAAAAAAG
++
+CCCBCFFFFFBCGGGGGGGGGGHGHGHHGGGGGFGHGGHGGGGGGGGGGEDHGGHFGHHHHHHFHHHHHHHHHGHHGHHHHHGHHHHHGHHHGGGGHHHHHHHHGEEGGGGGCDDHGHHHFGHHHGHGGGHHHHGGGGGCGGHHGHHHHGE
+@282455/2
+GTTCTTTTTCAGCAGGATAATATGGTCTTGCGCGATGGTACGAATCGTCGTGTCTTTACTGGCGAGATATTTTTTAACCGTCGTCTTATCCAGCGTGATTTTCCAGCCCTTACAACAGTGGTCGCGACAGGCCGAGCCAGAACAGGAAAAG
++
+ABABBFFFFFFFGGGGCGGGGFHGHHHHHHHGGGCGGG3FGGGDHGHHA0E?GEGBHHHHHGGGGGCFFHHHHHGHFGHGGGGFFGGGHHHHHHCEF/GHHGHHGHEFFHHHHFHGGHGHFHFGGGGGG@GGF->-CDCCCHHFHHHGHH/
+@1116832/2
+GATAATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGTGAATTCCATGCGCAGCATCGGCACGCTGTCAGTTTCCGGCGACGCTTTCAAACGCGCCTGGTAATCTTCCGGAATGTC
++
+@BBBBFFFFFFFGGGGGGGGGGHHGHFDGGGGGGGGHGHHHHFGGHHBFFGGCGGHHHHHHHHHHHBGHGGEEFHHHHHHGHHGGGGGHHHGGGGGGGGGGHHGGGHHHFGGCCGGGGGGHHHHHGGGGGGGGGGEGFFGGBDDGAGGGG
+@485228/2
+GGATCACCACTTTGGTATTCAGCGATTCCGCCATGCGTAAAATATCCGCGCTGGTCATTTTGTCCGTAATACCGCGCGGGTTTTCACCGTAAGAACCGAGCGCGACATCAATTTGATGTTCGTTGCCGTGTTTCGCGTAGTAGTTGGAATA
++
+CCCCCFFFFBFFGGGGGGGGGGHGCHHHGHGGGGHHGGGGHHHHHHHGGGGGGGHHHHHHHHHHHGHHGGHHHGGGGGGGEGGGHHHHGHHGHFHHHGFGGCGCGGGGFGHHHHHHHHHHHGGHHGHGGGHHHGGGG@FGFFHHHHGGFHF
+@1312369/1
+CTCTGGAGTTTTGCATTATACGGAACGGCTGTAGGCGCAGGCACTCTTTTCCTTCCCATCCAGTTGGGATCGGCAGGCGCAATCGTGCTATTTATTACCGCGCTGGTCGCCTGGCCTCTAACATACTGGCCGCATAAGGCGCTGTGTCAGT
++
+CCCCCFFFCFFFGGGGGGGGGGGGGGGGGGGHHHGHGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHGGHGGGGGGGGGGGGGHGHHGGEGHHHHHHHHGGGGGGCHGCGGGHHHHGHHHHGFHHHHHHHHGGGFGHGHHGGGGGHFDFDD
+@1555772/2
+ACCAAATACGGTACTGGCGCTTTGCTGGTGGGCGGCGGCGCGGTAGCGGGTTCCGTATTGTGGAATAAGTACAAAGATAAAGTACGCGCCGCGCATCAGGGGGAGCCGCAATTCGGCAGCCAAAGTACGCCGCTGGATGTTAGCACTGAG
++
+AAA1>1BFFAAF1AADGCE?E0FF1FGHB00AFG/////EE@E?EA1>E//?<1?BGHHH>FCDFBBFF2F>FFFFGHHGFHFD1?C?CCGCC@CCCB0GFC--A..@9@@9C0.99A-AAAFBF/B/BB-9-@==?FF/9/;BFFF/9/
+@1467186/1
+GGTTGGCGCCGAGTCGTTAAACGCGCTGACAGGTCAGATTGTGCCGAAAGACATTCAGCTCGCGACTCCGCCGCAGGTTGGCGAGGCGGCAACCGAATATGCCGCACTGGCGGAATTAAAAGCCATCGCCGGGCGTAACAAGCGCTTCACG
++
+C@BCCCFCBBCCGGGGGGGGGGGGGGGGGHHHGGGHGHHHHHHGHGGGGGHHHHHHHHHHHGGGGGGGHGGGGGGGGHHHGHGGGGGGGGGGHGGGGGGHHHHGGGGGHHHGGGGGGGGGGGGGGGGGGGGFFFF>-AFFFFFFFFBFFFE
+@1109953/2
+GCGTTAGCGTTTCCAGCGAATCAGCCTGATCGTCGAGCTGCTGCTGTTCTTCGAGCAGTGACTGATAAAGCTGCGGCAGCGCTTCCGGGCTGACGTGATGTTTTCGCGCCAGCGAAATTTGTTTAGCGATGCGCTGTTCAAGCTCAAACAG
++
+ABBABABFBBBBGCGFBGGGGGFHCHHHCHGGHFGCE?FFFHFHHHDBGFHHGHHGGHHHHHHHHHHHHFGHHHGGGEEGGGGFGHDGGGGGHFGFEHHGHHGFH@DCGGGGGGCCFHHHGFHFHBFGCGGGGGGFEFHGHHBGHFB:CGG
+@1305512/1
+GAACTTACGATTACCTGATCAGATAATCAGGTAATTTTAGGCAAAAAAAAATCCTTAGCAGATGCTAAGGATTATTTCTGGCAGGGGCGGAGAGACTCGAACTCCCAACACCCGGTTTTGGAGACCGGTGCTCTACCAATTGAACTACGC
++
+ABBBBFFFA?AAGGGGGGGGGGCFFHHHHHGFGHHHHHHHHHGHHGEGGG?GHHHHFHHEGGHFHHHDHHFHHGHHHHHFHHGGFGCCFG?EEGGFGHEGHHHHHHGFGGGGGGGCGGGHGHHFGGGGGFFFHGHHHHHHHGFFGCFHGG
+@798551/1
+ATATAACGCCTGTCGGTCGCCTGAATAATCTGGGTAATGAACAGGCTGGAAAACATCGCGACAAACGCCGTAACGGTGACCGACTGACCGGCGACGCCCTCGGAGATCCCCAGATCCTGCGCCATCGGCGTCAACAGACTAACGGGCAAAA
++
+BBBBBFFBBBFAGGGGGGGCGGGHHHHGHHHHHGEGHHGHHHFHHEHHGGHHHHGHHDGGAEECHHGGGGGGGGG?EGGHGGFGGGHHFEFGGGGCGGGGGGGGGGHHGHEHGHHHHG0/-CG?EFDDGGGGGGGGGFFGGFGGADCAGEF
+@1330635/1
+TTGTTAATCTGCTCCTGATTATTCTCCCCAAACAGTCCCCAGCGGCGGGGCGTTCCCCGCAAACAGAGAATTTCCCCCCGCGCACTTTTCGACGGCGGCGCCAAAAGTCCCCAAAGAACCGCTGCCAGCAGCAGGATAGCGCCCCCCATCA
++
+BBBBAFFFBDFFGGGGGGGGGGGFFBGHFHGHHHHGB3FHHF2AEEEG0//>///BGHCCC/<0B222??22F2>22?///----<<GF0-.<---;:-:--;@FF//::/A..;//...:;-BAF//::.9A.A.///99-;-;---.//
+@1553207/2
+TCTCTCGCTAACGGCCATTCATTAATTCAGACAATGAATATCCGTGTCGAGAATCCGAACCTCAATAATATGGCTATCCAGGATGTGCCGATCCTGAACAGCGATAAAATCATTTGCTCACGCCTGAAACGCGCTGACACGCTGATGGCG
++
+1>AAAB1AAAAFFEEEAFGFBGF33FBGHFD1F0FEGHHCFDG?/FGFEEEEEAFFAEEEEHHHHHFBGBGH1/0BGC0@@0/@1BFG1//EEEHHDG1GCGE@EAEHFHBGFB2>2>111?<<G/G1F<C@?///?CG1///..F1C0>
+@1300443/2
+TACCAGGCGCGTTTGAAAGCGTCGCCGGAAACTGACAGCGTGCCGATGCTGCGCATGGAATTCACCGGACAGTCTGTGGATGCCCCGCTGCTTTCTGAAATCGCGCGTCGTTTCAACGTGAACAATAATATTATCAGCGCGCAGATGGATT
++
+AAABBFABBBBBCFFGGGGBEGGGGFGGGGGHHHHHHGHGGGGGGFGFGHHFGGGGGHHGGEGHHGGCGGGGFHFHBDGGHHECFGGGGGGHFHHGHGHBDGGGGGGGGGGGGFHHHGEHHGHHHHHHFFHFHHHHHHGGGGGGGGGGEGG
+@1368638/1
+GTATTGTGCCGTGGAATTTCTCAATTATGATTGCTATCTGGAAACTGGCCGCAGCGCTGGTATGTGGCTGCACCATCGTCATTAAACCAAGTGAATATACCCCGCTGACACTGCTGCGAGTCGCTGAGCTGGCTAAAGAGGCAGGTTTCC
++
+A>ABBFFFFFBBEGGGGGGGGGGHHGHHHGFHHHHGHHHHGHHHHHHHHHGGGGGGGGGGHHHHHFGHHGGHHHHHHGHHHHHHHGHHHHHGFHHHHHHHHHHGGGGGHHHHHHHHHGEFGHGGGGCGHHHHFHHHHGHGHGGGG?GGGF
+@1333472/1
+ATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGTGAATTCCATGCGCAGCATCGGCACGCTGTCAGTTTCCGGCGACGCTTTCAAACGCGCCTGGTAATCTTCCGGAATGTCCAGGT
++
+BCBBCFFFFFFFGGGGGGGGGGFEGGGGGGGGHGHHHHHHHHGHHGGGGGGHHHHHHHHHHHHHGGGGGGHHHHHHHHHGGGGGGHHGGGGGGGGG<DGGGFHHHGGGGGGGGGGGHHHHHGGGGGGHGCFFGGGGGGGGGGGGGGGGFFC
+@303451/1
+GCTGTAGGCGCAGGCACTCTTTTCCTTCCCATCCAGTTGGGATCGGCAGGCGCAATCGTGCTATTTATTACCGCGCTGGTCGCCTGGCCTCTAACATACTGGCCGCATAAGGCGCTGTGTCAGTTTATTCTTTCCTCAAAGACTTCTGCAG
++
+>AAA3D5DFBBBGCFGGGGGGGHHHHHBGFHHHHHHHFHHGFHGGGGG?EAE00EEFG1BCFEHGHFHHHBFEGC/E//FG?/EFHACEHHH34FE?GFEHHHHFGGGDH?GHCGGGDHHHHGBGFFFFHHHHFHHGFHHHHFHGHFFGGG
+@683807/2
+GTAACCAGCATCATCGGTAACGGTGTTGTGCTGTCTCCGGCCGCGCTGATGAAAGAGATGAAAGAACTGGAAGACCGTGGCATCCCCGTTCGTGAGCGTCTGCTGCTGTCTGAAGCCTGTCCGCTGATCCTTGATTATCACGTTGCGCTGG
++
+CACCCFFBBFFFGGGGGGGGGGGEGGGHHGHGHHGHHGGGGGEGGGGGFHHHGHHGHHHHGHHHGHHHGHGHHHGHGGGGGGHGHHGFFHHFGGHGEGGGGGGHHHHGHHHHHHHHHHHHHHEFGCADGHHHHHHHHHHHGGHACEDGGGG
+@489450/1
+GCATTAACGCCGGGCTGTCGACCTGCTGGCTTAACGCGCATCATCGCGAGCAGCCCGCGGGTATTCATCCAACCTGGACTGTGGCGTCATTAAGCGAACTGGAGCAGCTCCTGTGTAAACACTGATTGCCTCCCCCAGGTTGATGGGTAAA
++
+AAABAFBFADDDCEEFGGGGGGGGGHGHHGHHHCFEGGGGGGHGGHGGGGGGGHHGGGGGF<EGHHHHHHFHGGFGFFFHHHFGHGGGGHHHHHHGGGGGGHFAGFHHHHHFHHHHHHHGHGHHBGHHHBHHHGGGFDGGCGHHGF?9FFB
+@1081838/2
+CTACTGGAACGGGCGGTGGCGGAATACGGTCATATTGATATTCTGGTGAATAACGCGGGTTTGATCCGTCGTGAAGATGCGATTGATTTCACGGAAAAAGACTGGGATGACGTCATGAACCTGAACATCAAGAGCGTGTTCTTTATGTCT
++
+CCCCCFBFFFCCGGGGGGGGGGGGGHHHGHGGHHHHHHHHGHHHHHFGHGHHHHGGGGGEGGGGHHHGGHGGGHGGHHGHGGHHGHHHHHHHHGGGGHGGGHHHGHHHGHHGFGGHHGHHHHHHHHHHGFFFHHHGGGFHHGHHHGHHHE
+@1273373/2
+CAGGGGAAGAACGTGAAGCCAATTCCCGCTCCGCGACTTTCTTTAACCTGCTGCCGCTGCACGATGGCAACCACTTCCCCGGCGTCAGCAAAACGGCGGATTATAAAATCCGCGCGCAGAAACTGTTCGATGAACTGGACGCCTTCTTTA
++
+BBACCCCBBFFFGGFGGGGGGGHHHHHGGGGGGGGGGGGHHHHHHHHHHHGHHHHGGGGGHHGGHGGHHHHHGGHHHHHHGGGGGGGGHHGHHHGGGGGGGGHHHHHHHHHGGGGGGGGGHHHGHHHHGHHHGGGGGGFGGGGGGGGGGG
+@1380840/1
+CTCTTCTTGTGTGCCGTGCATTTCCGTTAGCATAATGCCGAACTTCACACCGCCCGCGTAATCCATCTGCGCGCTGATAATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGTGAAT
++
+BBCCCFFFFFFFGGGGFGGGGGHHHGHHGGGHHHGHGGHGGGGHHHHHHGGGGGGGGGGGGGHHFHHHHHGGGGGGGHGHHHHHHHHHHHHGHHGGGHHHHGGGGGGGGGGHGHHHHHHHHHHHGGGCCCHHHHHHHHGHHFGGGGDCGGG
+@980118/1
+ACGTGATGGAGCGCGCGCTGTACAACACCGTCCTCGGCGGTATGGCGCTCGATGGCAAGCATTTCTTCTACGTCAACCCGCTGGAAGTGCATCCAAGATCGTTAAAATTCAACCATATTTACGATCACGTTAAGCCCATCCGCCAGCG
++
+CCCBCCFFFFFFGGGGGGGGGGHHHHHGGGHGGGHGGGGGGGGHHHGCEGGGHGGHHHGHHHHHHGHHHHHFGHGGHHGGGGGGHHFGHHHHHHHHHHFHHHHHGHHHHHHHHHGHHHHHHHGFHHGHGGHHGHHHHHFHHGGGGGEG
+@1430760/2
+ACTCTGGACACCGCCGTTTGCGCGGTAATAATGTTGCCGACGGCGCACACAAACGCCACAATGATGGAAAACGCCACTTTGAGCCAGATACCGCCAACGTTGCCGGCAATGGTGAAAAATGCTTCATTCGTCGCATTACCTTCCGCGAAG
++
+BB@BBFFFFFFBGGGGGGGEFFGGGGGGHHHHHHHHGHGEGGGGGGGGGHGGHHGGGCGHHHHHHHHFHHHHGGGGGHHHHHGHHHHHHHHHGGGGGGGHHHGHGGGGCGHGHHHHHHHHHHHHHHHHHHCDGGG?EHFHEFHG?FGGGF
+@703265/2
+GGATAGATTTTTCTGTGCGGCTAATTGTTGTGCGCTTAAAGGCATGAATGTTCTTCCTTTCTCTTTCGTTTGGTTATTAGTATGCCACCTGGAAGTGTGATTGCAGTTGCAATAACGGCAATTTGCTTATTTTATGGCACGTTAAGCACG
++
+BBBBBFFFFFFFGGGGGGGGGGGHHHHHHHHGHGGGGGHHHGHHHHHHHHHHHHHHHHHHHGHHHHHFHHGGGFHHHHHHGGGHHHHHGHHHHHHHHHHHGHHHHHHHHHHHHHHGGGGGGHHGHHHHHHHHHHHHHHFFFGHHGHHHHC
+@1427700/2
+GCGTCTCTTCTTGTGTGCCGTGCATTTCCGTTAGCATAATGCCGAACTTCACACCGCCCGCGTAATCCATCTGCGCGCTGATAATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGT
++
+ACCCBBFFFFFFGGGGGGGGFGGHHHHHHGHHGGHHHGHHGHHGGGGHHHHHHHGGGGGGGGEGGGHHHHHHHHGGGGGGGHHHHHHHHHHHHHHHHHHHGHHHHGGGGGGGGGGHGHHHHHHHHHHGGGCDGGHHHHHHFHGGGGFFGG@
+@480507/1
+GCATTTCTTTAATCATTTATTTGCATTTTATTAACACAAAATACACACTTCGCTTCATCTGGTACGACCAGATCACCTTGTGGATTCAGGAGACTGACATGCTTTATAAAGGCGACACCCTGTACCTCGACTGGCTGGAAGATGGCATCG
++
+BBBCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHGHGHHHHHHGHHHGGGHGHIIHHHHHHGGGGGGHHHHHHHHHHHGHHHHHHHHGHGHHHHGHHHHHHHHHHHHGGGGGGGGGHHHHHHHHGGGGGHHHGGHHHHHHHHHHGG
+@1148904/1
+TCGGTGAAGCGCAGATCGACAAACTTCACTTCGTGCTCGTTCAGCATCGTCAAAACGTGTTCAGCGGACATACTTGTACTCTCCCGGATTGGTCATGGTCGGTCGTCGTGGTAACGAGATCTTCAATTCTGCTGGCCGTGTCGCCGTAAAA
++
+BBCCAABFFFCCGGGGGGGGGGHHHHHHHHHHGHGGGHGGGHHHHHHHGHHHGHHHGHHGHHHHHGGGGGHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHGGGGGGGGGGGHHHHGGGGGHHHHHHHHHHGHHHHGHGGGHHGHGGDDGHH
+@642924/2
+CAGAATAACGATATAACGCCTGTCGGTCGCCTGAATAATCTGGGTAATGAACAGGCTGGAAAACATCGCGACAAACGCCGTAACGGTGACCGACTGACCGGCGACGCCCTCGGAGATCCCCAGATCCTGCGCCATCGGCGTCAACAGACTA
++
+CCDDCFFFFDEDGGGGGGGGGGHHGGGGGGGGHGHHHHHHHHHHGGHHHHHHHHHGHHGHHHHHHHHGGGGGCGHHGGGGGGGGGGGHGGHGGGGGHHHGGGGGGGGCGGHGDGCGHHGHGGGHFHHHHHGGGGGGGGGGGFDDGGGGGGG
+@1472758/1
+CGTTAGCATAATGCCGAACTTCACACCGCCCGCGTAATCCATCTGCGCGCTGATAATATTATTGTTCACGTTGAAACGACGCGCGATTTCAGAAAGCAGCGGGGCATCCACAGACTGTCCGGTGAATTCCATGCGCAGCATCGGCACG
++
+CCCCCCFFFFFFGGGGGGGGGGHHHHGGGGGGGGGGGGHHHHHHHHGGGGGGGHHHHHHHHHHHHHHHHHHHHHHGHGGGGGGGGGGHGHHHHHHHHHHHGGGGGGHHHHHHHHHHHHHHGGGGGHGHHHHHHHGGGGGGGGGGGGGG
+@1485673/1
+ACTCTGCACCTGGACATTCCGGAAGATTACCAGGCGCGTTTGAAAGCGTCGCCGGAAACTGACAGCGTGCCGATGCTGCGCATGGAATTCACCGGACAGTCTGTGGATGCCCCGCTGCTTTCTGAAATCGCGCGTCGTTTCAACGTGAACA
++
+BBABBBFFBBCFGGGGGGGGGGGGGFHHHFGHGGGGFGFFGE55DGHEEAFFGGGCEGEEGHHHFEFGGG1EGFGGHHHGGGGGGHHHHGHGHGBFGCGGHHHDGF22?GFGGGFFCDFGFHHHFHHGFGE@CCGGGCGGGHFHGHGGGEF
+@1222527/2
+GCCTCTAACATACTGGCCGCATAAGGCGCTGTGTCAGTTTATTCTTTCCTCAAAGACTTCTGCAGGTGAGGGAATTACTGGCGCCGTTACTCATTATTACGGCAAGAAAATCGGCAGTATTATTACCACGCTTTATTTCATTGCGTTTTTT
++
+CCCCCFFFFFFFGGGGGGGGGGGHHHGGGGGGHHHFHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGHHHHHHHEHGGGGGGFGHHHHHHHHHHGGGGGGGGHHHHGGGGGHHHHHHHHHHHHGGGGGHHHHHDGHHGGGGGGGG
+@218747/2
+GGTTTGATCCGTCGTGAAGATGCGATTGATTTCACGGAAAAAGACTGGGATGACGTCATGAACCTGAACATCAAGAGCGTGTTCTTTATGTCTCAGGCGGCGGCAAAACTTTTTATTGCCCAGGGCAACGGCGGCAAAATTATTAATATCG
++
+AAAAABFFFFFBGGGCFGGGGGHGEHGGBGHCGFGHGFGGFFGFHHHHGHFEHHGEGEHHHHHHHHHFFFGHFGFFGHGAFGHHHFHHHHHFGHHHEFC?CEGGCCF2GHHHHHHHGHHH1CGEDGFFHCGGGGGGGHHGGBFGGBFGFG?
+@1427748/1
+GTCTACAACATGACAAACAAAAACAAATGCGTAACGGAACTTTACGAAACATAGACACTCTAACCTGTTGCTTGCTCATAGTGCGGCTTATGGAGTGGCGTTTCGAAAGCGCGTGGAAATTTGGTTTGGGGAGACATTACCTCGGATGAG
++
+AABB3@D4CAFFFGFGGCGFGGDGH4FFHBE22EEECGFEGHHDHGFFEEAGDHGHHBFHF5G3F5BGGFE3F31@5FGHF5BG?/@E>FFDB31BC1FEE/>FA/?EF3?ED<C@/GHGFHGH/F0BGD///?FCGDGHED1<A.<CHH
+@710462/1
+CTTCGCGCTTGGCCGTATCACTGTACTCTTTTGCCGTTTTCATCTTCACTACCTCACGGGTTCCTGACAGCCTAAGTATAGACCGTTGAGAAAACCAGCAAACACGCCGGCAAGGCGCTGTCAGACGCAGAAAATTGTTCTACACTGGCA
++
+CCCCCCCCCCCDGGGGGGGGGGHHHHHGHHHHHHHGGGHGHHHHHHHHHHHHHHHHHHGGGGHHHHHHHHEHGHHHGGHHHGHGGGGGHHHHHHHGHHHHFHHHHGGGGGGGGGGHGGGGGHHHHHGGGGGHHHHHHHFGHHGHHEGHHH
+@1455894/1
+AGTTTATTCAGTCCACTCTGCACCTGGACATTCCGGAAGATTACCAGGCGCGTTTGAAAGCGTCGCCGGAAACTGACAGCGAGCCGATGCTGCGCATGGAATTCACCGGACAGTCTGTGGATTCCCCGCTGCTTTCTGAAATCGCGCGTCG
++
+>A3A?D5FFFFDFGGGGGG54BFGFA4BGEGBG6B2AFDAADAF5AAF2E?EG?EFHB5BBAGF0FA@?E//?E33BFHG///>>@E@EE34BE//</FFHEH1DHGG/>C//11?11<BGF1<F1>-@C<<<DHB0GFFG0D.C-:-:-9
+@587479/1
+GTTGCAGCGTCATCAATAATTCCGCCCCCTCTTTACGCAATGAAAACCGACTTACGCTCATCTCGCTTTCGGCCAACCGGACAAACAGTGACGGCACCGCATCCCAGGACGTTTTCAGCGCTATTTCTCCCCCCTGCGCCGATGGCTGCCA
++
+BBBBBFBFDBBBGGGGGGGGGGHHGGGGGGGHHHHHGGGGGHGHHHHGGGFGGHHGGGGGHHHHHGGGGHGGGGGHGGGGGGGGHHGHGHHHFGGGGGCGGGGHHHFEHHGEGHGHHHHGGGGGHHHHHHHGGGGEHGGGGGGGFGGGGGB
+@988290/1
+TTCATACAGAGATCATGACCACACATGCAACAAAAAAGCCTGCAACTCATTGAAGTTACAGGCTTTTTTAAGGTTCATGATGCATCATGAATGAATGTTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACATCCTCGGT
++
+BCCDDFFFFFFFGGGGGGGGGGHGGHHHHHHHHHHHGGHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHGHHHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHGHGGHHHHHHGGGGFG?F3DHBHG@CDGCFGGFGFHDHBHHHGHHHHGC<
+@939918/1
+ACCCTAATTAGGGGCGTAGTTCAATTGGTAGAGCACCGGTCTCCAAAACCGGGTGTTGGGAGTTCGAGTCTCTCCGCCCCTGCCAGAAATAATCCTTAGCATCTGCTAAGGATTTTTTTTTGCCTAAAATTACCTGATTATCTGATCAGGT
++
+CCCCCFFFFFFFGGGGGGGGGGHHGHHHGHHGHHHHHGGGGGHHHHHHHGGGGGGGGHHGHGGHHGHGHHHHHHHGGGGGHGHHHHHHHHHHHHHHHGHHHHHHHGHGHGHHHHHHHGGGGGHGHHHHHHFHHFHHGHHHHHHGFHHHHH0
+@1399547/1
+ATCACGCCCGGTTCTTTGGTCAACTGACCGTTATCGTCGAAACCGCCGTCCACCGGCAGTTCGCGGCCCGCCAGACGGTTAACTTCTAACATCCCGTAGGAGAACATCGACATCGACATATCTACCATCGTGATCGGCGTAGACGGGATGG
++
+BBBBBAFABBBDEGGGGGGGGGHHHHGHHGGGGHHHHHGGGGGGGGGGGGGGHHGGGGGHHHGGGGGGGGGGGGHGGGGEGHHHHHHHHGHHGHHGEGGGGHGHHHHHGFGGGFGHGGDHHHGHHHHHGGHHHHHGGGGFCAGGGGADGGG
+@905854/1
+CGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATATCCCCGGCGGCGAT
++
+BBABBBFFFFBBGGGGGGGGGGGGHHFHHFHHHGHHGHHHHHHHGGGGGHHHHGHFFHHHHHGHHHHGHGHHGGGCFGGGGGGGHHHGHHHHGGGGGGGGGDHHHGHHHHGGGGGGCFFFHHHGHHHHGFGGHHHHHHHHHGGGGGGGGGG
+@215813/1
+GTCTTTATCAAGCATTTGCTTACGTATAAACTTATTCTGATATTCAGGAACAATTTAAATGTCTATCACTAAAGATCAAATCATTGAAGCAGTATCCGCTATGTCCGTAATGGACGTTGTAGAACTGATTTCTGCAATGGAAGAAAAATT
++
+AABBBFFFFFFFGGGGGGGGGGCFFGHHGHHHHHGFFGGHHBFHHHHHHGHHFHHHFFGHEHHHHHHHHHHCFHHHHHHHHFHHHGHHGHHHHHHHGCFGGGFBFFFFFGGHHHHGGGGFGHGHBHGFHFHHHGGFHHFGFFFHHHHFG?
+@596321/1
+GCTCTATGGCATTGCCGATCTCGCCTTTGTTGGTGGTTCGCTGGTTGAACGCGGCGGTCATAACCCGCTGGAGGCCGCCGCTCATGCGATTCCGGTACTGATGGGTCCGCATACCTTTAACTTTAAAGATATTTGCGCCCGTCTGGATCAG
++
+BCCCCFFFFBFFGGGGGGGGGGHGGGGHHHHHHEGGGGFGGGGCFGGHHHHGGGGGGGGGHHHFHHGGGGGGHGGGGGGGGGGGHHHGGHHGHHGGGGHHFHHHHHHHGFGGGHHHHHHHHHHHHHHGCFHHGHHHGGGGG@DFEGFGFGG
+@1146198/1
+CGCATGTTGAATACGAAAAATGCGGCTATTTTACCCATCAACCTGGGGGAGGCAATCAGTGTTTACACAGGAGCTGCTCCAGTTCGCTTAATGACGCCACAGTCCAGGTTGGATGAATACCCGCGGGCTGCTCGCGATGATGCGCGTTAAG
++
+BCBCCCFFFFFFGGGGGFGGFGHDEGGFFHHHHHHHHFHHHHHHHHGGGGGGGGHHHHGD@GHHHHHHHHHHGHHHHGGCGHHHHGGGHGGHHHHGGGGGHHHGHGHGCFGCHHFGHFHHHHGGG/@DGGGHHGGGGGGHHFHGFGGGDGH
+@1215756/2
+CTGCAAGGGTTGCTCAAGACGAAGGACGGCCAGCAGTTGAACCTCAATAATATCGGCAGTACGCCGCTGGCGGAAAAGGTGAAAACCAAAGCTTGCGATCTGGTGTTGCAGCAAGGGCTGAATTTCCTCTCCTGACTGCGTTTTTCTGAC
++
+BAABBFFBBFFBGGGGGFGGGGGGGHHGCEEFHGHHGFHHHGGHHFFHHHHHBGGCGGGCHGGGGGFGG??EGCGCHFG?FGHHHE?GHHF2BGBEFCHGFHHFHHGHHHHFFBGEFFCD0GFBGHBDFHHFHHGHG10?.ACGEHHHFF
+@704047/1
+TTCTCACGCGCGTTATCCAGCGCAACGTGATAATCAAGGATCAGCGGACAGGCTTCAGACAGCAGCAGACGCTCACGAACGGGGATGCCACGGTCTTCCAGTTCTTTCATCTCTTTCATCAGCGCGGCCGGAGACAGCACAACACCGTTA
++
+BBBBBFFBFBBDGGGGGGGFGGGGGGGFGHHHHHHHHHHHHHGHHGGGGGGGGHHHHEFHHHHGHFHHHHGGEEGHGGGGGGGCEFGHGHHGGFDGHHHHHHHHHHHHHHHHEHHHHGHHHHFGGCGFCFGGGCGGHHHHGGGGGFGGGG
+@104829/1
+GTCCAGGTTGGATGAATACCCGCGGGCTGCTCGCGATGATGCGCGTTAAGCCAGCAGGTCGACAGCCCGGCGTTAATGCCGCCAAGAATATCGGATTCCGCGGTATCGCCAACCATTAATACGCGCGAGCGGTCAGGATTCCCCGCCTG
++
+CCCCCFFFFFCFGGGGGGGGGGGGGGGGGGHHGGGGGGHHHHGGGGGGGHGGHHGHHGFFCGGGGEHGGFGGCFGAFHHHGCGGGHHHHHHGGGGGGHHHGGGFFGHGGDGGFFGGHHFHHHGGGGFGGGGGGGGFFBFFFFFFFFFFF
+@764353/2
+ATACCGTGGTGCTAAACATGGTGCCAAAAGCTCAAGATTCATACAGAGATCATGACCACACATGCAACAAAAAAGCCTGCAACTCATTGAAGTTACAGGCTTTTTTAAGGTTCATGATGCATCATGAATGAATGTTTGGTGGAGCTGTCGG
++
+A@AAAAA??A1FGFEGGDD1FB1GGFFHCBAF1FHF11FEA2FFEAFAG1GHHHFCGHCGEECGGHHHFHHHEG?00F00BE1F111@21B@2BF2FDGE0BCGE@?B>1111FD22F2DEHH1>>212BF1FFFFE0F///F/0<111?/
+@390988/1
+GGCTATTATGATTGAACGTGAACTGGGGAACTGGAAAGATTTTATCGAAGTCATGCTTCGTAAATAAATGCCTGGAAGGCACCGCGCTCCCATAGGGGATAAGAAAAGGCGACTCAACGAAAGTCGCCTTTTTTGTGCCCGACACCTCGTA
++
+BBA@?DFFFFFFGGGGGGFGGEHHFHHGGGGGGHGHGHHHFHHHHGHACFGHHGGFGHHGHHHHHHGHHHHHHHGHGHGH1?FEFGEGEEGHFECHGFEGHFHHGFFFFEGGF?FHHHGGGCAGFDG?EDHFFGGFGHFFD@?@@.GGF<<
+@151279/1
+GCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATATCCCCGGCGGCGATGGCTTCAGACACCATCTG
++
+ABBCCFFFFFFFGGGGGGGGGGHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGCGGGHHHHHHHHGGGGGGGGGGHHHHHHHHGGGGGGGGGGHHHHHHHHHGGGHHHHHHHHHGGGGGGGGGGGGHHHHHHGHHHGHGGGG
+@166310/2
+GCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATATCCCCGGCGGCGATGGCTTCAGACACCATCTGCGTAGCGCGGG
++
+CCCCCBFFFFFFGGGGGGGGGGGHHHHHHHHHHHHHHHHHHGGGGGGGGFGGGHHHHHHGHGGEGGGGGGGHHHHHHGHGGGGGGGEE/FGGHHHHHHGGGEFHHHHHHGGGCDGCGGCGGDHGHHGHHHHHGHGHHHHCEDGGGGGAG
+@236692/2
+GATGGTGTCTGAAGCCATCGCCGCCGGGGATATTCAGGCGATAAACTACTTCGTGGCGCAGAAATACACCGAAGCGTTACAGCAAATCGGCTCGGCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGATGGGCG
++
+AAA3ADDAFFFFBGGGGGGGGGGGCFEGGFDHHFHFHHHGEGGGHEGHFHHFGGFGGGEEF/EBDFHHFFGGGGGFGGGGHHHGHHHHG?CGDGGGGGCDGFFHHHBGHHGHHHHHHHGDGFHGGGCCC0GHGHFACGHFBFCC::C.@
+@349461/2
+CAGTGACGGCACCGCATCCCAGGACGTTTTCAGCGCTATTTCTCCCCCCTGCGCCGATGGCTGCCAGTGCAGCAAACGCAGGGGAGGCGCCTGGAAATCTAACGGCGAAAAAGGACACGGATTTTCAACGGTGCCCCCGAAAAGCGGTTCA
++
+ABA>AFFBDDDDGGGGGGBFFGGGHGAFFFHFHFEEGCGGHHHHEFGGGGEHGGGCG?1EFGFGHHHHHHFBGGFFFFGGCEC//C/CCGCFEHB1DGHHHHHGGCGCCGGGGCHHFFDD-ADHHHHHH?-.;@FFGBG@@BGCG?-EBFF
+@1255188/1
+ATCTGCAGGCGCTGGAATGTCAGCGTGACGCTAACCGCGTGGTGGCGTTGCTGGGCGGTAAATCGCCGCATATCCAGAACCTGGCGGTCGGTGGGGTGGCGAACCCGATCAATCTCGACAGCATCGGTACGTTGAACCTTGAACGCCTGAT
++
+CCCCBFFFFBCCGGGGGGGGGGHHGGGGGGGGGGHHGGGGGGHGGHGGGGGHHHGHGGGGGHHHGGGGGGGGHHHHHHHHHHHHHGGGGGGGGGGGDGGHGGGGGGGGGGGHHHHHHGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFF
+@1533952/1
+CTTTTTTAATTTCCGGCGCCATTGGCGTGACCAGTTCACAACCGACGAACATAAACATCGCCATGCCAATATAACCAAAAAGACCAGAAAGATTACTGACATCAAGCGGTGAGCCAAACCACCCGGAATGATGAGTGACCGGGGATAACAG
++
+BBBBBFBBFFFBGGGGGGGGGGGHHHGGGCGHFHFG5GBHF1EE0A0@ECEHGHHBG3@11EGEEGGBFCGFFH433CG///??GC00FGFFDGE3DGGFFFF2F2B/>?@/?GHHBFFFEFFD?FCGEGH1>GHFBF1F--A<;.CG0::
+@191877/2
+GTTCTACGCAACAGCAGACCCTGAAAGTCGTTGAAAAGGTTGAAAACTATTACTTCACCCATGAGAAAGACAACATTATGTCGGTCTTCTCGACGGTCGGTTCCGGCCCTGGCGGGAACGGGCAAAACGTCGCGCGCATGTTTGTTCGCTT
++
+A3AAAFFBBBBBGFFGGGGCFGHGCHHHFGFEFHHGFHGHHHBFDGHFHHHHFGBGHHBCFFBGFFHHHFBCGEECGHEHHB1E>FDHHBEFFEGGGEGG@EGEEEGGGHHFE@CA?C/<<DC?FHBACCGC?FCGG-.;900/;/;A9A.
+@321211/2
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATA
++
+AACBBFFFFFF@GGGGGGGGGGHHGGCGFGCFFGGGGGHHHHHHHHHHHHGHHHHHHGGGGGGEGHHHHHHHHGHHHHHFHHHHHHGGGGGGCGGGGFHHGGHHFHGGGGGGGFACGHHHGGHHGGGGGGCGGEHGGHGHEHGGGGHEGHE
+@325573/2
+AGATATGCGGATGTACCAGAATCATCGCTATCATGCTTTTTTCCGTTCGCTGGCGCTGTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCG
++
+CC@BBFFFCBBCGGGGGGGGFGHHHHHGHGGHGFHGHHHHHGGHCHHHGGGGCGGGGGFHHHHHHHGHHHHGFGGGGHHHHGCGGGGGGHGGGGGHHHHEHGHEFHHGHHHHHHHGGGGGHFHHGHFFHHHHHHHHHHHGHFFDDGGGGGG
+@936291/1
+GCATGTAGTACCGAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAACATTCATTCATGATGCATCATGAACCTTAAAAAAGCCTGTAACTTCAATGAGTTGCAGGCTTTTTTGTTGCATGTGTGGTCATGAT
++
+CCCDDFFFFFFFGGGGGGGGGGHHHHHHHGGGGGGGGGGGHHHHHHHGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHEGGHHHHHGHHHHHHHHHHHHHHHHHHGHHHHHGGHHHHHHGHHHHGHHHHHHH
+@362138/2
+CATTATCACCGTACTGCGCAACACAAACTTTTAAGGTCTGCAAACTATCACGACGCGGCGCAAGAGTTTGTTATCAACTTATAACAGCTTTGTTACCTGCTTATACCAGCAATACCATGCCTGTCTGCTATGCTTTTTGGTTATGTAGTGT
++
+AA1AAFBFF1>1AA13BAE?00BFAA0AA1A1AA1GABF01F11A1FF12F/AE/AEAEEE/>/0012B1>F2BF22B>FG2B2B1BE111BFF2B111<112BF2F<1/B0B1<1FG1<11@@FDGFG1F111?111/<//?111<110<
+@559977/2
+ATCTTAGAGATAACACCCTTGTTACCGTGGCGACCTGCCATCTTATCACCCGGCTGGATACGGCGTTTAACGGCCAGATAGACCTTCACGATCTTCAGCACGCCCGGCGCCAGATCGTCGCCCTGGGTGATTTTACGGCGCTTCGCTTCAA
++
+BBCBCFFFFFFFGGGGGGGGGGHHHHGGHGGGGGGGHGHHHHHHFHHHHHHGGGGGEHHHHGGGGGGGHHHGGGGGHGHHHHHHHHHHHHGHHHHHHHHHHGGGGGGGGGGGGHHHHHHGGGGGGHG<EGHHHHGHGGGGGGGGGGGGGBB
+@400591/2
+CTACGCAGATGGTGTCTGAAGCCATCGCCGCCGGGGATATTCAGGCGATAAACTACTTCGTGGCGCAGAAATACACCGAAGCGTTACAGCAAATCGGCTCGGCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGAT
++
+BBBBBBBBBFFFGGGGGGGDGGHHHHCGGGCCEGGGE?CGFCHBGHGCEGGHHGFHHHHGCFEGCFGGGHHHGHHFG@EGFFGFGGEDGHF?GHHCDGGGCCC@@@@FH1FFACGFB=DH0DDDHHGHHHGGCFCFHHFHF0.:C::0;0B
+@420426/1
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATA
++
+AABBBFFFFFFAGGGGGGGCGFGHGGEGCGGGHGGGGGHHHHHHGHHHHHFHHHHEHHGGGGGHHHHHHHHHHHHHHHHFHGHHGFFGGGGGGGGGGGGHHHHGGHGGGGGGGFFDHHHHHHHHGGGGGGG?DEHHHFHHGHHGGGHHHHB
+@667516/2
+TGTATGTACAGTTTGTAACCTGGTTCGTTGGGGATGGAAAGTGGTGAAACGAGGGGATGATGATTCTGGATAGAGGTTCGCAAAAAATGGAATGCGGTTGGCGCTGGGTTTTTAATTTTTGTACTGTGAAACGATGATGCTATACGCCATT
++
+BBAABFFFFFDFGGGGGGGGGGHGFHGGHHHGGGGGGFHHHHFFDFFFGGGFFGGGEGGHHHGHHHHHHHGHHHGHHHHGGGG?G1EFHHGHHHFEFEEEGFGGGGFGHGGGGHGBFFHHGHHHGHHHHFHFFAFGHHHHHGHHGHDGFAD
+@486138/1
+ACGCAGATGGTGTCTGAAGCCATCGCCGCCGGGGATATTCAGGCGATAAACTACTTCGTGGCGCAGAAATACACCGAAGCGTTACAGCAAATCGGCTCGGCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGATGG
++
+BBBBBBBFFFFFAGGEGGFGGGHHGGFGGGGGGGGGHHHCHFBBEFC?FHGGFHHHFGFFEGGDEEEHFHHHHHHGGGGGGGGGGFFCGGHFHG?/FACGGGGGGGHE1GHHHHHHBFFDGFFFGGGHGGCCDFHFFHEHEGH::FGHHHH
+@119327/2
+ATGCAGGCGAACGCATTAAACAGTGACTGTACAAAAACCGAGAAAGAACGGCTGCACCGTATGCTGGAAGAGATGTTTGAAGAGGCTGATATGTGGCTGGTCGCCGAATAACGTCCCCTCCTGCGAAAGCGACATGTCCGATCGAAAACAG
++
+DCCCCFFCCCBBGGGGGGGGGGHHHHHHHHHHHHHHHGGGGGGGHHHHHGGGGGGHHHGHHHHFHFHHHH1FGHHHHHHHHHHHHEHGHHHHHHHHHHGGFGGGGGC<FFHHGCGGGHHGGHGHGGGGFGGGGGGGHHHGGGFCGGGGHHC
+@313131/2
+CTCCTGCAACAGGGGCAGCTTTCCATTCCGCAGCCGCAGCAACGTCCGGCAACGGATCGGCCATTATTGCCTGCTGAACATAATACGTTGAATCAGTTGGTGACGAAGCTGGCGGCCGCGACCGGCGAGTCAAACAAACTTATCTGGCAAT
++
+BBBBBFBFFF?FCEFGGGGGGGHHHHHHHGGCEGFCGGGGHGHGFHFEGGGGH@EFGCDEGGGHFFHHHHHHHGHHHHHHEHHHHHH3EGEHHHHGGGHHFCGFGGGGGHHHGFCGFCGGCDGGCGC?@BGBCFFGGFEFGGGGGFGGEGF
+@1030615/2
+CATATCCTGCATCCAGTACGGCCTGCACGCCCTGACATCCCATATCGTGATAGGCAAAAATAACGGCTTTCATTGGTGACTTTCCTCAGTAAACGGCGTGCTTTCCGGGGAGATAACTTGTTGAACAAAATAGCGGGGGCGGGCGCGGACA
++
+BBBBBFFFFFFFFGFGDDBEFGGGFFHHGCAEFGHFHCHHHFFHHHABGBGFHEGFHHBGFFFGG?EGGHHFHFHBFFHHHHHHFHHGHGGHHHGCCGE///FE33E?///<CHHHF>FG>GH2FFGGAGH1GHGFCGFGG?-;@-@B;9;
+@576313/1
+ATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATATCCCCGGCGGCGATGGCTTCAGACACCA
++
+CDDDCDDDDBFFGGGGGGGGGGGHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGGHHHHHHHHGGGGGGGGGEHHHHHHHHGGGGGGGGGFHGHHHHHHHGGGHHHHHHHHHGGGGGGGGGGGGHGGGGGGGGGGG
+@587407/2
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATA
++
+1>1AADFFFFFAGGGFGGGAGGCFEEGCE/E?GAEGAEGGHHFHEHGFFBEGHFHGFH?ECEFHFFHGHH2GGHGHGHHHFHHHHFAE?EEEE//<?FFHGHGD?FCCCGGGG/AAGHGFHFFHCCG.EG-<CC0=DFDGHHGGFAH/GB;
+@1422258/1
+TTGATATACAGCGCATCCGCACGCGGCGTGTAGATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGAT
++
+CCCCCFFFFFFFGGGGGGGGGGGGGGGGGGGHHHHHHHHHHHHHGGGGGGGGHHHHHHHGGGGGGGGGGHHGGGGGGGGGGGHHGGGGGGGHHGGGGGGGGGGCGGGGFFFFFFFFFFFFBE?BFFFFFFFFFFFFFFFFFFFFFFFFFF
+@616978/2
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGACTA
++
+AAABAF5DDBD4CGGEEGCGGGGEE22E2EG25AEEC1FGHFGFFGF5E3EB3FHCEFEC?@>GFHHHHHGFHHFHHHHHFHF44BEE??@EE?C/AEBDG2GHBB/BAE//C</?GBFGGHGHFCD.<A@.<C0<=<GGFDH.AEGB/00
+@324453/2
+GAATGGAAAACCTCGTTTTGTGCTATGAGAGCGCTGGGCGATCATGACAGGAAAAACGATCTGCGAGGCAATAAAAGCCGCCGCTCTGCTTCCGGGGACGCTATCCGCCTGGTTGTCATTCATACGGAGAACCTTTTTATTATCAAGATCG
++
+CBCBCFFFFFFCGGGGGGGGGGHHHHHHHHHHGGGGGGHGGGGGHHHHHHGHHHHHGGGHHHHHGGGGGGHHHHHHHHHGGGGGGGHHGHGHHGGGGGGGGGGGHHGGGGHHGHGGHHHHHHHHHHGGGGHHHHHHHHHHHHHHHGHFHG.
+@68755/2
+ATGTAGTACCGAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAACATTCATTCATGATGCATCATGAACCTTAAAAAAGCCTGTAACTTCAATGAGTTGCAGGCTTTTTTGTTGCATGTGTGGTCATGATCT
++
+AABABFFFFFBAECEGGGFGGGFHHHHHGGGGGGGGGGHHHHGHHHGGGGGGHHHHHHHHHHGHHHGFHHHHHHHHHGHHHHHGGHHHHGHFGEEFHHHHHHHHHHGHHHHGHHHHGHHFFHFHHHGGHHFFHFHGHGHGGHFHGGHHH
+@655642/2
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATA
++
+AABCBFFFFFFCGGGGGGGGGGHHGGGGGGGGHGGGGGHHHHHHHHHHGHGHHHHHHHGGGGGHHHHHHHGHHHHHHHHHHHHHHHGGGGGGGGGGGGHHHHHHHGDCGGGGGFGGHHHHHHHHGGGFGGGAE<GHHGHHHHFGGGHHGHC
+@1373661/1
+GTCTTATCCAGCGTGATTTTCCAGCCCTTACAACAGTGGTCGCGACAGGCCGAGCCAGAACAGGAAAAGCGGGTGACAAAGGCAGGTTCAGTGACGGTGATTTCTTTCATTACACAGGCTCCGGAATTAAAAAAGGCAGCTTTCGCTGC
++
+BAABBFFF5FFFGEFFGGGGGGHHHGGHHHHHHHHHHHHHHGGGGGGGGGGGGGGGHHHHHGGHFHHHHHGGGGGHHHHHHHHGGGGHHHHHHHHGGDHEHHGHHHHHHHHGHHGHHHGHHGGGGGGHHHHHHGGGHHFGHHHFGGGGG
+@66932/1
+GCTGAACGCGACCCTACTAACAACTGCGCCATCTCGCGCAGTGGTCGTCGTGCGTGTGGTGGTGGTCGTCGGCAATGCGCCGTAGGGTCCGGAACACACACGATTCCAAAACCCCGCCGGCGCAAACCGGGCGGGGTTTTTTGTTTAAGA
++
+CCCCCFFFBBCCGGGGGGFGGGHHHHHGGGCGHHHGGGGGGGHHBGGGGGGGGGGGGHGHGG?FGGHGGGGGGGGHHHGGGGGGGGGHHHGGGGGHHHGGGGGGHHHHHHHHGGGGGGGGGGGGGGGGGGGGGFFF@DFFFFFFFFFFFF
+@607748/1
+GTCCTGTACCGGCGGCTGGCTGGCGAAAGCCATTACCGACATCGCCGGAAGTTCCGCCTGGTTTGAACGCGGCTTTGTCACCTATAGTAATGAAGCCAAAGCGCAGATGATTGGCGTGCGTGAAGAGACTCTGGCGCAGCATGGCGCGGT
++
+BBCCCFFFFFCCGGGGGGGGFFGGGGGGGGHHGHHHHGGGFGHEGGGGGGGFGGHGGGGFHEHHCGGGHGEGG@DHHHHGHHHHHGHFHGHHHHHHHEFHHGGGGGDHHEHHFHHGGGGGEGDGHGHHHHHHHHHGGGGGGGGGEGGGGG
+@714684/1
+GGGATATTCAGGCGATAAACTACTTCGTGGCGCAGAAATACACCGAAGCGTTACAGCAAATCGGCTCGGCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGATGGGCGCTATCGCCGGGATCAGCGAGCTGGTTAA
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHGGFGGGGGGGHHHGHHGHGGGGGGGGGGHHHHHHHHGGGGGGGGGGGGGHHHHHGGHHGHHHHHHHHHHHHGGGGGHHHHHHHGGHHGHHHHHHHHGGCGGHGGGFGGGDGHHHFCDGGHHGHHH
+@1411044/2
+CGCCATTCACTTCGCCAATCGCGGGTTGCAGGTTATGCATATCGCTTTCCATTTTGCGGTAGACCGGGTCTTTAGCGCAGTTTTTTCGCCCGCCGTCCTGCCAGCACTGGCGCTGATGACCGAATTGCCAGGCGGGGACAACGTGCTCCCA
++
+CBBBBBFFFFFFGGGGGGGGCGGGGGGGHHGCFHHGHHFHHHHGGFFFEGHHFGFHHGGGGGHHHGGGAFFFGGFHGGCGGHHHGGHCFGGCFGGGGGGHGGFHGFHFGHHGGGGGFHHHHGG?EH0DGFHGGGCGGAD.9A=.AE.BFF/
+@748825/2
+GAAATACACCGAAGCGTTACAGCAAATCGGCTCGGCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGATGGGCGCTATCGCCGGGATCAGCGAGCTGGTTAAGGACAGCGCCAGCGAACGGAAAAAAGCATGATAG
++
+BBBCBFFFFFCCGGGGGGGGGGHHHHHHGGGGGGGGGGGGGHHHHHHHHHGHHFHHGHHGHGHGGGGGGHHHHGHGEHHHHHDGFHHHGGGGGHGGGGGGGGGHHHGGGGGHHFGGHHHHHBGHCFGDGGGGGGGGGGGHGGDFFFGGGGE
+@347960/2
+GAAATGGTATAACCGCGATCTTCAGCCCATTTCAGATAAGCGCCAGCGGATTCAAACGACTCATGGACAACAAAATGAACTCGCACGTTATTTTCTCCTGTTAGCGATTTAGCGCCTGATGGATATCAGCCGCCAGCGTGTTGATCTCG
++
+BBBBBFFFBFFFFGGGGGGGGFHHHHHGGGFGFHHHGHHHHGGCGCEEGGCGHHEHGGGGGGHHHBCGGHHHHFHFFHHHHHGGGGGHH2GHHHHHHHHHHHHGEEGEHFFFHGGGGGEGFGH2FHHHHGHGGGGGGFADCGHFHHGHH
+@830119/1
+GACTTAGTGAGAAGTGTTCATGGTGTCCCCTGCAGGAATCGAACCTGCAACTAGCCCTTAGGAGGGGCTCGTTATATCCATTTAACTAAGGGGACAACGCGGCGCCAGTATAGCGTTTTTTATTCGCCGGAGTAAGTGTAGCGCCGCCTGA
++
+BBCCCFFFFFFFGGGGGGGGGGHHHHHHHHHGHGHHGHHHHHHHGHHHHHHHHHHHHHHHHHHHGGGGGHGGGHHHHHHHHHHHHHHHHHHHGGGGHHGGGGGGGGGGHHHHHHGGGGGGGGHHHHGGGGGFGHHHHHHHHHGGGGGGGGF
+@770705/1
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATA
++
+CABCCFFFFFFDGGGGGGGGGGHHGGGGGGGGHGGGGGHHHHHHHHHHHHGHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGGHHHHHHHHGGGGGGGFDEHHHHHHHGGGGGGGGGGGHHHHHHHGHGGGHGHH:
+@770705/2
+ATATTCAGGCGATAAACTACTTCGTGGCGCAGAAATACACCGAAGCGTTACAGCAAATCGGCTCGGCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGATGGGCGCTATCGCCGGGATCAGCGAGCTGGTTAAGGA
++
+DDCCCFFFFFBDGGGGGGGGGGHGHGGGGGGGGHHHHHHHHGGGGGGGGGGHHHHHHHHGGGGGGGGGGGGGHHHGGHHHHGGHHHHHHHHHHHGGGGGHHHHHHHGGFGHHHHHHHHHGGGGGHGGGGGGGGGHGGGGGGGHHHHHHHH0
+@660070/2
+CAAACCAGGATCATGACGCGCCGCTATTGCAGCAGTATTTCTCCTGAGGATTTTCGCCCGGTGGCGGCTACGCCTTACCGGGCCTACAGTAAGCCGGATAAGCAAAGCGCATCCGGCAAATAAATCAACGAAAACTCACCTTTTCACCCG
++
+CCCCCCCCCAFFGGGGGGGGGGGGGGGFHHHHHHHHHHHHHHHHHGHHGCGHHHHGGGGGGFGGHEGGGGFGGGHGHHHGGGGGGHFHHHHHHHHGGGGGHHGHHHHHGGGGGHGGGGGHGGHHGHHGGGGGDGGHHHHHHHGHHHHGHG
+@1308542/2
+TACTTGTACTCTCCCGGATTGGTCATGGTCGGTCGTCGTGGTAACGAGATCTTCAATTCTGCTGGCCGTGTCGCCGTAAAAATATAAAGCGAAATCTGTGCCAACTTTCACATTGCCCCCAAAAGGCGTTATCATGCGCACCATCGTGCAA
++
+BCCCCFFFFFFFGFGFGECFGGFGHHHHHHGGGGGEFFEGGEGHHGGGEFHHHHHHHHHHHHHHHGHGGGHGGHCEEGGHHGHHHHHHHHGGCGHGHHHHHGHFFGHHHHHHHHGHHHGGGGGEF?EFDDGHEH1GFAEFGGHHHGHHGEF
+@659928/2
+CACCCGCCCCTGATCGTCTTTTAACGTATACGGTAAGCGACAGGCTTGCGAACAGTCGCCCCGATTGGCGCTGCGCCCGGTTTGCGCATGAGAGATATAACACTGCCCAGAATAAGCGACACACAGCGCGCCATGAATGAAGAACTCAAT
++
+A?3A>?D22>AABFGFGGGGGFFHBEFGFHGFDAFEHBAEA?EGGGEEEEEE0@35F?EGD?EEGCFGG/?ECEGGGEECGG/?GC//AAFCD1FFHHFGE11F11FG1GEGHHHFECDGCCHGCFE@C--;..=CCCCCFFC//9CFF0
+@136232/1
+TGTCAGTCGCCCCTGGCGACGAACAAAACTACGAATACGGCGCAGCGGGCGACCGTTTTCATCAAATTCCGGTGAAATGACGTCGTTTTTCATAAAAGTGTAGTCTGCTGTGTTTGAGTTCTGAAAACGGGCATTATCCAAAGTTAGTTG
++
+CBBCCFFFCCCCFGGGGGGGGGGGGHHFFHFHGGHHGHHGGGGGGGGGGGGGGGGEGGGHHHHHHHHHGHHFGGGHHHHHHGGGGGGGGGHHHHHHHHHHHHHGHHHGHHHHHHHHHGFGHHHHHHGHGGGGGHHGHHGHHHFCGFHFHH
+@168484/2
+ATCCTGCTGCTGGCAGCCGGACTTTGGGGACTTTTTGCGCCGCCGTCGAAAAGTGCGCTGCGGGAAATTCACTGTCTGCGGGGAACGCCCCGCCGCTGGGGACTGTTTGGGGAGAATAATCAGGAGCAGATTAACAATATTTCGCTGGGCA
++
+ABBABFFFFFFFGGGGGGGGGGGHHHHGGGGHHHHHGHGGGGGGGGGGCFGGGHHGGGGGGGGGGFHHGHGHHHHHHHFFEGGGFGGGGGGGGGGGCGGGGEFHHHHHHGGFGGGGGGGBFGGGFGGGGGGGGGGGGGGGFGFGGGFFFFB
+@456443/1
+GAATGAACGTTAGCGTCTGCGGCTGGCGCGATGATGGCGCGTTGTCGTAATGCCACAACGCCTGATGCTGCGCATCTGGGGCGCTTTGCTTCTCGCCTTCAGCCTGAATCAGCATCTTATGCGCAAAAAGCCCTTTGCCCTCAAAGACCCG
++
+>>>AAFFFFBFFEGGAEEAF?2EEEGGGGGCEGHHHGH0EEEGCEGFFHHGHHHHGHHGGCGHGGFHBH4GGGEGGHHGEEG@DCGEHHHGGFH/FCGACFFHHHF0GHGHDHHHHGHFGGFGGCCC/CAGCGHF0FCGFFEHHHB//;C@
+@869121/2
+GATGTACCAGAATCATCGCTATCATGCTTTTTTCCGTTCGCTGGCGCTGTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTG
++
+AAABCFFFFFFBGGGGGGGGGGHHHHHHHHHHGHHGGHHGGGGGGGGGGGHHHHHHHGHHGHGGGGEFHHFFGGGGEFEEHGGGGGHHHHHHHHGHHGGGHHHHFHGGGGGHHHHFHHHHGHHHHHGHHGHGHBGGGGGGGGGGGGH
+@1327424/1
+ATACGCATCAATACGCTTAAAATATCCGTGGCTGATTTCCTTGCCCTAATCGCGCCCTACGGCTGGTCGCTCACGCCAATTCCGTGGTGTCATGAAGGGTTCTGGATCGAACGCGATGATGAAGAGGCATTGCCGCTTGGCAGTACCG
++
+CCCCCCABDFFFGGGGGGGGGGHHHHHGFFGGHGHHHGHHHHHHGHHHHHHGGGGGGGHHCEGGGGGG?EEHGHHHGGGHHHHHCEGGFHHGHGGHHHGAFFHGHHHHGEHHGFGCGAGFHEFHHHHGGHGHHGFGGGGGGGDGGHHG
+@437741/1
+GGTAATACTGTTGAGAATGTCGCGGATCTGGTCGCGATCCTCTCCCGTGAACGTCAGGCTCAGAACGCCGGTATCTTTGCCGGTTTCCGTTACGGTGAGGTTATTTTGCAGGTTATTAATCATGCCAAGCGTTGAGAATTTACTCACCGTA
++
+BBABAFFFFFFFGGGGGFGGGGAEGGGGHHFHGEEGGGDGHHHHFHGHGGEHHHGGGHHHHHGHHHGGCFG>EGHHHHHHFGGEGGHHGHFGGGGBGFHGFGHHHHHHHHHHHHHHHHHHHHGGHHHFHGCGGGHHFGGHGFHHHEHHGHH
+@959549/2
+CAGATGGTGTCTGAAGCCATCGCCGCCGGGGATATTCAGGCGATAAACTACTTCGTGGCGCAGAAATACACCGAAGCGTTACAGCAAATCGGCTCGGCGAATAACAGCAAAGGGATCATGATGCCGCTGGATGCCAGCAGTCTGATGGGCG
++
+AABBBFFFFAFFGGG4BGGGFGFFGGGEGECFGHGHFHHHHGGGGGHFGGBGHHFHGGGCEGFGHHGHGFHEGGEGGGGGGFHHHHHGFEGFGGGGGA?C</FGBGHEFHF00>CFFGEBFFGFHCC--?;BGHE00.;GHHHG0C0:C.-
+@431361/2
+CTTTAATACGTACTTCACGCTCGGCCTCAACTTTCCTGGACCGTACTGCTTGCTCACGTTCGATCTCCGTCTCCTGGATCTGCCGCTCAGCAAGAATGCGCGTCTGTTCTGCTTCACGATGGCGCTCGGCCTCAAAAGCGGCAATTTTAG
++
+BBBBBFFFFBFFGGGGGGGGGGEEFGGHHHHHHHHHHGHGHHGGHGHHHHGHHHHHHHGHHEEHHHHHGHHHHHHHHHHHHHHHGGGGGHHHHHFFHHHGGGGGGGHHHHHHHHHGHHGHGGGCFGGG?FG?FGFGHGHGGG?-GHHHHF
+@974102/2
+AAATCGGCTCGGCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGATGGGCGCTATCGCCGGGATCAGCGAGCTGGTTAAGGACAGCGCCAGCGAACGGAAAAAAGCATGATAGCGATGATTCTGGTACATCCGCAT
++
+AABABBBB2>ADGEGGGGGGFGHFFHHFGFHHFFFBEDFGGCEGFHHHHHHEGGHHHHFHFGFAF/EEFGHGGDGGGCFGFBBFGGCFHFBGHHDGFGHFGCDG/@FD?D/AACF-FHGGHHEFFBGBB@@GDFHHEFH0GFGHFHFGG?D
+@978516/2
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATA
++
+A>AABFFFFFFCGGGGGGGGGGGHGGGGGGGGHGGGGGHHGHHHHHHGHHGFHHHHGHGGGGGHHHGHHHHHHHHHHHHGHGHHHHFGGGGGGGGGGGHHHHHHHHGGGGGGGFGEGHHHHHHHGGGGGGGFDCGHHHHHHGHGGGHBHG0
+@608372/2
+TATTACGCCAGATAATCTTTTGCATCGGATTCAGGCGGACATCCTTGAACTGGAAAGCCATGCGGTGGCGGGCGTAAATCTTGAGGAGTATTCGCGCAGCGACAATAAGCGTCTGCTCGATCCCGAGGATAACAGCCTCTCTTTTCACGTT
++
+CCCCCFCCDCCFGGGGGGGGGGHHHHGGGGGHHHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHGGGGGHGGGGGEGGHHHHHHFHHGGGHHHHHGGGGGGGGGGGHHHHHGGGCFHHHGGHHGHGGGGGFHHHHHGGGGGGGGGGGGGGGG
+@987236/2
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATA
++
+CCCCCFFFFFFCGGGGGGGGGGFHGGGGGGGGHGGGGGHGHHHHHHBGHGFHHHHHHGGGGGGHHHHHHHHHGHHHHHHFHGHHHGCGGGFGGGGGGGFHHGHHGHGGGGGGGGGGHHHHHHHHCCFFGG?EDEGHHHHHHHEGDFE/GC;
+@1030980/2
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGACTA
++
+A>ABBFFBDBF4GFGGGGGEGGHGGGGGGEEDG?GCGGHHFFDFFFBGBGGCGE3B3FE0EEFHHGHHFE4G3FGHHHHGGBGHFFGGGC?@C/<DGFHGGFGHGF//BFGGAFD/?FGHHFG1@?E.ED->C<G<00DDGDAFGGHF/C:
+@1044240/1
+GGGATATTCAGGCGATAAACTACTTCGTGGCGCAGAAATACACCGAAGCGTTACAGCAAATCGGCTCGGCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGATGGGCGCTATCGCCGGGATCAGCGAGCTGGTTAA
++
+CCCCCFFFFFFFGFEGGGGGGGHHGHGHGGGGGGGCHGHHHHHHGGGGGGGGGGHHHHHHHHGGGGGGGGGGGGGHHHHHHEHGFGFHHHGHGHFHHGGGGGFGHHHHHGHHHHHHHHHHHECGGGGGGGGGGGFGGHHHGGGGGHHFGHH
+@1099320/1
+TCGTGATGGAACGGGATCACCACTTTGGTATTCAGCGATTCCGCCATGCGTAAAATATCCGCGCTGGTCATTTTGTCCGTAATACCGCGCGGGTTTTCACCGTAAGAACCGAGCGCGACATCAATTTGATGTTCGTTGCCGTGTTTCGCGT
++
+AAAAA1FFF1DFG?1EA1GCFEFF1B1GFE22DGFHGEGEHBAEEEAEHG/EAGH21GAFGGGGE?E>BFBGH2FBEGEHEFGEDGEGGCEG?<//FH22F/FACCGFHHG?//<CCG@CCFDGD0DHBGFHFFGGGHFFCAA.;;GCGG9
+@1062285/1
+ATGTACCAGAATCATCGTTATCATGCTTTTTTCCGTTCGCTGGCGCTGTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGAA
++
+A1AA1DBBFFF1BGGDG1FGGGHH11DEDDHAGGEHC0E0AE??/EEE/BFGBFF1GE/EBGGGFEEGFH0>>>ECEE/@/>>/EC>1FDF1FCHHBE0BGB1<C@/B?/0G2BFB1?01<1?<?1?FGFHHB<.ACCGCC-AC.0:;00:
+@392513/2
+GGGCTATTACGTAAAAACGCCCATGATGCGCTGGAAGCCGATCAAGAAGCTATCCGACTGATCCTCAGTAACGATCCGCAGGCCACCCCGCTCGCTTATCAAAGAATGCGGGTCAACCAGGCGCATAACACGTTATTCAACTCGTTAAAT
++
+3?AABFFFFFBFGGGGGGGGGGGHHHHHHGGGGGCHHHHGGGGGHHGHHHHHHHHGGGGGHHHHHHHHHHHHGGHHGGGGEEFEHGHEGGGGGGGGHGHHHHHHHGHHHGGGGGGGHGGHGHGGGGGHHHHFGC/GHHHGHHHGGEEEFF
+@103405/2
+CTCGGTGGCCCGTTCCGCTATATGGATGCTCTCGGGCCGGGTGAAATGGTGGCGACATTACAGCGCCTGGCCGCACTTTACGGTCCTCGTTACGCGCCTTGTGAACAATTAGTGCGCATGGCGGAGCGCAGGGAGCATTTCTGGACGAATG
++
+CCCCCAABFFCCEGGGGGGGGGHHHHGHHHHHHGGGGGGGGFEHHHHHHHHGHGGGGGGHHHHHGGGGHHHHGGGGGHHHHGGHGGHHGHGHGGGGGGGGHHHHHHHHHHHHHHHGGGGGHHGGGGGGGGGGGGGGGGGGGGGEFGGGGGG
+@1078346/2
+ACGCAGATGGTGTCTGAAGCCATCGCCGCCGGGGATATTCAGGCGATAAACTACTTCGTGGCGCAGAAATACACCGAAGCGTTACAGCAAATCGGCTCGGCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGATGG
++
+AABBADDFFFFFFGGGGBGGGGHHGGGECEGGGGGGHHHHHBGHFFGGGFGHHHFHHGGFEEGEGGGHGHHHHHHGGGGGGEEFEHGFHHFGHDDCGDCC/CCGGEFHGHFCHHFHHGGDGHBBGDGH?FCGC:CGB0:GFFHHHHFBC00
+@332857/1
+GTTCGGCAAAACGCGCCTGGTAAACTTCCTGCTCCGCATTAAGCACGTCGAGCAGCGGGCGGGAACCGAGGTCAAGGTATTGCTGCTGATACAGTTCGCGCGTACGTTCGCTAAGCTGCTGTTGCCGACGAAGGATTTGTAACGCGCTGG
++
+CCCCCCCBCFFFGGGGGGGGGGHHHHHHHHHHHHHGGGGGHHHHHHGHHGGGGGHGGGGGGGGGGFGGGGGGHHHHHHHHHHHHHEHHHHFHHHDGHGGGGGGGFGGHHGGGGGHHHHHHHHGGGGGGGGGGGGGGGGGGFGGFFFFFFF
+@1101574/1
+GATGGTGTCTGAAGCCATCGCCGCCGGGGATATTCAGGCGATAAACTACTTCGTGGCGCAGAAATACACCGAAGCGTTACAGCAAATCGGCTCGGCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGATGGGCG
++
+BBBBBDDAFFFFGFGGGGGGGEFGGGGGGCGFFHHFGFHGGGGGHGHHFHHHGHGGGGCEGGHGHGGHFHGGGGGGGGGGGGHHEHHHGGGGGGGGCADGGBHHHHHHGHFGFFHHHFFGFFHGGFG?.DGCGFFGFHHFGHGHHHHAD
+@377227/2
+ACTCAGGATCATAGGGCGGCTCAACCACCAGCAGCTGATCGAACCCTACGCCCAGGTGTCTGTCGGATAGCCGACGAATCAGTTCCGGCGAAAAAAAGACATTCTGCGTTACCGCGTCGACGACCATAAAATCGTTGCCAAGGCCATGCAT
++
+BBBBBB44FF@FCGGGGGGGGGHHHHGGGHHHHHHHHHHHGGHHGGHHGGGGGGHFFFGHFFHHGGGGGHHHGCGGCEHGHHHHHHGGGC?CG?0<AGGHHHHHHFHGGGGGFFGGGGGGGC-@BGGEE0FFEBEEFGBFFGEGGGGGEBF
+@257080/1
+ATGGTAGATATGTCGATGTCGATGTTCTCCTACGGGATGTTAGAAGTTAACCGTCTGGCGGGCCGCGAACTGCCGGTGGACGGCGGTTTCGACGATAACGGTCAGTTGACCAAAGAACCGGGCGTGATCGAGAAAAATCGCCGCATTTTA
++
+?A3AABFFFFFFFGGGGGGGGCGHHHHGHHGHGGGCAEGHHHHHFFGHHGFH?FGHGFHGCGFG/EE?@EHGFHGG>EGHHC?DCGG?DBAFGGFGGGHGGGGGHHHHEGH/:GFHHG.@DGGGGG.CC.AEFGEFFEBDFFCB;DFFFF
+@64824/2
+ACCACCGCCAGGTTGGTGGTCTGCGTTTGCGCAATACCGATGAAGCTATTCATAATGCCCCATACGGTGCCAAACAACCCGACGAAGGGGGAAATGGCGCCGATCGTCGCCAGATAACCGTTGCCTCGTCCCATGTAGCGGCCAACCG
++
+ABABBBBBBBBBFFGGFGGGGFHHGEGEEHGGGGGHHHGGGGHHHGFHHFHHHHHHHHGHGGHHHHCFEGHHHHHHEHEGGGGG/@FGGGGGDHHHHHCDGGGGGGHHGGGGGHHHHHGGGG?DFHHGHGGCHHHFGFHGGGGGGGGG
+@1155741/1
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATA
++
+AAAABFFFFFFBCGGGGCGGGGGHAEFGFGAFGGGGGGHFHHFHEEG5GHGHHHCG3GFGGGEGHHGHHGHHHHHHHHHGFGFDGCGGGGEG?/<CDGHHHHHHHHGGGFGGGFCCFHDFFHHHGGGGGGGGGEFHHHHHHHHGGGHEBFB
+@1157521/2
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATA
++
+BAABBFFFFFFCGGGGGGGGGGHHGGGGGEGGHGGGFGHHHHHGHHGHHHGHHHGHHHGGGGGHHHHGHHHHHHHHHHHHHHHHHHGGGGGGGGGGGGHHHHHHHHGGDGGGGFFGHHHHHHGHGGCEGGCDE<GGGHHHHHHCFGHHGHB
+@784805/1
+CGTTGGCCCACCTCAGAACCTGATCTTCATCATCAAAGACGGTTATACTGACCACCGGGCCGAAGACCTCGCGTTGCACGATGGCATCTTCCTGTTTTGCGTCTGCCAGCAACGTCGGAGCGAAATAGTAACCTTTACCTTCCGTTTGA
++
+CCCCBFFFCBCCGGGGGGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHGGGGGGGGGGGHHHHGGGEGGGHHGGHGGHHHHHHHHHHHHHHHHGGGGGHHHHGHHHGHHGGGGGGGGGHHHGGHHHHHHHHHHHHHGHHHGH
+@1298580/1
+TGCCTTGCTGGAGCAACGCCAGAGTGAAATGCGCGCCGCGCGATCGTCATCTAACTGTTGTACAGATACCGCGCCACGCTGCGACAGCGAACGGGAACGCACGTGACGTTTAGAGACGGAGTCCAGCTCAGCTTCCCGCTGTTTGACGAC
++
+BBBBBFFF5DFFGGGGGEGGGCH4FGHHHGHGFEAEGGGGGGCGGGHHHHHHFHHHGHHGFGBHHHGHHHGGGGGDGGGGDGGEGGGHGGGGGGGGGFFGGGGHHEGGFFHGBGFHHGGGG?<GFEHHFGHHBGHHHCCCG9BFGGGGEG
+@462887/1
+ATCGAGAATATGCGGATGCTCAACCACTTTTTCGCGCATATTGTAATAACTGTCTTCAATCACCAGTTCGATATAGCAGTCCGGATGCAGCCCCTTACCGACTTTTTTGGCAATCTCCATCATTTTGCGTTTACGCGCTTCAAACTGCTTA
++
+3ABBBBABFFFFFEGGGGBGGGHHHGGHCGFHC?EGGGCAGHHFHHHHHHHFHHHHGGHGBHHHHHHHHGEHHGHHHHHDGFFGGGGHHFFHEGEHGHHGDGGGGHHE?EFF1CGHHHHFHGHFHH2DCGGGHHGC/CCDDHHFBG<GHHG
+@706754/2
+TTATCAGGCCTACATAAGCACTCGGCTGGTAGGCCTGATAAGCGCAGCGCCATCAGACATTGATTGGCAATTAAGCCTGTTTAGCAGCTTCTGCTGCTTTCACGATCACCGCGAAGGCGTCAGCTTTCAGAGAAGCGCCGCCTACCAGTG
++
+BBBBAFFFFBFFGGGGGGFGGGHGGGGGGGHHGHHHGHHHHHHGGGGGGGGGGGHHGHHHHFHHHHHHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHGHHGGGGGGGHGGFGGGHGHHHHFHHHHHGGGGGGGCFHHHFH
+@721164/2
+GAAGATATTCTCCGCACCCAGTTTGAACAGGTTGTTATCACCCTCCTCAAAGCTGTCTTTCAGATGGTCGCGTACTTTCTCTTCATTAGTATTGTGGCGCTGTGCGGCAACCAGACGTTCGGTCAGGCTGGTGTACAGGCCGCTATCCAGG
++
+AAABA5BDFFFFGGGGGGGGGGHHHHHGHHDDGHGHHHGHFHGHHGGHHGHHGHHGHHHDHGGHHHHHHGGGGGGHGHHHGHHHFBHHGGGHHHGGFGGGGGGHHGGGGGHHGEHECGGHGGGGGHHHHHGGHHHFGHGGGGGGGGHHHGG
+@772019/2
+ATGGTGCGAATACCGGTAATGCGTCGCAACAAGACGTAACAAATATTCAGCGCCAGCGCGAGCAACACCGCGTAGCCTACCCAACTATACGCATCACCCATCCGCTCGATCGTTGCCATCATCGAAGCATAGGTATCGGAAATCGCGCCGT
++
+AAAAAFFDADBBGGGGGGEGGGGGGGGGGGFDHGGFFHHGHHHHHGHHHHGFGGGCGGGGCGG/GHFEFEF@E/EGHFHHFHHHGHHHHHHGGGGHHCGGHFHGGDCGC0FC<GGFFFGFFHHF/GGGFHGHHD0DGD@EACHFGGCCCG;
+@407936/2
+GTTCTTTGCTGGTCAAATCAACGGTACTACCGGCTATGAAGAGGCTGCGGCGCAGGGCTTGCTCGCTGGTCTGAATGCCGCGCGTCTTTCCGCCGACAAAGAGGGCTGGGCGCCTGCGCGTTCTCAGGCTTATCTCGGCGTGCTGGTGGA
++
+BAABADDBFFFFGGGFGGGGGGGFFEGDGAB2AEEGBHHDHHHHGHHGGGGGG0EECECHGGHHGGGGGCGHHHHHGHHGGGGGGGGGHFHGCGGGFF?0GGHGGGGDADF?CCGHHGGGGCEAHHE/CHFGFFFGGGGGGADEFGCF?E
+@326892/1
+GTACATCAGGCGTTCAAGGTTCAACGTACCGATGCTGTCGAGATTGATCGGGTTCGCCACCCCACCGACCGCCAGGTTCTGGATATGCGGCGATTTACCGCCCAGCAACGCCACCACGCGGTTAGCGTCACGCTGACATTCCAGCGCCTG
++
+AAABBFFFFFFCGGGGGGGGGGHHHGHHHGGGGGGHHHHGHGHGHHHHHGGGHGHGGGGGHGGGGGGGGGGGGGGH?GHHHHHHHGHHGGGGGGHGHHHGGGGGHHHHHGGGGGHHHGGGGGGGHHGGGGGGHGGFGGGGGGGGGAFGGG
+@240457/1
+GCTTTGGGTACAACCAAAAGTGGATGGCGTAGCGGTAACACTGGTTTATCAAAACGGTAAACTGGCCAGGGCTATCAGCCGGGGTAACGGACTACAAGGCGAGGACTGGACGCCAAAAATTCGCCTGATCCCCTCTATACCGCAGTCAACA
++
+BBBCCFFCBFFFGGGGGGGGGGFHHHGHGGGGGGGGGGHHHHHHHHHHHHHHHHHGGGHGHHHHGHHHHHGGHHHHHHHHGGGGGGHHGGGGGHHHHGFHGGGGGHHHHHHGGGGGFHGGHHGGGGHHHHHHGHGHHHHHHGGGGGHGFHC
+@505277/1
+GTCCATTCTCGCCGGTCATCTGGAAAGATAAGGTTTATCCGATCGCACAATGTAATAACGCCTATATTTTCCCCGGCATCGGTCTGGGGGTTATCGCTTCCGGCGCATCGCGCATTACTGATGAAATGCTGATGTCAGCCAGTGAGACG
++
+ABAAAFFFFFA?2EEGGGGGGGFHHFCFGHHHGGHHHF5A2EBEEGGC0GHFGG5EGHH?EGHGHHHEEGGB3B@C@>>BEEGAEHHFCCEEEFDHGHHGFFCCCGGGGDD??-CFFGHH1DGHHGBD0=DG0GHFHGBG.GC0CCGHG
+@1365799/1
+GCGTAGAAGAGAGCGGCTGGAACCATGTCACCAAAGTGATGATGGTCGCCATCGTTTTGCTGTTTGTGTTGAGCGGCTTCTTCCGCGGCTTCGACATGAAAATGATCGAGTCTTTCAACATGACGGTACCGAACTGGCTTGAACTGATCCA
++
+CCCBCCDFFFFFGGGGGGGGGGHGHHGHHGGHHHHHHHHGHHHHHHFGGGGGHGHHGGHHGHHHHHHHHHHHHHGGGGGHHGHHGGGGGGGHGHGGGHHHHHHHHHHGGGHHHHHHHHHHHHHHGGFHGHGGGGHHHHHHGHHHHHGHHHH
+@1414008/2
+GTCCTTAACCAGCTCGCTGATCCCGGCGATAGCGCCCATCAGACTGCTGGCATCCAGCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATA
++
+AABBBFFFFFFAGGGGGGGEGGHHGGGGCGGGHGGGGGHHHHHFHFFHHHGHHHHHGHFGGGGHHHFHHHHHHHGFHHHGGFHFHGGGGGGGGFCGFGHHHH2GHHGGGGGGGFGG1GGFFHDFDGCCEFC.AC0DGHHHGHGCGGHHHHC
+@935863/1
+GTGCCGTGGTGCTGACCGGCGACGTTTCTGCCGTCGAGTATGCCCTCAAGCAGGTAACGCGCACGCTGGGCGAAATGATGCAGTTCACCACTTGCTCGATCACCCGGACGTAAAGTCATGAAGCGTTTGATGTTTATCGGCCCCAGCCAGT
++
+A>AACCBCDCCFGGGGGGGGGGGGGGHHHHHHGGGGGGHHHHGHHHHHHHHHHHHHHHGGGGGGGGGGGGHGGGGHHHHHGHHHHHHHHHHHHHHHHGGHHGHHHGGGGGGHHHHHHHHHHHHHGGGGGHHHHHHHHHHGGGGGGGGGGG:
+@1505236/2
+GTAAAAACAGGATCTGCTGCGAGGCCAGACGTCGCAATAATACTTTTTGCGCCACGCCATAGCTCACCCACACCATCGCCGCGCCTACGCCAAAAATAACGCCCCAGGTGTAGTCGGTCAGTCGGGTAAAAATCTCGATCAGACTGGTGTT
++
+CCCCCFFCCFCFGGGFGGGGGGGGGGHHHGGGGGGGGGHHHHHHHHHHGHGGGGGGGGGGHHHHHHHHHGGGGGHHHGGGGGGGGGGHGGGGGHHHHHHHGGGGGGGGHHHGH=GGGGGGHHHGGGGGHHHHHHGHHHHHGGHGHHHHFGG
+@633025/2
+CTGTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGTTCGTCGGTTGTGAACTGGTCACGCCAATGGCGCCGGAAATTAAAAAAG
++
+CCCBBFFFFFCCGGGGGGGGGGHHHHHHGGEGGGGHGGHGGGGGGGGGGGHHHHHHGHHHHHHHHHHHHHHHHHHHGHHHHHHHHEHHHHHHGEGGHHHHHHHHHGGGGGCGFDGHFGFGHHHHHGGGGGHHHHFGGGGGGGHHFFFHHD.
+@873976/2
+CTCCAGAAGATGAAGCCCGTGATGCGGCGCATCATATTTATGACCAGGGCAAGCAGTCGCCGCTGCTGTTGATCCCACGCAGCACGCTTGGCGATCGCGTGGCGAACGCCTTCACCCAAGAGTGGCAAAAACTGGGCGGCGGCATCGTGTT
++
+BCCBBFFFFFFFGGGGGGGGGGGHHGGGGGGGGHHHHHHHHHHHHHHGGGGGFHHHHHGGGGGGGGHHHHHHHHHHHHGGGGGHHGGGGGGHGGGGGGGDDGGGCGGGGGHFHFHHGFGEFFDGGGEEHHHGHGFEHGAGGGF;AFD;AAF
+@162776/1
+GGATAATATGGTCTTGCGCGATGGTACGAATCGTCGTGTCTTTACTGGCGAGATATTTTTTAACCGTCGTCTTATCCAGCGTGATTTTCCAGCCCTTACAACAGTGGTCGCGACAGGCCGAGCCAGAACAGGAAAAGCGGGTGACAAAGG
++
+AA3AAFFFFFFFGGGFGGGGEGGGGHHGGHHGGGGGGGHHHHHHHHHHGCGGGFHHHGHHGHHHHGGGGGGHGHHHHGHHGAFDHGHHGHGHHGGHFEGHHGHEFDG4EEGGGGGGGGGGGGGGHHFFFFBGHHHECFGGGCCHHHHGHH
+@246642/2
+GGCTGGGCACCATGGGGTTTGGTCTGCCCGCGGCGATTGGCGCGGCGCTGGCGAATCCGGGCAACAAGGTGCTGTGTTTTTCCGGCGACGGTAGTTTGATGATGAATATTCAGGAGATGGCTACCGCCAGTGAAAACCAGTTGGATGTGAA
++
+CCCCCCCCFBCFGGGGGGGGGGHHHHHHHGGGGGGFGHGHHGGGGGGGGGGGGGGGGHGGGGGGHHHHHHHHHHHHGHHHFHGGGGGGGGGGHGHHHHHHHHHHHHHHHHGHGHGGEBFGEFGGGGGG?FFGGGGGGGGGFFGFFFFFFFF
+@585872/2
+GTTCACAACCGACGAACATAAACATCGCCATGCCAATATAACCAAACAGACCAGAAAGATTACTGACATCAAGCGGTGCGCCAAACCACCCGGAATGATGAGTGACCGGGGATAACAGGATCCCGCATAAACCGAAGATGGTCAGGGGAGT
++
+A1>A11@FAADDGGEAFEGGGCGH1GEFG/AGB11ACGHFDGBGFGGHFFHHFHFGHHEGEHHFHFEHFHHHFFFC//>@?EEGHHFHGAEGGEEACHEBGH21BD1>//</C0<BFFEF<FFGGCCAE11FFC?-<.00/<00//.-;@.
+@1050076/1
+GTTGTGCGCTTAAAGGCATGAATGTTCTTCCTTTCTCTTTCGTTTGGTTATTAGTATGCCACCTGGAAGTGTGATTGCAGTTGCAATAACGGCAATTTGCTTATTTTATGGCACGTTAAGCACGCTATTGATGAAAAAAGAGACACTCAGA
++
+>1>>11B1DDAAFBDBABFFGBGFHGFFHFBGFEHH2FEHFECGEACAFA1DDAB2F2BEGHHGHHF1CBGFFDFFHDGF1FGFFHFHBEEECGCG1GHFFFFHHHFGGEF/EGEEGGFFFEBE?E?EBEB>GHGFHFCAE0CFGC<<FGH
+@1530738/1
+GCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGATGGGCGCTATCGCCGGGATCAGCGAGCTGGTTAAGGACAGCGCCAGCGAACGGAAAAAAGCATGATAGCGATGATTCTGGTACATCCGCATATCTTCTGG
++
+BBBBBBBFFFFFGGGGFGGGGGHHHGHHHGGGGGHHHHHFHGHHHHHHGHHHHGGGGGGHEGGGFGGGGHBGGGGGGHHHHHHHHHHHGHGGGGGGGCGGGGGADHHGDHHHHGHHHHGGHGHHGGHHGHHGHHHHGGGGGHGHEHHHH
+@4228/1
+ACATGGGACGAGGCAACGGTTATCTGGCGACGATCGGCGCCATTTCCCCCTTCGTCGGGTTGTTTGGCACCGTATGGGGCATTATGAATAGCTTCATCGGTATTGCGCAAACGCAGACCACCAACCTGGCGGTGGTCGCTCCTGGTATTG
++
+BB@BBFBFFDBBGGGGGGGGGGHHHHFGGGGGGGHGGGGGCGGHHHHHFEGFHHHGCGGHGGGHHHGHHHGGHHHHHHGDGHGHHGHHGHHHHHHHHHHGGHGHHHGGGGGHGGGGGHGHHGHHGGHHHHGF-D?FHAGDFGGGFCBBFF
+@1553088/1
+AACTACTTCGTGGCGCAGAAATACACCGAAGCGTTACAGCAAATCGGCTCGGCGAATAACAGCAAAGTGATCATGATGCCGCTGGATGCCAGCAGTCTGATGGGCGCTATCGCCGGGATCAGCGAGCTGGTTAAGGACAGCGCCAGCGAA
++
+CCCCCFFFFCFAGGFGGGGGGGHHHHHGGGGGGGGGGHHHHHHHHGGGGGGGGGGGGGHHHHHHHHHEHHHHHHHHHHHGGGGGGGHHHHHHGHHHHHHHHHHHGGGGFGHGGGGGGGGGHHHGGGGGHHHFHFGGHHHGGGGGGGGGGG
+@280955/1
+GCGGCATCATGATCACTTTGCTGTTATTCGCCGAGCCGATTTGCTGTAACGCTTCGGTGTATTTCTGCGCCACGAAGTAGTTTATCGCCTGAATATCCCCGGCGGCGATGGCTTCAGACACCATCTGCGTAGCGCGGGCTTCCGCTTCGT
++
+AAA@BBBFFFFFGG5FFGGCFCDGHHGHHHDEG?G?AEEFDFDGHGGHHBEC?FGCDAEADGHH5F5EE?EAA>EEEFGBGFHFEHHGGCC23FB4B4?F?/EDGCCCCDC00>01FGFHFEA0/0DFGDDCG@C@?--:9/BF?C.E?/
+@418014/2
+GAATTACACACACCCGGTTTCGGCCTCCTGTCGGCTCCGTTTGAATTATTATCGACATAGCATGTCAGAAAAGTTATCTCTGCATCCTGTAAAGATAGATATCGCAGATTAATTAGTTTTCTGTTTCTCCCCTGAGTCTCAGACGCAGTAA
++
+BB?AAFFFFF?AE2EGEEAFGECE2A2AFGHFF?2FEFAG331F5FBFFHHHH1CEDFH5F55BEF5EHBG2BG5FGGD@F4@4BGEHFHG44F3FB33BGHHGGFAEHFE4F4434B444B4BDGBGBGH/0CFF11B?D2BB///>/@2
+@5584/2
+CGCAAGGGCTGATGCTGCTTTGGCAGCCGCTTATCGACACGCTTTAACCGGGCACATGTCCATGACAGGAGTTGAGTATGGAGTTCAGTAATCCCTTCGATAATCCGCAGGGACAGTTTTACATCCTGCGAAATGCGCAGCGTCAATTCAG
++
+CBCCCCBCCFCFGGGGGGGGGGGHHGGHGGGGGHHHHEEGGGGGGHHHHGGGGGGHHHHHHHHHHGHHGGFFHHGHFHGHHHHHGHHHHHGHGHHHHHHHHHGHHHGGGGGGGGGGHFHHHHHHHHGHGGGGGHGHGGGGGGGGGGHHHHH
+@813645/2
+CAATAGAGCTGGTTACTACCGAATCCAGCAGAATATCGCGCAACTTACTCACATTAATTTCTCGATAAATGGCCGCCAGCGCCAGGCTATAGATTACCGCGATCGCAGAGGCCTCTGTTGGCGTAAATACGCCGCCGATAATGCCGCCGAT
++
+ABBCCFFFFFFFGGGGGGGGGGGGGHGHHHHHHFHHHGGGGGGGHHHHHHHHHHHHGHHHHHHGGHHGEHHHHGGGGGGGFGGGGHHHHGFHHHHHHGGFGGGGGGGGGHGGGHHHHHFHEHGGGGAGHHHGGGFGGGGGGFGHHCDGGC-
+@1340227/2
+GTTTTACTACTCCCCTGAGAGGCCGGAGGTGAAAGCGTTGTTCGATTGTTTGCCAACGTTGCCTGAGCTTTACCCCTGGCGCGATCGTGGACATATTGAATCACTGTGTGCGTCATGGTCGCTACCGGATAATGATGCGCTTACATGGCAA
++
+1A1>AFF33B1BCE?CCG1FGECEEEE0EE0AF1BBEAE/AFGGHEFCFGHHBGFHEAAFCEF1@GBEGFGB11BG///>>AE@GGE0B/>>FGGBBF2EFHHHGB>>FAG?FC?AF1BDCCCACFC?@E?GFHGGHFC.-<EHFGFBGC0
+@32716/1
+ATTCAGTGTTGTCCAGCGCGTATTAAGCCACTGCTGGCACGCGTCCTGCGATTGCGGTTCGCATACCACGTCCCAGCCTGCGGGAAGCGCACACGCCGCTGGCCAAAGGCTGAATTGACGCTGCGCATTTCGCAGGATGTAAAACTGTCG
++
+BABBBFFFDF?BGGFGGGEGGE23FHCH3EGFGHHHH?F3EFF0EFDFBEGHHGBDGEEFE@GGDHHHFGEGFGFFEEEHHGGCCGFHGFGGGGGGE@CGCCD0FF0FFEHGFHHGHBHDDDGGGGGGGE0CD.EC.CC/<CFGGFFFG.
+@43250/2
+GTCCCAGCCTGCGGGAAGCGCACACGCCGCTGGCCAAAGGCTGAATTGACGCTGCGCATTTCGCAGGATGTAAAACTGTCCCTGCGGATTATCGAAGGGATTACTGAACTCCATACTCAACTCCTGTCATGGACATGTGCCCGGTTAAAG
++
+BBBBBFFFBFFFGGGGGGGGGGCEHFGDGGGGGGHHHHGFGHHHBGHHHHFGGGGGGGGGHHGGGGFGEFGGHHHGGFFHEHHHHGGFGGHHHHHHGGGHHHHHHHFHHHHHHHHHHGHHGHHHHGFGEGHHHHFHHHGFHFGGDGGHHE
+@1015400/1
+GATAAAAGAGTGGGTGATATTCTCGTTGCTCATCGGCTTTGGCACGGTTGTTGCTCGCTGACGGTGCCAGGCAATACTGATTGAGAGGATTTGAATGACCAAAGAAATGCAAAATTTAGCTTTAGCCCCTGTTGGCAACCTGGAATCTTAT
++
+BABBAFDFAFFFCGEEGGGGFGGFEEFHEBGHGHHGFGGHHGHHHGGCFFEHHHGBE0AEGFGGEGGHHHHHHFHHFHHHHHHHFFHEGFHHGGHHHHFHHHHHFFFHHGHFHGHHHGBEGHHHHBGFGHCHHHEGGHHG2FA<GH2GGHH
+@816036/2
+GTACGTAGCTTCCCTAATATCTGCTATTTCGCGCTCTCTCCAGAAGATGAAGCCCGTGATGCGGCGCATCATATTTATGACCAGGGCAAGCAGTCGCCGCTGCTGTTGATCCCACGCAGCACGCTTGGCGATCGCGTGGCGAACGCCTTCA
++
+>>AAAFFFAFFFGGGGGGGGGGHHGHHFFHHGGGGGGHCHHHHHGHHGHFH5FHHEEDAGHHGFGGGGGGHHHHHHHHGFHH3GEGCGGGHGHHHGGEC?EGGHHFHFGHHHHHGGCDDGHGCGFGGGFFGGECGF@DGGGGDGGGGHG09
+@269460/2
+GCGTTAGCGTTTCCAGCGAATCAGCCTGATCGTCGAGCTGCTGCTGTTCTTCGAGCAGTGACTGATAAAGCTGCGGCAGCGCTTCCGGGCTGACGTGATGTTTTCGCGCCAGCGAAATTTGTTTAGCGATGCGCTGTTCAAGCTCAAACAG
++
+BCCBBCCFCCCCGGGGGGGGGGHHHHHHHHHGHHGFGGGHHHHHHHHHHHHHHHHGGHHHHHHHHHHHGGHHHHGGGGGGGGGGGHGGGGGGHHGFGGHHHHHHHGGGGGGGGGCDGHHHHHHHHHHGGHGGGGGGGHHHHHHGHHHHHHH
+@117798/1
+CGTCCTGCGATTGCGGTTCGCATACCCCGTCCCAGCCTGCGGGAAGCGCACACGCCTCTGGCCAAACGCTGAATTGACGCCGCGCATTTCGCAGGATGTAAAACTGTCCCTGCGGATTATCGAAGGGATTACTGAACTCCATACTCAACT
++
+>?>1AAFB1>>1FG?EAEEEGEE?EF1F0E/EE1BGF0FCE?EGAAEEC/EEC/EE0?1F1FF1/0////?/BFF1>>////<//</?22?//B/?1FGHHB1F11FGBG1<.@--@.0=DC.C.<AC:C0CG:C0;;0CFB:CF0;/:F
+@509837/2
+CCGTCATGTTGAAAGACTCGATCATTTTCATGTCGAAGCCGCGGAAGAAGCCGCTCAACACAAACAGCAAAACGATGGCGACCATCATCACTTTGGTGACATGGTTCCAGCCGCTCTCTTCTACGCCTTTACCGATCAAAATACCCAGCA
++
+BAABAAFFFFFFGGGGGGGGGGHGHHHHHHHGHHHHGGGHGGGGCGGHHHHHGGGFGHHHGHEHHHHGHHHHHGGHGGFGGGGGHHHHHHHHHHHHGGHHHHHGGHHHHHHGGGGGHHHHHHHHGGGHGHHDGGDDGGGHHHHHHFHHFH
+@161322/2
+GTATTAAGCCACTGCTGGCACGCGTCCTGCGATTGCGGTTCGCATACCACGTCCCAGCCTGCGGGAAGCGCACACGCCGCTGGCCAAAGGCTGAATTGACGCTGCGCATTTCGCAGGATGTAAAACTGTCCCTGCGGATTATCGAAGGGAT
++
+CABCCFFFFFFFGGGGGGGGGGGGGGGGHGGGHHGHGGEGGGGGGGHHHHGHHGGHHHGHHHGGGGGGHGGGGGHGGGGGGGGGHHHHHHHHHHFHHHHHGGGGGGGGGGHHHGGGGGHHHHHHHHGHHHGHHHFGGGGGHHHHEHEGGGF
+@1043835/1
+GTCTTTCAGATGGTCGCGTACTTTCTCTTCATTAGTATTGTGGCGCTGTGCGGCAACCAGACGTTCGGTCAGGCTGGTGTACAGGCCGCTATCCAGGAAGTTGGTCAGCGAAATATGCTGCGCCTGCGGTACCTGACGCATCGCGCGCTCG
++
+ABBBBFFFFFFBGGGGGGGGGGHHHHHHFHHFHHGEEGHHHF?HCFFGGHHGGGGGHHGHGGGGGGGGGDGFBGHHGGGHGHHHGGGGEGGGHHHGEHHGHHHHGHHHHGGGGHHHHHGHHGGGGHGGGDGGDGHHHGGGGGGGGGGGGGG
+@1551526/1
+GATCATGACCACACATGCAACAAAAAAGCCTGCAACTCATTGAAGTTACAGGCTTTTTTAAGGTTCATGATGCATCATGAATGAATGTTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACATCCTAGGAACTACATG
++
+AAABBFF5CFFBGCGGGBGFGGHCHHGEHHHHCGFBGGDGGFD5FE5A5GHGEAGGAFEG3BGGF3GHFHFHBG5@GHHBHEFBFHEHHHHA11>FGGHGFGGGE>//BFFH1?/>>/<<@>D/A/F1F<GF1F1<<1<<11>0<CHH0
+@196575/2
+ACGCTGCGCATTTCGCAGGATGTAAAACTGTCCCTGCGGATTATCGAAGGGATTACTGAACTCCATACTCGACTCCTGTCATGGACATGTGCCCGGTTAAAGCGTGTCGATAAGCGGCTGCCAAAGCAGCATCAGCCCTTGCGTTAGCCCG
++
+BBBBBBBDBBBBGGGGEGGGFGHHHHHHHHHHHHHHHGGGGGHFHHHHGGGEFHHHHHEGFGHHHGFHFGGFGGGHHHHHHHHHFHHHHEHHGH?FGEAGHHHGGFEGEGFHFFHGCGGGGHGHHGFHFHHHHHHHHGGHHHGGGGGHHH?
+@666946/1
+AGCCTACCCAACTATACGCATCACCCATCCGCTCGATCGTTGCCATCATCGAAGCATAGGTATCGGAAATCGCGCCGTTGATGCCGTAAACCTCAGACATTTTCGCCACCACCGGTTTAAAGGTGCTGGTCAGAATGCCGGACCCGGC
++
+CBBCCFFFFFCDGGGGGGGGGGHHHHGHHHGGGGGGHHGHHHGHHHHHHHHHHGGHHHHHHHHHGGGGGHHGGGGGGGGGGHHHHGGGGHHHHHHHHHHHHHHHGGGGGHHHGGGFGGHHHHHGHHHHHHHHHGHHHHHGFCGGGGGG
+@710779/1
+CTATCCTGCTGCCAATTGTCGAGAACTTTAACCGTCCGAACGCCGTCGCGCGTTTTGCTCGCATCGCACAGGCGATGGGCGTGGAGACGCGCGGTATGTCTGACGAAGTCGCAAGTCAGGAAGCGATTAACGCTATCCGTACGCTGAGCAA
++
+DDDDCFFFFFFFGGGGGGGGGGGHGHHHHHHHHGGGGGGGGGGGGGGGGGGGGGGGHHGHGGGGGGGGGGHGGGGGGGHHGBDGGHHGGGGGGGGGGHHHHHHHGGGGGHGGGGGHHHHHHHHHGGHHGHHGGGGGGGGGGDFGGGGGGGG
+@373919/2
+CTGATAGCGCGATCCAGCCATTTTTTGTCATGGGTAACGTCATAAACAATCAGGAACGCTTCGACGGCGTGCATATTGGCGTTACCGCCACGGTAATCTTCGGTTTTGCTAAAGGCTTCGTCCCAGGACTCCAGGCACATCTGCTCTTCTT
++
+CCCCCFFFCCDDGCGGGGGGGGHHHGGGHFHHHHHHHHGGHGGHHGHHHFHHHGCHHGGDCEGEFFECCGFGHFHHHFHHGGCEGHFCGGGGGGHGHHHHHGGFGGGHHHEHHHHEHHHGGDGDGHGHHHHHGGHHHHHFHGFHHHHHHHH
+@1434959/1
+GGCGATCGCGGAAGCCTCGCACAATGTGGTGCTGTTGCAAACCATGCGCGGTTTCTTCGACGTCCTGCAATCCTCCGTCAAACAGAGTCGCCAGCGTATGTATCTCGTTCCGCCCGTATTCTCAAAGCTGACGGAACAACACCAGGCAGTG
++
+BBBBBDABBBBBGFGGGGGGGGGFGFHHGHGHHHHHHHHHHGGGGHHGGGGDGGHHHEHHGGFGGGHHHEHFHFHHGHHGGHGHHHGHHGGGGGGGGGGBGGFHHHEGGHHGGGGGGGHHFHHFHHEBGHHHDGGGGHHHFEDEFA.GDGH
+@115354/1
+ATAAAAGAGTGGGTGATATTCTCGTTGCTCATCGGCTTTGGCACGGTTGTTGCTCGCTGACGGTGCCAGGCAATACTGATTGAGAGGATTTGAATGACCAAAGAAATGCAAAATTTAGCTTTAGCCCCTGTTGGCAACCTGGAATCTTATA
++
+BBBBBFFBFFFBGGGGGGGGGGHGFGGEHGHHFFFGGGCHHGHHGGFGG1GHHHHGGGGGGGGGHCFHHHHHHHGHHHHHHHFHFHGFHHHGHHHHHHHHHHGHHHHHHHHHHGHHHHHGHHHHHHGGEFHHHHGHHHGFHFFFHGGHGHF
+@388111/2
+ATCCCGCTCTCCTCCATTACCTCTCGCGCGACCGCCTGTTCTAAGGTTTCGCCGACTTCAACAAACCCGGCCAGCACGGTATGCACGCCGTTGCGGTGGCGAACGTGCCGGGCAAGGAGGATCGAATCCTCACGGCGGATCGCGACGATAA
++
+BBBB?AD?2ADCBGGGGGGGGGHHHGDGGGGGGGGGGGHFHHHGHHHF5AEAEGGECGHFGHEHHHGEEEGEGAFHGGGFFAGHFHGCFGCDDG?<DDGHGG@@CFGE.@CCCCGFGCGGGHHGGCHGHHHGGGGGGGB=B.DB?>@-AEE
+@81175/2
+TTCATCAATAGCGTGCTTAACGTGCCATAAAATAAGCAAATTGCCGTTATTGCAACTGCAATCACACTTCCAGGTGGCATACTAATAACCAAACGAAAGAGAAAGGAAGAACATTCATGCCTTTAAGCGCACAACAATTAGCCGCACAGAA
++
+CCCBCFFFFFFFGGGGGGGGGGHHGHHHHHHHHHHHHHHGHHHGHGGGGHHHHHHHHHGHHHHHHHHHHHHHHFGHGHHHHHFHHHHHHHHGGHGGGGGGHHHHHGHHHHGHHHHGHHHHFHHHHHHGGGGGGHGHHHFHFHFFCGDGHHH
+@1155858/1
+GTAACGGCATTCGCCTGCTCGCTGGTCCGCGTCGCGGCAAGCCACGGGAAAACGGTCGCATCACACTGGTCTGGTAAAGGCAGATCCGCAGTATCCTGCGGCATCACGTTGAGCCACAGCTTGCGCCAGAGCGGCGTTTGCCGCTCGCC
++
+AABCCCCCBCFFGGGGGGGGGGGGGHHHGGGGGGGGGGGGGHGHHGGGGGHHHGGGGGGGGGHHHHHHHHHHHHHHHHHGGHGGHHHHGGGGHHHHHHHGGGGGHHHGHHHHHHHHHHHHFHHHGGGGGHHGGGGGGGBGGFGGGGGFF
+@785483/1
+ATACCGTGCTGGCCGGGTTTGTTGAAGTCGGCGAAACCTTAGAACAGGCGGTCGCGCGAGAGGTAATGGAGGAGAGCGGGATTAAGGTGAAAAATCTGCGCTATGTGACTTCCCAGCCGTGGCCTTTCCCGCAGTCGTTGATGACCGCTTT
++
+CCCCCCCCCCFFGGGGGEFGGGHHHHHHHGGGGGGGGHHHHHHHHHHHGGG?FCG@@F?E?FG33EDFHFEE<EAECCFG?AGFGHH?GHHHHHHFHHHGGGGCHHHHHFHHHGFCHGGCCFCGFBGGGHGGGGDHDEGGEFGFGGCGGGG
+@565508/2
+GTTCACAACCGACGAACATAAACATCGCCATGCCAATATAACCAAACAGACCAGAAAGATTACTGACATCAAGCGGTGCGCCAAACCACCCGGAATGATGAGTGACCGGGGATAACAGGATCCCGCATAAACCGAAGATGGTCAGGGTAGT
++
+BAAB@FFFBBB?EFGGGCGAA5G5FF22EDFHFHFHHFHGHHEDAEEEGFHHBGH3C3FBGFFF5FCGGHHFHEFCDEGE@EGCEFFHGEGECGGGGGFGHF43FGFC//<CFF1GDBFCGFCFGC->EDGHFGGG-.DDC<DBG/GCGG0
+@292930/2
+GTTCTACGCAACAGCAGACCCTGAAAGTCGTTGAAAAGGTTGAAAACTCTTACTTCACCCATGAGAAAGACAACATTATGTCGGACTTCTCGACGGTCGGTTCCGGCCCTGGCGGGAACGGGCAAAACGACGCGCGCATGTTTGTTCGCTT
++
+1>>AAFFADADAG1BG1FAAG00FC11DFEF0BCGH1F/FB0F2BAF11D1GFHGHHBH0FF0D11FA1AEG0//EG1EB22/>///@1@GEHEEC?//>//?EF??/BA0?0C<///..<.--<</C?.---:@:-99E0;CF//0.-;9
+@1409913/2
+CGCCAATGATATGCTGGATAAACTGAGCGCCGAGAAACTGTTGAATCCGCGTGGCGTGGTGGGCCTGTTCCCGGCGAACCGTGTGGGTGACGACATCGAAATTTATCGCGACGAAACCCGTACTCATGTTCTGACGGTCAGCCACCAC
++
+AABCABFFFFFFGGGGGGGGGGHHHCHHGGGGEGEGHHCGHGHHHHHHGGGGGFFGFGGHGGGGHGGHHHHHGGGGGGGGGEGGHGGGGHHGGGGGHGHHGHHHGHHHGGGGGG?EFHGGGGGHECGHHHHHHHHGGDDDFBFGGGGG
+@1421389/2
+TCTTTGTACTTATTCCACAATACGGAACCCGCTACCGCGCCGCCGCCCACCAGCAAAGCGCCAGTACCGTATTTGGTTAATAATTTGCGCGAAGACTTATTGGCGACCAACAGTACAGCCAGACCGCCCAGCGCGCCGGGAACCAGCAGTT
++
+BABB3FFFFFFFGGGDGGGGGGFAEGFEAEECEEEF?AE?EGEEEEGGGGGA11EFGHEDEC>EBFGFF?FGF4F?FGHFHBFFGGHEGGGDGGDFGHBHDHD0@/>/@/<?CG<F1FGACGECCCCCC.C.-:DC-??B@BGGGGGBF90
+@310425/2
+GTCTTTCAGATGGTCGCGTACTTTCTCTTCATTAGTATTGTGGCGCTGTGCGGCAACCAGACGTTCGGTCAGGCTGGTGTACAGGCCGCTATCCAGGAAGTTGGTCAGCGAAATATGCTGCGCCTGCGGTACCTGACGCATCGCGCGCTCG
++
+BABBBFFFFBFFGGGGGGGCGGHHGHHHHHGHHHHGGHHHHHGHGGGGGHHGGGGGGHGHHGGGGHGCGGGHHHHHG?GHHFHHGGFGGGGGHHHHHEEFFGHFGHHHHGCCGHFHHHGHHGGGGHHGGGGGHH1GHGGCAFFGGG?CCDC
+@1249278/2
+CAATATAACCAAACAGACCAGAAAGATTACTGACATCAAGCGGTGCGCCAAACCACCCGGAATGATGAGTGACCGGGGATAACAGGATCCCGCATAAACCGAAGATGGTCAGGGTAGTCCACATACCGAATGTAAGAAACACTTCCACCTT
++
+3AAB@FFFFFFBCGGGGGEGGCH4FGHHGFHFCFHE3FDFGGEA2EFFCEFBE1FFGGGEGFGFHF5E3DD5GHGCE?/>FFFHFGFGBF2>/EEGHHEBFCF?DBFBFFFBH0@FFGF2D2FGH1FAEDFHDHBDFFH0GF1FG1>DGC1
+@760149/2
+AAACATACTTTTCTCCTTTATTTGACCTTTCAGCATAAACGCTAATCGCACGTAACGCCTTGCTTTCATATTCCAGTTGTCGCCGCGACGACATTTCGCTAAAGTCACGCCCCTTCTTCACTGGCATGGGGATTTTAAGGTGTTTATAGGA
++
+DCCCDFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHGGGGGHHHGGGGHGHHHHHHHHHHHHHHHHHGHHGHGGGCGGGGGGGHHHHGGGGHHHHHHGHGGGHHHHHHHHHHHHHHHHHGAEHHHHHHHFGGGHHHHHHF
+@1525017/2
+GGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGCCACCCTAATTAGGGGCGTAGTTCAATTGGTAGAGCACCGGTCTCCAAAACCGGGTGTTGGGAGTTCGAGTCTCTCCGCCCCTGCCAGAAATAATCCTTAGCATCTGCTAAGGATTTTT
++
+BCCBCBABCCCDGFGGGGGGGGGHGGGGFHHGGGGGHGHHHHHHHGHGGGECGGHHHHHHHHHHHHHGHHHGGGGGHHHHHHHGGGCDGGGHHGHGGHHGHHGHHHHHHGG?FGHGHHHHHHEFHGHHGHHHHGHHFHHHHHGGGBFGGGG
+@548313/1
+GTCCATTACAGGAGTTGAGTATGGAGTTCAGTAATCCCTTCGATAATCCGCAGGGACAGTTTTACATCCTGCGAAATGCGCAGCGTCAATTCAGCCTTTGGCCAGCGGCGTGTGCGCTTCCCGCAGGCTGGGACGTGGTATGCGAACCGCA
++
+1>AA1B3BDFFF11FFAFGDBGHFBGGHHGHFFBGBGCGHCF0FFFB2GEGGCGCFEFEFGHHFHFGFHHHHGCEEHFDFGGC//F?EAHGHBGHGFFHFFGCGGGC@ECGG//FBBCACGHC/A//CFC?CEFC>.<CFB/0.<<-A?:-
+@565847/1
+CCCTTCGATAATCCGCAGGGACAGTTTTACATCCTGCGAAATGCGCAGCGTCAATTCAGCCTTTGGCCAGCGGCGTGTGCGCTTCCCGCAGGCTGGGACGTGGTATGCGAACCGCAATCGCAGGACGCGTGCCAGCAGTGGCTTAATACG
++
+ABBBBFBBFBBFGGEGGGEGCGGGHHHHHHHHHHHGHGGGGHHHGGGGGGGFEEHHHGHFHHHHHHHHHHGGGGEGCAGGDC@FEHHAGGCGGHGGGEHGBDEFFGFBE?DCG<?GCDGGGGFGGGCDGCGCEHB?FAFGFF?ABBC9;E
+@194793/2
+CCAATCGCCTGTTTGAGCTTGAACAGCGCATCGCTAAACAAATTTCGCTGGCGCGAAAACATCACGTCAGCCCGGAAGCGCTGCCGCAGCTTTATCAGTCACTGCTCGAAGAACAGCAGCAGCTCGACGATCAGGCTGATTCGCTGGAAA
++
+CCDCCFCCCCDFGGGGGGGGGGHHHHHGGGGGGGHGGHHHHHHHHHHGGGGGGGGGGGGHHHGHHGHHGGGHGGGGGGHGGGGGHGGGGGHHHHHHGHHHHHHHHHHGGHGGHHHHHHHHHHHHHGGGGGGHGHHHHHHHHHGGGGGHHH
+@597549/1
+AAGCGCACACGCCGCTGGCCAAAGGCTGAATTGACGCTGCGCATTTCGCAGGATGTAAAACTGTCCCTGCGGATTATCGAAGGGATTACTGAACTCCATACTCAACTCCTGTCATGGACATGTGCCCGGTTAAAGCGTGTCGATAAGCGG
++
+AB@BBBDDBF@DFEEE?EEGGCGFHHHHFCHHHFFEGDGGGGGGEGDGGGGGGGHHHHHHHGHGHHFHGHGCEEGHHHHA3/EEAGFFFHFGHHHGFHHFHHHGHFDFGHHDGGF?CCGHHHHFFFHGCDDGHHHHGADEBFFGFFGHGC
+@386457/1
+CTACTTATTCCTCGATTTTACCGCCAGCAGCTTCGATAGCAGCACGAGCGCCTTTAGTAACACGCAGGCCACGAACAGTTACCGGAGTAGTGACTTCGCCAGCCAGGATCACTTTCGCGAACTCGATCTGGATACCGATAATGTTTGCCG
++
+BBBBBFFFFFFFGGEGCGGGGGGGGGGGHHHHHHGHGHGFHGHHHGGGGGGGGGHHHHHHHHHDGGG?GGHGGGGGGGHHHHGGGGGGHHGHHHGHHGGGGGGGAGHHFFFHHHHHGGGGGGHHCHHHGHHHHGHHGGGGGFHDGGHHHG
+@1368449/1
+CTTAATACCGAAGTGGGTCGTGATGTACAGCTTGAAGATCTGCTGAAAGATTACGATGCGGTATTCCTTGGCGTTGGCACCTATCAGTCGATGCGCGGCGGGCTGGAAAATGAAGATGCGGACGGGGTTTTCGACGCTTTGCCGTTCCTGA
++
+ABABBFFFFBBBEFGGGEEEEE4FGGGHHGCFFFGHFGHHGHHHHHHHHFHFHHGEHEGGGEGGHHHFHHHHGGEGHFHHGHHGFFDHHGGGFEEGG??<CGGGGF0GHHGHHGHFHHFCCDGGGGGDCEEBBGG@?EGGFEGGGGGGGGB
+@1194361/1
+CAATAATATGGCTATCCAGGATGTGCCGATCCTGAACAGCGATAAAATCATTTGCTCACGCCTGAAACGCGATGACACGCTGATGGTGCCGTCGCCGGGGACGATTATCCAGGCAGGCGACCTGCTGCACCTCGTCGGCCAACCTACCGA
++
+BBBBBFFFFFFAFGGGGGGGGGHHHHHGGGGDHHHHHHHGGGHGGHHHHHHHHHHHHHHHHGHHHHHHGGGGGGHHHHGGGGGHHHHHHGGGGGGGGGGGGGGGGHGGHHHHGHHGGGGGGGGHHHHHHGGHHGHGGCGDGEGGHHHFFG
+@988801/1
+ACATACAGAATGACTACGGTGACTACCGCAGTGACCACCCAAAGCCCTTTGATGATTGGCTCTGGCCCCATTTTTTCGTCTTTTACAATGATATTGGCCGCCTTCGGCGCCAGTTCAAACCAGGTTTTGGTGTGCAGCAGCGCGGCCGCCA
++
+BBABBBFFFFFFFGGGGGGGGGHGHHHGGGGGHHHHHHGGGHHHGHHHGHHHHHGHHHFHHHGHHEHHGGHHFFHGGGGGHGHHHHFEHHFHHHH4F3B>EEGGGFE@CGDFGHHFGHGHGGHGHGHGHGGFHCHHHGGGFCGC?-CGGGC
+@276243/1
+CGATAGAGTTGACGTGCGCCCAGTTACGACCGGCACCAACGCCAAGCGCATCGCCATACGGCGTATCCGGTTCGAGTTTCGCCTGCTGTCCGGCATGGGCCAGATCGACGTTCACGCATACTGCGCCCGCATCCAGCGCGCCGAGCAGCG
++
+BBBBBBFFFFFFGGGGAEGGGGHHHHHGGGGGGGGGGHHGGGGGGHGGGGGGGGGGGHHHGGGGGGHHGGGGGGGHHGHHGGGGHHHHHHHGCDCGFHEGHGHHHHHGGFGGHGHHHGGGHHFHGGGGCGGCDHFHHGGGGGGGFGFFFF
+@345645/1
+GTACCGGGGCTGGTGCTGGGTATTTTGATCGGTAAAGGCGTAGAAGAGAGCGGCTGGAACCATGTCACCAAAGTGATGATGGTCGCCATCGTTTTGCTGTTTGTGTTGAGCGGCTTCTTCCGCGGCTTCGACATGAAAATGCTCGAGTCTT
++
+@BBBBADDBBBBGCFGFGCEFGHHGFFFHBFCEGGHHBHEGCA15BB12AGEGGGGGGGH1GFGFBHF331FCGGGHFFHFFHFFEEFAGDGHGGEHFFGGHHFGHH/3?2/</CFF2GFFGGGCDCGHCHFF.CDGHHFF0=DD@?CCGF
+@719920/1
+GTCCCAGCCTGCGGGAAGCGCACACGCCGCTGGCCAAAGGCTGAATTGACGCTGCGCATTTCGCAGGATGTAAAACTGTCCCTGCGGATTATCGAAGGGATTACTGAACTCCATACTCAACTCCTGTCATGGACATGTGCCCGGTTAAAG
++
+AABBAFFFBFFFGGE22EGCGGGGF2EGEEGGCECBHGBFGHH1GHHFBFEGEFGCEEGDFHFG??EAGFHGEGFGGGGFHGFHHGG?<DBGBG/??DGEHHBGHHHHHF1CGHFHBDHBGFHHFFFFHHH1<GGG<GGHEHDGCGGGBH
+@363525/2
+TGTAAAGACTGACTAAGCATGTAGTACCGAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAACATTCATTCATGATGCATCATGAACCTTAAAAAAGCCTGTAACTTCAATGAGTTGCAGGCTTTTTTGTTGCA
++
+AAAAA3DBFFFBEFAF1BGGGBAAFH3BECECCGGFBGHHHGGEAA/E/AE/E?/F0GDHG1F>>/>EG/FE1F0>/?CGFHFE2EFE2GFEGHHGGHHHHHBFHFHF<1>1//G0FFFGEGHFBDGHH11@FD1FHGAHBHFHC@0001G
+@871418/2
+GATCCCCAGATCCTGCGCCATCGGCGTCAACAGACTAACGGGCAAAAACTCAACGGTAATCAGGCAGGCGACACAAAACGCCACGGCAAAAACGGCTGACCAGTTAGGCCTGGCAACCCCATCAGCGCGGAATTTTTCTGCGATATTTTCA
++
+ABBBAFAFA4DFGGGGECEAFFEGCCGGGGHHHGFGFFHDGGGGGFEGAGHFGF?0EFF5GHHFFFEGEGGGGGHFHFHGGGGCEEGGGHHH/<C?DCHHHHHHGHHFFH<C/GFGHH?DEHHFFFF?C<C-CG0CGHFGHGCA.@FFBB0
+@1181657/2
+GTTCGACCAGATATCGTGATGGAACGGGATCACCACTTTGGTATTCAGCGATTCCGCCATGCGTAAAATATCCGCGCTGGTCATTTTGTCCGTAATACCGCGCGGGTTTTCACCGTAAGAACCGAGCGCGACATCAATTTGATGTTCGTTG
++
+33AABBBDBFFFGGGGGGGGGGHHHGGGGGGHHHHHHHHHHFHHHHGGHGGHHHHGG?EGHHGGGGHHHHGHHGGGGGGGHHGFHHHHHHHFHHGGHGFEGGGGGGGGGGHFH@?GHGHGHHHGGGGGGGGFCDHHBFFGHFHHHGHGGGB
+@736548/1
+GCAATCCTCCGTCAAACAGAGTCGCCAGCGTATGTATCTCGTTCCGCCCGTATTCTCAAAGCTGACGGAACAACACCAGGCAGTGATGGACGCCATTCTGGACGGTAACGCCGAGGGCGCGCGTAAAGCGATGATGGCGCACCTCAGTTTT
++
+AAAAAF13DFAACEEDGGF1GAF00AEEC0EECH2B22DGGFFCF?CFGGA/FFHHHHGFFEGFBGGGCGE0B?G/>?B//F/F1B@21F1EE//FFGH2B10E?FEF1</C///////>->?--<.DG?...000CC?.:C?/9/900;0
+@1068621/1
+TTCCAGCGCCGCGCGATCAATCACGCCGATAATGCGTTTGATTTGCGCGTCGTTGATATCGCTGTGGTTTATCCGCAGATCCAGCACGGCCTTGAAGTTATCCAGCGCCCGCTTCATCTGCGGATTTTTACGTAACTCCATGCCCACACAA
++
+ABBBAFFBBBBDFGG2FGGGGGHHGHGGGGGGHHHGGGGGBHHHGHGG?EGGGGGHHHGEGGHGEGHGFHHHFHGGGGGGCFHHHFGGGFGGHGFGG?FGHHHHHECFGGGCCGGHHHFHED?C@DFFFHHGHHHFBGHHHFGFGFGGGGE
+@106436/2
+GTGAAAACCGATGGCCGCGCACAGGTGATCCCATTCCGTACGCAGCCTATCAACACCGTGCCGCCAGCAAACCAGGATCATGACGCGCCGCTATTGCAGCAGTATTTCTCCTGAGGATTTTCGCCCGGTGGCGGCTACGCCTTACCGGGC
++
+>1>1ABF1AD?DG?CGEGE?EEEGABFGGHHHGFHBF0ABEECGGG/FBGFFGFHGGGBC?GEGGEEFFFBCEG/?/EGHHGEHEGGGEGGCC?GF1FFEFGFDGHHHBB?DBBCGHHGHBD@.CEC->@AGCCCCCBACCFCBCF.@??
+@784463/1
+TTACTAACCTGAATACTCAGGTATCGAATCTGGATACCCGCGTCACCAATATCGAAAACGGCATTGGCGATATCGTCACTACCGGTAGCACCAAGTACTTCAAGACCAACACCGATGGCGCAGATGCAAATGCCCAGGGTGCGGACAGCGT
++
+CCCCDFFFFFFFGGGGGGGGG5GHHGHHHGHHHHHHHHHGGGGGGGHHHHHHHGHHGGHGGGGGHHHHGGGGGHGHHHGHHHHGGGGFHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGHGGGGGHHHHHHHHHHHHHGGFGGGGGGGGHGA
+@376975/2
+TCTATATCCAGCGAGAGATACAGCAGGAAGAGGCCGTGTCAGAGGAGATAATTTAATGGGCGATGTGTCAGCTGTCTGTTCATCCGGGAACATTTTACTGCCGCAGCAGGATGAGGTTGGCGGTTTATCAGAAGCATTAAAAAAAGCGGTG
++
+3>AAAFF@FFFFGGGGGGGCGBG4ACG2CGCGHEG?2AFGHD5FAFEGHHHFGGGFBDGHH?0FDHHHFDBBGBFGHGGFGHFHHGGGGCGHFFFHF3FF3B@EEGCC0E?GHFE0CGFCHCCGGGEFFHEH11F1??1<GGG-<.>ECGG
+@1338236/2
+CCTCCGTCAAACAGAGTCGCCAGCGTATGTATCTCGTTCCGCCCGTATTCTCAAAGCTGACGGAACAACACCAGGCAGTGATGGACGCCATTCTGGACGGTAACGCCGAGGGCGCGCGTAAAGCGATGATGGCGCACCTCAGTTTTGTCCA
++
+A1>AAAA1A?BDF111A1EFEEEGCEEFCGDDGDGGA/B0BEAEEE/GGGH2FFGGHGFFGGE//>00GHEG/F///>BBGFHFGFG?EFF1FGGGHGGEEFCGECC//CCCC//CGC-@?.=<E<.<0GHHHCC-:-:C/GGFFFFFGGC
+@628731/1
+ATGTGGACTACCCTGACCATCTTCGGTTTATGCGGGATCCTGTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGTTCGTCGGTT
++
+BBBBBBFFFFFFGGGGGGGGGGHHGGGGGGHHHGGGEGGHGHHHHHGGHGGGEGGHHHHHHHHHHHHGGEEGEGHGEHGGGGGGCGGGHHHHHHGGFGHFHHHGHHFBFHGFHHGGAGHHHHHHGHGHHHHGGGGHHHHHHHHHFGGGGDG
+@936812/1
+GGCACGCGTCCTGCGATTGCGGTTCGCATACCACGTCCCAGCCTGCGGGAAGCGCACACGCCGCTGGCCAAAGGCTGAATTGACGCTGCGCATTTCGCAGGATGTAAAACTGTCCCTGCGGATTATCGAAGGGATTACTGAACTCCATA
++
+BBBCCCCCDCCBGGGGGGGGGGGGGGGGGGHHHHGHHGGHHHGHHHGGGGGGHGGGGGHGGGGGGGGGHHHHHHHHHHHHHHHHGGGGGGGGGGHGHGGGGGHHHHHGHHHHHHHHHHHGGGGGHHHHEFGGGHHGHHHHHGHHHGGGG
+@401895/2
+CAACATAACGTTGTGAATATATCAATTTCCGCAATAAATTTCCTGTTGTAATGTGGGTTCATTCGCACAGATAGCAATCTGTAAACCGAACAATAAGCGCGACAACACAACATCACGGAGTACACCATCATGGCTAACTACTTTAATACA
++
+ABBBBFFFCAFBCAEGGGGGGGFHHFCHHHGGGCEFFFGHHFFHDFGGHHHHHHHH?EGHHHHFE1EEGFBFHHGFHFFHFFHFHFFEEG?EGHBGHFCGGGGGGEGFHE?GCGBFFGGGEHFFGGHHHGHHGFFHGHHHHHHHHDGHHH
+@1377431/2
+GTTGTGGCATTACGACAACGCGCCATCATCGCGCCAGCCGCAGACGCTAACGTTCATTCCGTGGTTTAGCTGGGCCAACCGTGGCGAGGGCGAAATGCGGATTTGGGTTAACGAGCGGTAATACTGTGCCGGATGGCGGCTGCGCCTTAT
++
+AAABCAABFFFFGGGGGCGGGGCGGGHHHHHGGGGGGGGGGGGGHGGGGGHGGHHHHHHHGHGGCFHHGFHHHGHGGHGGGGFFGGGGGGGGGGGHHHGG@DDHHGGFGHHHGGGGGG?ACGHGGHGHHHGGGGGGFDCGABGGCFFFFF
+@985800/2
+TTGATACACTACATAACCAAAAAGCATAGCAGACAGGCATGGTATTGCTGGTATAAGCAGGTAACATGGCTGTTATAAGTTGATAACAAACTCTTGCGCCGCGTCGTGATAGTTTGCAGACCTTCAAAGTTTGTGTTGCGCAGTACGGTGA
++
+BBBBBFFFFFFFGGGGGGGGGCHGHHHHHHHHHGHHGGCHHHHHHFHHGHHHHHFHGHHHFGHHHHHHHHHGHGHBFHGDGEFHHHEHHHHHHHHHHGGGGGGGGGGFHFHHFFHHHHGHHGHHHHHHHDGHHHHHHAFFGDGAFHFG0G?
+@408521/1
+GTACGTGAGCATTTACTCGCTCCGCTCGCCCTTCGGGCCGCCCTAAAGCGCGTTCAAAACACTATCGTGTTTTGTCGAGCACACTCCGGCGCCAAAATGGCAAATAAGGTAGCCCGATATATTTATCTACCCGGGAAGCCTGGCGGCATCA
++
+AAA1A>C1>B1@33FDAD1EAGEA00EA0A0AGGH/E?E/A/AEAFFD1?>FE/>FHHFHEFFHF1E0>/B>G002////<0<<0<<E@CC//?CCC11<0<<0D<1D1?GF1FG-@-C-0=GHHHHFHHEG.<-A-:CGG.GHG?GG?F0
+@32174/2
+ACTTTCTTACCCTCCACAGCATAAATGCCGGATGGCGGCTTTACCTTATCAGGCCTACATAAGCACTCGGCTGGTAGGCCTGATAAGCGCAGCGCCATCAGACATTGATTGGCAATTAAGCCTGTTTAGCAGCTTCTGCTGCTTTCACGAT
++
+CCBCCFFFFFFFGGGGGGGGGGHHHHHGHGGGGGGHGGGGGHHHHHHHHHHHHHGHHHHHHHHHHHHHGGGGGGHGHGHHHGHGHHGHGGGGGGGGGGHHHHHHHHGHHHHHHHHHGHHHHFHHHHGHHHHHHHHHHHHHHHHHGHHHHGC
+@1182531/2
+GCATTTGCAGTAGCTCCTGTTCATTTTCAACAACATGGAAGCGACGTTTACTTCGCTCAATCGCCTCAATAAAGTCGTTAGTATCAACAGGCTCATTACGATGTTCGTTAAACTCTTCCAGCACTTCCTGGTACTCCAGCCCTTCTGCCAG
++
+AA?A>3F3BBFFF333FGCFFG3B3F3GF33F0FCFHFH1GH?0AEEG0GF12GGA/G/1DDA/EEEEGGBEFGHGCFFH/22FGF20FG/>F0F1B2@F//?F2GEACG/GB21>>F1FB0<<11DGBHF1F2B>1<1<?/G0@<>1@G1
+@392813/2
+CGACATATTCCCGCACCGTGCCATGGCTCATCTCGGTTTGTTCAAACAAATACTGCTTGAAACCGATAATATCGAAAAAATCACTCTGCTTTTTGCAGTGCAAATCGCCGCAAAAGCGACACAGCGCCACCCACTCCTTCTGCTCCCG
++
+AAAAAAFFFFB1AEE1EGFFFGCHGCGHHBGHHHCGEA?EFFFGHHHHGGHFHHGGGGFHFHHFGCE/FHHHGEAFFGFCHGBGBDG1GHF1@GGHHHDGFFF1GDEF/EG//<<FFCE/CCHHGGCCCCHGFCFHFHHHFHFF=0CA
+@661230/1
+GGCCGATAAACATCAAACGCTTCATGACTTTACGTCCGGGTGATCGAGCAAGTGGTGAACTGCATCATTTCGCCCAGCGTGCGCGTTACCTGCTTGAGGGCATACTCGACGGCAGAAACGTCGCCGGTCAGCACCACGGCACCGGTAAAG
++
+A@BBBBBBBFFFGGGGGGGGGGGHHHHGGHHHGGHHGGGGEEGHHGGGGGHHHHHHGHHHHGHHHHHHHHHHGGGGHHGGGGGGGGGGGHHHHHHGHHHGGGHHHHHFHGGGGGGGHHHGHHGGGGGGGGGHHGHHGGGGGGGGGGGGGG
+@1039592/1
+AATTTATTCACGGCCTGTTCTTTGCTGGTCAAATCAACGGTACTACCGGCTATGAAGAGGCTGCGGCGCAGGGCTTGCTCGCTGGTCTGAATGCCGCGCGTCTTTCCGCCGACAAAGAGGGCTGTGCGCCTGCGCGTTCTCAGGCTTAT
++
+A3AABFDFFFF?AEGGGBFGG5FDFHHFHHHHFHGH3GGCFHGHHFGG?EEGBGFH5FGFFHHGGGGGGGEGGGHHCHGFEGGEEHFDHH4FGHHCGC@CGGGEFGHDCFCGGCCHFF/CEGHD.<GFGFCHFCGGGGGGGGGEBFFG0
+@902770/1
+CTCTAAACAGGGTTATCAACACTTCTTCGCCTTGCTGGGCGCGGCCAGCGCCGTCACGACCGGGCACCCTGAAGCCAGGAAATTGCTGGATTACACCATAGAAGTGATTGAGAAATACTTCTGGAGTGAAGAAGAGCAGATGTGCCTGGAG
++
+A3AAAFFCDFAAFFCGGGGF4FGHFHHCHGGGCFFCHBEHEEG0EEEAAEGGG@EGGGG@ECEEFE/FEEH2?3FGGEAFECGHHHFHF0FGGHHHFEBFGE2FFGHFGG2FG2CFBDHFHHF1?GC011>1<0<<BGFFHHHHFHH0GBG
+@618512/2
+TTATCAGGGCGTCCCGGCGTGGCGCACGGTCAGAAAAACGCAGTCAGGAGAGGAAATTCAGCCCTTGCTGCAACACCAGATCGCAAGCTTTGGTTTTCACCTTTTCCGCCAGCGGCGTACTGCCGATATTATTGAGGTTCAACTGCTGGC
++
+CCCCCFFFFCCCGGGGGGGGGGGGGGGGGGGGHHGFHHGGGGGGGHHHHGHGGHHFHHHHHHHGHHGGHHHHHHHGGHGHHHHGGGGHHHHHHAHHGGHHHHHHHHHGGGGGGGGGGGGGHHGHGFGGGHHHHHFGHHHHHFHHHHHGHG
+@1192160/1
+GTTCAGTAATCCCTTCGATAATCCGCAGGGACAGTTTTACATCCTGCGAAATGCGCAGCGTCAATTCAGCCTTTGGCCAGCGGCGTGTGCGCTTCCCGCAGGCTGGGACGTGGTATGCGAACCGCAATCGCAGGACGCGTGCCAGCAGGGG
++
+BAABBFFFFFFFGGGGGCGEFGHHGGGGGGGGGGHHHHHHHHHHHHGGGGGHHGGEGGGCEFEGHFHHGHHHGDGGCFFFEGGGGEE//4/EEEEHHDFGG@/0FDGCGC?DE<11?FDGG---<-CDEEG.ACE.-AD@DDEBFEFF.9B
+@1002550/1
+CCCCAGATCCTGCGCCATCGGCGTCAACAGACTAACGGGCAAAAACTCAACGGTAATCAGGCAGGCGACACAAAACGCCACGGCAAAAACGGCTGACCAGTTAGGCCTGGCAACCCCATCAGCGCGGAATTTTTCTGCGATATTTTCATT
++
+BBBBBBBFFFFFGGGGGGGGGGGGGCGHHGHHHHGHEA1EGGHHEEHHHHHGGGHGHHHGHHGGEGGGFGGHEHHHEGGGGGFGGGHGGGDGGGGHHFHFGFBHFHHHGEHHFEFGGGHHFGHGGGGCCEFHHHGGFHCCHCGGGGGGEG
+@1210284/1
+GCATTGCTCGGACAGAAGTTTACCCCGTATGATGCGGCATGTGTGGGATGTGTGGCTCACGGCGCGGCGGCGGACTTACTGGCAGCGCGTTATGGCGCTCGCGGCATGTTGGCGACCGATCTTTTTACTACGCTGCGGCGTATTGTTAAC
++
+?AABBFFFFBBBGGGFGGGGGGHHHHGGCHHHHHHGGGGFFHFHGGGHFGHHHHGHHHHHHEEGGGGGGGGGGCFGHHHHHHHGDDGGGGGGHHHG-ADDG?CBADGGBBFEFA?FGA;DFFFFFFFFFFFFFA..-BF;@;ABFFFFFF
+@737759/2
+GTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGTTCGTCGGTTGTGAACTGGTCACGCCAATGGCGCCGGAAATTAAAAAAGCG
++
+A>AABFFF@ADBGGGGFG5FGGHHGHGGFEEFGHGGGGGGGEEEGDGGHGHHF@GGGHEHHHFHHHHGHBFFFHGHA4FF4@GHHHHFFCEGGGHGHGHHHHHG//EGEFGDCFF?FG2GB2GGACE@CGGGFCDGC@CCHGBDFGF@AGD
+@835982/1
+AGATAAGGTTTATCCGATCGCACAATGTAATAACGCCTATATTTTCCCCGGCATCGGTCTGGGGGTTATCGCTTCCGGCGCATCGCGCATTACTGATGAAATGCTGATGTCAGCCAGTGAGACGCTGGCGAAACATTCTCCGCTGGTCAAT
++
+BBBABF4FFFFFGGFGCFGGGCGGHHHHHHHHHGDGGGGFHFHHGFHHHGCFCGHGG1EEHGFFGGGHHEHGHHGFGGGGGCGC?DCFGFGHEFHHFGHHHHHHHEHFFHHHFHHFH?FHHHHDFFGGG<?DGCFHGH0GH.ADCGGGCGC
+@1241444/2
+GGCTGAATTGACGCTGCGCATTTCGCAGGATGTAAAACTGTCCCTGCGGATTATCGAAGGGATTACTGAACTCCATACTCAACTCCTGTCATGGACATGTGCCCGGTTAAAGCGTGTCGATAAGCGGCTGCCAAAGCAGCATCAGCCCTTG
++
+CCCCCFFFFFFFGGGGGGGGGGHHGGGGGGHHHHHHHHHHHHHHHHGGGGGGHHHHGHGGGHHHHHHHHHHHGHHHHHHHGHHHHHHHHHGDHGFHHHGHHHHHGGGGGHGHHGFEEFGHGGFHHGGGGFGHHHHHGBGGHHHHHGHGHHE
+@498984/1
+TCCGAGGTAATGTCTCCCCAAACCAAATTTCCACGCGCTTTCGAAACGCCACTCCATAAGCCGCACTATGAGCAAGCAACAGGTTAGAGTGTCTATGTTTCGTAAAGTTCCGTTACGCATTTGTTTTTGTTTGTCATGTTGTAGACAGGT
++
+>ABB?DD2BF5DGGGGFGGGCFGFDFGHFFHHHHGGGGGGGHGGHDCGGGGGHFHHHHHGGHEGGCGHHHGHFFHHFHCFFHGBFGGFGHHHHHHGGHHHHGHGHHGHHHGGHHGGGGGGGHFFGHGGGHHHHBHFHFGGFFGHDHHHGH
+@48455/1
+GCACATTGGCGCTGAGGGCGAGCTGTGCGTTAGCGTCGGCGATCGCGTGCTACGCGGCCAGGCGCTTACCCGTGGACGTGGGAGAATGCTGCCGGTACACGCGCCCACCTCCGGGACGGTTATCGCTATTGCCCCCCACTCGACGGCACAT
++
+AABBAFFFFFAAGGGGGEEEEGGFHHHHGFEEDHGGGCCEEEGCEFGGGGGHGEEGGGGGHEE@ECDGHHHGDDGGHGDDGGGGGHFHFH1GFGCD@DFGDD-DFG?EGAFGE?GAGGGDGGGGGGGGGGGGBFFFFFFFFFFFFFFFFEF
+@1274930/2
+GGACAGTTTTACATCCTGCGAAATGCGCAGCGTCAATTCAGCCTTTGGCCAGCGGCGTGTGCGCTTCCCGCAGGCTGGGACGTGGTATGCGAACCGCAATCGCAGGACGCGTGCCAGCAGTGGCTTAATACGCGCTGGACAACACTGAAT
++
+CCCCCCFFFFFFGGGGGGGGFGGGHHGGGGGGGGGGHHHHHGHHHEFHHHHHAFGGGEGEFFAFEFEGHDE//EECGGG0?<?EFF4F22/B@CG@<DG?G///?@?C-<<--<CDFE/C<GF..C0CCGHAA-CACGG.9A.;.0:CFB
+@885230/1
+CGATACACACATCAAAACCCTGCGCGCTAAGCTACGCGCGATCAACCCGGATCTCTCGCCAATTAACACGCATCGTGGAATGGGATACAGCCTGAGGAGCGTCTGATGCGCATCGGAATGCGTTTGCTACTGGGCTACTTTCTTATTGTCG
++
+CCCCCCFFFCCFGGGGGGGGGGHGGGGGGGHHHHHGGGGGGGGGHGHGGGGGGHHHHGGGGGHGHHHHHGGGGGGFGFGHGHHHHHGHHHHHHHHHGHGHGGGGGHHHHGGGGGGGGGGHHGGGGGFGHHHHFHHHHHHHHHHHHHHHHHG
+@737571/2
+GCCCTCAGCCATATCCGTGTGATTACTGGTGGAAGTCAAACGGAAGGTAAAGGTTACTATTTCGCTCCGACGTTGCTGGCAGACGCAAAACAGGAAGATGCCATCGTGCAACGCGAGGTCTTCGGCCCGGTGGTCAGTATAACCGTCTTTG
++
+AABCCCFFFFFFGGGGGGGGGGHHHHHHHHHGHHHHHHHHHGGGGGGHFHHHFGHHHHHHHHHHGGHGGGGGGGHGHHHGHGGHGGGGGHHHHGHHHHFHHGHHHGHHGHHHGGGCGGEGGHHHGGGGGGCGGFHGHHHHHHHHGGGHGHH
+@1328715/1
+CGCTTTAACCGGGCACATGTCCATGACAGGAGTTGAGTATGGAGTTCAGTAATCCCTTCGATAATCCGCAGGGACAGTTTTACATCCTGCGAAATGCGCAGCGTCAATTCAGCCTTTGGCCAGCGGCGTGTGCGCTTCCCGCAGGCTGGGA
++
+BCCCCCFFDFBCGGGGGGGGGGHHHHHHHGGGHHHHHGHHHHHHHHHHHHHHHHHHHHHHHHHGHHHGGGGGGGGGGGHHHHHHHHHHHHGGGGHHHGGGGGGGGGGHHHHHHGHHHHHHHHGGGGGGGGGHHACCF.GHGF@GGGEHDGC
+@1234103/1
+AACTTATTCTGATATTCAGGAACAATTTAAATGTCTATCACTAAAGATCAAATCATTGAAGCAGTATCCGCTATGTCCGTAATGGACGTTGTAGAACTGATTTCTGCAATGGAAGAAAAATTCGGTGTTTCCGCTGCTGCTGCTGTAG
++
+AAABBFFF5FFFGGGFGGGGGGGFHGGHHHCBGAEFH6FG5DFGFHHFGHGHGGHHHHHHH3GFHHFFHG1EEAGGDFEHH1FF5BFEBFF1DBGDHFFBGFHEFD@43GGGBFHFHFHAFGG1?FEFFHHHGGGGFHFFGHHFHHDG
+@632028/2
+GTACGATGCGCTTTTTTAATTTCCGGCGCCATTGGCGTGACCAGTTCACAACCGACGAACATAAACATCGCCATGCCAATATAACCAAACAGACCAGAAAGATTACTGACATCAAGCGGTGCGCCAAACCACCCGGAATGATGCGTGACCG
++
+BABB@?AABBBBGGGGGGGGGGFHGGGGGGGGHHBFEEEFFGHHFHHHHHHCG@>EFGGCGHHBHFHHHEGGGGGHFDGGGEHEBEDHHHFFHHHFAHBF?2GHHFBDFHEF2<22FA//>A/<DAC0.>..<ECGC-<CGB00:;A?EB-
+@572250/2
+CCGCAACATAACGTTGTGAATATATCAATTTCCGCAATAAATTTCCTGTTGTAATGTGGGTTCATTCGCACAGATAGCAATCTGTAAACCGAACAATAAGCGCGACAACACAACATCACGGAGTACACCATCATGGCTAACTACTTTAATA
++
+AABBCCCFFFFFGFGGGEGGGGHHHHHHHHHHHGGGGGHHHHHHHHHHHFHHGHHHGFGGEGFHHHHHCFGGGHHHHHHGHGHGHHHHHGGGGGCHHHFHHGGGGGGGHHGHGGHHGHHGGGDDHHFGHEHHHFHEHHHHHGGGFHHFHHH
+@1427284/2
+GTATGGAGTTCAGTAATCCCTTCGATAATCCGCAGGGACAGTTTTACATCCTGCGAAATGCACAGCGTCAATTCAGCCTTTGGCCAGCGGCGTGTGCGCTTCCCGCAGGCTGGGACGTGGGATGCGAACCGCAATCGCAGGACGCGTGCCA
++
+>3>3AFFFFFFFGGGBGGGGFFHFHHHGGFGEFGGCCFF2FHEGH5EFHHHEHHEGGGHHG5FHFAEEFGCHHHHHFHFGHHGGHHFFEGEGEC?EBEE/EEGF////<<<?/E00ACEF@GEF0<.>@@---<.0.<<.@..--:-;A.0
+@908511/1
+AGGTTAAACGGGCTGACTCGCTTCTTTAACAAAAATGGCCCTTTTAAGTTGTAGAAATGTAAATTTATTGTCAACGAACTACACTTTTCTCTTTGGCATCACCGGGAGGGTTGCCTGAAAATCCCGGGATGAGGTTTTCTTAGAAGGACAG
++
+BBBAAFFFFB@A?FGGFGGGGGHGHHHHHHHHHGFHHHHHGHGHHH3FAFGHHHHFFHHDGGHHHHGHH5GHHGHGGGGEHHHGGHHHGHGHFGFBFHFHFHGGGGGCEGFF@FHFGHHHHHHHHCGGGGFHFHGEFGHHHHHGHHGHHFF
+@1446276/2
+CACACGCCGCTGGCCAAAGGCTGAATTGACGCTGCGCATTTCGCAGGATGTAAAACTGTCCCTGCGGATTATCGAAGGGATTACTGAACTCCATACTCAACTCCTGTCATGGACATGTGCCCGGTTAAAGCGTGTCGATAAGCGGCTGCCA
++
+BBBBBBBBBBDBCGGGGGFCCFHFHHHCDGGGFFEEEEAAHHFGCECGGGGFHHHHHEGGHHHHEGCEF?3@GHHHGGFEFFF3FEGFHHHGHHHHHHFHHHDGHEFGFHH22GFD2GHHHHGCFDGFHHHC</?F/C?FEFGFCDGG.CG
+@1479404/1
+CAGGAGTTGAGTATGGAGTTCAGTAATCCCTTCGATAATCCGCAGGGACAGTTTTACATCCTGCGAAATGCGCAGCGTCAATTCAGCCTTTGGCCAGCGGCGTGTGCGCTTCCCGCAGGCTGGGACGTGGTATGCGAACCGCAATCGCAGG
++
+A3AAABCCFBFFGGGGBFGGGGHGHBGHHBGHHHHHHCHHHGGGGGGGGGGGFHHHHGFHHHHHGGGGEGHGGGGGGGGFEHHGHHFGGHHEHHFGGEGGGGGG/EGGGGFDGGDCC/CFHHGG<FCAA.<1FGEGEGCGCCD-::.;C:C
+@485601/2
+GGTTACTATTTCGCTCCGACGTTGCTGGCAGACGCAAAACAGGAAGATGCCATCGTGCAACGCGAGGTCTTCGGCCCGGTGGTCAGTATAACCGTCTTTGATGATGAAGATCAGGTTCTGAGGTGGGCCAACGATTCTCACTATGGTCTGG
++
+BCCCCFFFFFFFGGGGGGGGGGGHGHHHGHGGHGGGGGHHHHHHHHHHHHHHHGGHHGHHHGGGGGGGHHHHHGGGGGGFGGFHHHGHHHHHHGFGHGHHGHHHHHHEFFHHHHHHFHHHHHGCGEGFHGHGGGHHHHHHHHHHHHHHHGB
+@1418744/1
+GTACAACACCGTCCTCGGCGGTATGGCGCTCGATGGCAAGCATTTCTTCTACGTCAACCCGCTGGAAGTGCATCCAAGATCGTTAAAATTCAACCATATTTACGATCACGTTAAGCCCATCCGCCAGCGCTGGTTTGGCTGCGCCTGCTG
++
+A>AABFFABBBF?AEF?EFGCAECG2AEGGGGEGFGGFHGH2GAEHHFFFBFF1FFEFHFGGEGGHHG3B4B4GFFGBG3?FFGFFHHFFG4F4GFEGHHFBGFGHHGHFHFHCGH1?FHFFFEFCCAC?F@G<D0A.//<C@@<C.;CC
+@1499402/1
+TATTAAGCCACTGCTGGCACGCGTCCTGCGATTGCGGTTCGCATACCACGTCCCAGCCTGCGGGAAGCGCACACGCCGCTGGCCAAAGGCTGAATTGACGCTGCGCATTTCGCAGGATGTAAAACTGTCCCTGCGGATTATCGAAGGGATT
++
+CCCCCFFFFFFFGGGGGFGGGGGGGGGHHGGHHGHGGGGGGGGGGHHHHGHHGGHHHGHGGGGGGGGHGGGGGHGGGGGGGGGHHHHHHGHHHGHHHHHGGGGGGGGGGHHHGGGGEHHCGHHHHHGHHHHHHHGGGGGHHHHCGEGGEBG
+@1499437/2
+TCGCATACCACGTCCCAGCCTGCGGGAAGCGCACACGCCGCTGGCCAAAGGCTGAATTGACGCTGCGCATTTCGCAGGATGTAAAACTGTCCCTGCGGATTATCGAAGGGATTACTGAACTCCATACTCAACTCCTGTCATGGACATGTG
++
+AAABCBBFFFFCGGGGGGGGGGHGCGGGGHGGGGGGGGGGGGGGGHHHHHHHHHHHFHHHHGGG?EGGGGGHGHGGGGGHHHGHHHGHHFBGFHHHGG@BDGHHHGHGGCCFHHHGGDHGBGHHGHGHGHHHHHHDGGHFHHGHGHFHHG
+@984218/1
+ATATGGAGGAGATCCTGCCGCCATACTCACAGCCAATGTACACCGTCGCCAGCAGAATTAGCGCCGACTCCGCAGGCAGATGCAACGCAAAGGCCAGCGGCAGTAAGATTGCCACGCCGTTGATCGGTCCCAGGCCCGGCAGCAGACCGA
++
+ABCCBFFFBBBCGGGGGGGGGGGGHHGHHHHHHGHHHHHHHHHHGHGGGGGGGHHHHHGHHHGGGGGGGGGGGGGGGHGGHGHHHHGGGGGHHGHHHGGGGGGHHHHHFHHHHHHGGGG@EGEHHGGGGGHHGGHGGGGGGGGHHGGFGG
+@1500509/2
+TTCAGTGTTGTCCAGCGCGTATTAAGCCACTGCTGGCACGCGTCCTGCGATTGCGGTTCGCATACCACGTCCCAGCCTGCGGGAAGCGCACACGCCGCTGGCCAAAGGCTGAATTGACGCTGCGCATTTCGCAGGATGTAAAACTGTCC
++
+CCCCCFFFFCFFGGGGGGGGGGHHHHHHHHHHHGHHGHHGGGGGGGHGGFHHGHGGGGGGGGGGGHHHGHHGGHHHGGHHGGGG?EGGGGGGHGGGGGGGGGHEHHHGHHHHHGHHHHGGCGGGGGGCHHHGGGGEGHGFCHGGGGGGF
+@1180342/1
+GGTCAAATCAACGGTACTACCGGCTATGAAGAGGCTGCGGAGCAGGGCTTGCTCGCTGGTCTGAATGCCGCGCGTCTTTCCGCCGACAAAGAGGGATGGGCGCCTGCGCGTTCTCAGGCTTATCTCGGCGTGCTGGTGGACGAGCTCTGTA
++
+>AA>1FFFDF1BAA1AEFF1BAEE?FGH221GGH000/AE////FAA/0BECE1A>/E>01DB1G2E11>EEEE>/EF22B?A///CCC0FHB///FA//0A@<A/0ACA<>.CGHHGBC//<00=G..;:@.ECCBF.A9-@--ABF009
+@1507203/1
+GTGTTCCTCCTGTGTTTATTGAGCAGGTAATGGCTCTTGTAGATACAGTGGGGCTGAATCAGCTAGAAAGCGTGATGCCAGCGGAAGCTTGGGAACCTCTACACTGGCTGGCAGAAGGGCTGGATTACCAGGAAGTGCTGGAAGAGTTTAA
++
+A3>ABFBFFFFFGGFBGBFFFGFFHFHBFDFFFFBFC3DHHFHFHFHHGFHHGFGGHGHGFGEGHGFFEBG?1EFHFFFHH1E??EG1GGBEHEHGGHHHFBFGGHGFFGGGHGGHHGGEHGGAGDHFHFGGHCBFDGHFHGHFAC1FGBD
+@420760/2
+GATTAATAACCTGCAAAATAACCTCACCGTAACGGAAACCGGCAAAGATACCGGCGTTCTGAGCCTGACGTTCACGGGAGAGGATCGCGACCAGATCCGCGACATTCTCAACAGTATTACCCGTAACTATCAGCAACAGGATATTGCGCGG
++
+BABCCFFFFFFFGGGGGGGGGGFHHHHHGHGGGGGGFGHHGGGGGHGHHGFHFGGGFGGEHFEGHHHGHGFGGHHHGGGG?FDHHFGGGGGGGHGHFHGGGGGGGHHHGHFHHH1FGFDDHHG?FDGHHHHHGGHHFGFHHHHHHGE?FGG
+@1556107/2
+CGCTTTAACCGGGCACATGTCCATGACAGGAGTTGAGTATGGAGTTCAGTAATCCCTTCGATAATCCGCAGGGACAGTTTTACATCCTGCGAAATGCGCAGCGTCAATTCAGCCTTTGGCCAGCGGCGTGTGCGCTTCCCGCAGGCTGGGA
++
+@ABBCCFFFFCCGGGGGGGGGGGGHHHGGGHGHHHCHFGHHHHGHHGHHHGHHFGHHHHHHHHGHGGGGGGGGGGGFFGHHHHGHHHHHHCCFGHHHGGGGGGGGGGHHHHHHHHHHHHHHGGGGFGGGGGHF?CGGGHH.A?DFEFCFG.
+@832327/2
+TTACAAATCCTTCGTCGGCAACAGCAGCTTAGCGAACGTACGCGCGAACTGTATCAGCAGCAATACCTTGACCTCGGTTCCCGCCCGCTGCTCGACGTGCTTAATGCGGAGCAGGAAGTTTACCAGGCGCGTTTTGCCGAACTGCAAACGG
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHGGGGGGCFHGGGGGGGGGHGHHHHHHGHHHHHHHFHHHHFGHHGGEGGHGGGGGEFGGGHGGGCCDDHGHHFHHHFGCGGHHHGFGHHHHHGHHGHGGG?DGGFHHGGGGGGGGGGFFG
+@755148/2
+TTTGTGAGCAACGCTCTACGGTTTGAGACGGCGCCGCCGATACCCGCTGTTTTTGCCGGAGAAAGTCCGGAACCGAAACCCTTTCAGATGGGGTTACCGGCGCTGGATCTCTTTCCACGCGAGAAGTGGGCGCGAGTAATGGGGCGTCGGT
++
+ABBBBFBDFFFFGGGEFFGGECFCF5FGFDDGGGGE?EGGGGGHFDEEF1FGFGGHHCGG?/FHFFHFD?FCFGECGGGHDHEGG2DDDBCE?<>GFHDGGCG?@GHFHHGGHEHHHHGFFCG-CB9FF??DGGACFFFFFFFFDCD;-D-
+@915344/1
+AGAAAACCTCATCCCGGGATTTTCAGGCAACCCTCCCGGTGATGCCAAAGAGAAAAGTGTAGTTCGTTGACAATAAATTTACATTTCTACAACTTAAAAGGGCCATTTTTGTTAAAGAAGCGAGTCAGCCCGTTTAACCTTTATCCAGG
++
+CCBCBFFCFFFFGGGGGGGGGGHHHHGHHHHHGHHGGGGGGGHGHHHGHHHHHHHHHGHGHHHHHGGHHHGHHHHHHHHHHHHHGHHHHHHHHHHHHFHHGGGGGHHHHHGHHHHHHHHHHGGGGFHGHHGGGHHHGHHHHHHHHHHEF
+@1184469/1
+TTGATATACAGCGCATCCGCACGCGGCGTGTAGATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGAT
++
+BB?BBFFFFFFBAEGEGGGGEGGGGEGGGGGHHHHHFAFGFGHHG0FEGGGGBGBCE@FECECEGGCGG?FFDCCCG-@DGGHHE.ACD:;C:GFGFEEG@-.9-.AB;>BFE.9EFFFFFA.;FFB..;FFFFFFFFF/9B9B/B9D9A
+@1355155/2
+GTTTTACATCCTGCGAAATGCGCAGCGTCAATTCAGCCTTTGGCCAGCGGCGTGAGCGCTTCCCGCAGGCTGGGACGTGGTATGCGAACCGCAATCGCAGGACGCGTGCCAGCGGTGGCTTAATACGCGCTGGACAACACTGAACCCGGCG
++
+AAAAA313DDFFG11EECGGGGG?EGGGGGGGHHFHHHHGFBC1A1GGE/A/>//?1/>/BECG//>//?B0/EFHE/?CGF21B</B////>BCFC//?>///--><AHD0<--<-....;GFFH.:-9A@@;.CF.:A0BBB/.9;@<-
+@418588/2
+TCTCTCTATACCGCTAACTACGTAGAATACCCATAATAATAAGAGAGGCTATTATGATTGAACGTGAACTGGGGAACTGGAAAGATTTTATCGAAGTCATGCTTCGTAAATAAATGCCTGGAAGGCACCGCGCTCCCATAGGGGATAAGAA
++
+BBCCCFFFFFFFGGGGGGGGGGHHHGHHHHHHHHHHHHHHHHHGHHGGGHHHHGHHFHHHFHHHHHHGHHHHHGGGGHHHHHHHHHHHHHHHHHHGGHHHHHHHHGHHHHHHHHHHHHHHHHHHGHHHGGGGGGFGGHHHFHHGFGHHHGH
+@1126365/2
+GTTCAGAATGTAAGACTCAAGCATGGTATCGAAGGCGATACCGCGCAGCTCAATACCGTAATTTTGCAAGACGCCGCGATCGTACTTGAGGTTTTGCCCCACTTTGCGCACTTTTTCATCTTCCAGCAGCGGCTTCAGCAGTTCCAGAGCA
++
+BABBAFFBBFFFBGFFFGFGGGHGFFFGHHEGHFGDEE?EGHGGGGGF0BGHFFHHBEFEGGHHFFGGHBHGEGGFGGGGFEBFHHHHHHHFHHGHGHFGDGAHHFFGGGGGHHGHHHHHHHHHFFEGHGFCG@C0FHEGGHFFHHHHHHH
+@760814/1
+CTAAATACCTGACTAATTTACTCAAGTAAATAGTTGACCAAATTACTCGGGAATGTCAGACTTGTCCCTGCTATGCAATACCCCCATTTTACAATAAAAAACCCCGGGCAGGGGCGAGTTTGAGGTTAAGTAAGACATGAGACTGACAT
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHGHHGHHHHHHHHHHHHHHGGGGGGHHHHIHGHFHHHHHHHHHHHHHHHHHHHHHHGGHHHHHHHHHHHHHHGGGGGGGGGGGGFGGGGFDFGHGGHHHHHHHHHHHHHHHHHHHHHHHHH
+@349683/1
+GCATCCACAGCACGAAAACTCTGTGTTTGTATTGTTGTGTTTCCCATAGCATCCTCATCGGTTCAGAAGCTTTTGCGTGCGGTCGGTTCTGGTCACCAGACCGTTAAATTAGGTGAGTTCGCTTTTCTTACCGGTAATAAATTGG
++
+DDEEEFFFFFEFGGGGGGGGGGHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHHHHHHHHHGGGGHHHHHHHHHHHHGGGGGGGGGGGGGHHHHHHHHHHHGHGGGGGHHHHHHGHHHHHHGGGHGHHHHHHHGGGGGHHHHHHHH
+@883679/1
+GTGTAGCCCATGCCAATGTACGACGTGAAGCGCTTGTTACGCCCGGCGATGGCTTTTAATTCCGCCAGTGCGGCATATTCGGTTGCCGCCTCGCCAACCTGCGGCGGAGTCGCGAGCTGAATGTCTTTCGGCACAATCTGACCTGTCAGCG
++
+AAABBFFFFBFFGGGGGGGGGGGGG?EHGFFCGGGGHHHFGGGGGGGGGGGGHGHGHHHHHHHHGGGGHFHGGGGGHHHHHHGGGHFGGGGGGGGGGGGHHHGGGGGGGGHGGG?FGGHHFHGGGGGGGGGGGGGGGGGGEGGGGGGGGGD
+@319143/2
+GTAGAAACCAAATTCAGCACAGATCCCATCCCCTGAGAAGAGCTGTAGATTACCATCGTGCCGTTAGGTGCCAGACTTGGCGTTTCATCCAGGAACGTTGACGACAGAACCTGTACGCCACCCGTCACCAGATCTTGTTTGGCAATGTG
++
+AA@1AFF1>11>1BGGFF1BBB11A10BBFHCF00FGF1G10011DAFAEDGHHBDFAGH////AA/0DAFE11A/FGFGFG/EECGFD@@F0F0>E>F/FE>//E/GGGAF0B22///?<0?CG?AE1<G0FG2FGH<C0F1?1?G<F
+@187985/2
+GCGCTCAGGGCATCCTCAAACCACAATGTCATCGCCTGAGTATGACGAAACGCCCGCCAGCCGCGCAGCGCGTGGTCAATGGCCTCTTCCGGCAAAAAGCTATTCGCGTGAGCGCGATTATCGACGGCCTGCCATGCCTGACGCAGCTCCG
++
+AAABBCBFF@CCGGGGGGGGGGHGHHHHHHHHHHGGGHGHHHHHHHGGGGGGGGGGGGGGGGGGGGGGGGGGEGGHHHHHHHHHHHHHHHGGGGGFHHGHHHHHHHGGFGGGHGGGGGHGHHHHGGGGGGGHHHHHHHHHGGGGGGGGGGG
+@381257/2
+CGGCAAGCGGCGTCAGCAATTCTTCAGCCTGTAAGCTGTCGTTTTCCGCGTCTACCAACACGGTGGGCTGGCGTTTAAGCGTAAAGAGGGTCAGGTCGGCATCCAGACCTGGCTGAAGACGCCCTTTGGTTTTCAGATTCAGGCTATCGG
++
+>3AAADBBABB@EEAEFBCGGGBFGH5GHFFHHFHBFGDGFDEFGGHGGGGGGHHHGF1CFECFEAEFHDGGGE@EEHGHG/E?/FHHH?EHGGHHHC/@GGHFFHHFHFBGFHEAFHFHGGGCGHHHF.CGEHFGBHFHHGFF.GHHGG
+@72433/1
+GTTTACGTGTTGACCCTGGCATCCTTTCTCCTGTCAAAAAATGTCAGTACGAGTAAAGGTGGCAGTGTAATGGAAATTCCCCGCGGCGGTTGAGGATTTGTTGAAAAAAAATTTCCAGGATTCCATAAAATGAACTTAAATTGATGGATAA
++
+CBCCDFDFFFFCGGGGGGGGGGHHHHHHHHHHHHHHHHHHGHHHHHHHHHGGGGHHHHHHHGHHGHHHHHHHHHHHHHGHGHGGGGGGG>EEEHHEGHHBGFHFHHHHGGG0GH1D?GH=FGGHHGHHHHHF1F1DGFGHBFB00GFCDFH
+@93264/2
+CCTTTACTCGTACTGACATTTTTTGACAGGAGAAAGGATGCCAGGGTCAACACGTAAACTACCAGTCTGGTTGCCCATTTTGGTTTTGCTCATTGCCATGTCCTCTATTCAGAGTGGCGCTTCACTGGCAAAATCGTTATTTCCTCTTGT
++
+AABABFFFFAFBGGGGGGGGGGHGGGHHHGHGHHHHHHHHHHBGAFHHHGHHGGHHHHHHHHFFGHHHHFHHGFHHHHHHHHGHHHGHHGHHHGGHHHHFHHHHHHHHGGHGFGGHGG?EGGGHGHHHHHGHHHFGFGEHHHHHHHHHHH
+@1168648/2
+ATTGTACCCGCCTGAACGCAGGCGGGCTCAATCCAAAAGCAACATTCAGCATTGAACAGATTTCGCCTTCAGTCGCTATTCTGGACTCTGATGATGGAATGGGACACTGCGCGCTGATAAAGGCGACAGACCACGCTTTTAGTCTGGCGAG
++
+BBBBBFFFFABBGGGGCGGGGGGCGC0E1BCDGHHFGH313FFFFF55DFDFEGFDGF?C3BF4?E?EFGFHHHC?ED?F4BG3BFB3F4DGDFHHFHH33FHEH/FHGFFCG//A/GDFH1D//--<CCFHHEDD..<D0/==GF/:@@@
+@1221949/1
+GTTATGGATTGAAGAGGCTCTGGCAGAACAGGGATTTGTCGTGACATTACAGAAAGGCGGTATTCAATTGGTTATTGAGGTTGAAGGTGATGATAAAGCGCAGGTAGCAAAAGCGAATCAGGCCGGACTGGCGGTACAGGCGCTAAGCCGT
++
+BAABCFFFFFFFGGGGGGGGGGHHHGGHHGHHGGHHHHGHGGGHGHHHHHHHHHHHHHGGGGGHHHHHHHHGHHHHHHHHHHHHHHHGFHHHHHHHHHHGGGGGHHHHHHHHHHGGGGGHHGHGGGGGGHHHGG/?CD1G.><-<E0/C-.
+@1273841/2
+TCTTAAAACCCTGCTGCTGTCGCCGGAGCGCGTGTACTCGCGTCAGCAATTGATGGATATTGTCTGGTCTGATGCCCAGGAGACCTTCGATCGGACGGTCGATACACACATCAAAACCCTGCGCGCTAAGCTACGCGCGATCAACCCGGAT
++
+BABCBFFFFBBFGGGGGGGGGGHGGGGGGGGGGGGHGHHGGGGGGFHHHHHHHHHHFHHHHGHHHHHHHHHHHHHHHHHGHGHGGHHHGFHHGGEGGGGGGGGHGHHHGGHHHHHHH/EFFGGCGGFGGGHHHHGGGGGGGGDFFFD?FG:
+@222725/1
+CCAAAATGGGCAACCAGACTGGTAGTTTACGTGTTGACCCTGGCATCCTTTCTCCTGTCAAAAAATGTCAGTACGAGTAAAGGTGGCAGTGTAATGGAAATTCCCCGCGGCGGTTGAGGATTTGTTGAAAAAAAATTTCCAGGATTCCATA
++
+BBBBBBFFFF@FFGGGGGCGGGHFHFGFHFGCFHHGHFHHHGHFBGFGFGHHHHHHHHHHHFGHGHHGHHHHHFGFGEFHHHHBFFFHEFGEHGHHHHHHHHHBHHGGGGGGG/</<2F2FDHF<FA1?FFHFGG.<G<DB0G.0G0=DHF
+@999102/1
+GCTATATAACATAGCAAAGGCTATATTCGATGATTAATTAACCACATTGTTGCGAGGGATACTATGACGAATCTACATCGTCTGAAAACACTCCTGCTTGCCGGTATTGTCGCGATACTCGCGCTATCGCCAGCCTATGCAAAAGAGAAAT
++
+ABBCBFFFFFFFGGGGGGGGGGHHHHHHHHHHGHHHHHHHHHHHGHHHHHHHHGGGGGGHHHHHHHHHGGGHGHHHHHHGHHHGHHHHHHHHHHHHHHHHHHGGGGGHHHHGHGGGGGHHGGGGGGGHGGGGGGGHHHHHHGHHHGHHHHH
+@477489/2
+ATTCAGCGTAGCGCCGCAATACTGCTTGACCAGCCAGAACAGGGAATCGGTCACGATCGTGCAGCCAATGGCGCCGGAACCAATGGCAATCGCAATGATCTCCGGGCTGACGTCAGGATAGAGCGGCAGCATGGGCGCAACAATCGCCGTG
++
+CCCDCFFCCDBBGGGGGGGGGGHHHGHHHHHHHHGHHHHHHHHGGHHHGGGGGHGGFHGHGGHHHHHHHGHHGGGGGGGGGHHHHHHHHHHGGGGGHHHHHHHGGGGGGHHGGGGGGGHHHHHHGGGGDGHHHGHHC?DGGHHHHGGGGGG
+@1312081/2
+CGTTACTACCCGCAAATCGCCCCTTGCATTATCGTCGCGATCCGCCGTGAGGATTCGATCCTCCTTGCCCGGCACGTTCGCCACCGCAACGGCGTGCATACCGTGCTGGCCGGGTTTGTTGAAGTCGGCGAACCCTTAGAACAGGCGGTCG
++
+AABBBBFBFFFBG?EEGGGFEEEDFGHBEHHHHCHHGGCCEFGFAECA01EH3FB31GHAEBFGHGGGHEG?EEGGFCGGGGGGHCG?EC@?C?BFGEFFGGA?GGCH1<0ACGFGFC<C.B00=D.<-@@D-999BB0FFFFF?A?;-9-
+@1331039/1
+GAAGGAGAGCATAGACGCGATATTAATAATTTTGCCGCCGTTGCCCTGGGCAATAAAAAGTTTTGCCGCCGCCTGAGACATAAAGAACACGCTCTTGATGTTCAGGTTCATGACGTCATCCCAGTCTTTTTCCGTGAAATCAATCGCAT
++
+AAAABFBAAAFFGGGFGGGFGGEGGFFHHHHHHHHHGGGGECGGGGHHHGHHGGHHHHDEFGHHHHHGGGGGGGHHHBGHHHHGHHHGHHDEEFHHHHHHHHHGHHHFFFHHHHDFEEFFHHHGHFHHHGHHHGFFGGGFFFGH1CFGG
+@1257036/2
+GTGAATGGTGCGGTTGGACAATGTTACCGATAACAGTTACCCGTAACAAATTTTGCAACTTGTAGAGTGGGGGCCCGCTTTGAGCACGACTAATCATGATCACCACGTTTACGTTCTGCTGGGCGTATCAGGCAGCGGTAAATCCG
++
+A3>AAFFBFFBDEECGGCFGGGHFH6BG2AEEFC3FFGHCGHDFAEF5FFGHGHFGHEHGGB5EFGDDF1FCECEFGCGGGEG/FGFGGGGCHHFGHGFHHHFGFHD?FFGFCCGGFE2F22A/@DGDFBDHHAEGCC<CFDGHHG
+@1339325/2
+GCATTGGGCGGTAGCGCTTCTCCGGCATAGACGCGCGACCATGAAATGGTATAACCGCGATCTTCAGCCCATTTCAGATAAGCGCCAGCGGATTCAAACGACTCATGGACAACAAAATGAACTCGCACGTTATTTTCTCCTGTTAGCGATT
++
+BBBBAFFBF@DDFGGGGFGGGCHGGGGGHHHHGGGGGGGGGHHHHHHHGHHHHHHHGGGGGGGGHHHHHGHGFHGHHHGHGHHFCGDGEGGFFDFHHHF?GCGDFFHHHHHGHEEHGHHGHEFHGGGGDGHHGHHHHHHHHHGHHHGAGFG
+@1228664/2
+GTGTTAATTGGCGAGAGATCCGGGTTGATCGCGCGTAGCTTAGCGCGCAGGGTTTTGATGTGTGTATCGACCGTCCGATCGAAGGTCTCCTGGGCATCAGACCAGACAATATCCATCAATTGCTGACGCGAGTACACGCGCTCCGGCGACA
++
+AAAAAFFFFFFFGCFFGGGGGGECEFFHFHGGGGGCFGGHHHHHGGGGGGGGGGGGHGHHHHHHHGHHGHGGGGFGGGGGGFFGGHGHGHHHHGHGHHHHHHHHHHGHHGHHH1FHHGHHHGHHHHGGGGGG?GHHHDG?@DGGG?DGAFA
+@974014/2
+GTGGATGCCCGTCGCGCATAATGGCGACCGAGCAGTTTGCCGTACCGTAATCAAATCCTATAAACACCTTAAAATCCCCATGCCAGTGAAGAAGGGGCGTGACTTTAGCGAAATGTCGTCGCGGCGACAACTGGAATATGAAAGCAAGGCG
++
+A>ABBFFFFFBCGGGGGGGGGGHHHGCFGFGFGCBHHFFHHGGGGGGEHCFHFHGHHHHHHHHHHHHGHHHHHHHHHHGHHHHHHHHHFHHHHHHGGGCBFGGHHHHHHGGGCFFHHHGGGGGGGFGGGGHHGGEGGGGGGFGGGGGFGGG
+@1124849/2
+TTGATATACAGCGCATCCGCACGCGGCGTGTAGATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGAT
++
+BBBBBFFFFFFBCGGGGGGGGGGGGGCGEFEGHBFHFFFGHFGHGGFEGGGGHHGFHHHGGEEFGC</DCGFGCGGGGGCACFACAFDCD?HGHFEACGEA?EGBEFF=@DFFFFFFFFF9A.FFF.9.;FFFFF/;DFB/FFFFFBDEA
+@735626/1
+CTCCTACGGGATGTTAGAAGTTAACCGTCTGGCGGGCCGCGAACTGCCGGTGGACGGCGGTTTCGACGATAACGGTCAGTTGACCAAAGAACCGGGCGTGATCGAGAAAAATCGCCGCATTTTACCAATGGGTTACTGGAAAGGATCTGGT
++
+BBBBBFFBBBAAGGGGGGGGGGHHHHGGGHGHHGGGGGGGGGGGHHHHGG/EEGHFGGGGFGGHGGGGGGGGHGGGGGHGHHGFHHHHHHFHHGGGFGACDFHGDGGGGGGGGGGGGGGGGGGFFFFFFFFFFEFFFFFFFFFFFFFFFBB
+@3729/1
+GTGTTCATGGTGTCCCCTGCAGGAATCGAACCTGCAACTAGCCCTTAGGAGGGGCTCGTTATATCCATTTAACTAAGGGGACAACGCGGCGCCAGTATAGCGTTTTTTATTCGCCGGAGTAAGTGTAGCGCCGCCTGACTGGTTAAACCGT
++
+BABCCFFFFFFFGGGGGGGGGGHGHHHHHHHGHHGHHHGHHHGHHHHHHHHGGGGGHGGGHHHHHHGHHHHHHHHHGGHGGGGHHGGGGGGGGGFFHHHHHGGGGGGGHHHHHGGGGFGDHHHHHGHHGGGGGGGGHHHHHHFHHGGGGGD
+@470901/2
+CCTTTACTCGTACTGACATTTTTTGACAGGAGAAAGGATGCCAGGGTCAACACGTAAACTACCAGTCTGGTTGCCCATTTTGGTTTTGCTCATTGCCATGTCCTCTATTCAGAGTGGCGCTTCACTGGCAAAATCGTTATTTCCTCTTGT
++
+CBCCDFFFFDFCGGGGGGGGGGHGGGHHHGHGGHHHHHHHHHGHHGHHGHHHGGHHHHHHHGHHGHHHHHHHGHHHHHHHHHGFHHGHHHHHHHHHHHHHHHGHHHHHHHHHHHHHGGGGGGGHHHHFHHHHHHHGHHHHHHGHHHHHHH
+@869153/2
+CATATAGCCCTTGCCTGCGCGTATCGCGGCAAGCGGCGTCAGCAATTCTTCAGCCTGTAAGCTGTCGTTTTCCGCGTCTACCAACACGGTGGGCTGGCGTTTAAGCGTAAAGAGGGTCAGGTCGGCATCCAGACCTGGCTGAAGACGCC
++
+BBBBBFFBFC4FBGGGGCAEGEFGG??EGGGGGGDAAEE@AEGBHFFF3GHHHFHFAGHBGHHBBGE?EEF4DEEEEEFHHHGH?CFGG?FFGEFDDDCDCFEHFHG?DDFDGFEGFHHFHGFF?@@GHHHGFFCCGHHGGF0CBFDGG
+@1520082/2
+CGGTTATACTGACCACCGGGCCGAAGACCTCGCGTTGCACGATGGCATCTTCCTGTTTTGCGTCTGCCAGCAACGTCGGAGCGAAATAGTAACCTTTACCTTCCGTTTGACTTCCACCAGTAATCACACGGATATGGCTGAGGGCCTTCG
++
+AAAAAAFFFFF5FGGGGGGGGGGGGGGHHHHGGGGGFGGHGGGFGHGGFFHHHHFHHHFHGGGGGGHHHGGHFHEHHGGGGGGGEGHBEHGHFHHEHHHHHGHHGFHHGGFHHHHHHCGCGGFHHHHHGGCGGDHFF.CFFFADDGCFHH
+@1253528/1
+CTTCTGAAAGATTGATACACTACATAACCAAAAAGCATAGCAGACAGGCATGGTATTGCTGGTATAAGCAGGTAACATGGCTGTTATAAGTTGATAACAAACTCTTGCGCCGCGTCGTGATAGTTTGCAGACCTTCAAAGTTTGTGTTGCG
++
+BBAABFFFFFFFGGGGGGGGGGHBGHHHHHHEAGGHHHFHHHGHHEHGGHHHHHHHHHHHHHHHHHHGHGHHFHHHHHCFHHFHHHGGHHGHFHHHFHHGHHGHHHHHGGGGFGGGGEEHHHHHHHHHHHHHAHFHGHFHDGHHG2FCAGC
+@620256/2
+GACAAGAGGAAATAACGATTTTGCCAGTGAAGCGCCACTCTGAATAGAGGACATGGCAATGAGCAAAACCAAAATGGGCAACCAGACTGGTAGTTTACGTGTTGACCCTGGCATCCTTTCTCCTGTCAAAAAATGTCAGTACGAGTAAAGG
++
+CCCCCFFFCFFFGGGGGGGGGGHHHHHGHHGHHGGGGGHHHHHHHHHHHHHGHHHHGHHHHHHHFHHHHGHHHGHFFHHHGHHGHHGHHHGHGGGGHHGHHHFHHHFGHHHHHGHGHHHHGHHHHHHGGFFHGHEHHHHHHHGGGGHHHHF
+@495840/1
+TTCGCTGACCGCGCCATGCTGCGCCAGAGTCTCTTCACGCACGCCAATCATCTGCGCTTTGGCTTCATTACTATAGGTGACAAAGCCGCGTTCAAACCAGGCGGAACTTCCGGCGATGTCGGTAATGGCTTTCGCCAGCCAGCCGCCGGTA
++
+CCCCCCCCFFCCGGGGGGGGGGGGGGGGHHHHHHHHHHHHGGGGGGGHHFHHHHHGGGGGHHHHHHGHHHHHHHHHHHHHHHGFGHHGGGGGGHHHHGHGGHGGGGGHHHHGGGGGGGHHHGCEGHHHHHHHHGGGGCGGHHGGGGGGGGG
+@964913/2
+GCTATATGGATGCTCTCGGGCCGGGTGACATGGTGGCGACATTACAGCGCCTGGCCGCACTTTACGGTCCTCGTTACGCGCCTTGTGAACAATTAGAGCGCATGGCGGAGCGCAGGGAGCATTTCTGGACGAATGGGGAAACTGACCAGGG
++
+AAAAAFB3D1BC1FFGGGF1EEE?0EA01DGHA1BEF/EEEGHHBGABAAE/FGFEE/EG?11@1FEHCEBBE?//?F?EE///<F1>2GFF1DFF1BFCGCC?HHGGCG--<CGGCF<A.0<=DCGHBF?-;GH/CC.AEFBFFBF/A.9
+@712253/1
+GGAGAAAGGATGCCAGGGTCAACACGTAAACTACCAGTCTGGTTGCCCATTTTGGTTTTGCTCATTGCCATGTCCTCTATTCAGAGTGGCGCTTCACTGGCAAAATCGTTATTTCCTCTTGTCGGCGCGCCGGGTGTAACGGCGCTTCGT
++
+BCCCBFFFFFFFGGGGGGGGGGHHGGHHHHHHHHHHHHGHHGFGGGHHHHGHHHGHGHGGHHHHHHHHHHHHHGGHHGGHHGHHHHHFGGGGGGGHHHHHHHHHHHHGHHHHHHHHHHHHHHHGGGGGGGGGGGCCDHHHFAFGGGGGGG
+@1404882/1
+GGTTCGGTACGACCATCGCGATGGTGTGCGAGGAGGCAGACGCCAGCGCGCTGGCGGCGAGATTAGGCATATAGCCCAGCTCATGCACTGCCGCTTCGATTTTTTCCCGGAGTTTATCAGAGACCTGTTCCGGCGTGCGTAAGGCTCGTGA
++
+CBBABCBABCCBGGGGGGGGGGGG3GCEHGGGGGGGGGGGHGGGGGGGGGGGFFGGGGGGCCGHHHHHHHHHHHHHHHGHGHFHGGHHHHHHGGGGGG.FGGHHGHHHGGCGGHHHHHHGHFHHGHHHHHHGGGGABEAEGG?FGFFFAEB
+@825481/1
+GTATGTACAGTTTGTAACCTGGTTCGTTGGGGATGGAAAGTGGTGAAACGAGGGGATGATGATTCTGGATAGAGGTTCGCAAAAAATGGAATGCGGTTGGCGCTGGGTTTTTAATTTTTGTACTGTGAAACGATGATGCTATACGCCATTG
++
+BBBBBFFFFFFFGGGGGGGGFFGGHGEHHH?EFEFCFHHHHFHBAGHHHG?EGGGDGGHHHGGHFGHFEHHHFGHHHHGGGGEFHGHHGHHFHHGGE@EEGGGFGGGHFDGGHHDGHHHGFFHHHHHHFHHEDHGHHGFHHHHHGGGGGHG
+@187477/1
+GATCACGATGGTAGATATGTCGATGTCGATGTTCTCCTACGGGATGTTAGAAGTTAACCGTCTGGCGGGCCGCGAACTGCCGGTGGACGGCGGTTTCGACGATAACGGTCAGTTGACCAAAGAACCGGGCGTGATCGAGAAAAATCGCCG
++
+DDDDDFCBCCDFGGGGGGGGGGHGHHHHGGHHHHHHHHHHGGGGGGHHHHHHHHHGHHHGGGHGGHGGGGGGGGGGGHHHHGGGGGHHGGGFFC?DHGGGGGGGGHGGGGGHHHHHHHHHHHHGGGGGGGGGGGGGGFFFFFFFFFFFFF
+@858508/1
+ACTCTGAATAGAGGACATGGCAATGAGCAAAACCAAAATGGGCAACCAGACTGGTAGTTTACGTGTTGACCCTGGCATCCTTTCTCCTGTCAAAAAATGTCAGTACGAGTAAAGGTGGCAGTGTAATGGAAATTCCCCGCGGCGGTTGAGG
++
+CCCCCFFFFFFBGGGGGGGGGGHHHHGHHHGHHGHHHFHHHGHGGHHGHHGHHHGHHHHHHHGGHHHHHHEHHHHGHHHGHFHHHHHHHHHHHGHHGHHHGGHGHHGGGEFHFHHFGGHHGHGHHHHHHGHHHGHGFHGGGGGGGAD@/<G
+@67351/2
+ATAATATGGTCAGCGCCCCGACTAAAATGGTCAAACTTAACACCAGCGAGTAATCGCGGTTGAGCGCGCCATTAACGAAAAGCTGCCCAATGCCCGGTAAGCCATAAATAGTTTCAATCACCATTGAGCCGGTAATAATGCCGACAAAGG
++
+CCCCCFFFFFFFGGGGGGGGGGGGHHHHHHHHHHHHHHHHHHHGHHGGGGGHHHHGGGGGGGGHHGGGGGGGHHHHGGGGGHHHHHHHHHHHHHHGGGGGHHHHHHHGHHHFFHHGHHHHHHHHHHHHHGGGGGGHGHHHGHFGGGGHHG
+@1041099/2
+CTTATAATGGAAGATAAGACCTGTCTACAACATGACAAACAAAAACAAATGCGTAACGGAACTTTACGAAACATAGACACTCTAACCTGTTGCTTGCTCATAGTGCGGCTTATGGAGTGGCGTTTCGAAAGCGCGTGGAAATTTGGTTTGG
++
+BCCBCFFFFFFFGGGGGGFGGGHHHHHGHHHHHHHHGHHHHHHHHGHFHHGGGGGGGGFGGGHHFDFGGH?EHHHHHHHHGHEHHHFGFGFFHHHHHHFHHHHGHHCFGGGHGHHHHHHGGGEEDGGGA/CG?CCFGG?FHGHHEFGHAAF
+@801265/1
+AGCGTGATCTCTGCCGAGCGTGATCACATCGGCATTTCTTTAATCATTTATTTGCATTTTATTAACACAAAATACACACTTCGCTTCATCTGGTACGACCAGATCACCTTGTGGATTCAGGAGACTGACATGCTTTATAAAGGCGACACC
++
+AAAAABAFFF5BGGGCEE?EAEEFFGGHHFEDECEGGHGEHHHHBGGGDHHDHFFHFHHHHHGHHHHBGGHEDF3FBGGHHFGFEEEDF4GFF3FFEGGGEHFF33303BFBF?3FGGGGHEFEFFGH1BFGFFGFHHGGFH1CC?/?//
+@1291817/1
+ATTTAAGTTCATTTTATGGAATCCTGGAAATTTTTTTTCAACAAATCCTCAACCGCCGCGGGGAATTTCCATTACACTGCCACCTTTACTCGTACTGACATTTTTTGACAGGAGAAAGGATGCCAGGGTCAACACGTAAACTACCAGT
++
+A?AAAFBD5BDFGGFGGGF5FBGFHBFHGGHHFGHGGCGGHHFHHGHEHHH3210E00A0E@EGGECFGHHDFFGB3G333B3B0GDBDFGAHGCGFFHGBHHFB/DAFD1/<FC?GHFHD<GCF1..><0FFGEA<CCGHFD<CC00
+@1312319/1
+GAGGAAATAACGATTTTGCCAGTGAAGCGCCACTCTGAATAGAGGACATGGCAATGAGCAAAACCAAAATGGGCAACCAGACTGGTAGTTTACGTGTTGACCCTGGCATCCTTTCTCCTGTCAAAAAATGTCAGTACGAGTAAAGGTGGCA
++
+BBBCCFFFFFFCFGGGGGGGGGHHHHHHGGGGGHHHHHGHHHHHHHHHHHHHHFHHHHHHHHHHGHHHHHHHHHHGHHGHHGHHHHHHHHHHHGHHHHHHHHHHHGHHHHHHGHHHHGHHHHHHHFHGHHHHHHHHHGGGGHHHHHHHGGF
+@1052/1
+CCTGATTATTCTCCCCAAACAGTCCCCAGCGGCGGGGCGGTCCCCGCAGACAGTGAATTTCCCGCCGCGCCCTTTTCGACGGCGGCGCAAAAAAACCCCAAAAGCCCGCTGGCAGCACCAGGATAGGGCCGCCGATCAACCACGGGACCAA
++
+AAAAAFFBFFFFGGGCG?GGGGBFFH4G?CAEAGGGG/>/>/<GH/>/>/0B22?222@F2@D/<///---<-<CD0-<.---:------;9.--99AD..../.9.;--;-9.9...9..9.;///..9-9---9-:/;:.9.9-.-..;
+@1470639/2
+CCGTTACACCCGGCGCGCCGACAAGAGGAAATAACGATTTTGCCAGTGAAGCGCCACTCTGAATAGAGGACATGGCAATGAGCAAAACCAAAATGGGCAACCAGACTGGTAGTTTACGTGTTGACCCTGGCATCCTTTCTCCTGTCAAAAA
++
+BBBCCCCFFFBCGGGGGGGGFGGGHFHHHHHHHHHGFHEGHHHGHHHHHBGHGGGFGFFHHHHHGHGHGHHHHHGGHHHHGFHHHGHHGHGFHFHHHHGGHHGHGGHHGGHHDHHHHGFGGFHHHFHHHHGHHHGHHHGHHGHHHHGHGHH
+@1541123/2
+ACGAAGCGCCGTTACACCCGGCGCGCCGACAAGAGGAAATAACGATTTTGCCAGTGAAGCGCCACTCTGAATAGAGGACATGGCAATGAGCAAAACCAAAATGGGCAACCAGACTGGTAGTTTACGTGTTGACCCTGGCATCCTTTCTC
++
+AAA@AADD1DD>EEFFBGF0AEGEC?EEGGGGHHFEFGHHHH1BFFFFHFFHFHHEGF1FEG?EGGEGGHFHGHHBCGGFHFHHHFFHEHHGHHHHGHEGAGHBHHFFHHGEHGHHC<1GGGFGHFGBFFHHEHHFHEFGHHFHHDHH0
+@1550424/1
+CTGGTAGTTTACGTGTTGACCCTGGCATCCTTTCTCCTGTCAAAAAATGTCAGTACGAGTAAAGGTGGCAGTGTAATGGAAATTCCCCGCGGCGGTTGAGGATTTGTTGAAAAAAAATTTCCAGGATTCCATAAAATGAACTTAAATTGAT
++
+CCCCBFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHGHHHHHHGHHGHHHFHHGGGEHHHGHGHFHHGHHHHHHHHHHGHGHHHHGGGGGGGEGGGGF22GF3?C?3FGHHGGGFCG?FHDG.<G1F11><GGDDFGDFG0DGFH0=0
+@446335/2
+CTGGATACCCGCGTCACCAATATCGAAAACGGCATTGGCGATATCGTCACTACCGGTAGCACCAAGTACTTCAAGACCAACACCGATGGCGCAGATGCAAATGCCCAGGGTGCGGACAGCGTCGCGATTGGCTCTGGCTCTATTGCTGCCG
++
+AAB@AFFFFFBBGGGGGGGGFGH5F2GFGHGGGGGHGHGCGFGGHAGHEEBHHHGGEGGGHHHEHADGHGHHHHHHHHHHGGGGGGE/EHCEG@E2GF2BDDGGHHHHG?<</BDCF?FHC.C@C?-@.EAGFHHHGFFHHG0C0GCGCG-
+@18797/2
+GTGAAAACCGATGGCCGCGCACAGGTGATCCCATTCCGTACGCAGCCTATCGACACCGTGCCGCCAGCAAACCAGGATCATGACGCGCCGCTATTGCAGCAGTATTTCTCCTGAGGATTTTCGCCCGGTGGCGGCTACGCCTTACCGGGC
++
+BAABCFFFCCBCGFGGGGGGGGGHHHHHHHGHHHHHHHGHGGGGGGHHHHH1FGGGGGHHGHGGGGGGHHHHGHHGEHGHHHHHGGGGGGGGGGHHGHFHHHHBHHHHHHHHHEGGHHHHHHGGGGCCDCGHGGGGGGGGGGGGGGGFFG
+@837693/1
+CTATTTATCCATCAATTTAAGTTCATTTTATGGAATCCTGGAAATTTTTTTTCAACAAATCCTCAACCGCCGCGGGGAATTTCCATTACACTGCCACCTTTACTCGTACTGACATTTTTTGACAGGAGAAAGGATGCCAGGGTCAACACGT
++
+BCCBCFFFFFFFGGGGGGGGGGGHHHHHHHGHHGGHGHHHHGHFGHHHHGFGHHHHGHHEHHHFHHHAECGGGGCGGGGHFFBFGGHHHGHGFHHHEHHHHDHHHGHGHHEHHFHHHHGGGGGHHFFFHHHHEBFHHHGHEGCHHGHHGGC
+@843699/1
+AATATGTTGTACGCTACCAGGGCGGTCACAACGCAGGCCATACTCTCGTAATCAACGGTGAAAAAACCGTTCTCCATCTTATTCCATCAGGTATTCTTCGCGAGAATGTAACCAGCATCATCGGTAACGGTGTTGTGCTGTCTCCGGCCG
++
+A?AAAFFFFFFFGFCEGCGGCEDG?EEGHHHEGFGEGGGDHHGHHGHGFFHGGHHHDEEGFHHFHGGGCEEHGHEFGHHHHHHFHEHGFHHFHHHHFHGFFGDGGGHHFFFF22GAGHHFHHFGDFGHDCCGADHHGGHHHHFDFA?@@D
+@372334/1
+GGTCAGTTGCAGGCGCTAAATCAGGCGGATGGCGCCATTACATGGACGGTGAACCTGGATATGCCTTCGTTGTCGCTGCGCGGCGAATCTGCGCCGGCAACCGCGTTCGGCGCGGCTATTGTTGGTGGTGATAATGGCCGCGTCAGCGCCG
++
+1>>A1B331D11BE1A1FEDF3B110A00EE/BEC/BCG21B2FCH1A//A/B1>CGHGHFBB21B1BFFGGGF///?/EE@EEBCGC/22DB@////>-F<-A-<-<<-<C:@---.0;B009EGGGBEFFFBF00/;-;@-9-ABB@@-
+@82134/2
+GTCTATTTATCCATCAATTTAAGTTCATTTTATGGAATCCTGGAAATTTTTTTTCAACAAATCCTCAACCGCCGCGGGGAATTTCCATTACACTGCCACCTTTACTCGTACTGACATTTTTTGACAGGAGAAAGGATGCCAGGGTCAACA
++
+AABCBFFFBFFFGGGGGGGGGCHGFHHHHHHHHHHHHHHGHHHHEHHHHHHGGGHFHFHHFHHHHHFHHFGGC?EGFGGGDHHHHHHHHGGHHHGFHHHHHFHHHHHGHFHHHGHHHHHHHGGF1FCFAFEEHFACHFGHEB.EHGFHHH
+@858525/2
+GTCTATTTATCCATCAATTTAAGTTCATTTTATGGAATCCTGGAAATTTTTTTTCAACAAATCCTCAACCGCCGCGGGGAATTTCCATTACACTGCCACCTTTACTCGTACTGCCATTTTTTGACAGGAGAAAGGATGCCAGGGTCAACA
++
+3>>AAFFF5DFFDEGEGGGFGGHHHHCHHHHHHHH5DEG4GAGE33FFHHHG?EGHHFHHHFF3FFGHHHCGG00EEGGGGHHDG4DGDDB3BG110??GFBDHHFHFHC/GB1@<@FGFF//FHF<FCFGFGHAGHHG00GC<<CHHHG
+@1365973/2
+CATCAACACGGCGCTGACGCGGCCATTATCACCACCAACAATAGCCGCGCCGAACGCGGTTGCCGGCGCAGATTCGCCGCGCAGCGACAACGAAGGCATATCCAGGTTCACCGTCCATTTAATGGCGCCATCCGCCTGATTTAGCGCCTG
++
+>AA11BFFAA1A1EEE00AE?C/E?GHHFHCFGHCFCFCFCGGFBGEC/EEEGGGCC/E/>EFFEE?@C?C?GHHGGGCG-C-@C@--A@HGFGCFHH0G;CGGB/90CGGFCAABBEFGG0C0CF@G@.AFF??BB-9BFFF/B-@@FE
+@1097798/2
+ATCCGCTACTGGCCTCATGGGGAAAACTGGGACGGGATTATATCTACCTGCTATCTGAACTGGAAAACAGCCAGGAGCTGGATGCGTTTGTTGATATTACGCCAGATAATCTTTTGCATCGGATTCAGGCGGACATCCTTGAACTGGAAAG
++
+>AA?ABAD2C444CFGFFFFAE2EHFFHHHHFHGCEAEFFFH5BFGBBGGFHGDGBGHDFFHHHHHHHEFAGFHE1FACFBFGFB/?EEEBFG4FGHHBHGGGFGGHFGFFHGD?D3FD4?EDBDGFGFHGGGGC110<?<DGHGHHFFD0
+@1256704/1
+AGCCATTACCGACATCGCCGGAAGTTCCGCCTGGTTTGAACGCGGCTTTGTCACCTATAGTAATGAAGCCAAAGCGCAGATGATTGGCGTGCGTGAAGAGACTCTGGCGCAGCATGGCGCGGTCAGCGAACCCGTAGTGGTCGAAATGGCG
++
+BBBBBFFFBFBBGFGGEGGGGGGGHHHFEDGFCHCGHGGHHHGCGGGEGHHFHHGHGHFHFGHHHHHFHHHHHHHGGGFGHHHHHHHFEFGGCFGGGHHHHHHFHHHHGGGGGFGHEHCGGFGGDHHGGGGGGGGCDCGH0G--CEEGGFG
+@2230/2
+TCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCGTCTTACACTCGAAGCGCGGTTTAATTGCCTGGTCAGTGAAGATAACGTAAGACATGTTCCCGCAGGAGGCATCCAGCGCAAAGTC
++
+BABBBFCCCCCFGGGGGGGGGGHHGGGGGHGHGGGGGGGGGGHHHGGGGGHHHHHHHHHHGGGHGHHHGHHHHHHGHHGGGGGGGGGHFHHGHHHHHHHHHHHHHGHHHHGGHGHHHHHHHHEFFHGGGGGGGADFGHGHHHGGGCGH<G
+@1182879/1
+AATCAGCGTCGGTCAGTAAAGAGGAAACTTCTTTTGCCAGCGTAGCCGCATCGGTAATCGTGATAAGTCCGCTCGCCTGATCCAGACGGGCGCAAATATCTTTAAAGTTAAAGGTATGCGGACCCATCAGTACCGGAATCGCATGAGCGG
++
+CCBCCFFCCBCCGGGGGGGGGGHHHHHHHHHHFHGHHHHHGGGGGGHGGGGGGGGHGHHGHHHHHHHGHHGGGGGGGGGHHHHHHHGGGGGGGGGGHHHHHHHHHHHHHHGHHHHHHHHGCGGGGHHHHHGHHHGGGGGHFGGGDHEFDG
+@32090/2
+CAGATGACGCATCCACTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGTCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCTTCTTACACTCGAAGCGCGGTTTAATGGCCTGGTCAGTGAAGATAGCGTAAGACATG
++
+>1>11B31111>ABA1BG11F3BFG000EE0A00AB//A/ADF2FAFG0A12FE?EAE/C1A/BE/B////>BFD>EE//>B2BB2B2@1D12222>BFFB11FFFA0FEECECCCG1GD2<0@F</@1@022?F11??1?</<C01>01>
+@1013625/2
+ATATCGTCGCATGGGAGTCAATATCATTAGGTCTCCTGGTCGGATTGATACATTCCAACACCTTTTATTTTTCACGAAGTTGAGGTTTGAACCCCAAATTCTAGCAAAAATAGGCTTAAAAAGCACCTCAGGGAATAGTCTTAATCCGAAA
++
+1>AA1A>?11DACGFBFAFF3AAFDFHFHHG111FDFFGGHC/ACGEBFGHBGHFD2F1//ECGHDDGH22FFDD>EAE/1FFCG>FGE1GHE?ECEEBGFFHEFHBG0GGD1BFFGFB1FB<0<GHE01BCGGFCG1BGD2B2G2@C/CG
+@1503635/1
+GTCCATTACGGACATAGCGGATACTGCTTCAATGATTTGATCTTTAGTGATAGACATTTAAATTGTTCCTGAATATCAGAATAAGTTTATACGTAAGCAAATGCTTGATAAAGACAACTGCGATTACGCAGCTTCTTTTGCATCGCGTACA
++
+AAAA1DFF1AAAEAGGFCEC0ECHGHHGHGGHGHFHHHBFGAGFFHFF1FGGB1FGFHHGHFHEHHHFHHHGHGBHFHGFHHHGHHHGHGHGFHGHEHGHFHHHHFFFFFHHFHFGC>1GFFCHGGHAEGGGCHFHHFGHHFF1C/C/BBC
+@53747/2
+GCCTCTGAGCAGATGGACTTTGCGCTGGATGCCTCCTGCGGGAACATGTCTTACGTTATCTTCACTGACCAGGCAATTGAACCGCGCTTCGAGTGTAAGACGATTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACCA
++
+>1111@11DFF11BFGBGG1BD1E?EEGHGG0EFB0FFFG/E//F01F2FB2F1C0BF/2EGHHHB1F1G10?G/01BFB1FC@GEG>/EE/BB/B222BFCG/?FFFH2>B1<G1FCG/BCBCFFFG?/@C?A/@FCFBCC.A<<GF.<
+@612029/2
+GCCAGTGCAACGACAGATGCGATAAACGTGGCCGTCGTATAGTATTTAAACGTTTCATTCAGCGTAGCGCCGCAATACTGCTTGACCAGCCAGAACAGGGAATCGGTCACGATCGTGCAGCCAATGGCGCCGGAACCAATGGCAATCGCAA
++
+CCCCCFFFFFFCGGGGGGGGGGHGGHHGHHGGHGGGGGHHHHGHHHHHHHHGHHHHHHHHHHHGGGGGGGGGGGGGHHHHHHHHHHHHHHGHHHGHHHHGGHHHHGGGGHGGHHGHHGHHHHHHHHHHGGGGGGGGGHHHHGGHHHHGGGG
+@1145610/1
+CCCCCTGATGCGCGGCGCGTACTTTATCTTTGTACTTATTCCACAATACGGAACCCGCTACCGCGCCGCCGCCCACCAGCAAAGCGCCAGTACCGTATTTGGTTAATAATTTGCGCGAAGACTTATTGGCGACCAACAGTCCAGCCAGAC
++
+ABBAADABFFFDGC2EEEA2EEDHHGGHHHHHHGHGFGHHHHHHGHHHHHGGGGGGGGGEGGGGGGGECGGCCGGFGFAEHHHHHGGCGGB1GHDFHHGGHG<CHHHE1>DGDBCGGCCGDBCGGHFCBG?D@?BEGGFGGGGGEGGGG?
+@1389975/1
+AATTAATCATTTAAAAAATAATGATAAAATAATCAGCGAGCGGCTGGCGGGCATTCGTCTGTTGTATGGTGTTGAACCGGGGCCGCGCACGCCGGTCATGTATCAGCCTGGCATCATATTTCTCTTTTCCGGCCATAAAATTGGCTATATT
++
+BBBBBFFFFFFFGGGFGGGGGGHHHGHHHHHHGHHHHGGGGGGGGGGGCEGGGGHFHHGHGFGHGHHHHFHHGHHHHHGGGGGGGGCGCGGGGGGGGGHFHGHBGFHFGFHHGHHHFFHHHHFFHHFHFHGGGGGGGGBFGGFGFFFGFFF
+@972445/1
+GGATACGCCTATCGCCACCGGGGAAATGCTGACCAGTTTCCGGGAACACGAGCAGTTGATTCTGGGCAATGCCAGCGATTTCGTTCAGCCAGATGCGCCGCGTGTCGGCGGTATCTCTCCTTTCCTGAAGATTATGGATCTGGCGGCGAAA
++
+CCCCCFBCBFCFGGGGGGGGGGGGGHHHHHFHHHGHHHHHHGGGFGGHHDEGGGGFHHHHHHHHHHHHGGHHHGHGGGHHGHHHHHHGHGHHFHFGGAFGGGGGGHGGGGGCFGHHHHGHHHHHHHHHFHBGHHHGHHHHHHHHGGGGGAG
+@667554/1
+TTTCAGGCGTGAGCAAATGATTTTATCGCTGTTCAGGATCGGCACATCCTGGATAGCCATATTATTGAGGTTCGGATTCTCGACACGGATATTCATTGTCTGAATTAATGAATGGCCGTTAGCGAGAGAGGATTCGTGCTTCTGCGCCTC
++
+BCCCCFFFCBCAEGGGGGGGGGHHHHHDGHGGHGHHHHHHGGGGGHHHHHHHHGHHHHHHHHHHHHHHHHHHHGGGGGHHHGHGGGGGGGGHHHHHHHHHHHHHHHHFHHHHHHHHHGGGGGHGGGGGGGCHHHHGHGGGHHHHGGGGGG
+@1046573/2
+GGTGGAAAATGCCTATGGCGAGCTGGTGGCGCAGGGCTGGCTGGAGCGACGTGGCCAGGCAGGCACGTTTGTGAGCAACGCTCTACGGTTTGAGACGGCGCCGCCGATACCCGCTGTTTTTGCCGGAGAAAGTCCGGAACCGAAACCCTTT
++
+AA>AA1F1BDFD1FGCABCAEEEEBF0BEGGGGGGCAH/AEHGC0BGCEC@/EFEFHEHFACGAGFFHHF?FFHFFBGAEE/??G1FF0FEF1FCCCGC//>@CC-<->CHHGGCCAFFFGGGFCC-A-.//00;.-.-9;?-@@@.9-;F
+@139215/2
+AGGGATTTGTCGTGACATTACAGAAAGGCGGTATTCAATTGGTTATTGAGGTTGAAGGTGATGATAAAGCGCAGGTAGCAAAAGCGAATCAGGCCGGACTGGCGGTACAGGCGCTAAGCCGTTGGCGAGTGGGTTCGTCAGGGAAGGGGGG
++
+3AABAFFFFFFAFFGGGGGFGGHGHFCHGGGEEGFGCEGHHGDEA35EGHH3BGCA5FAFDGHFHHFFHEDGGEF?5FBFFHHFHE?/>>DFGBFGGEEEGH/EG///?3?/>///?201</??A1<---><.<..<..<./....:C??C
+@857025/2
+AATCAGGGCAACAAGGTGCTGCGTTTTTCCGGCGACGGTAGTTTGATGATGAATATTCAGGCGATGGCTACCGCCAGTGAAAACCAGTTGGATGTGAAAATCATACTGATGAATAACGACGCGCTGGGACTGGTAACTCAGCAACAGAGT
++
+1>A111111A1A1ABA1BFD11AE0ECFF10E0AA/EEAAEFGCF122B@2DGB22DFFFB0/>/BEFF10>>//>/BFBG1E0?/?>G1111B1122BG11B2>>F2>FFF12>>DA///////--<0<0.<G11100<0<D/.<<GBD
+@217033/1
+TTACGAAACTCCTCAAAGGTGGGCAGATTCGGAATGGATTTACGCGACTGTTCGTACAGATGACGCATCCACTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCG
++
+BBBBBBBBBFFFGGGFGGGGGGGGHGGHHHGHGGGHHHHHHFHGGGGGGGHFHGGHHGHHHHHHDFGFEHHHHGHGHHHHHGGGGGHHGGHHHGGHGHHHHHGHHFHGHHGGGGGHGHGGGGHGDGGGHHHGGGGCGHHHHHGHHFHHDFC
+@1351555/2
+GATATACAGCGCATCCGCACGCGGCGTGTAGATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGATCTT
++
+CCCCCFFFFFCCGGGGGGGGGGGFGGGGGHHHFHGHFHHHHGGGEGGGGGHHHHGHHGGCGGGG?FDHHHGGGGCGGGGGHHHGGGGGGHEHHGEGGFAGFGAGFG@DFFFFFFBFFF;EEFFF/FFFE0FFFFFFFFFFFFFFFDEEEFF
+@237773/2
+CTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCGTCTTACACTCGAAGCGCGGTTTAATTGCCTGGTCAGTGAAGATAACGTAAGACATGTTCCCGCAGGAGGCATCCAGCGCAAAGTCCAT
++
+AABBBAAAAFFFGGFG4GGGGGGGGFGHGHGGGGHGGGGGBGHFCGGEFGFHHHHFHHHHHHGHHGFHHGHHHGEB1@EEGCGEGHHFGHHGGEHHHHHHHHFGHHFHHGFFHFHHGHHFFHDFCCGGGGF?DFFHHFHHGGGCCFHHHFH
+@481721/1
+CTTATAATGGAAGATAAGACCTGTCTACAACATGACAAACAAAAACAAATGCGTAACGGAACTTTACGAAACATAGACACTCTAACCTGTTGCTTGCTCATAGTGCGGCTTATGGAGTGGCGTTTCGAAAGCGCGTGGAAATTTGGTTTGG
++
+BBBBBFFFFFFFGGGGGGGGGGHHGHHHHHGEGHHHGHGHHEHCHGHHHHHHGGGGGCFGGGHHHHHGGHGGFHHHFHHHHGHHHGFHG3FGGFFHEHHHHFHHEHGGCGGHHHHGFHHFGGGGGHGGHFGHGGGGGGGHHHHHHHFFGEE
+@1310368/2
+CGCCAGGATCAGTCGCTCAGTGCGAACATCCAGCGGCGTACTTTGGCTGCCGAATTGCGGCTCCCCCTGATGCGCGGCGCGTACTTTATCTTTGTACTTATTCCACAATACGGAACCCGCTACCGCGCCGCCGCCCACCAGCAAAGCGCCA
++
+BBCCCCCBFFFFGGGGGGGGGGHGGGGGHHHHHGGGGGGGGHHHGHHHGGHGCGGHHHGGGGGGGGGGGHHHHGGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGHGGGGGGGGGGGGGGFFFFFFFFFFFFA
+@270903/1
+ATCTTCACTGACCAGGCAATTAAACCGCGCTTCGAGTGTAAGACGATTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACAACAGTTTACCGAAGGACGGACGCAAGAAGAGTGGATGCGTCATCTGTACGAACAGTCG
++
+AAABBFFFFFFFFGGGGGGGGGHHHHGGGGGGGGHHGHFGHHGHGGGHGHHHHHHHHHHHHHHGGGGHHHHGGGGGGGGHGHHHGEGGGHHFHHHHGHHHHHGGCGGHHGGGGGGGGGHHHGHHHGHHHFGDGGHGEHHHHHGHGGGHHF
+@1171124/1
+AAACAGGCGAGCTGCCAGTCGCTCAGTTGCGCTATCACCATCGGTTTTGCCAGCGGCAAGAGCGCTATCGTACATAAAGTGTACAGTAAAAACAGGATCTGCTGCGAGGCCAGACGTCGCAATAATACTTTTTGCGCCACGCCATAGCTCA
++
+BBBBBFBBDBBBGGGGGGFFGGGHGHHHFFGFGGGHGHHHHHGGGGGGHHHHHGGGGGGGHHHGGGGGHGGHHGHHHHHBGGGHHHHHFHHHGHHHHGHHHHHHHGGGGGGHHHGGFGGGGGGGHHHHGHHHGGEGG?AFGGGGEFHGHHC
+@313247/2
+GATGGACTTTGCGCTGGATGCCTCCTGCGGGAACATGTCTTACGTTATCTTCACTGACCAGGCAATTAAACCGCGCTTCGAGTGTAAGACGATTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACAACAGTTTACCGAA
++
+BAABCFFFFFFFGGGGGFGGGGHHHHHHGGGGGGHHHHHHHHHGHHHHHHHHHHHHHHHGHGHHHHHHHHHHGGGGGGGGHHHHHHFHHHGGGHGHHHHHHHHHHHHHHGGGGHHHHGFGGGGGGHGHHHGEGGGHFHHGHHHHHFHHGGF
+@380152/1
+AGGTAAAGGTTACTATTTCGCTCCGACGTTGCTGGCAGACGCAAAACAGGAAGATGCCATCGTGCAACGCGAGGTCTTCGGCCCGGTGGTCAGTATAACCGTCTTTGATGATGAAGATCAGGTTCTGAGGTGGGCCAACGATTCTCACTAT
++
+BCCCCFFFFFFFGGGGGGGGGGHGGGGGGGHGHHHGHGGHGGGGGHHHHHHHHHHHHHHHHGHHGHHHGGGGGGGHHHHHGGGGGGGGGFHHHHHHHHHHGGGHGHHHHHHHHHHHHHHHHHGGHHHHHGGHGGGHGHGGGHHHHHHHHHH
+@332702/1
+GGATTTACGCGACTGTTCGTACAGATGACGCATCCACTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCGTCTTACACTCGAAGCGCGGTTTAATTGCCTGGTCA
++
+CCBCCFFFCCCCGGGGGGGGGGGHGHHHHGGGGGHHGHHHHGHHHHGGGGGHHGGHHHGGHGHHHHHHHHHHGHHFGGGGHGHGGGGHGGGGGHHHGGGGGHGHHHHHHHHHGHHGHHHGHHHHHHGGGGGGGGGGGGHHHHGHHHHHHHG
+@495822/2
+GTATAGGTGGATTTTAGCTTCGCCAGACCACGATACTCCAAAATCACTTTCGGCAGCGGATAGTCCAGCGCCAGCTCTTCCAGCACCTCTTCCGACGTTGACGGCGCGCCGCCAGGCGTTTTCTTCAACGGCTTAATACCCTGCTTTTCAA
++
+A>AABFFFFCBFGGGGGGGGGGGGGGHGHHHGGHGGFGHGHHHHHHHHHHGFGGGGGGGCEGGHHHHHHGGGGGGHHHHHHGGHHHGHGHHHHDAGGFGFHHGGGGGGGCGGGGGHHGGGGGHHHHGHHGCGGGHGHFHHHHGHFHFFGGG
+@362690/2
+GTACAGATGACGCATCCAATCTTCGTGCGTCCGTCCTTCGGTAAACTGATGTTCCCCGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATCAATCGTCTTACACTCGAAGCGCGGTTTAATTGTCTGGTCAGTGAATATAACGTAAGA
++
+>AAAAFFFBF111AE1B11B013D0BA00AAEEA0E/2BG/FH/F1FF1D1ABGH10AA/EE>//>EG@E//>//1BB/>//>012FGF>22>F11DF/<<EHFF1>EF/0/>>C//?//11?G11<11?<<1F?11111>>FG.0>C0=
+@41032/1
+ATATAACATAGCAAAGGCTATATTCGATGATTAATTAACCACATTGTTGCGAGGGATACTATGACGAATCTACATCGTCTGAAAACACTCCTGCTTGCCGGTATTGTCGCGATACTCGCGCTATCGCCAGCCTATGCAAAAGAGAAATTTA
++
+CDDDCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHGHHHHHHHHGGGGGGHHHHHHHHHGGGHGHHHHHHGHHHGHHH5FHHHHHHHHHHHHHGGGGGHGGHGHGGGGGHHGGGGGGGFGGGGGGGHHHHHHHHHHGHHHHHHHG
+@1263202/1
+GAGATCGTCCACCAGCACGCCGAGATAAGCCTGAGAACGCGCAGGCGCCTAGCCCTCTTTGTCGGCGGAAAGACGCGCGGCATTCAGACCAGCGAGCAAGCCCTGCGCCGCAGCCTCTTCATAGCCGGTAGTACCGTTGATTTGACCAGCA
++
+CCCCCFBFABBFGGGGGGGGGGGGGGFHHGHHHHHHHCGGGGC?CFEGG1EEGHHHHHHHH4FE?EGGGGGHHGGGGGGGGGGHGHHGHHHHHGGGGGHBHFHEHHGGFGGGGGGGGGGGGFGFFGGA?@EFGGGF;CDGFFFFFFFFFFB
+@1481918/1
+AACGTGAACTGGGGAACTGGAAAGATTTTATCGAAGTCATGCTTCGTAAATAAATGCCTGGAAGGCACCGCGCTCCCATAGGGGATAAGAAAAGGCGACTCAACGAAAGTCGCCTTTTTTGTGCCCGACACCTCGTATCAGGCTGGCCGGG
++
+BBBBB4AAFFFFGGFAF4GFC4FGGFHHFHFFAGHGFFHHHFA5FFHFHCFFBGFE5B53AAFGEHAGGCGGGGGFGBG?GFHGDEHFFHGGGG?G/E>EDFGGAAF/<4BEDFGGHHHGCGHHGHCGGGGGEFGG?FFHHFHH0.C.<@C
+@462879/2
+TGTCTTACGTTATCTTCACTGACCAGGCAATTAAACCGCGCTTCGAGTGTAAGACGATTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACAACAGTTTACCGAAGGACGGACGCAAGAAGAGTGGATGCGTCATCTGTA
++
+BBBBBFFFBFFFGFGGGGGGGGH444FDHFHFHHHCFGCEEGGDGHHHEGFHGHGDGGHGFHHHEFEBFHHHHE??FGHGEHGGGGGGGGEEHEGE?E@/FGHHEHHDGHHGHGCDCDHHCCFG/ACCCHBF1<1=.DC<<@DCAGGFHG:
+@1191849/2
+TTACTGACATCAAGCGGTGCGCCAAACCACCCGGAATGATGAGTGACCGGGGATAACAGGATCCCGCATAAACCGAAGATGGTCAGGGTAGTCCACATACCGAATGTAAGAAACACTTCCACCTTGCCAAATACTTCAACACCAATGGCAT
++
+BBBBBFFCDFFBDGGGGGEFGGGGGCHGHGGGGGGGGGHHHHHHHHHHGGGGGGHGHHHHHHGFHGGGGGHHHGGGGGGHHHGHHHGGGHFGFHGHHHHGHGGGGHHHBGGHHB2FHHHHGGHGHHHHGFGHHHHHHHHHFGGHFHFHFHF
+@706222/2
+CCTCAATAATATGGCTATCCAGGATGTGCCGATCCTGAACAGCGATAAAATCATTTGCTCACGCCTGAAACGCGATGACACGCTGATGGTGCCGTCGCCGGGGACGATTATCCAGGCAGGCGACCTGCTGCACCTCGTCGGCCAACCTAC
++
+BBBCCFFFFFFFGGGGGGGGGGHHHHHGHHGGGGGHHGHHHHHGGHGGHGHFHHHHHHHHHHGHGHHHHHHGGGGGGHHHHGGGGGHHHHHHHGGGGGGGGGGGGGGGHFHHHHHGHHGFGGGGGGHHHGHHHHHHGGCFGFGGHGGHGH
+@965673/1
+ATCCTATATGGGGCCAGCCTTTGTCGGCATTATTACCGGCTCAATGGTGATTGAAACTATTTATGGCTTACCGGGCATTGGGCAGCTTTTCGTTAATGGCGCGCTCAACCGCGATTACTCGCTGGGGTTAAGTTTGACCATTTTAGTCGGG
++
+BBBB?DFFFDF?2E2EAA2BBGAFD22AEEGBEHHHGGGCEEHFGFFFFGFFDGHFGHBFB55AGG1GHHHGGGGC/F@F3EG2E1GFFGG?FHHFEGGG@EEEECEFFGCCCCCEDBGFG/FGC/>C@<1>FGH1=FFCGGHH10=DAC?
+@1314201/2
+CAGGAGGAGACGCGAGGGGGAGCGACGAGGCGCAAAAAAACGCCTCTATTTGCGATAAGCACCACATTTTATTGGCATTATTGCTGCCTGTTATCGTTAATACTTGACATAGTTTCGGATTAAGACTATTCCCTGAGGTGCTTTTTAAGC
++
+ABBBABBBBBBBG?EEGGGGGGGGGGGGGGGGGGGGHHGGGGGGHGHHHHHHHGGHGGHHHGHHHHHHHHGGHHHHHHHHHHHHHHHHHHGHFHHHFGHFHHHHHHHHHHG1DGGH?DFGGHGHHHHHHHHHHHHFHGHHGHHHHHHHHH
+@547005/2
+GTCTTACGTTATCTTCACTGACCAGGCAATTAAACCGCGCTTCGAGTGTAAGACGATTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACAACAGTTTACCGAAGGACGGACGCAAGAAGAGTGGATGCGTCATCTGTA
++
+AAAAB5FBFFFBGGGGGGGGGGHHHGHGHHHHHHHHGGGGFGGGHGHHHF5GHHCGFHGHGGHHGHHHGHHGECGGGHHFHGGGGGGGGHCGEGFGGFGGGFHGHHHGHHHHFGCGDEFCFFCCGGCGHHHHHFGEHHHEGDDGHFHGHF
+@939434/2
+CTTTCATCTCTTTCATCAGCGCGGCCGGAGACAGCACAACACCGTTACCGATGATGCTGGTTACATTCTCGCGAAGAATACCTGATGGAATAAGATGGAGAACGGTTTTTTCACCGTTGATTACGAGAGTATGGCCTGCGTTGTGACCGC
++
+BCBBBFFFFFFFGGGGGGGGGGGGGGGGGGGGHHHHHHHGHGGCHGGGHGCGCHHHGHBGHHHHHHHHHHGGGGGGGHBGHHHH?FGHHHHHHHHHHHEGFHHFGBFEGGGHHFEDGADHGGHFFE.EDFHGHGFHHGHCFGGGCHHHGG
+@1456492/2
+CGATAACATCGGCCACGCGTTCGCCGCCCGGATATAAGATTCCAGGTTGCCAACAGGGGCTAAAGCTAAATTTTGCATTTCTTTGGTCATTCAAATCCTCTCAATCAGTATTGCCTGGCACCGTCAGCGAGCAACAACCGTGCCAAAGCCG
++
+AA@AAAFFFF1ACEEFE?0AEFEEECCGGGGGCGHH2BFHHHHGHFFDGGB1FFGGGG@CEHG@GGBEGFHHHGHH2EHHHHHHHFHHHHGGHGHHHHGHHFHHD1FGGGHFBFHFDCGFF/@HGGCHCCCCGHHHHG?CECGEHHHHGH-
+@1166446/2
+GGGCGATGCTGTGCAGCCATTGCCGCGAGCGTTACTACCCGCAAATCGCCCCTTGCATTATCGTCGCGATCCGCCGTGAGGATTCGATCCTCCTTGCCCGGCACGTTCGCCACCGCAACGGCGTGCATACCGTGCTGGCCGGGTTTGTTGA
++
+@BBBABBBBFFFGGGGGGGGGGHGGGGGGGGGGGGHHHHGGGGGGGHGGGGGHHHHHHHHGHHBGGGGGGGGHGGGGGGGHGHHHGHGHGFHHHGGHHHDGGCFGHHHGGGGGHGGGGGGCGC@DGHHHHHGGGGGGGGGGGG..CEGFGF
+@1342194/1
+GCTGGAGCAACGCCAGAGTGAAATGCGCGCCGCGCAGTCGGTCGTCAAACAGCGGGAAGCTGAGCTGGACTCCGTCTCTAAACGTCACGTGCGTTCCCGTTCGCTGTCGCAGCGTGGCGCGGTATCTGTACAACAGTTAGATGACGATCG
++
+ABBBBFFFBFFBGGGGGGGGGGHHGHGGGGGCCEGCGGGGCFGGCFHFHEHHHGGGEFGEHHGEHHHHHHHHFFHHHGHHHFFFHHGGGHEHGF/FEFDGHHGGGGGFGHGGGGGDGG?DGGGGGHHHGHFFFFGHHFGGFGGFGGFGEG
+@374719/1
+GCGTTTCTCAGGACTACCAACAGGCGCTGGCGTGGTATCGCAAAGCCGCTCGCCAGGGGCTGCCTGCTGCGCAAACGCATCTGGGCATCATGTCTGCATTTGGTCGCGGCGTCGCGCAAAGCGACAGACAGGCTATCGCATGGTATCGAAA
++
+BCCBCCFFFFFFGGGGGGGGGGHHGGGGGGGGGGGHHHHGGGGGHHHGGGGGGGGFHGGGGGGHHHHHHHGGGGGHGGGGGHHHHHHHHHHHHHHHHHHHGHHHHGGGGGGGGGGGGGGGHHGGGGGHGGGGGGGGGGGGGGGGGGGGGGG
+@671596/2
+CCTGCGGGAACATGTCTTACGTTATCTTCACTGACCAGGCAATTAAACCGCGCTTCGAGTGTAAGACGATTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACAACAGTTTACCGAAGGACGGACGCAAGAAGAGTGGAT
++
+CCBBCBCCCCBFGGGGGGGGGGHHHHHHHHHHHHHHHHGHHHHHHHHHHGGGGGGGGGHHHHHHHHHGGGHGGHHHHHHHHHHHHGGGGGGGHHGGGGGGGGHGHHHGGGGGHHHHHHHHHHHHHGDGCGHHGGGGGGGGGHHHHHHHGGB
+@1004240/1
+TCTTCGGTTTATGCGGGATCCTGTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGTTCGTCGGTTGTGAACTGGTCACGCCAAT
++
+BAAAAABABBFFGGGGGGCFFGCDFHHHHHGGGEEFFHHHHHHHHHHHGCEGEGGHGGHGGGGGGGGGGEHHHHHHHHHHHHGHHGBHHHHGGHHHG?FDGHHHHGHGHHHHGGFFHHHHHHHHHDFGGG@EDGGHHHHHHHFFHFHFGGH
+@1229420/2
+GTTTAATGACGATGGTGCAGCCACATACCAGCGCTGCGGCCAGTTTCCAGATAGCAATCATAATTGAGAAATTCCACGGCACAATACCGACGACCACGCCAATGGGTTGGCGTTGGGTAAACGCTGTGTATCTCTCTTCTCCCATTGATGG
++
+A1AAAFFFDFAAFGCAG1FGFCHHAFFFFFFHGGGGGGCECEHHFHEEGHBHFFEFFHGHHHHHHEFHEHBGFFG2GGGGGGGF1FGFEEEEGEGGAEEFG/BGFH0FC?HCFCGECCD0<GECACGHGHHHHGFFF1GFEHEFHG0<0<0
+@1205470/2
+CTCTTGCGCGGCTGAATTTTCCCCAGCGAACCATGATACGTTTCACGGTATTTAGCGCTCATGTCTTTACCGGTCTCGTACATCGCAGCAATGATCTCATCGAGCGAGATACAGGGTTCACTTACGCGACTCATCGCCATCGTCGCCGCGT
++
+BBBBBFFDDB@DEGGGGGGGGGHHHGHGGGGGHHHHGHHGHHHHHHHGFEFGHHHHGGGGGHHHHHHHHHHGGGGGHHGGHGHHGGGGGHHHHHHHHHHHHGHGGGGGCFHHHGHGGHHHHHHHHGGGGGGGHHHHCFGGHGHHFGFGGC9
+@1417383/1
+ACTTTACGTCCGGGTGATCGAGCAAGTGGTGAACTGCATCATTTCGCCCAGCGTGCGCGTTACCTGCTTGAGGGCATACTCGACGGCAGAAACGTCGCCGGTCAGCACCACGGCACCGGTAAAGCGATCGAGAAAACCAATTTCCACCGCG
++
+BBBBBFFBFFBDCEEFEGGGEAFEFFFHHDDFGHHHHHHFHHHHHHGGGGHHG1EGGGGGGAFHHHGEFHHHHGEGHHHHHGGGGGGGGGHHHGFGGGGGFBCAG1FGFHHGGGGGGGGCDGHHHGGHGGGGHGHHHDGGHGHFHHGGGG-
+@723488/1
+CAGATGACGCATCCACTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCGTCTTACACTCGAAGCGCGGTTTAATTGCCTGGTCAGTGAAGATAACGTAAGACATG
++
+BCCBCFFFCCCCGGGGGGGGGGHHHGGGGGHHGGHHHGGHGHHHHHHHHHHHHHGGGGGHGHGGGGHGGGGGHHHGGGGGHHHHHHHHHEGGGHGHHHGHHHHHHGGHGGGGGGGGGHFHHHGHHHHHHHHHHHHHGHHHHGHHHGGHGHG
+@1337757/1
+GTTCTAAGGTTTCGCCGACTTCAACAAACCCGGCCAGCACGGTATGCACGCCGTTGCGGTGGCGAACGTGCCGGGCAAGGAGGATCGAATCCTCACGGCGGATCGCGACGATAATGCAAGGGGCGATTTGCGGGTAGTAACGCTCGCGGCA
++
+BBCCCFFFFFFFGGGGGGGGGGHGHHHHHGGGGGGGHGHHGGGHGHHHHGGGGGGGGGGGGGHGGGGGHHHHGGGGGGEFFHGFHFGGGFGHHHHHEGGGG?DFFDCDFG@EEFFFHHHHGGGGD?DGGGGFFF;CF90:BABDFFFFFF;
+@218605/1
+ACGTTTACTTCGCTCAATCGCCTCAATAAAGTCGTTAGTATCAACAGGCTCATTACGATGTTCGTTAAACTCTTCCAGCACTTCCTGGTAATCCAGCCCTTCTGCCAGCCAGTGTAGAGGTTCCCAAGCTTCCGCTGGCATCACGCTTT
++
+BCBBBFCFFFFCGGGGGGGGGGGGHHHHHHHHHGGGHGHHHHHHHHHHGHHHHHHHGEHGHHHGGHHGHHHHHGHHHHHHHHHHHHHHHHHHHGHHHGGHHHHHHHGHGGHHHHGHHHHHHHGHHHHHGHHHHGGGGGGHHHHHGHGGG
+@1204175/1
+AGCTTGGGAACCTCTACACTGGCTGGCAGAAGGGCTGGATTACCAGGAAGTGCTGGAAGAGTTTAACGAACATCGTAATGAGCCTGTTGATACTAACGACTTTATTGAGGCGATTGAGCGAAGTAAACGTCGCTTCCATGTTGTTGAAAAT
++
+BBBBBFBB@FBBGGGGGGBDGGHHGCGHEGHHFGGHGGHHHHHHHHGHHHHHHHHHHHHHHHHHHHHGGGCFHHGFGHGHHHHHHHHHHGHHHHHGFEFGFFHHHHHFHEEEGCHGHGGFCGGFHHHGDH/CFGHGHHHHHHGGHHEHFF1
+@880077/2
+GTGCGAATACCGGTAATGCGTCGCAACAAGACGTAACAAATATTCAGCGCCAGCGCGAGCAACACCGCGTAGCCTACCCAACTATACGCATCACCCATCCGCTCGATCGTTGCCATCATCGAAGCATAGGTATCGGAAATCGCGCCGTTGA
++
+A3AABABBBFFBGGGGGGGGGGGGGGGHHHHHGGHHGHHGHFFFHHHHGGGGGGGGGGGGGHHHGGGGGGGGGHHHGHHHHGHHHHFHGGGGHFHFGHHFGGGGFGHGGHHHGHHGHHHHHGHFCHHHHGDDHFGGGGCCGDGGGGGAFGE
+@1318025/2
+CGGCAATCTCATATCCTGCATCCAGTACGGCCTGCACGCCCTGACATCCCATATCGTGATAGGCAAAAATAACGGCTTTCATTGGTGACTTTCCTCAGTAAACGGCGTGCTTTCCGGGTAGATAACTTGTTGAACAAAATAGCGGGGGCGG
++
+AAABBDFBDFFFFGGGBDGF5GFCCDGB2EGGGFGCBF2FGGCHGFFF3E3BFGHGGFGHGBAGCHHGEHFFGDGFGGCGBBGFFFGHFHHGG3BFGFGBGFGE1E/EEFFHFDBACC<//BG3DHHHHHFFFBG2<GFDD11CC@CGCGG
+@404793/1
+TTCATATTCTCTTTGACCTCAATTTCCCTGGTCAGTTTCCCCATTCGTCCAGAAATGCTCCCTGCGCTCCGCCATGCGCACTAATTGTTCACAAGGCGCGTAACGAGGACCGTAAAGTGCGGCCAGGCGCTGTAATGTCGCCACCATTTCA
++
+DCDDCFFFFFFFGGGGGGGGGGHHHHHHHHGHHHHHHHHHHHHHHHHHGGGHHHHHHIHHIGHIHGGGGGGGGGGHHGGGGGHHHHHHHHHHHHGHHGGGGGGGGGGGGHHGGHGHHHHHGGGGGGHHGGGGGHHHHHHHHGGGHHHHHHE
+@803542/1
+TTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACAACAGTTTACCGAAGGACGGACGCAAGAAGAGTGGATGCGTCATCTGTACGAACAGTCGCGTAAATCCATTCCGAATCTGCCCACCTTTGAGGAGTTTCGTAAGCA
++
+CCCCCFFFFFFFGGGGGGGGGGGHHGCGGGGGGHGHHHGGGGGHHHHHHHHGHHHHGEGGGHHFGGGGGGGGGFHHHHHGHHHGGGGGHHHHHGGGGHGGHHGGGGGGGHHHGHHHHHHGGGGHHHHHHGGHHHHEGGHGHHHHGHHHHHH
+@1546835/1
+TCATTTGTATAATAACCTATTGATCAGGCTAATAACCGCAGTCTATATCAGGGTAAGTCTTTTCGGCGCGTTTTGATATACGCGCTCATACGTTTCGGGATGGCATTAAAAGGCGAAGGAATATGAATACAACTGCACCTACGGGCTTG
++
+BBABCFFFFFFFFGGGGGFGGGHHHHHHFHHHGHHHHGGCGEFGHGHGHHHHGFGHHHGGHHHHGGGGGGFGGGHGHHHHHEFFGGGGHHHHHHHHGGGGGGGHHHHHFHHHGHGGGGGHHHHHGHHHHHHHHHHHHHHGHHCAFGGGG
+@94289/2
+CGTTCGATCTCCGTCTCCTGGATCTGCCGCTCAGCAAGAATGCGCGTCTGTTCTGCTTCACGATGGCGCTCGGCCTCAAAAGCGGCAATTTTAGCGTTTTGTTCGGCGGTGCGGGTTTTAACCTGTTGCTCCTGCTCCAGAGTCATAAAGG
++
+BBBCCCCFFFFFGGGGGGGGGGHHHHCHGGGGGHGHFHFHHHHFGGGGGGHGHHHHHHHHHHEHAEFGFGGGGGGGHHHHHGHGGGGFFHHHHHHGGGGGHHHHGGGGG</<CGG-FGGHHFHHHHEFGGDFCCGFFHHHGHHHCHHHHHH
+@1032443/1
+CCATTGCCGCACTGCGAGACTTCACTGCCGTCGGCGTTGAAGATGCGGTAATGAAAGTCCAACTCAGGATCATAGGGCGGCTCAACCACCAGCAGCTGATCGAACCCTACGCCCAGGTGTCTGTCGGATAGCCGACGAATCAGTTCCGGCG
++
+CCCCCFFFCCCCGGGGCGGGGGHDHHHHHGGGGGGGGGGHHHHHHHGGGGGHHHHHHHHHHHHHHGHHHHHHHHHHHFGGGGGHHHHGGGGGGHHHHGHHHGGHHGGHHHGGGGGHGHHHHGHHHGGGGGHHHGGGFGGHFFHHHHHGGG?
+@963767/2
+GTGTAAGACGATTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACAACAGTTTACCGAAGGACGGACGCAAGAAGAGTGGATGCGTCATCTGTACGAACAGTCGCGTAAATCCATTCCGAATCTGCCCACCTTTGAGGAG
++
+AAABAFFBDADAGGGGFGGGGGHHHBFHCGGGDBBDGGGGEFCCHFFGG0EE?EHHHFAGFBGFBHHGCEGGGGGCFGE/EEEEHHHF4FAFEGCCFCFHHGF>FDHGHGGHGF/AC/CF.GHHHFHHFEDFGCHFFHHHGG.CHFHGEHD
+@978461/1
+CATGTCTTACGTTATCTTCACTGACCAGGCAATTAAACCGCGCTTCGAGTGTAAGACGATTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACAACAGTTTACCGAAGGACGGACGCAAGAAGAGTGGATGCGTCAT
++
+ABCBAFFFFFCFGGGGGGGGGGHHHHGHGHHHHHHHGHHGGGGGGGGHHHHFGHFHHGEGHGHHHHHHHHHHHFFHGGGGHHHHGGGGGGGGHGFGHGGGG?HHFHHHHHHHHHHGGGGGHHGGGGGGGGGFHHHGGHGHHHGGGGGH
+@987449/2
+GTTCGTACAGATGACGCATCCACTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCGTCTTACACTCGAAGCGCGGTTTAATTGCCTGGTCAGTGAAGATAACGTA
++
+CCCCCCFCCFFFGGGGGGGGGGHHHHHHHHHHGGGGGHHGGHHHGGHGGHHHHHHHHHHHHGGGGGGAHGGGGHGGGGGHHHGGGGGHHHHHHHHHHHGHHGHHHGHHHHHHGHHEDGGGGGGGHGHHHHFHHHHHHHHHHHHHHHHGGHH
+@996166/2
+CTCTTCTTGCGCCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCGTCTTACACTCGAAGCGCGGTTTAATTGCCTGGTCAGTGAAGATAACGTAAGACATGTTCCCGCAGGAGGCA
++
+1A?AAFFBBFD1AA1AEEEFGG?00A1F2G2F1FG12DBAECEEHA/AEAEBEGGGGBFHGGGGCGFFGHBEBGHHHHEEHHGGHFFDFGFEFGC?@@/EE/1BGHHFHDF/CGFGDFFB11FHFHGFA<CFF0GBG1?FG/@@CCCACFA
+@717147/2
+GATGAGACTCTCTGGAGTTTTGCATTATACGGAACGGCTGTAGGCGCAGGCACTCTTTTCCTTCCCATCCAGTTGGGATCGGCAGGCGCAATCGTGCTATTTATTACCGCGCTGGTCGCCTGGCCTCTAACATACTGGCCGCATAAGGCG
++
+BBBBBFFBFFFFGFGGGGGGGGFHGHGHHGHGGGGGGEGGHHHGHGCFGGGEGHFHHGHHHHHGHHHHHHHHHFHHGEGGCE?EEGFGE/E/???FFGBGHH4GHHBHAG//@BDFFC?EC/G0FDGBGGHBGBGG1FGHCCDDFEBFFC
+@540732/2
+GAAGATGGCGTTCAGGGTTACGGCATACGCGTTACGTATAGTCAGAAATAGCGTCAGCGTTGTGGCTGACCAGCCAGCCGCTGAATTTTGAGAAAAAGGAGAGTCTGAATGCAAGCAACAGTAAAACGGCGGCTGACGAAGGTCGCTTTAG
++
+>AAA35DFFBBBGGGGGGGGGFGGGGHHHGGEEGGCECG3GHCHHHGHHHFHGGGGGHG1EGGGGGHEHHGHFAFHHGAEGGGGFGGGHF/FGHHHHGGFHFGFDGGFHHHGHHHHHHHHHBFHHHHGGGG-?DGGF?ECFFHGDGGEEGB
+@182516/1
+AACCGCAACATAACGTTGTGAATATATCAATTTCCGCAATAAATTTCCTGTTGTAATGTGGGTTCATTCGCACAGATAGCAATCTGTAAACCGAACAATAAGCGCGACAACACAACATCACGGAGTACACCATCATGGCTAACTACTTTAA
++
+CCDDCCCDEFFFGGGGGGFEGGHHHHHGHHHHGHHGGGGGHHHHHHHHHHHHHHHHHHHHHGGGHHHHHHGGGGHHHHGHHHHHHHHHHHHHGGGGGHHHHHHGGGGGGGHHGHGGGHHHHGGGGGHHHHHHHHHHFHHHHHHHHHHHHHH
+@1046127/1
+GCTTCTGAGCAGATGGACTTTGCGCTGGATGCCTCCTGCGGGAACATGTCTTACGTTATCTTCACTGACCAGGCAATTAAACCGCGCTTCGAGTGTAAGACGATTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACAA
++
+ABBB?DF5DFFFGF5GGCDBA4FGGCGGFGGHCFFG23CECC?EACFFAEGFHHGGHHFFHHHHHHHFHHFHFHEFFHHGHHHGGCGGGGG/GGHHHFBB?EEFHGBHHHEHHHGE1FHHCGG?/GBC?/@CGFG?0AFCBCAAD.DBFH
+@1068178/1
+GACTTTGCGCTGGATGCCTCCTGCGGGAACATGTCTTACGTTATCTTCACTGACCAGGCAATTAAACCGCGCTTCGAGTGTAAGACGATTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACAACAGTTTACCGAAGGA
++
+A?AAA5FFDBDBGCGGCGGFCFHFG2AEGGHHHHFHHCGFFCHHFFGGHGHH3BGHF1EFFHHHHHH3E0>EF1EECGHGHGHFH3E>FAFFHHH3E4FGB3BFHFGGBHHG/@DF@CFBDADFHEGGGGCGFHGHHE1FGHHHDA<CDG
+@147246/2
+GTCATAACCCGCTGGAGGCCGCCGCTCATGCGATTCCGGTACTGATGGGTCCGCATACCTTTAACTTTAAAGATATTTGCGCCCGTCTGGATCAGGCGAGCGGACTTATCACGATTACCGATGCGGCTACGCTGGCAAAAGAAGTTTCCT
++
+?ABBBFFFFBBBGGGGGGCFGGGGGGGDHHFGGHHHHHGGGGHHHHGHHHHHGGGGGHHHHGHHHHHHHGHHGHHHHHHHGGFFGFGFFHGEHHHGHGGGGGGGGGHHHHHHGGHHDFGGGGGGGGGGGHGGGGFGHHHFHGGHFHHHFH
+@606976/2
+GCGCATCAGACGCTCCTCAGGCTGTATCCCATTCCACGATGCGTGTTAATTGGCGAGAGATCCGGGTTGATCGCGCGTAGCTTAGCGCGCAGGGTTTTGATGTGTGTATCGACCGTCCGATCGAAGGTCTCCTGGGCATCAGACCAGACAA
++
+CACCCCCFFFFCGGGGGGGGGGHHFHGHHHHHHHHHHGGHGGGEEEHHHHHHHHGGGGGGHHHHGGAFGHHHGGGGGGFGGHHHHHGGGGGGGF?F?FHFHH@FFGGHHFGHGGGCEAFGDFGGGGGCFBFGGFFEEGFHHFHHGHHHEHG
+@963759/1
+GTAAAAATACCCTGCTGCGGACGTTCGCTATCCACCCCGCGTAAAAAGAGATAGATGACGCCGCCGAAATGGCGTTCATAGTCGTAATTCGCCATGCGATGACGAAGGTAACGATGCAATGCCAGCGTATAAAGCTGGTACTGCAAATCAT
++
+AAAABFFFFFFFGGGGGGGGGGGGGHGGGGGHHHHHGGGGGEGGHHHGGHHHHHHHHHHGGGGGGGCGGHHHHGGGGHHHHGHGGHHGHHGGGGGHHGGHGHHGGGGGFHHHGGHGGHHHEHHHHGGDGDHHHHHHHHHHHHHHHHGHHHF
+@415941/1
+GAACAGATTTCGCCTTCAGTCGCTATTCTGGACTCTGATGATGGAATGGGACACTGCGCGCTGATAAAGGCGACAGACCACGCTATTAGTCTGGCGAGAGAGACGAGGCTGGGTTTCGTCAGCGTCAAAAATACGTCCCACTGCGGCGCG
++
+AABBAFFFFFFFGGGEGGGGGGGGGGHHHHGHHHHGHHHHHHHGGHHHHHHHEHHHHGGGGGGFHHHHHGHGGGGGHGFHHGGGCGHHHGFHHHHGCECEFGGHGBDGGGHGGFGGHGGFFGHGGGGDGHHHHFAGFGGGGHHHGGGGGG
+@702216/1
+AGCTTAATTTGAGTCAGATAGCGGCTATTCATCAGGCTACTGACGCCACGATTGAGTTCTTCATTCATGGCGCGCTGTGTGTCGCTTATTCTGGGCAGTGTTATATCTCTCATGCGCAAACCGGGCGCAGCGCCAATCGGGGCGACTGTT
++
+CDDDDFFFFFFFGGGGGGGGGGGGGGGHHHHHHHHHHHHHHHHHGGGGGGGHHGHHHHHHHHHHHHHHHHHGGGGGGGHHHHHGHGHGHHHHHHHHHGHHHHHHHHHHHHHHHHHGGGGGHGGGGGGGGGGGGGGGGHGGGGGGGGGGGG
+@47652/1
+GGTATTCTTCGCGAGAATGTAACCAGCATCATCGGTAACGGTGTTGTGCTGTCTCCGGCCGCGCTGATGAAAGAGATGAAAGAACTGGAAGACCGTGGCATCCCCGTTCGTGAGCGTCTGCTGCTGTCTGAAGCCTGTCCGCTGATCCTTG
++
+ACAACFFFFFCCGGGGGGGGGGHHHHHHHGHHHHGEGGHGGEGGGHHGHHHHHHHGGGGGGGGCGGEHHHHHHGHHHHHHHHHHHHHHHHHHHHGGHGGHHHHHGGGHHGGGHGHGGGGGHHHGHHHHGHHHHHHHHHGHGGGGGHHHHHG
+@311487/1
+TCCTTTCTCTTTCGTTTGGTTATTAGTATGCCACCTGGAAGTGTGATTGCAGTTGCAATAACGGCAATTTGCTTATTTTATGGCACGTTAAGCACGCTATTGATGAAAAAAGAGACACTCAGAAAATTATTTTAAATTTCCTCTTGTCAGG
++
+>A1AAFBBFBFD3AFEFGGAFGGDD3GGH3FFG1FGGA0GA1B2A1GFAF1B1AE1EHDH1FE/AEEE1GG2G1GDBDGBFGHFHB/>BG/GDF>/E/B/@12@FH1EF0>//FEGCGGGBCGHHHHHGEHB>2<>2GG2>BGGF111210
+@969670/1
+GGTCATTTTGTCCGTAATACCGCGCGGGTTTTCACCGTAAGAACCGAGCGCGACATCAATTTGATGTTCGTTGCCGTGTTTCGCGTAGTAGTTGGAATAGTGAGAATCGCCGCTGTGATAGAGATTGCCGCCCGGCGTTTTAAACAGATAG
++
+AABAAFFFFFFFGGGGGGGGGGGGGGGGGGGGHHHHGHHGHHGHHGFGGGGGGGGGHHHHHHHHHHHHHGGHHGHFFFGHHHGGGGGGFGFGHHHHHHHHHHHHHHHHHGGGGGGGHHHHHHHFHHHHHGGGGGGGGDFGGGGGGGGFFFF
+@559354/1
+GCGCTGAGGTCATCCCGGTTCATAGCGGCTCCGCTACGCTAAAAGATGCCTGTAACGAGGCGCTGCGCGACTGGTCCGGTAGTTACGAAACCGCGCACTATATGCTCGGCACGGCGGCAGGACCGCATCCCTATCCCACCATCGTTCGCGA
++
+BCCCCCBFCFFFGGGGGGGGGGHHHHGGGGGGGGGGGGGGGGHHHGHHHHHHHFHHGEGGGGGGGGGGGGGGGGHHHGGGGGGHHHGGGGGHGGGGGGGGHGHHHGHGGGGGGGGGGGGGGGGGGGAGGGGGGGGGGGFFFFFFEFFFFF-
+@531229/1
+ACGTAAAAATCCGCAGATGAAGCGGGCGCTGGATAACTTCAAGGCCGTGCTGGATCTGCGGATAAACCACAGCGATATCAACGACGCGCAAATCAAACGCATTATCGGCGTGATTGATCGCGCGGCGCTGGAAATCGCCGAAC
++
+CCCBCFCFFFFFGGGGGGGGGGHGGGGGGGGGHHHHHHHHHHHHHHGGGGGGHHHHHGHGGGGGHHHHHGHHGGGHGGHHHHFGGGGGGGGGHHHGHHGGGGGHHHHGGGCF.CGGFHEEGCFGGCBABDGGFGGGGGGFFFF
+@1073107/1
+CAGTATTACCGCTCGTTAACCCAAATCCGCATTTCGCCCTCGCCACGGTTGGCCCAGCTAAACCACGGAATGAACGTTAGCGTCTGCGGCTGGCGCGATGATGGCGCGTTGTCGTAATGCCACAACGCCTGATGCTGCGCATCTGGGGCG
++
+CCCCCFFFFFDDGGGGGGGGGGGHHHHHGGGGGHHHGGGGHGGGGGGGGGGGHHHGHHHHHHHHHGGGGGGHHHHHHHHGHGGGGGHGGGGGGGGGGGGGHHHHHGGGGGGFHGGHHGHHHHHHHGGGGHGHGHHHHHGGGGGHHHHGGG
+@1252444/2
+CTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCGTCTTACACTCGAAGCGCGGTTTAATTGCCTGGTCAGTGAAGATAACGTAAGACATGTTCCCGCAGGAGGCA
++
+ABBBCFFFFFCCGGGGGGGGFGGFHGHHHHEGHHGHHHHGGGGGHGHGGGGHGGGGGHHHGGGGCGHHGHHHHHHHHHHGGHHGHHHHHHGHHGGGGGGGGGHGHFHHHHHHHHGHGHHHHHHHHHGHHGHHHHHHHHHDGGGGGGEFGGE
+@1442583/1
+GTCCAGACGGAGGATGCCAGACCATAGTGAGAATCGTTGGCCCACCTCAGAACCTGATCTTCATCATCAAAGACGGTTATACTGACCACCGGGCCGAAGACCTCGCGTTGCACGATGGCATCTTCCTGTTTTGCGTCTGCCAGCAACGTCG
++
+AAAB@FFAB?AACCGGGGGBGFHGGFFHHGGHDGGHHHHHHHHGEEFAFB3FHHHHHGHEHHHHHHHHHHHGHHGGEFFFEGHHGFCHHAFGFCE/EEEGHHHHGGGGGCDHHGGHGGGHHHHHH2GGF1GFHHG?@AFHHEHGHHGGHHC
+@754655/2
+TCGTTGGCCCACCTCAGAACCTGATCTTCATCATCAAAGACGGTTATACTGACCACCGGGCCGAAGACCTCGCGTTGCACGATGGCATCTTCCTGTTTTGCGTCTGCCAGCAACGTCGGAGCGAAATAGTAACCTTTACCTTCCGTTTGA
++
+BBBABFFFFABBGGGGGGGGGGHHHHHHHHHHHHHHHHGHHGGGGGHHGGHHHHHHGGGGGGGGGGGGHHHGGGGGGGHHGGHGGHGHHHHHHHHHHGFHHGGGGGHHHGGFHHGHHGCCGGGGGGHHHHHHHHEFHHFGGGHHGCGGGF
+@1312534/1
+GTTCGTACAGATGACGCATCCACTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCGTCTTACACTCGAAGCGCGGTTTAATTGCCTGGTCAGTGAAGATAACGTA
++
+BABBBBFBAFFFGGGFGGGGGGHHHHHHHHHHGGGGGHHGGHHHGGHGHHHHHHHHHHHHHGGGGGHGHGGGGHGGGGGHHHGGGGGHHHHHHHHHHHHHHGHHHGHHHHHHGHGGGGGGGGCGHHHHHHHHHHHHHHHHGHHFGHHHGGH
+@1162660/1
+GTAAGAGACCACCCGCCCCTGATCGTCTTTTAACGTATACGGTAAGCGACAGGCTTGCGAACAGTCGCCCCGATTGGCGCTGCGCCCGGTTTGCGCATGAGAGATATAACACTGCCCAGAATAAGCGACACACAGCGCGCCATGAATGAAG
++
+BCCCCFFFFCFCGGGGGGGGGGHHGHHHGHHHHHGHHHHHHGHHGHHGGGGGGGHHGHGGGGGHHHGGGGGGGGGGHHGGGGGGGGGGGDGGCHGGGGGGHFHGHGHHHHGHHHHHHHHHHHHHHHGFGGGHGGHHGGGGGFGGFGGGGGB
+@1089248/1
+TCCCTCACCTTTTCCCTGATTGCGGTGCTGATCCCGTTGCTCTTTATGGGCGATATTGTTGGTCGACTGTTCCGCGAATTTGCGGTGACGTTGGCGGTAGCGATTTTAATCTCCGCCGTCGTCTCTTTGACGCTCACGCCCATGATGTGCG
++
+CCCCCFFCFFFFGGGGGGGGGGHGGGGGHHHHHHHGHHGGHHHHHHHHGHHGGGGGHHHHHHGHGGGGGHHHHGGGGGGGHHHGGGGGHGGGHHHGG<CGHGGHHGHHFHFHFHGGGGGGGGGHHHHHG=FEGGGGHHGGGGHHHGHHGHG
+@1465057/2
+ATTCGGAATGGATTTACGCGACTGTTCGTACAGATGACGCATCCACTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCGTCTTACACTCGAAGCGCGGTTTAATT
++
+CCCCCFCCCFFBGGGGGGGGGGGGHHHGGHHGHHHGHHGGGGGFGHHHHHHHHHHGGGGGGHGGGHGGGHGHHHHHHHHHHHFHGGGGGHGHFGGGGGGGGGGHHGGGGGHHHHHHHHHGHGHHGHHHGGHHGHHGEHGGGGGGEGGHGHH
+@1472015/2
+CCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCGTCTTACACTCGAAGCGCGGTTTAATTGCCTGGTCAGTGAAGATAACGTAAGACATGTTCCCGCAGGAGGCATCCAGCGCAAAGTCCA
++
+CCCCBCCCCCFFGGGGGGGGGGHGGGGGHGHGGGGHGGGGGHHHGGGGGGGHHHHHHHHHGHHGHHHGHHHHHHGHHGFGGGGGGGHHHGHHHHHGHHHHHHGFHFFHHHGHHHHHHHHHHHHHGGGGGCGGGGGHHGHHGGGGCGEGFHH
+@1485982/2
+TCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCGCTGGTCATCTCATAAATCGTCTTACACTCGAAGCGCGGTTTAATTGCCTGGTCAGTGAAGATAACGTAAGACATGTTCCCGCAGGAGGCATCCA
++
+AABBBFBBBDBBGGCGCCEGGGCHFHHHHGHDHFHGGGGGHGGGGGGGGGGFGFHHGGGFGHGFHHHGFHHHFGFGCGHGHHHHHHGHFGGFGGGGGGHHHHHGHHGFBFHFHHFBGHHHFHGCGHGBGHFHHGHHHD/CG-<C<?CHH/C
+@1516631/2
+GGAACATGTCTTACGTTATCTTCACTGACCAGGCAATTAAACCGCGCTTCGAGTGTAAGACGATTTATGAGATGACCAGCGAACTGGCGAAACGCCTTGGCGTGGAACAACAGTTTACCGAAGGACGGACGCAAGAAGAGTGGATGCGTCA
++
+ABBBCFFFFFFFGGGGGGGGGGHHHHHHHHHHGHHHHHHHHHHGGGGGGGGHHHHHHHHHHGGGHGGHHGHHGHHHHHFHGGGGHHHHGGFFGGGGHGHHGCFFGGHHHHHHHHHGGHHGGGGGHHGGGCCGGCFHHHHE0GEFEHHGGGG
+@1262127/1
+CTTTAGCACTATCACTGCATATCGTCGCCATTACGCAAATAAGAATTATTTTCATTTATTCATGCCTTGTGCTATATAACATAGCAAAGGCTATATTCGATGATTAATTAACCACATTGTTGCGAGGGATACTATGACGAATCTACATCGT
++
+BBCBBFFFFFFFGGGGGGGGGGHDHHGGGGGHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHEHHHGHHHGFGFHHHHHHHHHHHHFHGHHHHHHHHGGGGGGHHHFHHHGHGGGHDHHHGHHGG
+@612006/2
+GTTTGAAGATGCCTTGCTTACGAAACTCCTCAAAGGTGGGCAGATTCGGAATGGATTTACGCGACTGTTCGTACAGATGACGCATCCACTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCG
++
+BABCCFFFFFFFGGGGGGGGGGGHGGHGHHGHHGHHEGGGGHGGHHHGHGGGHGHHGHHGGGGGGGGHHHGGHHGHHHHHGGGGGGHHHHHHHHHHHHGGGGGHHGGHHHGGHGGHHHHHHHHHHHHGGGGGAFHGGGGHGGGGGHHHG
+@725303/1
+GTTTGAAGATGCCTTGCTTACGAAACTCCTCAAAGGTGGGCAGATTCGGAATGGATTTACGCGACTGTTCGTACAGATGACGCATCCACTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCG
++
+BBBB?FFDDFBFGFGFGGGGGGGFEGHHHHHDFGHHGFAEGFFDHHFGHGGFHGHHHHHHGGE?EGGHHHGFHHGHFFFBGEGEG@GHHEGFFHHHGH?FEGGEF/AGHCAFHFHHGHHHHGHFHGHGGGDGHA<CDGGHADDDGGHHG
+@1499575/2
+GCGTATAGCATCATCGTTTCACAGTACAAAAATTAAAAACCCAGCGCCAACCGCATTCCATTTTTTGCGAACCTCTATCCAGAATCATCATCCCCTCGTTTCACCACTTTCCATCCCCAACGAACCAGGTTACAAACTGTACATACATACA
++
+>>>>>AFFFFFFGGGGGGGCGGHGAEGFFHGHFCHFGBFEEEGDHGEA2E11A0E?EHGHHGBFF@EFEECG/2GFFF43FDGFFHGHHHBG3FF2//?//FGHB3FGFFHHGFFA/FFDF?FE/BFG<2<G2>GGHFBGGGH1DFH1G1?
+@1153610/2
+GTTTGAAGATGCCTTGCTTACGAAACTCCTCAACGGCGGGCAGATTCGGAATGGTTTTACGCGACTGTTCGTACAGATGACGCATCCACTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCG
++
+AAAA111@1@DFB311FADGF1C1AAAFGFFGF00A0A/ECEEFF12BGC/FCB1FGFGFCEE//>E1EB<?0CEHDG1FD//</BBGF?0?1?F111</@/A<CE/FDC.<..1FFGHFH0<DGDG?CEC@G.CC.;:GA.CA-9BF?
+@1515418/2
+CCGCTATATGGATGCTCTCGGGCCGGGTGAAATGGTGGCGACATTACAGCGCCTGGCCGCACTTTACGGTCCTCGTTACGCGCCTTGTGAACAATTAGTGCGCATGGCGGAGCGCAGGGAGCATTTCTGGACGAATGGGGAAACTGACCAG
++
+ABAABBBFFFFDGFCFFFGGGCCEEGGGGHHBFFCGFGHGGGGGHEGHFFEGGGFHHHGGGGGHGHHGGHGGHHGHGHGGGGGGGGFHHGHHHHHHHH?FGCFGGFGGCC-DGGCGGCFEFGGHFHHHHGGGGGCHHEGGGFGFFGGFGGG
+@674551/2
+AATCAGTATTGCCTGGCACCGTCAGCGAGCAACAACCGTGCCAAAGCCGATGAGCAACGAGAATATCACCCACTCTTTTATCAGACAGTGATTTTATCCACAAGTTCAATGTAACACTGTGCATAATTTGCACAAATCTTGTGACATAAAG
++
+AABCBFFFFFFFGGGGGGGGGGGGGHGFGGGHHHHHGGGGGHHHHHHHGGGGHHHHHHGGGGGHHHHHHHHGGHHHHHHHHHHHHHHHFHHHHHHHHHHHHHHHFHHHGHHHHHHHHHHHHHHHHHHHHHGHHHHGHHHFHHHGHHHHGG2
+@1464772/2
+GTTTGAAGATGCCTTGCTTACGAAACTCCTCAAAGGTGGGCAGATTCGGAATGGATTTACGCGACTGTTCGTACAGATGACGCATCCACTCTTCTTGCGTCCGTCCTTCGGTAAACTGTTGTTCCACGCCAAGGCGTTTCGCCAGTTCG
++
+A>ABBFFFFFFFGGFGGGFFGGCFEGHHHHHHGGHHFHGGGHGGFHHGGGGGHHBGHEHHGGEGGEEGHHGGGHGHBFBFHFEEEEHHHHHHHHHHFFGGFG@GHGGGHHGGHGHHHHFHHHHHHHGGGGGGHGACDGGHGGGGGHHHG
+@254517/2
+GTCTACAACATGACAAACAAAAACAAATGCGTAACGGAACTTTACGAAACATAGACACTCTAACCTGTTGCTTGCTCATAGTGCGGCTTATGGAGTGGCGTTTCGAAAGCGCGTGGAAATTTGGTTTGGGGAGACATTACCTCGGATGAG
++
+AAA@AFFFFAFFGGGGGFGG1E0BGGC1EGFGGGCA0EF/GHH2GFF/EEGGHBHFDC1EFFFFEFGGFGHGFHHFHGHHHFHHGGGGGHDB1EFHA/FEAEGGGEH??GEGGGCC/11FFHHB?G</FCCF@GEHHGHHHGHGGCFGHE
+@1232217/2
+GGGCTGCATATGACCGTGGGCATGGCGGTAGCCAGCTAACGCGTTGAGTCGCATTCGGCCTGCAGAACGTGCAGGCCGAATACGCCCTTAGCCACCATCAATCTAAGGAATATAACCGGGGCGGGGAAGATGGCTATAAATCCATAGAGAA
++
+>>11>A@BFFFFGGGAGG1EF0FF0F00EE/AF10/BFAG//A//AA111A/EE/D2E///B0BC1FCE////B0/FC>E/?F////>FBB<1100/111B111212010<1F>@1<////<-?C?-9..00///;90000090/9/////
+@1166908/2
+ACTTATTCCTCGATTTTACCGCCAGCAGCTTCGATAGCAGCACGAGCGCCTTTAGTAACACGCAGGCCACGAACAGTTACCGGAGTAGTGACTTCGCCAGCCAGGATCACTTTCGCGAACTCGATCTGGATACCGATAATGTTTGCCGCTT
++
+BBBAA5FFFFFBEGFGGGGGGGEGGGHHFHHHGHHHGHHHHHHC220AEEGGDDHHHHHHHGGG?EGGHEFEGGGHFFFHHGGGEEGHHHFHHGHGGGGGEGHFFHHGHHHHFHGFG@@FHG?FGHHHHDHHHHGG-<EHF0GHCGHGGGF
+@964369/1
+CTTCACGCACGCCAATCATCTGCGCTTTGGCTTCATTACTATAGGTGACAAAGCCGCGTTCAAACCAGGCGGAACTTCCGGCGATGTCGGTAATGGCTTTCGCCAGCCAGCCGCCGGTACAGGACTCTGCTGTCGTTACGGTCGCCCCGCG
++
+BCCCBFBFCCCCGGGGGGGGGGGGGGGGHHHHHHGHHHHHHHHHHBHHHHHHHHHGGGEEGHHGHGHHGHGGGGGHHGHGGGGGGGHHHGGHGHHHEHHHHGGGGGGGEHGGGGGGFCGGHHHGHHHHHHHHHHGC?GGGGHCGGGGGGGA
+@834295/2
+CTCTATACCGCTAACTACGTAGAATACCCATAATAATAAGAGAGGCTATTATGATTGAACGTGAACTGGGGAACTGGAAAGATTTTATCGAAGTCATGCTTCGTAAATAAATGCCTGGAAGGCACCGCGCTCCCATAGGGGATAAGAAAAG
++
+AAABBFFFFBBBGEEGGGGGGGGHHHFHHGHHFHHHHHGHHHCGGGHHHHHHGFHHHFHFHGEHGGHFHEGGGGGHHHHHGHHHHHGHHFGHGFHFFH3GFGGGHHGGHHG4GFFGHHHFHE/FG/<E@/CDDEGHEG<CADGHHHHGHH0
+@93386/1
+CATCAGGATGATACCGCCGGCCAGAATAGCGTTGCCGATAAGCCCGGAAAACGTCGAGGCGGCAGAGGCGCGCAACAGGATCTGTTGCTGCTCCGGCGTCATATTTTGTACCAGCTCAAACAGGCCAGCGCTGCCTGCCAGATGTTCTC
++
+>1>AAFFB1C1B3GGCGGE0EECHFGF1GHGGGGGGE?E?GHHFGECCECFB/>FEGGCCCGGCEG/AE/@BC/<B<<GCHFGDFHFGF1FBGH?-ACAC?CBDDHFFGHFHBGFFF0CFHH/:CEA.A@G.ABGFG.;BBAG00;0CB
+@844257/2
+GCGTTTCGCGCTTCATCGGCATTCTGCCCCATCGGTATCAGCAGCGTTTGCGCGCCGTCGTCGAGCAGTTGCTTAATCTGTACCGGATCGTTCCACGACGGACGCACCACCGGCTGGCTGGGATAGGGCGCAATCGCCTGCAACTGGGTC
++
+A>1>A11>A1AD0AF33C0AE0FGBGG1AFAF0EFG//1DF11GCEE///AEE?/>//>>EEE?//EHGDGHHHF12FGFFGDBE/</E/0/BF2GC////////<>-<.<>--<@.C/E?A:C/::CHCC--9F..;.:AB90FBFG/9
+@959865/2
+CATTGAGCATTTGCAGTAGCTCCTGTTCATTTTCAACAACATGGAAGCGACATTTACTTCGCTCAATCGCCTCAATAAAGTCGTTAGTATCAACAGGCTCATTACGATGTTCGTTAAACTCTTCCAGCACTTCCTGGTAATCCAGCCCTT
++
+AAAABFFFFDFFFGGBGD55GGCHFHHFFGFHBGHHHGCHAGBHFHHCEDE2AFGGHHHHFEDHGHHHFGGFGHHDGH5FGHFFEAFEGHHHEFHFFA1FFFDHGEFHEG4GEGHHG4FGHFHGFH4?FHGHHHHHHCDHHHHHFBFABG
+@437453/1
+AGGCGCTCGTGCTGCTATCGAAGCTGCTGGCGGTAAAATCGAGGAATAAGTAGCAGATGGCTAAACAACCGGGATTAGATTTTCAAAGTGCCAAAGGTGGCTTAGGTGAGCTGAAACGCAGACTGCTGTTTGTTATCGGCGCGCTGATTGT
++
+CC@ABCCCCCCCGGGGGGGGGFGGHHHHHHGGGGGGHHCBAFEEFHH3GB5EFFGHFGHFCGDGHGFGHGGGG@DGGH44BFHGHHHFGHFHGHHGF3BFGHHFFHFHFAFHHFGHFFDGGGFHHHHFDGGHFHFG1CD@@@D@?@AGG00
+@850714/1
+TCCATGCTGAACGCGACCCTACTAACAACTGCGCCATCTCGCGCAGTGGTCGTCGTGCGTGTGGTGGTGGTCGTCGGCAATGCGCCGTAGGGTCCGGAACACACACGATTCCAAAACCCCGCCGGCGCAAACCGGGCGGGGTTTTTTGTTT
++
+AAAA@FF1BFF1A11E0AAEGAFGC1FAF1GHG?EFFCGFHGGG?/AF01B>>F>/AFG/?>>/0//?///1/>///</<G11?A//>/?/?0C/><ACC0?C/?<@-GCB111<.0.<C-<---:-A@A?AEAGGG@@<@-;-A--@--9
+@62844/1
+CCCTCAGCCATATCCGTGTGATTACTGGTGGAAGTCAAACGGAAGGTAAAGGTTACTATTTCGCTCCGACGTTGCTGGCAGACGCAAAACAGGAAGATGCCATCGTGCAACGCGAGGTCTTCGGCCCGGTGGTCAGTATAACCGTCTTTGA
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHGGHGGHHHHHHHHGGGGGGAGHEGHHHHHHHGHHHGGGHGGGGGGGHGHHHGHGFHGGGGGHHHHHGHHHHHHHHHHGHHGHHHGGGGGGGHHGHHGGGGGGCCDEHHHGHHHHHHGGGHGHHG
+@785769/2
+GTACTGCTTGCTCACGTTCGATCTCCGTCTCCTGGATCTGCCGCTCAGCAAGAATGCGCGTCTGTTCTGCTTCACGATGGCGCTCGGCCTCAAAAGCGGCAATTTTAGCGTTTTGTTCGGCGGTGCGGGTTTTAACCTGTTGCTCCTGCT
++
+AAAAA5DBFFADGGGGGGGGCGHGH4AF4CGGHHBFHHHGH3EEGGEHHH2GBGGHHGGGGGDGFFFHD5GB5FGGFAF>B/E>>/EFEGH3CBGFGGCG/@31G2B0D/?CCGHHCFE@?D@--<C@C@E.EGCGF0.CGFH000;CFH
+@30392/1
+ATTAAATGGACGGTGAACCTGGATATGCCTTCGTTGTCGCTGCGCGGCGAATCTGCGCCGGCAACCGCGTTCGGCGCGGCTATTGTTGGTGGTGATAATGGCCGCGTCAGCGCCGTGTTGATGCAACAAGGCCAGATGATTTGGCAACAG
++
+ABBBBFFFFFFBG2A2FBCBGGFHGGHHGCHGHFHHGHG2EEGGGGGGGEEEGHHFGGGGGGGGGHC?EEGEDGGGGGGCGGGHG>FAG.>?AFFBGHEHFHHGGGCCD?FFCBBBGG?EFGGGGGGGFBEEEFGGGFFEBFFFFFFEFB
+@652969/1
+GGCGCCGATAGCGCGCAGCGCGCTAACCCGATGTCCCGCTGAAACTAACTGAATCATCAGGATGATACCGCCGGCCAGAATAGCGTTGCCGATAAGCCCGGAAAACGTCGAGGCGGCAGAGGCGCGCAACAGGATCTGTTGCTGCTCCGG
++
+ABABBBBBBBBFGFGGGGGGGGGGGGHHHGEGGHHHHGGGGGHHHHGHHGHHHHHHHHHHHHHHHHHHHGGGGGGGGGHGHHHHGDGGGHGGGGGGHHHGGGGGHHGCGGGCGGGGGGGGGGGGFGFFFFFFFFFFFFFFFFFFFFFFFF
+@495571/1
+GTGCAGCCCTTTTGCACGATGGTGCGCATGATAACGCCTTTTGGGGGCAATGTGAAAGTTGGCACAGATTTCGCTTTATATTTTTACGGCGACACGGCCAGCAGAATTGAAGATCTCGTTACCACGACGACCGACCATGACCAATCCGGGA
++
+AAAABFFBBFFFGGGGGGGGGGHHHGGGGGHHHHHGGGHGGHHGGGGGGGHH5EFFHHHHHGHHHHHEGHHHHGGHGHHHHHHHHGGGGGGGGGGGGGGGHGFFHHHHHEGHGHHHHHGGHGHGG?DFGGGGGGGGGGHFHGGHHHHGGG?
+@1033106/2
+GGCGCTTTGCTGGTGGGCGGCGGCGCGGTAGCGGGTTCCGTATTGTGGAATAAGTACAAAGATAAAGTACGCGCCGCGCATCAGGGGGAGCCGCAATTCGGCAGCCAAAGTACGCCGCTGGATGTTCGCACTGAGCGACTGATCCTGGCG
++
+BBBBBBBAFFFF4GCC2FGC?EGGGEEEEEAGEEGEFFHGGHGGH3FED3FFFHHHHGFBGGHHFFFHFFDGGC//@CC-CDGGH.?<-:.:DGGGGGGEFB@?DAAF9/9FGFGGGBBB<FFFFFFD>.@@F/:F?B@?A/9FF://.9
+@35462/1
+GTGGGATACGCTGAGCGGCCGTCTGGATTTTTGTAATCTTGACGTTAACGATACGCCTGCGTTCAGTCGCTTGGGCGATATGCTGGATCAAAAAAACCGTACCACCATTAACTATTTTGCGATGCCGCCCAGCACGTTTGGCGCTATTTG
++
+CCCCCCFFFCCCGGGGGGGGGGGHGHHHHHHHGHHHHHHHHHHGGGHGHGGHGGGGGHHHGGGGHHHHGGGHGGHHGGGGGHHHHHHHHHHHHHGGGGGGHGGHHGHHHHHHHHHHHHHHGGHGGHGGGGGHHHHGHHHGGHGGGGGHHH
+@1146897/1
+AAAGTGATGATGGTCGCCATCGTTTTGCTGTTTGTGTTGAGCGGCTTCTTCCGCGGCTTCGACATGAAAATGATCGAGTCTTTCAACATGACGGTACCGAACTGGCTTGAACTGATCCACAACTCGCTCAGCGGCAAATAACGGAGGCCA
++
+>AAAAFFFFFFFGGFE?EEGGGFHFGHHGHGHHHAGFGHGHFGGGGGHGGFHGGGGGGGHGHEGCGFHHEGGHHHGGEFG3GHHFDFHGFGHGGGAEHFEE/GGHGHHGFHHFFHHFHHHHH/GBACFAGHGGGGGG0<<GHGC?DGGGE
+@1225691/2
+CCGCTGGCGCGGCGCAATACCCGGCAACTACTAATGCTAAAGCGACCTTCGTCAGCCGCCGTTTTACTGTTGCTTGCATTCAGACTCTCCTTTTTCTCAAAATTCAGCGGCTGGCTGGTCAGCCACAACGCTGACGCTATTTCTGACTATA
++
+CCBBC@DADBCCGGGGGGGGGGGGCGGGHHHGHHHHHHHHHHHGGGGGHHHHGHGHHGGGG>EHGHHHHHHHHHHHHHHGHHHHHHHHHHHHHHHHHHHHHHHHHHGFD<CDGGGHGGHHFHGHHHHHGCGGGGFGGGGGHHHHHEHHEG0
+@106206/2
+CCCCTAACCCTTTGCAAATAGCGCCAAACGTGCTGGGCGGCATCGCAAAATAGTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCG
++
+AABBB@FFFCFFGGGGGGGGGGGGGGGHHGFHHGHHGHGGGGGHGGGGGEHHFFGHHHHHGFG1FFFGFFFGFGGGGHGGFFHHFFHHCGGGCHHGGGGFGHHHHGGGGGGADGHGHHHEHGHHGGHGHHHEFEFHHHHGHHHGF.DGC
+@113942/1
+CCCTAACCCTTTGCAAATAGCGCCAAACGTGCTGGGCGGCATCGCAAAATAGTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCGCT
++
+>AAAAFFFCFFFGGGGGGGGGGGGGGHHGHHGGHHGHGGGGGHGGGGGHHHHHHHHHHHHHGEHGGGGGGGGGGGGHHHHHHHHHHHGGGGGHHGGGGGGHHHHGGGFGGGGGHGHHHGHGGHEGHHHHHHGHHHHHFFHHHFGGGGGGG
+@136842/1
+CAAAATACACACTTCGCTTCATCTGGTACGACCAGATCACCTTGTGGATTCAGGAGACTGACATGCTTTATAAAGGCGACACCCTGTACCTCGACTGGCTGGAAGATGGCATCGCCGAACTGGTGTTCGATGCTCCAGGCTCGGTCAATAA
++
+DDDDDFFFFFFDGGGGGGGGGGHHHHGHHGGGGGHHHHHHHHHHHHGHHHHHHHHGHGHHHHHHHHHHHHHHHHHHHGGGGGGGHHHHHHHHGGGGGHHHGGHHHHHHGHHHHGGGGGGGHHHHHFGHGHHGGHHHHHHHHHGGGGGHHHH
+@62831/1
+AACAGTGACGGCACCGCATCCCAGGACGTTTTCAGCGCTATTTCTCCCCCCTGCGCCGATGGCTGCCAGTGCAGCAAACGCAGGGGAGGCGCCTGGAAATCTAACGGCGAAAAAGGACACGGATTTTCAACGGTGCCCCCGAAAAGCGGTT
++
+BBBBB5DFFBBBGGGGGGGGGGHHGHHGGGHGHHFHGGGGGHHHHHHHGGGGGHGGGGGGGGHHGGHGHHHFHHHGHHHGFGGGGGGGGGGGGDHHFGHHHHHHGGGGGGGGGHGGHHHHGGCFGGHHHHHGFF?DGGGGGG?DGG?AGFD
+@945988/2
+CGCGTGGCGTGGTGGGCCTGTTCCCGGCGAACCGTGTGGGTGACGACATCGGAATTTATCGCGACGAAACCCGTACTCATGTTCTGACGGTCAGCCACCACCTGCGCCAGCAGACCGAGAAAGTCGGTTTTGCCAACTACTGTCTGGCGGA
++
+B3ABBBBBBBDBFFFGCAFFGGHHHGC?EECEEEEHFC1E11EHG1EGGHG1EFGFHHHHHCEGGFGG?EFGGDDGHHEFHHHHHEHHFFCADCCC0FFGHGHHFCDDEDGFFFHCCC-CDFFHFDC@D?FFFGGFGGGBFBFFGGFE??-
+@263250/1
+GTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCGCTCAGCGTATCCCACAAGCCTTCATCAATTTTTTCCTTCATGAAGGTTTCCAG
++
+CCCCCFFFDDACGGGGGGGGGGGGGGHHHHHHHHHHGGGGGHHGGGGCGHHHHGGGGGGGGGHGHHHGHGHHGGHHHHGHHHHHHHHHHGHGGFFGGGGGGHHGGGGHHHHHGHHHEHGHHHHHHHGHHHGHHHHHGHHHGHHHHHFFGG
+@280230/1
+TTTGCAAATAGCGCCAAACGTGCTGGGCGGCATCGCAAAATAGTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCGCTCAGCGTATC
++
+BBBBBFFFFFFFGCGEGGGGGGHGHGCCFGGGGGGGGGGHHHHFGHHHHBHHG1BD?DGFEFGGGGFHGF3EHHHHHHGC/EFHHGFGGGGHHEFDGGGGGGGGHGHHHGHCHHGGHHFFHHGFHFEHGHHHHGGGCGCCFGGGGDCDA.
+@93878/1
+GCACGATGGTGCGCATGATAACGCCTTTTGGGGGCAATGTGAAAGTTGGCACAGATTTCGCTTTATATTTTTACGGCGACACGGCCAGCAGAATTGAAGATCTCGTTACCACGACGACCGACCATGACCAATCCGGGAGAGTACAAGTATG
++
+BBBBBBBBBFDFGGGGGGGGGGGGGGGHHHCGGGGGGHHGHHCHHHHHHHHHGHGHHHHHGGHGHHGHHHHHHHGGGGGGGGGGGGGHGHHHHHHHHHHHHHHHHGGHGGHHGGGGGGCCGGGGHHFHHGFHGHGGGGGGGFHHGHGFGGG
+@1462499/2
+GGTAACTGTTATCGGTAACATTGTCCAACCGCACCATTCACGACGCAATGACCATTCGTGCCAAAAGTGAATAAGTGTGAGCTACTTCAAAGTTGTCAGACTAAATAGATCCGCCCGGTGACAAGGTGAAACCTAAATCTAACATTTTCGG
++
+BCAABFFFFFFFGGGGGGGGGGHHHHHHHGGGGGGHHHHHHHGGGGGGGHHHHHHHHHHGGHHHHHHGGHHHGHHHHBGFHHHHHHHHHHFHGHHHHHHHHGHHHHHHHGHHGGGGGGGGGHHHHHHHHGHHHHHHHHHHHHHHHHHHHFG
+@388769/1
+CCCCTAACCCTTTGCAAATAGCGCCAAACGTGCTGGGCGGCATCGCAAAATAGTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCG
++
+CDCDDCFFFDFFGGGGGGGGGGGGGGGHHGHHHGHHGHGGGGGHGGGGGHHHHHHHHHHHHHGGHHGGHGGGGGGGGHHHHHHHHHHHGGGGGHHGGGGGGHHHHGGGGGGGGGHGHHHGHGHHGGHHHHHHHHHHHHHHHHHGGGGGG
+@892694/1
+GAATAACGATATAACGCCTGTCGGTCGCCTGAATAATCTGGGTAATGAACAGGCTGGAAAACATCGCGACAAACGCCGTAACGGTGACCGACTGACCGGCGACGCCCTCGGAGATCCCCAGATCCTGCGCCATCGGCGTCAACAGACTAA
++
+CCCBAFFBBACBGGFGGGGGGGGGGGGGGGHHHHHHHHHHHHHHHHHFBGHHHGHGGHHHFHHHHGGGFGCGHGGCGGGGGGFGEHCGHGGGGGHHGGGGGGGGGGGGHGGGGCHHHHGHGHHHHHHHGGGGGHGGGGGGGGFGGGGGGG
+@446718/1
+TGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCGCTCAGCGTATCCCACAAGCCTTCATCAATTTTTTCCTTCATGAAGGTTTCCAGCGCCT
++
+?AABABAFFBBFGGEFFGGFGGHD3GHHFGHGGEGEGHGGGCCEFHHFGCEGEGGCEHGHEGEGG21F?33GDBGHHFGEGCFBED/E/<EGC?@<FGGGDDGHF2FA/F/F1DG1FDG?GHHH1@GDDGFHHHDFBEFHEGGH0/-<C.
+@864081/2
+GTATCCCTCGCAACAATGTGGTTAATTAATCATCGAATATAGCCTTTGCTATGTTATATAGCACAAGGCATGAATAAATGAAAATAATTCTTATTTGCGTAATGGCGACGATATGCAGTGATAGTGCTAAAGAGGGATAAGATGTAAAATA
++
+AAABBFFFFBBBE2EGGGGGGFFHHHHHHHHHHHHHHHGHGHHHHHHHHHGGHHHHHHHHFHFGHHGGFFFGGHHGGHHHHHHHHHEHHGHHHHHHH5EEFDFFDEGGGGEGGGH4FDBB3GE44FFBHHFEH2?/BFHHFHHGDDHH3DF
+@212352/2
+CAATATGCCCATCGCTTTTTGCAGCAAAAACCAGCGCCAGGATCAGTCGCTCAGTGCGAACATCCAGCGGCGTACTTTGGCTGCCGAATTGCGGCTCCCCCTGATGCGCGGCGCGTACTTTATCTTTGTACTTATTCCACAATACGGAAC
++
+ABCCBFFFFFFFGGGGGGGGGGHHHHHHHHGGHHHGGGGGHHHHHHGHGGGHGHHHGCDGGGHHHHHGGGGGGGGHHHHHHHGGHGFGGHHHGGGGGGGGGGGHHFHGFGGGGGGGGGHHHHHHHHHHHHHHHHHGGGGGGGGGGGGGGG
+@1444533/1
+AGGGTTGCCAGTGGGCAGGGTAAATAAGGTCGATGATGCCCAGCGAAATATTGTTAATCTGCTCCTGATTATTCTCCCCAAACAGTCCCCAGCGGCGGGGCGGTCCCCGCCGAAAGTGAATTTCACGCAGCGCACATTTCGCACGCGGCG
++
+>ABBAFBFFFFFGGGGGEGGFGHCGHHHHHHGGGHHHHHHHFHAAEEEFEGHHHHHHHFHHGHHHHHHHHHHHGHHHHEHGHHHHGFFHHHGH?EEF//>/<-<--<C-;----;.0;9F00;00;;9------A-;;B/...-;----9
+@70737/1
+TAATATGGCTATCCAGGATGTGCCGATCCTGAACAGCGATAAAATCATTTGCTCACGCCTGAAACGCGATGACACGCTGATGGTGCCGTCGCCGGGGACGATTATCCAGGCAGGCGACCTGCTGCACCTCGTCGGCCAACCTACCGAC
++
+DDDDDFFFAFFFGGGGGGGGGGHHGGGGGHHHHHHHHGGHGGHHHHHHHHHHHHHGHHGHHGHHHGGGGGGHHHHGGGGGHHHFFHHCGGGGGGGGGGGGGGHGHHHHHHGGGGGGGGGGHGHHHHHHHHGHGGGGGGHGGHHHHGGG
+@574445/2
+GTTTCGGCGCGACAAAATCCGCCAGACAGTAGTTGGCAAAACCGACTTTCTCGGTCTGCTGGCGCAGGTGGTGGCTGACCGTCAGAACATGAGTACGGGTTTCGTCGCGATAAATTTCGATGTCGTCACCCACACGGTTCGCCGGGAACAG
++
+BBCBCCBBCCCBGGGGFGGGGGGGGHGHHHGHHHHHHHHHGHGGGGGGHHHHGGGGGHHHFFGGGGGGGHGGGGHHGHHHGGGGGHHHHHHGHHHHGGGGGGHGHGGGGGGCGGFHHHHEHHFHEFGEGHFGG?EGGGGEFGGGCGG-CFF
+@1337142/1
+ATTTTAGCGCCTGGGCGAACGTCTTTCCGGACGACATTGGCAACTTCAGCGCCTTTAACGGTAATTTCCCCCAAACCCACTGGGCGCCACAAAATCTGGCGCAGGACGATACCACGCATATGAAATCGCTGTATGCCGCTACGCGCATTT
++
+BBBBBFFF@DBBGGGGGGGGGGHHGHHHGGGGGGGGGHHGHHHHHHHHHHGGGGGHHHHGGEGFHHHHHHHGGGHHGGGGHHHHHGGGGGHHHHHHHHHHGGGGGGHGGGGGHHHGGGGGDHHHGHHGGHGGHHGHHGGGGGGGGGGGGG
+@762667/1
+ATGCCGGACAGCAGGCGAAACTCGAACCGGATACGCCGTATGGCGATGCGCTTGGCGTTGGTGCCGGTCGTAACTGGGCGCACGTCAACTCTATCGCTTATGACGCGAAAGACGACTCCATCATCCTTTCTTCCCGCCATCAGGGTATTGT
++
+BBBABDDBDDAACFGCAEEE?FGGEGHFGGEEGHFFGGEEGEGHGG?FEGDFG?1EE1>EE1?DGEGGEF<B0<EFFHGCCGGF0/FDGFEHHHFFGHHDGGHHGGGGG?DHGCC@DDHHFGHFBGBCCFHGG0FFGAGGGGFE?;9CBF0
+@243930/1
+CCGTTATTTTTGCCTATCACGATATGGGATGTCAGGGCGTGCAGGCCGTACTGGATGCAGGATATGAGATTGCCGCGATTTTCACTCATGCCGACAATCCTGCGGAAAACACCTTTTTTGGCTCCGTCTCCCGGCTGGCGGCAGGATTAGG
++
+CCCCCBCFFFFCGGGGGGGGGGHGGHHHHHGHHHHHHGGGGGHHHGGGGGGHHHHHHGHHHGHHHHHHHHHHHHGGGFGHGHHHHHHHHHHHGGGGGHHHHHHGGGGGHHHHGHHHHHGGGHHHGGHHHHHHGGGGGGGGGGGGGGHHHGG
+@577677/1
+GGTTTCGTCGCGATAAATTTCGATGTCGTCACCCACACGGTTCGCCGGGAACAGGCCCACCACGCCACGCGGATTCAACAGTTTCTCGGCGCTCAGTTTATCCAGCATATCATTGGCGTCTTTAAACAGACGCTGCGCCTCAACGCCCAC
++
+BCBBBFCFCCCCGGGGGGGGGGGHHHHHGGHGHHGGGGGGGGGFGGGGG@EGHHGGGGGGGHHGGGGGGGGGGGGGFGHHHHHHHHHGGGGGGGGHHHHHGHHHGGBHHHHHHHHBF@D@GGHGHEFHHHHCGGGCGGGGGHHGGFDG?F
+@1335494/1
+CCGCCGAACTGTTCGCGCAGCCGGACATCGACGGCGCACTGGTAGGCGGCGCTTCTCTGAAAGCTGACGCCTTCGCGGTGATCGTGAAAGCAGCAGAAGCTGCTAAACAGGCTTAATTGCCAATCAATGTCTGATGGCGCTGCGCTTATCA
++
+BBBABBBDDAFDGAEECGGGGGGGGGGHHGGGGGGGCGGEHHHFHGHGGGGGGGGHHHHGHGHHHHHHGGGHGHHGC@<C/<GFGHHFHFHFCGHHGHHHHHHHHHGHGHHG.GHHFFHHHGGHGHHGFHHHHHGGGEGGG?DGBGGGGGF
+@594217/1
+CGCCCACCTCCGGGACGGTTATCGCTATTGCCCCCCACTCGACGGCACATCCTTCGGCGCTGGCGGAGTTAAGCGTCATCATTGATGCCGACGGCGAGGACCGCTGGATTGAACGCGAGGGCTGGTCTGATTACCGCGCCCACAGCCGTGA
++
+CCCCCBBBFFCCGGGGGGGGGGHHGHGGHHHHHGGFGGHHGHGGGGGGHHHHHHHHGGGGGGGGGGGGGHGHHHGGGGHHHHHHHGHHHGGGGGGGGGGGHHGGGGGCHHHHGGGGGAGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFDDE
+@725026/1
+CGCCTGCGTTCAGTCGCTTGGGCGATATGCTGGATCAAAAAAACCGTACCACCATTAACTATTTTGCGATGCCGCCCAGCACGTTTGGCGCTATTTGCAAAGGGTTAGGGGAGGCTAAACTCAACGCCAAACCGGCGCGTGTCGTGATGGA
++
+BBBBBBFBABAFGGGGGGCFGGGGGGFGFHHHHGHHF3GHHGGGGGEH?FHHGFHHFGFHHFHEHHHGCFEFCEE@EGEGHHGGFCFFFGGCFGHGFHHHGHHDFGGFGADDCGGHGHEGHHHBG?CF?DGGGFCDC?@@@CCEEFFGFG/
+@659406/1
+GTAACGGTGACCGACTGACCGGCGACGCCCTCGGAGATCCCCAGATCCTGCGCCATCGGCGTCAACAGACTAACGGGCAAAAACTCAACGGTAATCAGGCAGGCGACACAAAACGCCACGGCAAAAACGGCTGACCAGTTAGGCCTGGCAA
++
+AAABBCCABBFFGGGGGGGGGGGGGGEFGGGHGGGGGGHHHGHGHHHHHHHGGGGGHGGGGGGGCHGHHHHEHHGCGGGGHFHGHHHGHGGGHGHHHGHHGGGGGGGGGHGHHHGGGGGGCGGGHGGGGGGCGGGGGGGGGBGGGGGGGFF
+@965990/2
+GGGCTTGCTCGCTGGTCTGAATGCCGCGCGTCTTTCCGCCGACAAAGAGGGCTGGGCGCCTGCGCGTTCTCAGGCTTATCTCGGCGTGCTGGTGGACGATCTCTGTACGCTGGGCACCAAAGAGCCGTATCGCATGTTTACCTCCCGCGC
++
+BBBBBBBBFDBBGGGGGGGGGGHHHCGGGEEEGGHHHGGGGGGCGFBGFGEGHGD?FFGGGHGGGGGGGGHFFGHGHHHHHHHGGGGGGGGHGFGHGC<FGEHHGHFDHF.DCAEGGGHGEHFHHHG;AFCDEGGGFBCHFGEGEEGGGG
+@700487/1
+CAATATGCCCATCGCTTTTTACAGCAAAAACCAGCGCCAGGATCAGTCGCTCAGTGCGAACATCCAGCGGCGTACTTTGGCTGCCGAATTGCGGCTCCCCCTGATGCGCGGCGCGTACTTTATCTTTGTACTTATTCCACAATACGGAAC
++
+CDCDCFFFFFFFGGGGGGGGGGGHHHGHHHGGHHHGGGGGHHHHHHHHGGGHGHHHHGGGGGHHHHHGFGGGFGGGHHHGHHGGHGGGGHHHGFGGGGGGGGGHHHGGGGGGGGGCCFHHHEHGHGHHHHHHHHHHHHGGF90FFFEGGG
+@247978/1
+GTCTACCGGCGTGCCGTTTTCATCGTAAGGCATGTCTTCGATCGGGTTGATCTTAGAGATAACACCCTTGTTACCGTGGCGACCTGCCATCTTATCACCCGGCTGGATACGGCGTTTAACGGCCAGATAGACCTTCACGATCTTCAGCACG
++
+AAAA1DFD?1DAEGCE0EGAB22DAGA001BGH0A22BF//20AA//A/02AAFFHHGDF@1@@1>>GGBFG22GAFC>EE/EEEGH>B1>B>FFF2BGG////<?01><?C?/><AHHF<C/@->0<F1111<0/0<..GA.D0000<.:
+@1103586/1
+GCCTCGCACAATGTGGTGCTGTTGCAAACCATGCGCGGTTTCTTCGACGTCCTGCAATCCTCCGTCAAACAGAGTCGCCAGCGTATGTATCTCGTTCCGCCCGTATTCTCAAAGCTGACGGAACAACACCAGGCAGTGATGGACGCCATT
++
+AAABBBBB@BFFFGGFFFGGEGFFBFHHHGHHFFCFGGGGGHFHHHEFGFGG?GHHFHGHHGHFHEGGEHHHEF@FEFGGGEGGGGHGHHFFFHGGHHGGGC<</GHHHFFFHGHFGGFFGDFGGFHHEACG<GGG<FGHBBBCC-@GCG
+@939489/2
+AACGTGCTGGGCGGCATCGCAAAATAGTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCGCTCAGCGTATCCCACAAGCCTTCATCAA
++
+CBCCCCCCFFBAGGGGEGGGGGGHHHGEGHHHHGGGGGHHGGFFGGGGGCEFHHHEHHHHHHGGGGGHAFGGGGFFHHHGGGGGGGGGHGHHFGHGHHFGFHHHHHHGHHGHHFHHHGGGGFCGG?EGGDDDFHHHHHGHF.CCFFGFF0B
+@967409/1
+GAGTTTAGCCTCCCCTAACCCTTTGCAAATAGCGCCAAACGTGCTGGGCGGCATCGCAAAATAGTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATC
++
+BBBCBFFFFFFFGGGGGGGGGGHHHHHGHHHHHGGGGGHHGHHGGHGGHGGGGGHGGGGGHHGHHHHHHHHEGGGHHGGHGGGGGGGGHHHHHHHHHHHGGGGGHHGGGGGGHHHHGGGGGGGGGHGHHHGHGHHGGGHHHGHHGHHHHH
+@717024/2
+ACCATTCCCTGGCTTGTCGCCTGCTCAATGAACCACGAGAGCGCGCCGCAGTGGGACGTATTTTTGACGCTGACGAAACCCAGCCCCGTCTCTCTCGCCAGACTAATAGCGTGGTCTGTCGCCTTTATCAGCGCGCAGTGTCCCATTCCAT
++
+A3AABFFFFFF?FGGGGGCGECHH4GHGHHHHHHHEGG?AFHGGF?EGGGGGHHGEHGGCGHB44>1G?EEFGHDGGG/0EECAFDEE?/?BF2BFD/>ACHGHGGHHHHGDFCGGDFG1FADFDBGFHHHHGGGGCFDHF0;CFHH0GHG
+@866221/2
+GTCAGAAATAGCGTCAGCGTTGTGGCTGACCAGCCAGCCGCTGAATTTTGAGAAAAAGGAGAGTCTGAATGCAAGCAACAGTAAAACGGCGGCTGACGAAGGGCGCTTTAGCATTAGTAGTTGCCGGGTATTGCGCCGCGCCAGCGGTGG
++
+AABBAFFFFFFFGGGGGFGGGGGGGHHGHHHHHHGHHGGGGFGGHHHHHHGGEHHHHGGGHGGHFHHHHHHHHFHHHGFHG@GHHGHGGGGGGFC0B/?CDG////BFGHEHFHFEF1FFGFHHHCGG<CFHHF?CADCG?CDCE?C??D
+@396309/2
+GTTCGGTACGACCATCGCGATGGTGTGCGAGGAGGCAGACACCAGCGCGCTGGCGGCGAGATTAGGCATATAGCCCAGCTCATGCACTGCCGCTTCGATTTTTTCCCGGAGTTTATCAGAGACCTGTTCCGGCGTGCGTAAGGCTCGTGAT
++
+A3AAB@ABBBAAE?FGCGGEGCFHCHGHGGGGEEGGGEGH2AFGFGGGGGEEGGEGGGGC?FGFHFFEHHFHHHGFHHGHHGHHGHHFFFHG?CDDDCGHGHGGEHHGGGGDHFHHHHHHFHGGHGHHECEGCGGGG@;9AACBFGBBEFF
+@648885/1
+TCTCAGGACTACCAACAGGCGCTGGCGTGGTATCGCAAAGCCGCTCGCCAGGGGCTGCCTGCTGCGCAAACGCATCTGGGCATCATGTCTGCATTTGGTCGCGGCGTCGCGCAAAGCGACAGACAGGCTATCGCATGGTATCGAAAAGCAG
++
+CCCCBFFFCFFFGGGGGGGGGGGGGGGGGGHHHHGGGGGHHHGGGGGGGGGFDGGGGGHHHHHHHGGGGGHGGGGGHHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGGGGGHGGGGGGHHHHGGGGGGGGGGGGFFGGGGGGGGGGF
+@252739/1
+TCTGTTGCTTGGCGGCATGGTGTTCCTGTTTTTGCGCCTCCCCACCTCCTTTCTGCCGCAGGAAGATCGGGGCATGTTCACTACGTCTATCCAGCTACCGAGCGGTTCTACGCAACAGCAGACCCTGAAAGTCGTTGAAAAGGTTGAAAA
++
+BBBBBFFFFFFBGGGGGGFG5GHGHHHHHHHHGGHGGGGGHGGHGGHHHHHHHHHHHGGGGGGHHHHHHGGGGGHHHGHHHGHHGGHHHHHGGHHHHHHGDGGGCEGGHGFFGGGGFHHHHFHFHHHHGHHFHDGGHEFHHHGHHHHHGH
+@1131032/2
+AACGATACGCGTGCGTTCAGTCGCTTGGGCGATATGCTGGATCAAAAAAACCGTACCACCCTTAACTATTTTGCGAAGCCGCCCAGCACGTATGGCGATATATGCAATGGGCTAGGGGAGGCTCAACTCAAACCCAAATCGGCGCGTGTCG
++
+>AA1111>111>0AEE0A1BAA0A000//B///A/D22D1B1F01F1FEEE?EGC//2BB/?>1BB212222B1>//>/>EE////B<B/B0B00///<//2?22?111100?F0F//.--.<0<><000<00.....00..:-:---;;.
+@505905/1
+AGCCAATTTTATGGCCGGAAAAGAGAAATATGATGCCAGGCTGATACATGACCGGCGTGCGCGGCCCCGGTTCAACACCATACAACAGACGAATGCCCGCCAGCCGCTCGCTGATTATTTTATCATTATTTTTTAAATGATTAATTTTAT
++
+AAAA1FF@FFDFFGGFEGG0E0AFGCGGFFHHCFFHHGHGGAHHDHGHEFFGHGGGG/AEEEEEG?EGGG>EGHHBGFEFHHEFHBFC00BCCH11GBGGC?//<///A?CECCFGHHDGHGHHDGHH0GGHGCGH0CCGHHHHGHFGHB
+@665375/2
+CGTGTACTCGCGTCAGCAATTGATGGATATTGTCTGGTCTGATGCCCAGGAGACCTTCGATCGGACGGTCGATACACACATCAAAACCCTGCGCGCTAAGCTACGCGCGATCAACCCGGATCTCTCGCCAATTAACACGCATCGTGGAATG
++
+ABAAAFFFFCBCGGGGGGGGGGHHHHFHHHHHHHHHHFHHHHHHHHHHHGHGHGGHHHHHHHGGGGGGGGGGGHGHHHGGHHHHHHHGGHHGGGGGGGGHHHHHGGGGGGGGGHHHGGGCGGHHHHGGGGGHHHGHHHGGCGGGAGGGBFF
+@937716/2
+GTGTGTGTTCCGGACCCTACGGCGCATTGCCGACGACCACCACCACACGCACGACGACCACTGCGCGAGATGGCGCAGTTGTTAGTAGGGTCGCGTTCAGCATGGAAGGGTTCATTAGGGGCCTTGTCTGTTTGTTATTAACACGTTTTAT
++
+A>AABFFFFFFBGGGGGGGGGGGGGGGGHHFGGGGGGGGHGGHGHHGGGGG??E@EEEEGHHGDAEEGGGFB2FGGGFDGFFFEHGHHGGCGDGFA@FBGGHFHHBGGED.<CDHFGHHH?FFGHFCHHHFHFHGGEFGFGGFFCCFGGGF
+@1200215/1
+CCCTAACCCTTTGCAAATAGCGCCAAACGTGCTGGGCGGCATCGCAAAATAGTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCGCT
++
+ACCCCFFFCFFFGGGGGGGGGGGGGGHHGHHHGHHGHGGGGGHGGGGGHHHHHHHHHHGGGGFHHEGGGGGGGGGGHHHHHHHHHHHGGGGGHHGGGGGGHHHHGGGGGGEGGHGHHHGHGHHGGHHHHHHGFHHHHHGHHHGGGCGGGG
+@1204739/2
+GGATACGCTGAGCGGCCGTCTGGATTTTTGTAATCTTGACGTTAACGATACGCCTGCGTTCAGTCGCTTGGGCGATATGCTGGATCAAAAAAACCGTACCACCATTAACTATTTTGCGATGCCGCCCAGCACGTTTGGCGCTATTTGCAAA
++
+ABABBFBBBBBFGGGGGGGGGGHFHHHHHGHHHHGHHHFGEGGHGHGGHGGGGGHHHGGGGHFGHGGGHGGHHGGGGGHHGHHGHHHHHHHGGGDGGHGGHHGHHHHHHHHHHGHHHGGHGGHGFGGGHHFHGCGHGGHGGCCDHHHHHGH
+@1218564/2
+ATAGTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCGCTCAGCGTATCCCACAAGCCTTCATCAATTTTTTCCTTCATGAAGGTTTC
++
+CCBCCFBFFFFDGEGGGGGGGGGGGGGGHHGHHHHHHFHGGGGGHHGGGGGDHHFHDGCGGGGGGHGHHHGHGGHGGH3GHHHHHHGHHFFHHHGFGFFGGGGGFHDAEGHGHHGGFHGGFHHBG1FFF>GFGCGHHHHHGFFF0F<DFH
+@1235160/1
+CCCCTAACCCTTTGCAAATAGCGCCAAACGTGCTGGGCGGCATCGCAAAATAGTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCG
++
+AAABABFBFAFFGGGGFGGGGBEGEFCHAEFGHGHFECECEFGHGGGGGFHFH@@GGHHB@BEBFDEE2?EEFGCGGHHHHHHFFHGFE/<EFHHGGDFGC2D<GECC?EGFGDFD<FFF1EGGAEHGGHHGEFFHHHBFCHHFCA--@
+@1260106/2
+GACTAAGCATGTAGTACCGAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAACATTCATTCATGATGCATCATGAACCTTAAAAAAGCCTGTAACTTCAATGAGTTGCAGGCTTTTTTGTTGCATGTGTGGTCA
++
+CCCCCFFFFFFFGGGGGGGGGGFHHHHHHHHHHHHHEGGGGGGGGGHHHHHHHHGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHHHGHGGGHHHHHHHHHHHHHHHHHHHGHHHGHHHHHGGHGHHHHHHFHHGHHD
+@514482/1
+CATTTCGCCCTCGCCACGGTTGGCCCAGCTAAACCACGGAATGAACGTTAGCGTCTGCGGCTGGCGCGATGATGGCGCGTTGTCGTAATGCCACAACGCCTGATGCTGCGCATCTGGGGCGCTTTGCTTCTCGCCTTCAGCCTGAATCAG
++
+DDDDDFFCCCCCGGGGGGGGGFGHHHGHGGHHHHHHGGGFGGHHHHHHHHGGGGGGGHGGGGGGGGGGGGGHHHFHGGGEGGGHGGHHGHGHHHHGGGGGHHHHHHGHHGGGGGHHHHGGGGGGGHHHHHHHGGGGGGGGGGGGGGGGGG
+@1300539/2
+CTTGTGGGATACGCTGAGCGGCCGTCTGGATTTTTGTAATCTTGACGTTAACGATACGCCTGCGTTCAGTCGCTTGGGCGATATGCTGGATCAAAAAAACCGTACCACCATTAACTATTTTGCGATGCCGCCCAGCACGTTTGGCGCTATT
++
+ABBBAFBBBFFFGGGFGGGGGGGGGGHGHHHHHHHGFCFHHHHHHHGGGHGHGGFGGGGGHHHGG?FHHHHGGGHGGHHGGGGGHHHHEHGHHHHHHGGGGGGHGGHHGHHHHHHHHHHHHHGGCHGFHGGGGGHHHHGFHFDG:C?FCGH
+@1314341/2
+CGCCTGCGTTCAGTCGCTTGGGCGATATGCTGGATCAAAAAAACCGTACCACCATTAACTATTTTGCGATGCCGCCCAGCACGTTTGGCGCTATTTGCAAAGGGTTAGGGGAGGCTAAACTCAACGCCAAACCGGCGCGTGTCGTGATGGA
++
+DDDDDCFCCCCFGGGGGGGGGGHGGGGGHHHHHGHHHHHGHGGGGGGHGGHHGHHHHHHHHHHHHHHGGHGGHGGGGGHHHHGGHHGGHGGGGGHHHHHGHHGGHHHHHHGGGGGHHGHHHHHHHGGGGGHHGGGGGGGGGGHGEGFGGGB
+@170161/2
+ATAGAGAAGCGTTCGTGCGCATCGCCCGCCTGATAATGCTGCCCGTCCACGGTACAAATCGCTATTCCCAGCTTTGAACCCTCGACGGACGCTAATGCCGGAATATAGTCAGCGACTTTGCCCTGGCCAATGAGGGGGCGAACGCGCTGTA
++
+ABBBAFFFFFBBGGGGFGGEAEGGCFFGGEFHHHHHHHHHHGFFGGGFEGGCFGEFGHHHGGHGGHHHHHHHHHHHHHHHGHHGGGGCGGGGGGGHHE2CGGGGHHHHFHHHHGGGGGHHHHHHHGHHHHHGGBGDCGGFGFGG?DCCGCF
+@408253/2
+GGTTAGGCATGTTTTAGCACCACGCTTTTTTAGCCCCACGATACCGTGGTGCTAAACATGGTGCCAAAAGCTCAAGATTCATACAGAGATCATGACCACACATGCAACAAAAAAGCCTGCAACTCATTGAAGTTACAGGCTTTTTTAAGGT
++
+ABAABFFFFFFFGGGGAFGGGGHGFGGGHHGHHHGGGGGGAGFGFGFHFHGHHFFHHHHHFHGHHHHBGCFBGHBFBGHHHHHHHHFHHHHGHHFHFHFHGGGHHH3GGEHHHEGGGHFGFGFHHGEHHEF33FFFHBFCGHFFGGFGGBF
+@852589/2
+GCGTAGCGCCGCAATACTGCTTGACCAGCCAGAACAGGGAATCGGTCACGATCGTGCAGCCAATGGCGCCGGAACCAATGGCAATCGCAATGATCTCCGGGCTGACGTCAGGATAGAGCGGCAGCATGGGCGCAACAATCGCCGTGGCGC
++
+AAA11>A1AADDGGGGGGGGGG1GGHHH0FHHHHHHHHCCGHHHGGGCGEGHGG0GFEFGHHGHFHEEEEGGCGGGHGHHHHHHGHGGGGGHGFHFDG?CGGGGHHGGGGGFFGBBGFHGCCCGCFHGHGEC?CGGHHGHEGG?--9?AB
+@1369276/2
+CTTATACCCACGTCGTGCGTGAGGCGCTGGAAACCTTCATGAAGGAAAAAATTGATGAAGGCTTGTGGGATACGCTGAGCGGCCGTCTGGATTTTTGTAATCTTGACGTTAACGATACGCCTGCGTTCAGTCGCTTGGGCGATATGCTGGA
++
+ABABBFFDFFCBGGGGGGGGGGGHGGGGFGHHHHHGHHHHHGFHHHHHHGGHHGGGHFHHGHHFGHHGGHHGHGGGGGHHGGCEEEGHGHBHHHHHGHHHHEHHHGHGGGHGHGGEFGGGGHHHGGGGHHHHGGCHGDHHGGGGGHHHFH.
+@228982/2
+TCTGGAAAGATAAGGTTTATCCGATCGCACAATGTAATAACGCCTATATTTTCCCCGGCATCGGTCTGGGGGTTATCGCTTCCGGCGCATCGCGCATTACTGATGAAATGCTGATGTCAGCCAGTGAGACGCTGGCGAAACATTCTCCG
++
+BBBBBFFFFFFFGGGGGGGGGGGGGGGGGGGHHHHHHHHHHGGGHGHGHHHHHHHGF?EFGHGGGGGHHBEGEEHHHHGHFGHFGGGGGGGGGGGGGGHHHHGHHHHGHHHHHHHHHHHHGHHHHHGHHHGGGGGGGGCCDHGHHGHHG
+@1381423/2
+TACCCACGTCGTGCGTGAGGCGCTGGAAACCTTCATGAAGGAAAAAATTGATGAAGGCTTGTGGGATACGCTGAGCGGCCGTCTGGATTTTTGTAATCTTGACGTTAACGATACGCCTGCGTTCAGTCGCTTGGGCGATATGCTGGATCAA
++
+CCCCCFCCCCCCGGGAEFGGGGGGGGGHHHHHHGHHHBHHHHHHHHGHGHHHHHBGHHGGGHHGGHEHGGGGGGHGGGGGGGGHGHHHHHHGGFHHHFHGHHHGFGHGEDGHGGGGGHHHGGGGHGHHGGGEFGFFGGGGGCHHHHAGHHH
+@721551/2
+TTACAATACCCTGATGGCGGGAAGAAAGGATGATGGAGTCGTCTTTCGCGTCATAAGCGATAGAGTTGACGTGCGCCCAGTTACGACCGGCACCAACGCCAAGCGCATCGCCATACGGCGTATCCGGTTCGAGTTTCGCCTGCTGTCCGG
++
+CCCCCFFFFFFFGGGGGGGGGGGGHHHHHHHHHHHHHHHHGGGHGHHGGGGGGHHHHHGGHGGHHHHHHHGGGGGGGGGHHHHHGGGGGGGGGGHHGGGGGGHGGGGGGGGGGGHHHGGGGGGHHGGGFGGGGGGGGGGGGGGGGFGGGG
+@1399604/1
+ACGCTGAGCGGCCGTCTGGATTTTTGTAATCTTGACGTTAACGATACGCCTGCGTTCAGTCGCTTGGGCGATATGCTGGATCAAAAAAACCGTACCACCATTAACTATTTTGCGATGCCGCCCAGCACGTTTGGCGCTATTTGCAAAGGGT
++
+BBBBBA?FFBBBGGGGGFGFGGHHHGHHHHHHHHHHGGGHGHGGGFGGGGHHHGGGGHHFBEEGHGGHHGGGGGHHHHHHHHHHHGHGGGGGGHGGGHGHHHHHHHHHGHHHGGCHGGHGGGGGHHHHGHHHGGGGGGGGHGGHHGHHHC.
+@1405944/2
+GTTAACGATACGCCTGCGTTCAGTCGCTTGGGCGATATGCTGGATCAAAAAAACCGTACCACCATTAACTATTTTGCGATGCCGCCCAGCACGTTTGGCGCTATTTGCAAAGGGTTAGGGGAGGCTAAACTCAACGCCAAACCGGCGCGTG
++
+AAABAFBABCCCGGGGGGGGGGGHHGGGHGGHGCEGGGGHHFHHHHHHGGHGGFGGFGGGGHGHEHHHHHHHHHGHHGGHGGHGGGFFHHHFGGHHGGHGGGGGHHHHHFHFHGHHHGHHGGGGGHHHHHHHHGHFGGD?HHFGGCFGGFF
+@1242326/2
+GGCCTGGGACCGATCAACGGCGTGGCAATCTTACTGCCGCTGGCCTTTGCGTTGCATCTGCCTGCGGAGTCGGCGCTAATTCTGCTGGCGACGGTGTACATTGGCTGTGAGTATGGCGGCAGGATCTCCTCCATATTGCTCAACGTCCCCG
++
+BBCCBABCFFCCCGGGGFFGGGGGGGGCHGHHHHHGHHEEGCCAHGHHBGGDGGGFHHHHFHFFHEGEFFHGEGGEEFDHHHHHHHHG?@DGGCDFDHHHHHHHHFGFG1GHHFFFG@@C--@.:/00::CC/:;BCC09;00/.:..EE-
+@287252/1
+TCACGGTATTTAGCGCTCATGTCTTTACCGGTCTCGTACATCGCAGCAATGATCTCATCGAGCGAGATACAGGGTTCACTTACGCGACTCATCGCCATCGTCGCCGCGTTTATCGCTTTCACGGCAGAGATGGCATTTCTCTCTATGCAGG
++
+BBABABAA3DFFGGGGGGGGGADFHGHHHGCEEEHFEGHGGGGCGDAHHGFGFFFHHHHHGGGGGGGGHHHGHGHHHHHHHEHFGGCGEGFFGGFEGEHCGEGGGGGGGGCHHHHCHHGH1FGD?C-.F0FFHHHFHHDFGFHHHGHHHHH
+@1419549/2
+GGTCTGGCTGTGGCCGCAATGGCAAAGCGGGCTATTACGTAAAAACGCCCATGATGCGCTGGAAGCCGATCAAGAAGCTATCCGACTGATCCTCAGTAACGATCCGCAGGCCACCCCGCTCGCTTATCAAAGAATGCGGGTCAACCAGGCG
++
+>3>AAFFFFBFFGGGGGGGGGGGHHHHHGGGGGGHGHGA2BGHHHGGGGGGHHHHHHGGGGGHHHHHGGGGGHHGFFFBGFFHGGGGGHHHHHHHHHGHHDFGHGHGGGDDFHGFGFGGCFGCGHFHHHEHHHGHHEFGFGGFFHHGGGG?
+@1468077/1
+CAAACGTGCTGGGCGGCATCGCAAAATAGTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCGCTCAGCGTATCCCACAAGCCTTCAT
++
+BBBCCBFCCCFFGGGGGGGGGGGGGHHHHHHHHHHHEGDEGHGGGGGGGGGGGHHHHHHGHHHGGGGGGEHGGGGGGHHGHGGGGGGGGGHGHHHGHGHHGGHHHHGHHHHHHHGHHHHGGGGGGGGGGHHGGGGHGHHHGHHHGGGGGG
+@885877/2
+TAGATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGATCTTGGATGCACTTCCAGCGGGTTGACGTAGA
++
+CBABBFFFFFFFGGGGGGGGGGFHHHGHHGGGGGGGGGGHHHGGGGGGGGGGGGHGGGGGGHGFHHGHHHGGGGGGGGCGGGEHHGHGHG/CAGHGHHHGHHHHH:GFGFGGGGGGGAEEGGGGGBFBFFGGGGGGGGGFFFFFFF?AE?A
+@1483447/2
+ATCGCAAAATAGTTAATGGAGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACCCAGGCGTATCGTTAACGTCAAGATTACACTAATCCAGACGTCGCCACAGCGTATCCCACAAGCCTTCATCAATTTTTTCCTTCAGAA
++
+A1A111A11D1BAFG33F11B00BFEGFAFE0EEEFGBD1B001BG2/B/EEHHGGGG?/B@1/B//EGE/>E0E0/>/1?GF//BDGHB111101BF2FF1//<//////BFG/C/?02110/<0/<1<G1@1@1>FGGHGHF1=0<000
+@1492902/1
+GGCTTGTGGGATACGCTGAGCGGCCGTCTGGATTTTTGTAATCTTGACGTTAACGATACGCCTGCGTTCAGTCGCTTGGGCGATATGCTGGATCAAAAAAACCGTACCACCATTAACTATTTTGCGATGCCGCCCAGCACGTTTGGCGCTA
++
+BBBBBBFFB@BFGGFGGGGGGGGGGGGGHGHHFHGHHGHFHHHGHHGHGGGHGHGFHGEGCGHHHGEFGHHHGGGGHGGGHGGGGGHHHHHGHHHHHHHGGGGG?GGGHGFHHHHHHHHGHHHHGGGHGGHGGGGGHHHHG<GFGGHGGGC
+@1496422/2
+AGTTAATGGTGGTACGGTTTTTTTGATCCAGCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCGCTCAGCGTATCCCACAAGCCTTCATCAATTTTTTCCTTCATGAAGGTTTCCAG
++
+AAAAAFFFFFFBEGGGEFF2FFGGGGFHFGHFGGGHGGGAEEHHGDEEEFHFH1EE@@EEG?FFGFHGAF?FCF1FFEDGFHHHHGE3FGHHGEAEEGGGCDCFD<<EHFGHHGHHG/?FFDFFH1GGFHDFH1DDDGFGHBGHGD=DBB=
+@568722/2
+CCTTTGATGCCGACATTACCGGTAATGGTCGCCAGTAGAGTCGAGCCGCGCGCGGTGCGCTCGCCGCAGTTGTGGCGCTGTGGTCCCCACCCCTGAATCAACGCGGCAGGTTTGGTATTCGCGTAATCACGCGCTAACTGGCGAATGGTTT
++
+BBBBBFFFFFFBGGGGGGGGGGEEDGHHHHGGGGGHHHGHHHEEEGGGGGGGGGGGGGGGGGGGGGGGGGHHHGGHGGGGGHGCDGHHHGGDGGGHHHHHHHGGGGGCFGCHHEF.GFHGFDC-?EGF0CDABFACEGGGFFFFFFFFFFF
+@263262/2
+GTACCGCCAGTCCGGCCTGATTCGCTTTTGCTACCTGCGCTTTATCATCACCTTCAACCTCAATAACCAATTGAATACCGCCTTTCTGTAATGTCACGACAAATCCCTGTTCTGCCAGAGCCTCTTCAATCCATAACCGTCGCTGAGCATA
++
+BAABBBBBBDFFGGGGGGGGFGHGGGHGHHGHGHHHHHGGGGGHHHHHHHHHHHHHHHHHHGGHHHHHHHGHHHGHHGHGGCGGHHHHHEHHGHHFHGGGG?FGHHGHHHHHGHHHHFGFHGHHHFHHHEHHHHHHHHCFDCCAAEFEFHH
+@705056/2
+GACCAGGAAGTTGCGGCCGATAATCATCGGCTCCGATTCCGGGTGGTTGATGTTGGCGGGAATAATCGCGCGGCCCGCGGCGACTTCATCACGCACGAATTCCGGCGGAATGTTTCCGGCAGGCGCGCGCCAAAGCTCATCCCCGGATG
++
+A33AAFBBFFFFFG2EGGGCGEGHFBGEG?E2EFACGGHHHGGEECEFFFHHH5GGFEC///GGHFHF/E/EDGGGGGGGCC<ADF0=DD0<DAC-:.A.C09/-??--9A/BFFFF.9>-;-.---9->=.-.9.F////99A-@99;
+@505295/1
+GTATCACTGTACTCTTTTGCCGTTTTCATCTTCACTACCTCACGGGTTCCTGACAGCCTAAGTATAGACCGTTGAGAAAACCAGCAAACACGCCGGCAAGGCGCTGTCAGACGCAGAAAATTGTTCTACACTGGCACAAAGCGACAGGAGG
++
+BABABFFFFDDFGGGGGGGGGGGGHGHGHHHHHHHHHHHHHHGE?EGGHHGFHHHGHHHGBGHHFGFHHGGGEEEGGHHGHGHHHHHHHHHGGGGGGGGGGFGGGGEGHHHHGGCGCHGHHEHFHBHEHHHHHHGHHHHHHHGGGGGGHGF
+@909858/2
+GCATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACCAAAATCCAGACGGCCGCTCAGCGTATCCCACAAGCCTTCATCAATTTTTTCCTTCATGAAGGTTTCCAGCGCCTCACGCACGACGTGGGTATAAGCTT
++
+BBA?AFBAAABBGGGCCEGGGCFFDCEGGGA2EGDHAF1FFHFF?3DGHHG553BGAEHFHHGFFGGGG?EEFGGEEGHBGGHGE0FEBGGEGGB?GDFGBCGGEFFFFFFFFFGHHH2GHEFGGGGGE/C@DGGC?<<CDCFFGHFBGG
+@882604/2
+GTTGTCTCGCCCGGTTGTCAGTGATGGAATCGTCCTTATCCATACCAGCAACGGTCAGTTGCAGGCGCTAAATCAGGCGGATGGCGCCATTAAATGGACGGTGAACCTGGATATGCCTTCGTTGTCGCTGCGCGGCGAATCTGCGCCGGCA
++
+BAABBFFFFBBBGF2EEGGGGBGBGFHHHGHHHHGGHHHHHHHHGHHHHHHHGGEFGHHHHHFFEFGGC@FHHEHHCHGGEFGGEFGGFFHHHHHHHHEGGGGGFGHHGGFGFHHHHGHHGFGH/<<FGDGGGGGGGGGGGHHECFGAFG?
+@1366484/2
+CATATCGCCCAAGCGACTGAACGCAGGCGTATCGTTAACGTCAAGATTACAAAAATCCAGACGGCCGCTCAGCGTATCCCACAAGCCTTCATCAATTTTTTCCTTCATGAAGGTTTCCAGCGCCTCACGCACGACGTGGGTATAAGCTT
++
+CCCCCFCCCCCCGGGGGGGGGGHGGGGGGGGGHGHHHGHGHHGGHHHHHHHGHHHHGHHHHGGGGGGGGGGHGGGGGHHHHHGHHHGGHHGHHHHHHHHHGHGHHHHHGHHHHHHHGHHHHGGGGGHHHHGGCGGGGGGGDHHHHHFHH
+@1018041/2
+GATACACAGCGTTTACCCAACGCCAACCCATTGGCGTGGTCGTCGGTATTGTGCCGTGGAATTTCTCAATTATGATTGCTATCTGGAAACTGGCCGCAGCGCTGGTATGTGGCTGCACCATCGTCATTAAACCAAGTGAATATACCCCG
++
+BBBBBFFFFBBAGGGGGGGGGGGGGGGGGGGHFHGGGGGGHCECECEHGHFDHHHCGGGFGHGHGHHHGHHHHG4GHHFHHHHHGHBFEHFHHFF?@EEGGGGGGBGHH?FDGHGFHHHHHBFHH/GHHHGGHHHHBG1GHFFHHBGHG
+@850600/2
+GTGATGTACAGCTTGAAGATCTGCTGAAAGATTACGATGCGGTATTCCTTGGCGTCGGCACCTATCAGTCGATGCGCGGCGTGCTGGAAAATGAAGATGCGGACGGGGTTTTCGACGCTTTGGCGTTCCTGATCGCCAATACGAAGCAGTT
++
+>1>1>D333B31BF1111BFDB13DCE1BE0B11BAFAF?0E0AC2AB2D1FFEAE/AA?/F0BGFDG21///@EE>E>>E/>//EF0B101B1B11111<<<C/</</<//1@<.-A.F.0//<<<./0<0;0:;.::CCGE...-//00
+@1095539/1
+GGCATGGAGTTACGTAAAAATCCGCAGATGAAGCGGGCGCTGGATAACTTCAAGGCCGTGCTGGATCTGCGGATAAACCACAGCGATATCAACGACGCGCAAATCAAACGCATTATCGGCGTGATTGATCGCGCGGCGCTGGAAATCGCCG
++
+AAABCFFFFFFFGGGGGGGGGGHGGCGGHHHGHHFGEGCFGGGHHHHHHHHHHHHHHGGGGGHHHHHHHHGGGGGHHHGHGHHHGGHGGHHFHGGGGGCGGGGHHHHHHGGGGGHHHGCGCDFGHHHHEBEE?C@-CGGAFFFFFFFFFFD
+@440194/1
+ATCTCATATCCTGCATCCAGTACGGCCTGCACGCCCTGACATCCCATATCGTGATAGGCAAAAATAACGGCTTTCATTGGTGTCTTTCCTCAGTAAACGGCGTGCTTTCCGGGTAGATAACTTGTTGTACAAAATAGCGGGGGCGGGTGCG
++
+AAAAAFFFD3DFDFF1DGAA3F110A0EA001A00A00BBGDB0AAFGH2B0FEFHFBEE0FCFE111//>>>GDFDDGE1//B@E2GFBGG@BF2@DCA/EE/>FFD11</E?>CBFDGFGFFHD001>2@<0@F<1/</-@C----;-9
+@1471676/2
+GTCCTCGAAAGGAGTGCTGTGATGAACGTCGTCATCCTTGACACCGGCTGCGCCAATTTAAGCTCGGTAAAATCCGCCGTGGCGCGCCACGGTTACACCCCGGTGGTCAGCCGCGAAGCGGAAATCGTATTACGCGCTGACAAACTCTTT
++
+ABBBBFBBFABFFGGGGFGFGGHG5GFH4GGGGHFHHHHFHHHHGGGGFFEGGGGCFHHH5GHHBEC?FFHHHHHGGGCE?>??E/EGGGGCAADHGHHGCC@CFG<FGGHHGGG?GGGGG@@@GF:GFCGFHGGGA?DCFFFB.FFGGG
+@1129885/1
+ATATTTATCTACCCGGGAAGCCTGGCGGCATCATCCCCTTCATACTCCGCATCATCTTCGCCATCCCGCCCTTCTTCATCTTCTTCATCATGCGCTGCATGTCGTCGAACTGTTTCAGAAGGCGGTTAACGTCCTGCACCTGCATCCCACA
++
+>A3AAFFFBFFFFGF2E?C?CGFADAFCGG2AGFF3GFHHG35GBBDHEGGGGGHFHHHHGGGGHEF1E?/ECGHHHH4@FFEGHHEFFGGHHGCEGGHHHHFFGG?CCGHFHFHF2FGFFFHGGGGGHHGHGGGGHFHHHEH/GH/<GG?
+@47590/2
+ATCCCAGCCCATTCCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACGCGCGGCCGTTAAAGCCGGTCTTGGCGTAACGGCTCGGCCTGTCGGAATGAGGAG
++
+CCCCAFFFBCCFGGGGGGGGGGHHHHHHHHHHHGGGGGGHHHHHHGGFFEFHGHHHHHHHGGGGGGGHHGHHHHHHGGGGHHHHHHHHGGGGG//?C?CC-C?F<<A.CGH0GCG--.B;FFF.@GG?F-?E--....//.-;..////9.
+@47902/1
+GCGCCCAGCACGCGAAGGTCGGGACTCATCATTTCGACAGGTCGAGCCGTTACGCCAAGACCGGCTTTAACGGCCGCGCGTACCGCCGGTAATGTAGACGCCACATAGGCCAGCCGCCAGGTAATACCCGCTGCATTTAGCGTCTCCAGCA
++
+CBCCCCAA@FFBGGGGGGGGGGGGGHHGHHHHHGHHGGGGGHHGGGGGGEGGGGGGGGHHHHGGGGGHHHHGGGGGFGGGGGGGGGGGG-AFHHHHFGHGGGGGHEGFHFHHHGGGGGGGGCFGGGFFGGGGFGGGGGGGGGFFFFFFFFB
+@48701/2
+ATTCGTCTGCGGCGCCCAGCACGCGAAGGTCGGGACTCATCATTTCGACAGGTCGAGCCGTTACGCCAAGACCGGCTTTAACGGCCGCGCGTGCCGCCGGTAATGTAGACGCCACATAGGCCAGCCGCCAGGTAATACCCGCTGCATTTAG
++
+AA@AA>>AAFD@EAEEEEGG00/EE/AEE11AAEE?FFFE1@2FFGHGEE/?F1EEGGGGG?EFFCGG@HEHGGGC?CGFHHFCCCGGGGGG-<.A?CGG--C0::0CB0B-:EB.B9009/EE.;AA;->E9BBFBBFFB;=--B/:/;/
+@221936/1
+ACCAAACAACGTGGCGAAATCTACCGGCGCTTCGCTGAACTCGACGCCCATCACCGGCCAGTAGTTTTCCAGCGCGTGCTCTTGCCCCTTTGTCAGTCGCCCCTGGCGACGAACAAAACTACGAATACGGCGCAGCGGGCGACCGTTTTCA
++
+CCCCCCCFCCCBGGGGGGGGGGHHHGGGGGGGGGGGGGHHHHGHGGGGGGHHHHHGGGGGHHHHHHHHHHHHHGGGGGGGHHHHHHHGHHHHHHHHHHGGGGGHGHHGGGGGGGGHHHHHHHGGHHGHHGGGGGGGGGGGFFFFFFFFFFF
+@1423906/2
+TGCCAATATAACCAAACAGACCAGAAAGATTACTGACATCAAGCGGTGCGCCAAACCACCCGGAATGATGAGTGACCGGGGATAACAGGATCCCGCATAAACCGAAGATGGTCAGGGTAGTCCACATACCGAATGTAAGAAACACTTCCA
++
+DDDDDFFFFFFFFGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHGGEGGGGGGGHHGHGGGGGGGGHHHHHHHHHHHGGGGGGHHHHHHHGHHHGGGGGHHHHGGGGGHHGGHHHHHGHGHHHHHHHHHGGGGGHFHHHFHHHHHHHHGH
+@220108/1
+AGCCCGTACCATTAGTCCTGCTGGACGATCCCAGCCCATTCCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACGCGCGGCCGTTAAAGCCGGTCTTGGCGT
++
+BBBBBBDDBBFFGFFGFFGGGGHHHHEGGHGHHBGGGHHHHHHGGGGGGHHGHHGHEHHGGGGFGGHHHHFHHGGGEEHHGHGGHHHGGGGGGGEFHHHHHHHGGGGHHGHFHHHGGGGGDFG?A:-@C--9-9..;=9A-;-9.BFFBD.
+@323173/2
+GTGCGGTTGGACAATGTTACCGATAACAGTTACCCGTAACAAATTTTGCAACTTGTAGAGTGGGGGCCCGCTTTGAGCACGACTAATCATGATCACCACGTTTACGTTCTGATGGGCGTATCAGGCAGCGGTAAATCCGCTGTCGCAAGCG
++
+AAAA3DBBBBFF4FGGGGGGFCEEGGHHCHGHHHHEA2EEHHFGFHHHGEFCGHHGHHHHHHGAEGGGGEGGGGF4FHHHGGGGGBHHHHGHHFHHFDHG/GHHHGFHFFHHDHFHHGCDFFHBHFEDDGGDCFFHHFD.A?DHCECGCC.
+@371913/1
+GTATTGCTGGTATAAGCAGGTAACATGGCTGTTATAAGTTGATAACAAACTCTTGCGCCGCGTCGTGATAGTTTGCAGACCTTCAAAGTTTGTGTTGCGCAGTACGGTGATAATGTGCGGCGCACCAGGCCGCGTCACTTTTTGAACGATA
++
+ABABCFFFFFFFGGGGGGGGGGHHHHHHHHGHHGHHHGHHHHHHHHHHHHHHHHHHGGGGGGGGGEGHGHHFHHHHHHHGHHHHGHHHFGHHFHGHHHGGGGFHHGGGHGHHHHHHHHGGGGGGGGHHGHGGGGFGGGHHHHHGGHHHGEG
+@787752/1
+GCACGATGGTGCGCATGATAACGCCTTTTGGGGGCAATGTGAAAGTTGGCACAGATTTCGCTTTATATTTTTACGGCGACACGGCCAGCAGAATTGAAGATCTCGTTACCACGACGACCGACCATGACCAATCCGGGAGAGTACAAGTATG
++
+AABCCCCCBFFFGGGGGGGGGGGGGHGHHHGGGGGGGHHFHHHHHHHHHHHHHHGHHHHHGGHGHHHHHHHHHHGGGGGGGGGGGGGHGHHHFHHHHHHHHHHHGGGHGHHHDGGGGGGGGGGGHHHHHHHHGHGGGGGGG;GHHHGBFGB
+@312506/1
+TAATTCGTCTGCGGCGCCCAGCACGCGAAGGTCGGGACTCATCATTTCGACAGGTCGAGCCGTTACGCCAAGACCGGCTTTAACGGCCGCGCGTACCGCCGGTAATGTAGACGCCACATAGGCCAGCCGCCAGGTAATACCCGCTGCATTT
++
+CCBCCFCFCCCFGGGGGGGGGGHHGGGGGGGHHGGGGGHHHHHHHHHHGGGGGGHHFGGGGGGGGGGGGGGHHHHGGGGGHHHHGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFF
+@249051/2
+ATCCTCTCCCGTGAACGTCAGGCTCAGAACGCCGGTATCTTTGCCGGTTTCCGTTACGGTGAGGTTATTTTGCAGGTTATTAATCATGCCAAGCGTTGAGAATTTACTCACCGTAAATTCTGTATCAGGACGGGCGTCAATTGCCTCTAC
++
+CCBCCFFFFFCCGGGGGGGGGGHHHHHHHHGCGGGEFEHHHHHHFFGFGGHHGHHGGGGHHGHHHHHHGHHHHHHHHGHHHHHHHHHHHFHHGGGGGGGHHHHHFHHFFHHGGHHGEHHHHHHHHGHHHHHG?GGGFGFGHGHHFHHGHG
+@468261/1
+CTATATAACATAGCAAAGGCTATATTCGATGATTAATTAACCACATTGTTGCGAGGGATACTATGACGAATCTACATCGTCTGAAAACACTCCTGCTTGCCGGTATTGTCGCGATACTCGCGCTATCGCCAGCCTATGCAAAAGAGAAATT
++
+ABBBAFFFFFFFCGGGCGGGGGHFHFHFGGHHHHG5F6AFDGHGHHHHDHHFGGGGGGGGHHGHFHEFGGHGHHHFFHGCHHGEHGBFHHHHHHHHFFHHHGGGGGHHHHEE@EEGGGFEDGCGGGFGGGGGFGHHEHHHFF0FFHFFBGH
+@370787/1
+GGGGAGAGCCCGTACCATTAGTCCTGCTGGACGATCCCAGCCCATTCCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACGCGCGGCCGTTAAAGCCGGT
++
+CCCCCCBBCFCCGGGGGGGGGGHHHHHHHHHHGGGHGHHHHGGHHHHHHGGGGGGHHFHHHHHAHHGGGGGGHHHHHHGGGGEEHHHHHHHHHGGGGGGGHHHHHHHHHGGGGHHHHHHHHGGGGGCDDGGC@BG-A?9CAGGF0F9D-
+@63126/1
+GGTATCGCAGAGCCGCAGCGCAAGGATTGGCCGAGGCGCAGGATGCGATCGGCGTGATGTTTATGCAGGGTGAGGGCGTTTCTCAGGACTACCAACAGGCGCTGGCGTGGTATCGCAAAGCCGCTCGCCAGGGGCTGCCTGCTGCGCAAA
++
+CCBCCFCDDCDDGGGGGGGGGGGGGHHHHHHHGGGGGGGGGGGHHHGGHGGGGGGGGHHHHHHHHHHHHGEFHHHGGG@FGHHHHHHHHHHHHGHGGHHGGGGGGGGGGGGHHHGGGGGHHHGGGGGGGGGGGGGGGGGGGGGGGGGGFF
+@387018/1
+CCCATTGGTATTGTGCGGCTGAGTATGTTTTGCAAAGGGGAGAGCCCGTACCATTAGTCCTGCTGGACGATCCCAGCCCATTCCGCGATATGGGGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTA
++
+AABAADFFBDDFGGFFGG?ECGHGFGHBB5GCFDF5FBE22AAEE1FA0AEFHHHHFFDGHBFGHF1AFEF1?G3@GEEGHHDEFAE>>?>F30E/><AGEFE?/?EDHHGGHGHGC@C@1GFBFHHCGGGC?@..<<<DD0<0:A.-..
+@833942/1
+ACTGACCGGCGACGCCCTCGGAGATCCCCAGATCCTGCGCCATCGGCGTCAACAGACTAACGGGCAAAAACTCAACGGTAATCAGGCAGGCGACACAAAACGCCACGGCAAAAACGGCTGACCAGTTAGGCCTGGCAACCCCATCAGCGCG
++
+AAB@BFF3ADBB2AEE?EEEGF?AGHDG1FEFH3FEGFCGGGGHG?EE?FEAGFFEACGB3/EFCGGHF/EBGGHHGG/CFFHFG1FGDGGCGGGCFGHGHCCDDE@@DD?GHHG-.:;@CBBGH;GCG/FB:.9CBF?.9.AFGF0CDGB
+@1052229/2
+ATTTAGCGCTCATGTCTTTACCGGTCTCGTACATCGCAGCAATGATCTCATCGAGCGAGATACAGGGTTCACTTACGCGACTCATCGCCATCGTCGCCGCGTTTATCGCTTTCACGGCAGAGATGGCATTTCTCTCTATGCAGGGAATTTG
++
+A?ABBFFBBBBBGGGGGGGFGGGGGGGHHGCHGHHGGGGGGHGHGHHHHHHHHHGGGGGFGHHHHHGHHFGHHHHFFGEGGFGGHHHGGGGHGHHGGGGGGGGGGHHGGHHGHGBGADFGEHHHGGHFHH1GHHHGHEHFHHHHGGHHHHB
+@429187/2
+CATTTATAACGATGTCCGCGCCCGCCCCCGCTATTTTGTTCAACAAGTTATCTACCCGGAAAGCACGCCGTTTACTGAGGAAAGTCACCAATGAAAGCCGTTATTTTTGCCTATCACGATATGGGATGTCAGGGCGTGCAGGCCGTACTGG
++
+3AAABB5@DFB2FFGGFGEGGFEEEGG2EE0E0EDHFGFGHHHCF1FFGFFHDGGGAA0EGFGGF2EEGG>>GHDHEGHGE2FF?DGHBG/GBFD3FHHGGGCEFBFFCFFFHHFHHD?GEDEGHHHEGBD1GF?C--><0<..@FG.GHC
+@573830/1
+CCGTCTGTACCGCCGCGAATTGGTTTCATCTCCGGCGTAATATGACAGTCACGCATGGCCTGCTGGGCGATATCGAGAATATGCGGATGCTCAACCACTTTTTCGCGCATATTGTAATAACTGTCTTCAATCACCAGTTCGATATAGCAGT
++
+3AABAFBFFBDACGEGGGGCGGHHHHDGHHGHGGGGEFGGGHHHHHHHHHFHGHGGGHHHHEHGHFGHG?EGFHGHFAEEFGFFECFDFHFHFGHHGGGFHGGHGGGGCGGHFDDF1FHHGHHGHHHHEHHGHHFHHDGFGHGHGHEHGH;
+@1051354/2
+ATCACGCCCGGTTCTTTGGTCAACTGACCGTTATCGTCGAAACCGCCGTCCACCGGCAGTTCGCGGCCCGCCAGACGGTTAACTTCTAACATCCCGTAGGAGAACATCGACATCGACATATCTACCATCGTGATCGGCGTAGACGGGATGG
++
+@BBBB?F?DDDB?FFBGGFEDGDGCFHHGEEFFAHFEFECFGEF000AAFEGHHF?EGECFHECG?ECCE?EE/GE?DCFDFGGGHHGHHBFCGH?CCD?1GFHFHHFG0?<EGGH-..=DG0DDGF0C?.<<CGEA@C@G@E0A.A.99E
+@907139/2
+ATTGCTGGTATAAGCAGGTAACATGGCTGTTATAAGTTGATAACAAACTCTTGCGCCGCGTCGTGATAGTTTGCAGACCTTCAAAGTTTGTGTTGCGCAGTACGGTGATAATGTGCGGCGCACCAGGCCGCGTCACTTTTTGTACGATACG
++
+1>A1>3D1>@DD3E11BEGGGG1A10F00AAF3E3ADFEBE2E1ABGGFCFF11//BEEGECGE/FEDFDFHF@F110EHFGGFHHFHGFFGH0?GGG//?>F/?>?CDG2GFHHH?C/CGCGC<?FGF/-<<@<AD00=D-/=DGEGC@.
+@502874/1
+GGGGAGAGCCCGTACCATTAGTCCTGCTGGACGATCCCAGCCCATTCCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACGCGCGGCCGTTAAAGCCGGT
++
+BBBBBDAABFBBGCGGFGGGGGHHHFGHHHHHGGGGGHHFHGGGHHHFHGGGGGGHHGHGHHHGGHGFGGEAFFHHHHHGGGFGCGHHHHHHHFGGGGGGHHHHFDGHHGFGFHHHGHHHHGGGGG-;.E:@@-@@?@@D.EGEFF-@9
+@421973/2
+CCATGAGACAATGCGACGTTTATCGTCGCCAGGGAACATAACAGAATGGAAAACCTCGTTTTGTGCTATGAGAGCGCTGGGCGATCATGACAGGAAAAACGATCTGCGAGGCAATAAAAGCCGCCGCTCTGCTTCCGGGGACGCTATCCG
++
+BABBCFFFFFFFGGGGGGFGGGHHHGHGGGGGHGGHGHHHHHHHHHHHHHHGHHGHHGHGGGGHHHHHHGHHHHHGGGGGGHGGFEGHGHHHHGHHHHHGGEHHHHHGGGGGGHHGHGGHHGGGGGGG?HHHHHHHC?FFGGGGGGGHBF
+@1314646/2
+CCACTAATTAGTTTGCGTATCATTTGTATAATAACCTATTGATCAGGCTAATAACCGCAGTCTATATCAGGGTAAGTCTTTTCGGCGCGTTTTGATATACGCGCTCATACGTTTCGGGATGGCATTAAAAGGCGAAGGAATATGAATACAA
++
+1A?AAFFFFF1BFGBE1EGGGFDGGHHCFF3G3EG1ABGFBBGHEE1BGB1GFBGF?/EEE1F2GFFDFFFFCHHBGHFF2GDA/ECE?EGGCHAGHFHHH/>>EGGHHHE10B<ECE?EFFFF1F111>FG/C/@<E0GHHHHFFDGHHH
+@741674/2
+CCACACATGCAACAAAAAAGCCTGCAACTCATTGAAGTTACAGGCTTTTTTAAGGTTCATGATGCATCATGAATGAATGTTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTACGAAATTCCTAAATCCTCGGTACTACATGCTTAGTCAGT
++
+>3AAAABFFFFFGGGGGCEGCGHHCGFAGGG5FFGCG55DEBGH22BBE3AGHBB5BABGGF5A5BBEGHHGFGEGDDD5FB3?FFEEA?EF2E@E/<E/BF4B3F/<////</<?</?111<1F11<DD...<.>G1F1FFGG<G=0=D0
+@1192921/1
+AACTACCTGAACGGCCTGCAAGGGTTGCTCAAGACGAAGGACGGCCAGCAGTTGAACCTCAATAATATCGGCAGTACGCCGCTGGCGGAAAAGGTGAAAACCAAAGCTTGCGATCTGGTGTTGCAGCAAGGGCTGAATTTCCTCTCCTGA
++
+BBBBBFFFFFFFGGGGGGGGCGGCGHGFHHHHHHFGGGFGGGGGGGGHEHGHHHHGHHHHEFHHHHHHHGGGGGBFGGGGGGGGGCECECGHHGHFFHHHHGHHEFHGHEHGGEFGHHHHHGEHHGHFHHGGEHGGHHHHGHHHGHHHHE
+@661886/2
+ATGTAGACGCCACATAGGCCAGCCGCCAGGTAATACCCGCTGCATTTAGCGTCTCCAGCACCATATCGCGGAATGGGCTGGGATCGTCCAGCAGGACTAATGGTACGGGCTCTCCCCTTTGCAAAACATACTCAGCCGCACAATACCAATG
++
+3ABBBFFF@DBBGGGGGCGGCCDGEEEGEDFFGHHFGFEGGCGGEHHBFHG1EAGHHGFHHHAHEFG1EGC/EFBFHHHGFEFBFFHGGFHGCHHGGFFHHHHFFB//@DCAGGB0/0C1GHBDDGHAGFF1?GB1<AC?-</00<C0CF/
+@832302/2
+ATCAATGTCTGATGGCGCTGCGCTTATCAGGCCTACCAGCCGAGTGCTTATGTAGGCCTGATAAGGTAAAGCCGCCATCCGGCATTTATGCTGTGGAGGGTAAGAAAGTAGTATCCCCGGCAACCTTAAACATCGCCCTCCAGCTCCGCGT
++
+BBBBBFFFFFFFGGGGGGGG?EGGGGHHHHHFGHHHGFGHGGGGGHHHHHHHHGHGHHHGHHHHGHHGGHHHGGGGGGHHGGGGGBHHHHHHHHGGHHGG/FFGBBEHFFFGHHFHHGGGGGGHGGFGHHHHHGGDGGGHGHGEFHHGFG-
+@670612/2
+GCCCAGCACGCGAAGGTCGGGACTCATCATTTCGACAGGTCGAGCCGTTACGCCAAGACCGGCTTTAACGGCCGCGCGTACCGCCGGTAATGTAGACGCCACATAGGCCAGCCGCCAGGTAATACCCGCTGCATTTAGCGTCTCCAGCAC
++
+CCCCCCFFFBCCGGGGGGGGGGGHHHHHHHHHHHGGDGGHHGGGGGGGGGGGGGGGHHHHGGGGGHHHHGGGGGGGGGGGGGGGGGG@CGHGHHHHHGGGGGHHHHHHHHHGGGGGGGGCBFFGGGGGGGGGGGGGGGFFGGFFFFFFFF
+@706671/1
+GTCGGGACTCATCATTTCGACAGGTCGAGCCGTTACGCCAAGACCGGCTTTAACGGCCGCGCGTACCGCCGGTAATGTAGACGCCACATAGGCCAGCCGCCAGGTAATACCCGCTGCATTTAGCGTCTCCAGCACCATATCGCGGAATGGG
++
+CCCCCCBBFFFFGGGGGGGGGGGGHHGGEGGGGGGGGGGGGHHHHGGGGGHHHHGGGGGGGGGGGGGGGGGGBDGHGHHHHHGGGGGHHHHHHHHHGGGGGGGG/GFHFHHHGGGGGHHHHHHHGGGGHHGGGGGGGGGGGGGGGDFGGFF
+@1368103/1
+GTGGAAGATGGCGTTCAGGGTTACGGCATACGCGTTACGTATAGTCAGAAATAGCGTCAGCGTTGTGGCTGACCAGCCAGCCGCTGAATTTTGAGAAAAAGGAGAGTCTGAATGCAAGCAACAGTAAAACGGCGGCTGACGAAGGTCGCTT
++
+AAABABFFFFFFGGGGGGGGGGFHGGGGGHHHGGGGGGGHHHHHHHHHHHHHHHHGEGGGHGGGGGGGHHGGHHHHHGHHGGGGGGGHHHHHHFGHHHHHFGHHHGHHHHHHHHHHHHHHHHHHGHHHHHGGGGGGGGHHGGGGGGHCGDH
+@129817/1
+GATAGGGCTACTGTGCGTCGAATTCACTCTTGCGCCGGCCACCGAATGGATGACTCAGGCAGGATGGTTAGCAACGCTTTCGTAACGTTTGGCCGGGCAATACACCGCCCGGCTCCGATTTTTGCCTGATAATTATCCAATTACACATTAT
++
+AAAAAC1CF?BFC3F1EAAEEA1EGFF2FFDGFEG??//EEFAECECCCBGFF@GFHHEBFE//BBFHFGFB1GHGCGECEEF0GAEH0BEGHEC?ECC/<DGGHEB/<@/@C?EE<-.CFDDCHFGG0<DD0DFH0DDC0=DHHH0CGBG
+@964326/2
+GTGCTGGCAGGACGGCGGGCGAAAAAACTGCGCTAAAGACCCGGTCTACCGCAAAATGGAAAGCGATATGCATAACCTGCAACCCGCGATTGGCGAAGTGAATGGCGATCGCGGCAACTTTATGTATAGCCAGTGGAACGGCGGCGAAGGT
++
+AAABBFFBBBBBGGFGGGGGGGCGCHGDHGGGGGGGHHHHFHGGEEEGGBEGFGEBGHHF22GFGCHFGHHHH2DGHHHHHHHHGGGGGGHGGCCF?CGHGHFGFHGG?C?DGFGG?EFB0BFGGFGFFBF0.;FFFEFFB-BD;=---./
+@840475/2
+CACAGGAGCTGCTCCAGTTCGCTTAATGACGCCACAGTCCCGGTTGGATGAAGACCCGCGGGCTGCTCGCGATGATGCGCGTTAAGCCAGCAGGTCGACAGCCCGGCGTTAATGCCGCCAAGAATATCGGATTCCGCCGTATCGCCAACCA
++
+1>1AAA1AAFCCFEFGCFG3A00F0ABDF1E000EGAFG11AAE?E/F11FG1DAFGA/E//////F@//>//?FGHE//<BBFAD1FCFE00/01//>CCEA?C-@C@?AEHGG<<C?-C.;CGF0G.-.CCBF/..;;CFFACCGGEF?
+@155670/2
+GCGGTTGGCGCCGAGTCGTTAAACGCGCTGACAGGTCAGATTGGGCCGAAAGACATTCAGCTCGCGACTCCGCCGCAGGGTGGCGAGGCGGCAAACGAATAAGCCGCAACGGCGGAAATAAAAACCATCGCCGGGGGCAAAAAGGGCGTCA
++
+>>>>>111111>A000AA000FG1AEE/AA/0A1/1BB01A1B0/0?/>/>/>00121B2@1@?/>>//?1/<?<//<</<?/0>@/</@--<-...<;C.0;0/--;---;--A-9-9/;FF/-;A//---9---9----9;-----;;9
+@1485243/1
+TCTTTCATCAGCGCGGCCGGAGACAGCACAACACCGTTACCGATGATGCTGGTTACATTCTCGCGAAGAATACCTGATGGAATAAGATGGAGAACGGTTTTTTCACCGTTGATTACGAGAGTATGGCCTGCGTTGTGACCGCCCTGGTAG
++
+ABABBFFFB5FFGGGGGGGG?GFDHGGHHHGGHGGCGDEGGGEEEGHHHHHGHHHGGHHFHHGGGGGGGHHHHHHGFHHGHHGHHHHGHCFFHHFFG<FDGGGCHHFF<EGEHHHHGGGGGHHHHHGFFEHGG?DGGHHFGGGGGFACGH
+@546753/1
+GATTCTGCACGCGGCGGTCGGCTCTGCGACGGTGGCGATGATGGGCGCCACGGCGATTGTTGCGCCCATGCTGCCGCTCTATCCTGACGTCAGCCCGGAGATCATTGCGATTGCCATTGGTTCCGGCGCCATTGGCTGCACGATCGTGAC
++
+A3ABBFFFFFABGFFCFGGGGGGGHHHGFGGGGHGHGGFGHHBGGFFFGGGCEEGGGHGGHHHGGGGGGHHHGHHGGGGHGFHGHHFHDGGGGHHGGGCCCFHEHHHBA@HHGGGGGGGB9EFFGGBAA@DF9F/BFEFFFA.AEA.AB?
+@919744/2
+CCTATATGGGGCCAGCCTTTGTCGGCATTATTACCGGCTCAATGGTGATTGGAACTATTTATGGCTTACCGGGCATTGGGCAGCTTTTCGTTAATGGCGCGCTCAACCGCGATTACTCGCTGGTGTTAAGTTTGACCATTTTAGTCGGGG
++
+A1A1A1331BAACG1EEGBGBADAE?EEDHGHFHF00EAEEFFFFBA1BBG01BB1EHHG22DGFBFFHBEC/FEHHHHFCGFGFHFGFEHBGEH2BC@//</E/1GHCCG////@G1<CECCF0</11<<FFFDDGFFHDB10>FAC--
+@803454/2
+ACATAGGCCAGCCGCCAGGTAATACCCGCTGCATTTAGCGTCTCCAGCACCATATCGCGGAATGGGCTGGGATCGTCCAGCAGGACTAATGGTACGGGCTCTCCCCTTTGCAAAACATACTCAGCCGCACAATACCAATGGGTGGGCGAGG
++
+11AAA1CF1111AA1AAF0FD3DEBFBE00AECGBG2DFAEECF1F100FGH1F22/BAE/EGHFAAGEG?F1?E0//>10>FHE/E0FGFFFG2</////BFGCA<FC11>1FBG/FFB1@11<FCGCG?G111GH111<00.--<-<-:
+@808294/1
+GTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACGCGCGGCCGTTAAAGCCGGTCTTGGCGTAACGGCTCGACCCGTCGAAATGATGAGTCCCCACCTTCGCGTGCTGGGCG
++
+CBCCCFFFFFCCGGGGGGGGGGHGGGEFHHHHHHHGGGGGGGGGHHHHHGHHHGGGGHHHHHHHHGGGGGEGGE///<C?CC@D<FHBGHCG@DDHHHC<ACDA.@@:C@--:--:.A-.:900000;09CG./.;.00..--;..:9..-
+@1270809/2
+GGTGAAGCGCAGATCGACAAACTTCACTTCGTGCTCGTTCAGCATCGTCAAAACGTGTTCAGCGGACATACTTGTACTCTCCCGGATTGGTCATGGTCGGTCGTCGTGGTAACGAGATCTTCAATTCTGCTGGCCGTGTCGCCGTAAAAAT
++
+ABAABFFFCCCCGGGGGGGGGGHHHHHHHHGHGGGHGFFHHFHHHHGHHHGHHHGHHGFHHHHGGGGGHHHHHHHHGHHGGHHGGGGGHGFGHHGHHFGFEGGGGGCFGGHHFGFDFGHHHHHGFHGHGFHHHGHGGGHBDHGGGDGEF0C
+@1381607/1
+TTTGTGAGCAACGCTCTACGGTTTGAGACGGCGCCGCCGATACCCGCTGTTTTTGCCGGAGAAAGTCCGGAACCGAAACCCTTTCAGATGGGGTTACCGGCGCTGGATCTCTTTC
++
+BCCCBFFFFFFFGGGGGGGGGGGGGHGHHGGGGGGGGGGGGGGHHGGGGEHHHGGHHGGGGGHHHHHHGGGGGGGGGGGHGHHHHHHHHHHHGGGHHHGGGGGGGGHHHHHHHHH
+@871209/1
+GGTCGGGACTCATCATTTCGACAGGTCGAGCCGTTACGCCAAGACCGGCTTTAACGGCCGCGCGTACCGCCGGTAATGTAGACGCCACATAGGCCAGCCGCCAGGTAATACCCGCTGCATTTAGCGTCTCCAGCACCATATCGCGGAATGG
++
+3AABBBBBDFFFGGGBGGGFGGGEA3GEF?EFGEEGGGGGGGGHHHGGGGGHHDGFGGGGGGGGEGGGG?EFC<CFHFHHFHHDGGGCFFHGFHGGH.FFCGGGHCDFFDFGHGGGGGGHHHHHHGGGEBBFGGGGA.BBCFEGAABCE/F
+@1491068/2
+CTATTGTACCCGCCTGAACGCAGGCGGGCTCAATCCAAAAGCAACATTCAGCATTGAACAGATTTCGCCTTCAGTCGCTATTCTGGACTCTGATGATGGAATGGGACACTGCGCGCTGATAAAGGCGACAGACCACGCTATTAGTCTGGCG
++
+BBBBBFFFFFFAGFGGGGGGGGGGGGGGCEFBFFFCHHHHFCF31FGH55FG5FB3BGFGHHGHF42EEGGHFH4GDGGGGHBGGHHHHGHGBGHEHFFFHEGFHF0?FGFFGGCC/>?GHFFHHHGCGGCGAGG.?DGGGHGEHHFF/0:
+@360639/2
+GCTACGCCCCGTAAGCGCAGAGTCGCTGGAAAATCTGGTCACGACCTCAACGGCGCCGTTTATTTCTCGCGAGACCGCGCGTGCCGCCCAGTCGCTGAATAGCCCCGCTCCCGGCGGATTCCTGATCGCCAGCGATGAAGGCAGCGAA
++
+ABAAB?DBBBDAGGAEEGCGGCHHCEGDGA3FGEHGGBGFGGE1EE1FF3B1EE?EG@>EHEHHHGHH/FGGEEEGEGCCGDGGHGGGGAGGDDGGGGBDHHHHHGGG?CFGGGCGGGGGFFBFBFFGDG?9EB;AAF/BBFADFB-9
+@1227339/2
+ATCCTGACGTCAGCCCGGAGATCATTGCGATTGCCATTGGTTCCGGCGCCATTGGCTGCACGATCGTGACCGATTCCCTGTTCTGGCTGGTCAAGCAGTATTGCGGCGCTACGCTGAATGAAACGTTTAAATACTATACGAGGCCACGTTT
++
+AA1AAFBBA1>AEGFCE0A00GGGH2GGAEFHCHH1FF1F1EG1ECCGGCCFEFFHHEFGHG/>F@C>FFGCE@EHHHH1GGFGFBC0FC0B>1FF0<BGFFHHFGCCCCCC?@F?.1=GF111F0GHEFFFHHHFGFHCA.<-:CEC.:/
+@61483/1
+CTACATAACCAAAAAGCATAGCAGACAGGCATGGTATTGCTGGTATAAGCAGGTAACATGGCTGTTATAAGTTGATAACAAACTCTTGCGCCGCGTCGTGATAGTTTGCAGACCTTCAAAGTTTGTGTTGCGCAGTACGGTGATAATGTG
++
+BBBBBFFFFFFBGGFEGGGGGGHHHHHHGGHHHHFHHCFHHHGFHHHHHHHFGGGHGHHHHHHGGHHHHHHHGFBFHGEGHHHGHHHHEEGGECGEGGGGFGHHHHGGHHHHHHGGHFHHHFFHB?FFGFHCGGCFGHGCHHGHGHHHHB
+@1453817/1
+CTACGGGTTCGCTGACCGCGCCATGCTGCGCCAGAGTCTCTTCACGCACGCCAATCATCTGCGCTTTGGCTTCATTACTATAGGTGACAAAGCCGCGTTCAAACCAGGCGGAACTTCCGGCGATGTCGGTAATGGCTTTCGCCAGCCAGC
++
+AABBABBDAFDBGCGGGGGGGGGGHGHHGGGGGGCGHHHHHHHHHHGGCEEGGGHHHHGHHHGGGFGGGHGGHHHHHGHHHGHHDGFHHHBBHHGGGEGGGHHHFHHEHG?DFGHHHGGCGGGGGHHHGCHGHFEHHGGCAEFGGGGGGG
+@962609/1
+GGGGAGAGCCCGTACCATTAGTCCTGCTGGACGATCCCAGCCCATTCCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACCCGCGGCCGTTAAAGCCGGT
++
+AAAAA@A?A>ADAE?FF3AFGFGGHFCGBGHHEGGHGGFGHGAEFGHHH/AEGGGFHDGEGHFFAGGFGGGFHG2GGFHGGCEGFHHHHFFA0E/<@@CCHHGHFGFHGGCCEH<GHFFHHCGCG-;AC00CCGG----;:EF9;AA@9
+@6770/2
+GCCGGCGCAGATTCGCCGCGCAGCGACAACGAAGGCATATCCAGGTTCACCGTCCATTTAATGGCGCCATCCGCCTGATTTAGCGCCTGCAACTGACCGTTGCTGGTATGGATAAGGACGATTCCATCACTGACAACCGGGCGAGACAACG
++
+AABBCCCCCC@FGGCGGGGGGGGGGGGGGHGGGGGHHHHHHHHHHBFHHHHGHGGGHHGHHHHHHGGGGGHHGGGGHFHHHHHHGGGGHHHHHHHHHHGGGGGHHFGHHHHFHHEHHHHGGGHHHGHHHHHHHGHHHGGGGGGGGGGGGGC
+@1006446/1
+GAGTATGTTTTGCAAAGGGGAGAGCCCGTACCATTAGTCCTGCTGGACGATCCCAGCCCATTCCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACGCGCGG
++
+BBCAAFFFFFFFGGGGGGGGGGGGHHGGGGGGHHHHHGHHHHHHHHHGGGGHGHHHGGGHHHHHHGGGGGGHHGHHHHHHGHGGGGGGHHHHHHGGGGGGHHHHHHHHHGGGGGGGHHGHHHHHHGGGGHHHHHHHHGGGGGCC.AA9?-9
+@1556325/2
+GAGTGGGGAGGTCGAGTCTCTCCGCCCCTGCCAGAAATAATACTTAGCATCTGCTAAGGATTTTTTTTTGCCTAAAATTACCTGATTATCTGATCAGGTAATCGTAAGTTCCCTTCTTTTTCTTTTCATCATTTTCATTGTTCATCCAGCA
++
+11>>1>A1>>1AAE0A1BGF3FFA0EEFA/CCCFE0BFGGD21AEEB1A21AFDG1GF01F1BFFC/EECHBGHBGDGHFG1BB01B2>>2EFGFFGB1>2FB//000B222<BFCFG1BGGF1>F2>2GD>F2G22>2FF21222??FG0
+@1118738/2
+GACAACCAGGCGGATAGCGTCCCCGGAAGCAGAGCGGCGGCTTTTATTGCCTCGCAGATCGTTTTTCCTGTCATGATCGCCCAGCGCTCTCATAGCACAAAACGAGGTTTTCCATTCTGTTATGTTCCCTGGCGACGATAAACGGCGCATT
++
+A@BAAAAABB4DCFECFGEECAEHG2AEEEHHFFHCGCEG?//3B3@@G3G3G////>3GG2?EFFGHEHHFH?B2B2F<D/?G0@<FBFGGD11FBDGFAG0><>?AGGC1DGGFBDD0G0DDHH0D00C<A@-A@C9EABBD.9B--C.
+@1457647/1
+ATCTTCCGCCATGCGTTAAAACCTGCGCTGCTGCCGGTTTTATCCTATATGGGGCCAGCCTTTGTCGGCATTATTACCGGCTCAATGGTGATTGAAACTATTTATGGCTTACCGGGCATTGGGCAGCTTTTCGTTAATGGCGCGCTCAAC
++
+CCCDBFFCDCCCGGGGGGGGGGGHHGGGGGGHHHHGGGGGGHHHHHHHHHHHHGGGGHGGHHHHHHGGGGGHHGHHHHGGGGGHHHHHFGHHHHFDFHHHHHHHHHGHHHHHHGGGGGHHGHEHHGGHHHHHGHHHGHHHHGGGGGGGHH
+@835804/1
+CTACTGGGGGCACCCGGCAATGCAGTTACCGCCGGAGGTCAACCTGATTGCGGTCGCCCACTATCTGCAGGCGCTGGAATGTCAGCGTGACGCTAACCGCGTGGTGGCGTTGCTGGGCGGTAAATCGCCGCATATCCAGAACCTGGCGGT
++
+CCDDDFFCCCBBGGGGGGGGGGHHHHHHHHGGGGGGGGGHHHHHHHHHHHHGGGGGGGGGGHHHHHHHHHHGGGGGGGHHHHGHHHGGGGGGGGGGHHGGGGGGHGGHGGGGGHHHGHGGGGGHHHGGGGGGGGGGGGGGGGGGGGGFFF
+@974087/1
+AATGAAAGCCGTTATTTTTGCCTATCACGATATGGGATGTCAGGGCGTGCAGGCCGTACTGGATGCAGTATATGAGATTGCCGCGATTTTCACTCATGCCGACAATCCTGCGGAAAACACATTTTTTGGCTCCGTCTCCCGGCTGGCGGCA
++
+AAAABFFB4CA>2A4FGBGADGHHHHCBEBGC?5FAB32AFBDCFD?EGGHHGEAFE11A53BGFBBG5BF5G5D5FGFHEFE//E/1F44BGBEG4EGB/E/EEFCB1G1B/@//@0/@/@>DD1//<11?FA.<001CD--<-EAD??:
+@392728/1
+GCATATCGCTTTCCATTTTGCGGTAGACCGGGTCTTTAGCGCAGTTTTTTCGCCCGCCGTCCTGCCAGCACTGGCGCTGATGACCGAATTGCCAGGCGGGGACAACGTGCTCCCACTCAATGCGTCTGGCGCGATTCTCGTTTTTACGCA
++
+CDDDCFFDDFCCGGGGGGGGGGGGGGHHHGGGGGHHHHHGGGGGGHHHGGHGGGGGGGGGGGGHHHHHGHHHHHHGGGGGHGHHHGGGGHHHHHHHHGGGGGGGHHGGHHGHHGHHHHHHGHHGGGGGGGGGGGGGGGGGAEGGGGFFFF
+@376369/2
+GTCCTGAACCGCTGGTTGACAGGGGAAGAACGTGAAGCCAATTCCCGCTCCGCGACTTTCTTTAACCTGCTGCCGCTGCACGATGGCAACCACTTCCCCGGCGTCAGCAAAACGGCGGATTATAAAATCCGCGCGCAGAAACTGTTCGATG
++
+AAABBFFFFBBBGGGGDEGGGFGGGGGGCHHDEFGFHHHHBGCFHH1ECEGGGGGGFCFH4GFHHHHHGFHHHHGGGGGGHGDHGEHHHHGGGHHHHHGGGGGDCDDGHEHFH@?@CCCGGGHHGHHHHFGEC??DG?BBB/0CFFGGGF0
+@106148/1
+CGCTAAAGCCGCAGATGCTGCTAAAAAATAAAAACTGAGAGCCGCCGCTTGTAATAGCGGCGGTTTTTTTTTTTAGGCCCGGTATATTATTCCCCCTAATTTTTTTTTTGGGGAAAAGGGCTTGGGCTGGGTGGTTAGGGCAGGACCCTAG
++
+CBBCCAFFFFBBGCGGGGGGGGGHHGHCHHF5FGGHHHHHCEHG?EGEEGGEGHHHFGGGGGG>>?FFGG//<//2<2</>>///11111111>0.-.<11<10-<A---;:-;..//....;-.../.../.-;./..9...-....;..
+@584085/2
+ACTTCACTTCGTGCTCGTTCAGCATCGTCAAAACGTGTTCAGCGGACATACTTGTACTCTCCCGGATTGGTCATGGTCGGTCGTCGTGGTAACGAGATCTTCAATTCTGCTGGCCGTGTCGCCGTAAAAATATAAAGCGAAATCTGTGCCA
++
+CCDCCFFFFFEFGGGGGGGGGGHHHHGHHHGHHHGHHHHHHHHGGGGGHHHHHHHHHHHHHHHGGGGGHHHHHHGHHHGGGGFGGGFGGGHHHGGGGGHHHHHFHHHHGHHHHGHGGGHHGHGGCGFHHHHHHHHHFHGGGGHHHHHGHHH
+@1163932/1
+CCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACGCGCGGCCGTTAAAGCCGGTCTTGGCGTAACGGCTCGACCCGTCGGAATGGTTAGTCCCGACCCTCG
++
+CCCCCCCCCFFFGGGGGGGGGGGGGGHHHHHHHGGGGGHHHHHHHHHGGGGGGGHHHHHHHHHGGGGHHGHHGHHGGGGGBGDGF@F?CGC@@D.CGDBG-<-:.CGFB@C@A.ADBCG?-9@--;.---;.00:00.00;B-.;@9B.:
+@1228714/1
+ATGAATATCCGTGTCGAGAATCCGAACCTCAATAATATGGCTATCCAGGATGTGCCGATCCTGAACAGCGATAAAATCATTTGCTCACGCCTGAAACGCGATGACACGCTGATGGTGCCGTCGCCGGGGACGATTATCCAGGCAGGCGAC
++
+ABBBBFFFFFAAGGGGGGGGGGHGGGGGGHHHHHHHHFGFGGGHHHHHHHHHFFGHGGGGDHHHHHHHHGEHGGHHHHFHGHGGHHHGGFGHHHHHHGGGGGGHHHHGGGGGHHGFHHHGGGGGGCFGGGGGGGGGHHHHFHHHGGGGGC
+@1175296/1
+GAGTCTGTTTTGCAAAGGGGAGAGCCCGTACCATTAGTCCTGCTGGACGATCCCAGCCCATTCCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACGCGCGG
++
+1>A11BD3DF1>G3EGFFGEEEEEHCFAEEEAGHHGBDGHHHHHFHHHGGGHGHHGHGEEHHFHGCC?EEEFG2BB@DFAFGGGEG/EHEGHHHGCCEEEFFG2GFFFHGGGGC/EGBGHH1?1>CFCG.GFHHHHHGCGGC-.9..---;
+@168983/2
+GCTTCGTATTGGCGATCAGGAACGGCAAAGCGTCGAAAACCCCGTCCGCATCTTCATTTTCCAGCCCGCCGCGCATCGACTGATAGGTGCCGACGCCAAGGAATACCGCATCGTAATCTTTCAGCAGATCTTCAAGCTGTACATCACGAC
++
+BBABBDFFFFFFGGGCCGGGGGHGGGFGGGCGGGGGDEGHGGGGFGGCEGGCHHHGHHHHHHHHFFGGGGGGGCEGEFFGGGGHHGHFHHHGGGFGCGGHGGHHGHHGGGGGGGGFGGHHHHHEHHHCFFHHHHGHHHHHHHHGFFHDDG
+@739413/1
+GCGCAAGGATTGGCCGAGGCGCAGGATGCGATCGGCGTGATGTTTATGCAGGGTGAGGGCGTTTCTCAGGACTACCAACAGGCGCTGGCGTGGTATCGCAAAGCCGCTCGCCAGGGGCTGCCTGCTGCGCAAACGCATCTGGGCATCATGT
++
+BAAAB?DB@FBFAFFEGEFFGFEFGDFHCEEHDADGGGGEHHHFHFH@FGDGE?FE1?EEG>EEBGFHHHHHFHHHFHDFGECE/C@DGCB@CFDGGGGGGGFFHGGFGG?-.A..@@FGEFHGHHHECC@CDGG-@.DFFGFEGGGGGF;
+@272697/2
+GATTTAGGTTTCACCTTGTCACCGGGCGGATCTATTTAGTCTGACAACTTTGAAGTAGCTCACACTTATTCACTTTTGGCACGAATGGTCATTGCGTCGTGAATGGTGCGGTTGGACAATGTTACCGATAACAGTTACCCGTAACAAATTT
++
+BABBBFFFFFFFGGGGGGGGGGHGGGGGGGGGHHHHHHHHHHHHHHHGGHHHHHHHHHHHGHHHHHHHHHHHHHHHHH?GHFGGGHHHGHHHHHGGGGGGGHGHHHHFHGGGGGGHHHHHHHHHHHGGGGGHHHHHHHGHGGGGGHHHHHH
+@1277232/2
+CGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACGCTCGGCCGTTTAAGTCGGGCTTAGGGTAACGACGCGCCCTTCCCGAATGTGTGCGTCCCTCCCTTCGGTGCCGGAGGCCGCATAGG
++
+1AAAA1FFBB1BG1AEA0A33A1EGFHGG//AE/AB0G1DAG//AEEFGFFGF1BE>EEG>/////////?B/?0/B122///>//1?100?01//--------////..-./:00.0.;:990/../09;.9.-/------------//
+@1289211/1
+GACGATCCCAGCCCATTCCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACGCGCGGCCGTTAAAGCCGGTCTTGGCGTAACGGCTCGACCTGTGGTAAAGA
++
+AA1AAAAAFBC?F1AGAFGG?00E00FFH1A1AF00BF//AE?HH211B1EG/AEF2FFBDFGH?/>EEC?AGFF>FDE/EFCEGHE12>EFC?BC/<////<--<<---.::000;-;-9.900/-99..;---.-;----//--/9///
+@1335852/2
+AGCTCACCTAAGCCACCTTTGGCACTTTGAAAATCTAATCCCGGTTGTTTAGCCATCTGCTACTTATTCCTCGATTTTACCGCCAGCAGCTTCGATAGCAGCACGAGCGCCTTTAGTAACACGCAGGCCACGAACAGTTACCGGAGTAGTG
++
+AAAAAF1FBFBFG1FFCFGGEGGHHF1FEDFBGFFGHHHHHHGGAFEEAHHHHHHFHGBGGHGHBHHH2E2DE/FHGHFGHFCEEGGHHHFGHGHFEGHFHHFHEEECE@EEEFF1>F2FGHFGCCGCE/CB@C?@HDGFGFE@CGGHHHF
+@558670/2
+CCTTTTATTTTTCACGAAGTTGAGGTTTGAACCCCAAATTCTAGCAAAAATAGGCTTAAAAAGCACCTCAGGGAATAGTCTTAATCCGAAACTATGTCAAGTATTAACGATAACAGGCAGCAATAATGCCAATAAAATGTGGTGCTTATCG
++
+BBBBBFFFFFFFGGGGGGEGGGGGGHHHGFFHHGGGGFHHHHHHHHHHHGHHFBHHHHHHFHEHHGHHHHFHHGGHHHFHHHHHGHHGGGGGHFHHHHHHHHHHHHHGGGHGGHHFGGHGGHGHHHHHEHHHHFHHFHHGHHH/BG?DGHH
+@922641/1
+GGTAATACTGTTGAGAATGTCGCGGATCTGGTCGCGATCCTCTCCCGTGAACGTCAGGCTCAGAACGCCGGTATCTTTGCCGGTTTCCGTTACGGTGAGGTTATTTTGCAGGTTATTAATCATGCCAAGCGTTGAGAATTTACTCACCGTA
++
+BCABCFFFFFFFGGGGGGGGGGHGGGGGHHHDHGGGGGGGHHHHHHGHGGGHHHHGGHGHHHHHHHGGGGGGGGHHHHHHHGGGGGHHGHHGGGGCGGHHHHHHHHHHHHHHGHHHHHHHHHHHHFHHHGGGGGHGGHHHHHHHHGGHGGH
+@128317/2
+CATCCGGACTGCTATATCGAACTGGTGATTGAAGACAGTTATTACAATATGCGCGAAAAAGTGGTTGAGCATCCGCATATTCTCGATATCGCCCAGCAGGCCATGCGTGACTGTCATATTACGCCGGAGATGAAACCAATTCGCGGCGGTA
++
+BABBABBABCCFGGGGGGGCGFHHHGHGHHHHHHGHHHGHHHHHFHFHHHHHGGGGGGEFGBGGGGGHHHHHFHGGGGGHHHGHGGHHGHAGEFGHHHHHFGHGHEGFCGGHHHHHHHGHHFGGGGGGCGGHHHHHHHGHHHGGGGGGGAE
+@149332/2
+CAGTCGCTATTCTGGACTCTGATGATGGAATGGGACACTGCGCGCTGATAAAGGCGACAGACCACGCTATTAGTCTGGCGAGAGAGACGGGGCTGGGGTTCGTCAGCGTCAAAAATACGTCCCACTGCGGCGCGCTCTCGTGGTTCATTGA
++
+>>3>>AD?2AFFFG4GGFFGGDFG5FGG4ADGHFBFFFCFBAEEEECFHHFHHFGEEGGGGAEGHGCAE1GGG4E44B3E/@/>C?FGG//E///CB/<BFCB?G?HGF?D/DG/FGHEHGEGFGHFF?--<-;A-.:09A.E=;9F09F0
+@1352710/1
+CCGTACCATTAGTCCTGCTGGACGATCCCAGCCCCTTCCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACCACCGGCCGTTTAAGGCGGGATTGGTCTAA
++
+BB@AB?AFFFFFGGFDDGGGGGHEA242FFBA2A2AAAGEGG20A05B5BFGFCE13110A1EGFFDGDCEGG//3BGFFB3C1EEE//E/F?01B2FB///<B/1FHFGGF///@A-<<0=0..<-:--:/:<:0:-9--./..////9
+@1364902/1
+ATATGGATGCTCTCGGGCCGGGTGAAATGGTGGCGACATTACAGCGCCTGGCCGCACTTTACGGTCCTCGTTACGCGCCTTGTGAACAATTAGTGCGCATGGCGGAGCGCAGGGAGCATTTCTGGACGAATGGGGAAACTGACCAGGGAAA
++
+CCCCCFFFFFFFGGGGGGGGGGEGHHHHHHGHGHGGGGGHHHHHHGGGGHHHHGGGGGHHHHGGHGGHHGHGHGGGGGGGGHHHHHHHHHHHHHHGGGGGGGHGGGGGGGGGGGGGGHHHHHHHHHHGFGHHHHGGGGGGGGGGGGGGGGG
+@1393396/1
+CTGCTGGACGATCCCAGCCCATTCCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTACGCGCGGCCGTTAAAGCCGGTCTTGGCGTAACGGCTCGACCTGTCG
++
+BABBBFFFCDBBGCGGGGGGGGHHHGFGGGGGGFFHGHCCFHHGGGGGGHHHHHHHGCG?FHHHHHHHHHGGGGGGGHHGHHGHHGEEEFHHHEFG2FDFGGG<ADDGGGCGGG-:C.EF99F-?-;.F0:/?.;A.AAD-9---;..:/.
+@1442130/1
+GGACGATCCCAGCCCATTCCGCGATATGGTGCTGGAGACGCTAAATGCAGCGGGTATTACCTGGCGGCTGGCCTATGTGGCGTCTACATTACCGGCGGTAAGCGCGGCCGTTAAAGCCGGTCTTGGCGTAACGGCCCGGACTGTTGGAATG
++
+1>AA@1>AAFCFCCECFGGGFE?0EAEBFD11GHC00FFCAEGGEEG1D1CEA/>/FH22@FD0F//EEE/?0BB11221?//>EGDFHF1GB/@CCG//?11<<A@-<--..;C00:;--;.900;-9-9..----------/9/-9///
+@952039/2
+GTTGTACAGATACCGCGCCACGCTGCGACAGCGAACGGGAACGCACGTGACATTTAGAGACGGAGTCCAGCTCAGCTTCCCGCTGTTTGACGACCGACTGCGCGGCGCGCATTTCACTCTGGCGTTGCTCCAGCAAGGCACGGGCGGCGG
++
+A11AAFFF3FFFGGFE1E0EE?0EEE00A//A/?E?EFF/ECEEEGEFHFG1DBB@21@@0?ECCEG1@GBFCGEFGHFGFGE/EEHF011////>//<BBCC@CGC-CC-A?CH000C0:CE:;A@CFFEF/;9FF?E?..-AG-99@@
+@720049/1
+CTCCACAGCATAAATGCCGGATGGCGGCTTTACCTTATCAGGCCTACATAAGCACTCGGCTGGTAGGCCTGATAAGCGCAGCGCCATCAGACATTGATTGGCAATTAAGCCTGTTTAGCAGCTTCTGCTGCTTTCACGATCACCGCGAAGG
++
+CCCCCFFFCFFFGGGGGGGGGGGGHGGGGGHHHHHHHHHHHHHGHHHHHHHHHHHHHGGGGGGHHHGGHHGHHHHHHGGGGGGGGGGHGHHHHHHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGHHGHHGGGGGGG
+@724463/1
+CCATTATTTCCCTCACCTTTTCCCTGATTGCGGTGCTGATCCCGTTGCTCTTTATGGGCGATATTGTTGGTCGACTGTTCCGCGAATTTGCGGTGACGTTGGCGGTAGCGATTTTAATCTCCGCCGTCGTCTCTTTGACGCTCACGCCCAT
++
+BBBBBFFFFFFFGGGGGGFGGGHFHHHHHHHGCEGGHHFHHHHGHHGGHHHHHFFHFFHGGGGGHHHHHHDHGGGGGHHHGGGGGGGHHHHGGEEGHGGGHHHGGCGGHGFHHGGHHHGHHHGGGGDFCGGGHGGHGGGGGFGDHGHGGG:
+@468071/2
+GTCCAGAAATGCTCCCTGCGCTCCGCCATGCGCACTAATTGTTCACAAGGCGCGTAACGAGGACCGTAAAGTGCGGCCAGGCGCTGTAATGTCGCCACCATTTCACCCGGCCCGAGAGCATCCATATAGCGGAACGGGCCACCGAGAAACG
++
+1AAAAFDFFFFFGFGGGGG1E0EEGGCEFBGEGGGEHHHHFDGFFGFBAGAFGEAECEEGF?FGEEEFA>G@GB>/EEEEAAGGGGEF2EDGFHHGCFHEFFG2GDFF?@<@GC@-<AFHFHH1FDF0GHC@-<:AC.ACEEH??-ACB9.
+@33329/2
+AGCCCTTAGGAGGGGCTCGTTATATCCATTTAACTAAGGGGACAACGCGGCGCCAGTATAGCGTTTTTTATTCGCCGGAGTAAGTGTAGCGCCGCCTGACTGGTTAAACCGTCGCCACTCAGCGCTGTTTTTCCGCTTTTTTCCGCTCCCG
++
+CCCCCFFFFFFFGGGGEFGGGGHHHHHHHHHHHHHHHHHHGGGGHHGGGGGGGGGGGHHHHHGGGGGGGHHHHHGGGGGGGHHHHHHHHHGGGGGGGHEHHHHHHHHHHHGGGGGGGGHHHHHGGGGDFHGGHHGGGGGGGGGFGDFGGGG
+@401260/1
+TCTTTTAGCGTAGCGGAGCCGCTATGAACCGGGATGACCTCAGCGCCCATCAGACGCATACGGAAGACGTTCGGCGACTGGCGCTCAACGTCTTTGGCGCCCATATAAATACGGCATTTCAGACCCAGCAGGGCGCTGGCGAGCGCAGAGG
++
+CCCCCFFFFCBCGGGGGGGGGGGGGHHHBGGGFEGGHGHGHHHHGGEEEHHHHHHGGGGGHHGGGGHHEFGFEEGGGGGGHHGGGGGFHGHFHGHHHHGGGGGHHHHHHGHFHGGGGHGHGHHGCEHHHHHHGGGGGGGGGFGGFGFG?EF
+@990514/1
+CGTCTACCAACACGGTGGGCTGGCGTTTAAGCGTAAAGAGGGTCAGGTCGGCATCCAGACCTGGCTGAAGACGCCCTTTGGTTTTCAGATTCAGGCTATCGGCGGCATTGGCCGTCACGCACGCAATGACCTGCGGCAGCGACATGCCGAT
++
+CCCCCCFFFFBCGGGGGCCGGGGGGGGGHHHHGGGGAGHHGD1GHHHHHGGGGGHHHHHGHHHHHHFHHHHHGGEGGHHHHGEHGHHHHEEHHHHGGHHHGGGGGGCFB1?GGGGCDGGGGGGGGGDHFBGBGFFGGF-.??C-DFGFGF-
+@37714/2
+TTCATATTCCTTCGCCTTTTAATGCCATCCCGAAACGTATGAGCGCGTATATCAAAACGCGCCGAAAAGACTTACCCTGATATAGACTGCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTGGATCA
++
+CCCCCFFFFFFFGGGGGGGGGGHGHHHHHHHGGGGGGHHHHHGHGGGGGGHHHHHHHHGFFGGGGGGGHGHHHHHHHHHHHHHHHHHHHHGGGGGHHHGHHHHHHHHHGHHHHHHHHHHHHHHHHGHHHHGGGGGHHHHHGFHGHHHHHH
+@1009870/2
+CCTTCTAAGAAAACCTCATCCCGGGATTTTCAGGCAACCCTCCCGGTGATGCCAAAGAGAAAAGGGTAGTTCGTTGACAATAAATTTACATTTCTACAACTTAAAAGGGCCATTTTTGTTAAAGAAGCGAGTCAGCCCGTTTAACCTTTAT
++
+1>AA1F3@FB111B1B1111B1AEAAEGDFAE21BAG0BAGGGF/EAACG2GFFHFG0B0AGFG//>>/12F/BC0AGD1F111B@1FGE2B@G22211F@DFBDBBEEF//BFFGFEHGB2G1BFGB/A//0B11B///@</>>11<D1F
+@162555/2
+TCATGCTCCATGCCCATGTTGAGGCCGTACCCGCGGCGATTACCGTCTCCTGCGCGATTCTTGGCTTAGTGCTAGTAGTGACGCGCGACGGCTGGCTCAGTCTGTTTATGGCGGCAGTCGTCGTACCGGATACCAATCTGCTGCCGCTG
++
+CCCCCFFFFFFFGGGGGGGGGGHHGGGGGGGHGGGGGGGGHGHHGFFHHHHGHGGGGGHHHHHHHGHFHHHHHHHGHHFGFHGGGGGGGGGGGGCGHHHHHHHHFHHHHHHHGGC@C:GD..<-:GGDC-.<BFFG0B0BF00BF?---
+@162920/2
+GATTGGTATCCGGTACGACGACTGCCGCCATAAACAGACTGAGCCAGCCGTCGCGCGTCACTACTAGCACTAAGCCAAGAATCGCGCAGGAGACGGTAATCGCCGCGGGTACGGCCTCAACATGGGCATGGAGCATGAGCCCCAGCGCCG
++
+BABBBF5@DFFBG2EEGFGEEEEECHGGGGGFHHHGHHHHFHHFGGGGGGGGGGGGGGCGEHHEBGHHFFHHHF3FGHGHHHHHGGGGGGEGFGGGDGFHHGGDDGGGG--C?<@CAGHFFHG//:GBGFFF/9.BGGGGBEGGGGGG@B
+@171422/1
+CAATGCAGAGCAGCGGCAGCAGATTGGTATCCGGTACGACGACTGCCGCCATAAACAGACTGAGCCAGCCGTCGCGCGTCACTACTAGCACTAAGCCAAGAATCGCGCAGGAGACGGTAATCGCCGCGGGTACGGCCTCAACATGGGCATG
++
+AAABBFFFFBFFGGGGGEGGGGHHGHHAEGHHGGGGGGGGGGFF?GFGGGGGFFHHGHBHFHHHHHGHFGGGGGGGGGGGGGHHHHEHHBFGGHGGFHHHHFH2FFCDGGGGGGGGG<FCFGFGDCDGCC99F?CFGGAFFGGFFGE./9F
+@488369/2
+GGATCCTGTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGTTCGTCGGTTGTGAACTGGGCACGCCAATGGCGCCGGAAATTAA
++
+AA@ABFFB5DDFGGECEFAEAFDGHHHFHHFHHGGEFAEGHGGHGGCEGG?EGGFGFHEGF5FFGHHHHHHGHHFHHFHFHGGHBGFHGHHBHHGGHGCGGHHHHHGFHHGEFGG/BCFDHHHEHFEHHADDGGGFHBGCDCCCCC-<GHF
+@274276/1
+ATGCAGAGCAGCGGCAGCAGATTGGTATCCGGTACGACGACTGCCGCCATAAACAGACTGAGCCAGCCGTCGCGCGTCACTACTAGCACTAAGCCAAGAATCGCGCAGGAGACGGTAATCGCCGCGGGTACGGCCTCAACATGGGCATGGA
++
+CCCCBFFBFFFFGGGGGGGGGGHHHHHHHHGGGGGGCGGGGGGHHGGGGGHHHHHHGHHHHHHHHHGGGGGGGGGGGGGGHHHHHGHHHHHGHHHHHHHHHGHGGGGGGGGHGGGGHGGHGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGF
+@283855/1
+GCGATTACCGTCTCCTGCGCGATTCTTGGCTTAGTGCTAGTAGTGACGCGCGACGGCTGGCTCAGTCTGTTTATGGCGGCAGTCGTCGTACCGGATACCAATCTGCTGCCGCTGCTCTGCATTGTGATGCTCCCCGCCTGGCTATTGCTGG
++
+CCCCCCCFFBCCGGGGGGGGGGGHHHHHHHHHHFHHHHHHHHFGHHHGGGGGGGGGGGCDFHHHHHHHHHHHHHHGHGGGFCFGD/F//BGFAF//<CFCFFFDG11=DG@??-.FG11FGHHF0D0D00DGHGGGGGDEG.CGHHHHHFF
+@751987/2
+GACTTACCCTGATATAGACTGCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTGGATCACACTAATTATGTTTGGTGTGCTGGAATGATGTACTGAGTACTGCGAAGAATGGGGGATAAACAAAACG
++
+BABCCFFFBDFFGGGGGGGGGGGGGGGHHHGHHHGHHHHGHHHHFGGFHHHHHHFHGHGGFHGGGGGHGHFHHHHHHHEFFHHHGHGHHHHHHHFHEFGGHGGHGEHHHGGDGHHHHHBGHGDFHFEE@EEEFGECEEBDHGBGHHFHH?
+@946018/1
+GGGCGACCGTAACGACAGCAGAGTCCTGTACCGGCGGCTGGCTGGCGAAAGCCATTACCGACATCGCCGGAAGTTCCGCCTGGTTTGAACGCGGCTTTGTCACCTATAGTAATGAATCCAAAGCGCAGATGATTGGCGTGCGTGAAGAGA
++
+A3>AABBBBBAAFGCGGGCFGFDFGHHBFGHHGCGCA?0>EEHCE1//EE13B2B333F/AEEE3EEEEGB//F2DB//?DAAFFHA<FGFGGFF-A/<=GHFHCGHFFD0DB0CC0<CGFCGBACC--99B0FFGGGGA.?.9.:BFFB
+@420608/1
+TCACAATGCAGAGCAGCGGCAGCAGATTGGTATCCGGTACGACGACTGCCGCCATAAACAGACTGAGCCAGCCGTCGCGCGTCACTACTAGCACTAAGCCAAGAATCGCGCAGGAGACGGTAATCGCCGCGGGTACGGCCTCAACATGGG
++
+BBAABFFFFFFFCFGGGGEGGGGFH3GBGAGBDGFGGEGGFGDCEEEGGHFGGGGHBGGHGHHGFFHHHHHGGGEGGGGCFEGFGHHFHHHGHHFCHF2CGHFHHGHHACCGGGGGHGGCCFGHHGEGGGGGGBDGG????FFGGGFB/C
+@422465/1
+TCACAATGCAGAGCAGCGGCAGCAGATTGGTATCCGGTACGACGACTGCCGCCATAAACAGACTGAGCCAGCCGTCGCGCGTCACTACTAGCACTAAGCCAAGAATCGCGCAGGAGACGGTAATCGCCGCGGGTACGGCCTCAACATGGG
++
+ABBBBBFFFFFFGGGGGG?EGGGFGGHHGGHHHFHGGGGGGGGGFGGGEHGGGGGHHHHHHHHHGHGHGHHGGGEFGGGGGGGGGHHHHHHHHHBFGHHHHHEHGHHGGGGGGGGGHGGGGGGHHEGGGGGGGDBGG?@AFFGGGGFFFG
+@37279/2
+TTATCACCGTACTGCGCAACACAAACTTTGAAGGTCTGCAAACTATCACGACGCGGCGCAAGAGTTTGTTATCAACTTATAACAGCCATGTTACCTGCTTATACCAGCAATACCATGCCTGTCTGCTATGCTTTTTGGTTATGTAGTGTAT
++
+BBBBBFFFBFBBGBGGGGCGGGHFHHHHHHHGHGFGHGHHHHGHHHHHHGGGGGGGGGGGEGHHGFHHGHHHHHGHHHHGHFFHHGHHHHHHHGHHHHHHHGHHHEFFFFHHHHHFHHHHHHFHGEHHHHHFHGGHGGFE1FGHHHHHHFD
+@563238/2
+CTTCTGGACCCGTTCAACCAGGACCTGGTCCGTTAACTGCTCGCTCATCCGAGGTAATGTCTCCCCAAACCAAATTTCCACGCGCTTTCGAAACGCCACTCCATAAGCCGCACTATGAGCAAGCAACAGGTTAGAGTGTCTATGTTTCGTA
++
+BCBCCFFFFFBBGGGGGGGGGGGGHHHGGGFGGHGGHHHHHHGGGHGFHHGGGGEHHHHGHHGHHGGFHHGEHEHHHHGHHFGGGGGGHGGHGGGGGGGHHGHHHHHHHGGGGGHHHHHHHHHHHHHHHHGGHHHHFFHFHHHHFGFFGHF
+@707290/2
+ATATGGATGCTCTCGGGCCGGGTGAAATGGTGGCGACATTACAGCGCCTGGCCGCACTTTACGGTCCTCGTTACGCGCCTTGTGAACAATTAGTGCGCATGGCGGAGCGCAGGGAGCATTTCTGGACGAATGGGGAAACTGACCAGGGAAA
++
+BCCCCFFFFFFFGGGGGGGGGGEEHGHHHHHHGGGGGGGHHHHHHGGGGHGHHGGGGGHHHHGGHGGHHGHGHGGGGGGGGHHHHHHHHHHHHHHHGGGGGHGGGFGGGGGGGGGGGHHHHHHHGHHGGGHHHHGGGGGGGGGGGGGGGGG
+@1201102/2
+GACTTACCCTGATATAGACTGCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTGGATCACACTAATTATGTTTGGTGTGCTGGAATGATGTACTGAGTACTGCGAAGAATGGGGGATAAACAAAACG
++
+CBCCCFFFFFFFGFGGGGGGGGGGFGGHHHHHHHHHHHHHGHHHGHHHHHHHHHHHHHHHHGGGGGGHHHHHHHHHHHHGHHHHHHHHHHHHHHHHHGHGHFFHHHHHHHGGHGHHHHHGHHHGHGGGGGGGHHGAFFCDHFGFFGFHHG
+@407572/1
+TACAGAGATCGTCCACCAGCACGCCGAGATAAGCCTGAGAACGCGCAGGCGCCCAGCCCTCTTTGTCGGCGGAAAGACGCGCGGCATTCAGACCAGCGAGCAAGCCCTGCGCCGCAGCCTCTTCATAGCCGGTAGTAACGTTGATTTGAC
++
+AAA@AFF1FFACCA111FFAFGGGGECEEGHFHGHHFF0FBG/E/AEE?EEGGGGFHEGHHHFFHFHGGCG/<EECGHGGGGCGGG?GBGFH1FFHHGGGGGHFFEHHHHCCCGCAGGGGGGGGGGGGG0AA?@G0C0;C9FEEFF/;//
+@250856/1
+CTTTCCGTTTGCAGTTCGGCAAAACGCGCCTGGTAAACTTCCTGCTCCGCATTAAGCACGTCGAGCAGCGGGCGGGAACCGAGGTCAAGGTATTGCTGCTGATACAGTTCGCGCGTACGTTCGCTAAGCTGCTGTTGCCGACGAAGGATTT
++
+BBBBBFBFFFBFGGGGGGGGGGHHGGGGGGGGHGHFHHHHGFFHHGHHGGFGGGHEBHGGHHGGGGGHEE?EEGGGGGGGGGGGFHHHHF1FGHHGHHGFHHFGHFFGHHGGGGGGGCGHGHGGGGGFGGGGEGGGGGGGGGGG-ADEFEF
+@591936/2
+GTACCCGCGGCGATTACCGTCTCCTGCGCGATTCTTGGCTTAGTGCTAGTAGTGACGCGCGACGGCTGGCTCAGTCTGTTTATGGCGGCAGTCGTCGTACCGGATACCAATCTGCTGCCGCTGCTCTGCATTGTGATGCCCCCCCCCTGG
++
+AAABCFCCCCCCGGGGGGGGGGHHHHHGGGGGHHHHHHGHHHGHHHHHHHHHGFFHGGGGGGGGGGGGGGGHHHHHHHHHHHHHHHGG?/C0FAFE?-0CC<D-<E0FCBCGF0;C00C---:A09000;CF990B0000;.A?--;-.A
+@208775/1
+GAAGGGGATGATGCCGCCAGGCTTCCCGGGTAGATAAATATATCGGGCTACCTTATTTGCCATTTTGACGCCGGAGTGTGCTCGACAAAACACGATAGTGTTTTGAACGCCCTTTAGGGCGGCCCGAAGGGCGAGCGGAGCGAGTAAATG
++
+B?AAABBBBBFFGGGGGGGGGGHHHHHGGGEFGHHHHHHHHHHHGGGGGHHHHHHHHHHHHGHHGHHGGGGGFGGGEGGGGHHGFGD/GFHHHGEHGGHHGHHHHGHHHGGGGHHGGHHHGGGGGGGFFGGGCGGGGGGGGGGGGGGFGF
+@1491348/2
+TCTAAACAGGGTTATCAACACTTCTTCGCCTTGCTGGGCGCGGCCAGCGCCGTCACGACCGGGCACCCTGAAGCCAGGAAATTGCTGGATTACACCATAGAAGTGATTGAGAAATACTTCTGGAGTGAAGAAGAGCAGATGTGCCTGGAGT
++
+CCCCCFFFFCCBFGGGGGGGGGHGHGGHGGGGHGHHHGHCGGGGGGHGGGGGFGGGEGGGGGGGGGGGHHHHGHHHHGHHGHHHHHHHGHHHHHHHHHHHHHGHGHHHHHHHHHHHHHHEHHHGHGHFHHGHHHHHHHHHGHFHHHHHGF<
+@1448009/1
+ACGATACCGTGGTGCTAAACATGGTGCCAAAAGCTCAAGATTCATACAGAGATCATGACCACACATGCAACAAAAAAGCCTGCAACTCATTGAAGTTACAGGCTTTTTTAAGGTTCATGATGCATCATGAATGAATGTTTGGTGGAGCTGG
++
+BBBBBBBFBAABGFCGGGGGGGGGHHCHHHGHHGHHHFFFHHHFHHHHHGGHHHHHHEGHHHHGGHHGHGHHHHHHGGHGFHGHFFF3FFHHHFFDGFGGHHGHHHHHGFHHHGHHHHHHHHHGHGHHFHHHHHHHHDHGH/?FDHHHH2F
+@540666/2
+ACGATGTTCGTTAAACTCTTCCAGCACTTCCTGGTAATCCAGCCCTTCTGCCAGCCAGTGTAGAGGTTCCCAAGCTTCCGCTGGCATCACGCTTTCTAGCTGATTCAGCCCCACTGTATCTACAAGAGCCATTACCTGCTCAATAAACACA
++
+CCCBCCFFFCCFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHGGGHHHHHHHHHFGHHHHHGHFHHGHHHHHFGGHHHHGGGGGGGFHHHGHGGGGHHHHHHHHHHHHHHGGGGHHDHHHGHHHGHGHHGHHHHHGHHHHHHHGHHHHHHG
+@807284/1
+GCGATGGCTTTTAATTCCGCCAGTGCGGCATATTCGGTTGCCGCCTCGCCAACCTGCGGCGGAGTCGCGAGCTGAATGTCTTTCGGCACAATCTGACCTGTCAGCGCGTTTAACGACTCGGCGCCAACCGCATTCAGCATCTCTTGTTG
++
+CCCCCCDFFFFFGGGGGGGGGGGHHHGGGGGHHHHHHGGGHHGGGGGGGGGGGGHHHGGGGGGGGHGGGEGGGHGHHHHHHHHHGGGGGHHHHHHHHHHHHHHHHGGGDGGHHHGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFF
+@374774/2
+GGAAAGGAGAGATACCGCCGACACGCGGCGCATCTGGCTGAACGAAATCGCTGGCATTGCCCAGAATCAACTGCTCGTGTTCCCGGAAACTGGTCAGCATTTCCCCGGTGGCGATAGGCGTATCCAGCGCGGCAGCAAGCTGGGCGTGGC
++
+CCBCCFFFCCCCGGGGFFGGGGGGGGGGGGGGGGHGHHHGHHHGGGGHHGGGGFGHHGHHHHHGGHHHHHHHHHHHGGHHHHHGGGGGGHHHHHHHHHHGHHHHHHFGCGGHGGGGDHHGGGGGHHHHGGGGGGGGGGGGGGFGGGGGAG
+@841332/2
+GACTGAGCCAGCCGTCGCGCGTCACTACTAGCACTAAGCCAAGAATCGCGCAGGAGACGGTAATCGCCGCGGGTACGGCCTCAACATGGGCATGGAGCATGAGCCCCAGCGCCGCGCCGATAAACACAGCCGGAAAAATGCGCCCGCCGCG
++
+AABBABFBFCFBFEGGAEEGEEGGGFHHHBFHHHGH3GFFHGFHFBFGGGGGGEGGHGGGEGGHBFGGGGGCG/BFBADCAGFFFEGHCFFFCGHHHFEEFFFHHE.CDACGG-<DGGG-DBFGGGGEFGG?B@BBFFFBBDF.B?B<;?B
+@392162/1
+CTCCCGGATTGGTCATGGTCGGTCGTCGTGGTAACGAGATCTTCAATTCTGCTGGCCGTGTCGCCGTAAAAATATAAAGCGAAATCTGTGCCAACTTTCACATTGCCCCCAAAAGGCGTTATCATGCGCACCATCGTGCAAAAGGGCTGCA
++
+ABBBB332AAFFGGFG54GG?EAEEEF2AEGCEHHG2EAFGHFFG5AEGGFBAECEAEG0FGEEG/>EEEHHHHHHHGBD1EECFFHHHFFFHCFHHGHEGBGHFFHHGGG/BG0CGCDGGHHHFDGDD?@DAHH.GFFEHEBCDGFFAE/
+@877386/1
+GCGCTGGGGCTCATGCTCCATGCCCATGTTGAGGCCGTACCCGCGGCGATTACCGTCTCCTGCGCGATTCTTGGCTTAGTGCTAGTAGTGACGCGCGACGGCTGGCTCAGTCTGTTTATGGCGGCAGTCGTCGTACCGGATACCAATCTG
++
+CCBCCCCCCCCCGGGGGGGGGGHHHHGHHHHHGCGGGGGGGHGGGGGGGGHGHHGGGHHHGHHGGGGGHGHHHHHHHHHHHHHHHHHHGHHGGGGGGGGGGGDGGGHHHHHHHHHHHFHBCCGGG-:;FFAEA-CF..B-9DFGFG/F0C
+@330459/2
+CGACAGACCAGATCCTTTCCAGTAACCCATTGGTAAAATGCGGCGATTTTTCTCGATCACGCCCGGTTCTTTGGTCAACTGACCGTTATCGTCGAAACCGCCGTCCACCGGCAGTTCGCGGCCCGCCAGACGGTTAACTTCTAACATCCCG
++
+CCBBCCFFCFFFGGGGGFFGFGHHHFFHFHHHHHGFHHHHGGGGEEEGEGGHHEGHHFEHGHGGGEEGGHGHHHHHHGGHHHFHFGGGHHHHHGGGEEGGGGGGGGGHHGGG@CGHGF/@DGGGGGGGCHGGGGGFHFHHGGFGGGEGGGG
+@977263/2
+GAGCATCACAATGCAGAGCAGCGGCAGCAGATTGGTATCCGGTACGACGACTGCCGCCATAAACAGACTGAGCCAGCCGTCGCGCGTCACTACTAGCACTAAGCCAAGAATCGCGCAGGAGACGGTAATCGCCGCGGGTACGGCCTCAACA
++
+CCCBCFFFFFFFGGGGGGGGGCFGGGGGCHGHHHGFHFHGGGGGGGGGGGGGGFHCGGGGBFHHHHHEHHHHGHGHGGEGGGGGCG/BFFHHHBHEGHHHHCGHGHCHHHHHHGGGCGGAFHGDFDHCGHGG?@F?:D?BGFGGGGGGGGF
+@1001160/2
+TCACAATGCAGAGCAGCGGCAGCAGATTGGTATCCGGTACGACGACTGCCGCCATAAACAGACTGAGCCAGCCGTCGCGCGTCACTACTAGCACTAAGCCAAGAATCGCGCAGGAGACGGTAATCGCCGCGGGTACGGCCTCAACATGGG
++
+CCCCCFFFFFFFGGGGGGGGGGGHHHHHHHDGHHHGGGGGGGGGGGGGHHGGGGGHHHHHHHHHHHHHHHHGGGGGGGGGGGGGGHHHHHHHHHHHHHHGHHGHHHGHGGGGGGGGHGGGGHFHHGGGGGGGGAGGGGGGGGGGGGFFGG
+@138110/1
+GGACGATGCGATTGTGGTGATCGAGAACATCTCGCGCTACATCGAAAAAGGAGAAAAACCGCTGGCGGCGGCGCTCAAAGGCGCGGGCGAAATCGGCTTTACCATTATTTCCCTCACCCTTTCCCTGATTGCGGTGCTGATCCCGTTGCT
++
+>AAA?DA>AD1>AF13E0A1FGCFGAECGDGHHAA?/AA/AEEE0BAE0AE0GHHHFFAEE/@@E/>E?E@C/C?<C<B<0<@?@@--<--;:G?A@A?BFFGF090;FFB0CFGG.9..CF9BFFBFG00BA-B=-9//BFB9BA---/
+@1253740/1
+TGCCAATGTACGACGTGAAGCGCTTGTTACGCCCGGCGATGGCTTTTAATTCCGCCAGTGCGGCATATTCGGTTGCCGCCTCGCCAACCTGCGGCGGAGTCGCGAGCTGAATGTCTTTCGGCACAATCTGACCTGTCAGCGCGTTTAACGA
++
+BBBBBFFFFDDAGGGGGGGGCFGGGGHGHHGGGGGGGGGGGGHHHHHHHHHHHFGGGGHHHGGGGGGHFHHGFEFEHGGGGGGGGGGGGHHHGGGGGGGDHGGGCGGGHFHHHHHHHHHGCGGGFGGGGGGGGGGFFFGGGGGFFFFFFDA
+@450413/1
+ATCCCATTCCACGATGCGTGTTAATTGGCGAGAGATCCGGGTTGATCGCGCGTAGCTTAGCGCGCAGGGTTTTGATGTGTGTATCGACCGTCCGATCGAAGGTCTCCTGGGCATCAGACCAGACAATATCCATCAATTGCTGACGCGAGTA
++
+CDCCCFFFFFFFGGGGGGEGGGHHHHHHHGGGGGGHHHHGGEFGHHHGGGGGGGGGHHHHHGFGGGGGGHHGGHGHHHHFHHHHHGEGEGGGGGGGGGGGGGHHHHHHHHGHHHHHHHHHHHGGGHHHHHHHHHHHHHGGHHHHGGGCFDG
+@1307781/1
+TATCGGTAATCCGCTACTGGCCTCATGGGGAAAACTGGGACGGGATTATATCTACCTGCTATCTGAACTGGAAAACAGCCAGGAGCTGGATGCGTTTGTTGATATTACGCCAGATAATCTTTTGCATCGGATTCAGGCGGACATCCTTGAA
++
+CCCCCBCBAFFFGGGGGGGGGGHHHHHHHGGGHHHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHGHHHGHGGHGHHHHHHGGGGGGHHHHHHHHGGGGGGHHHHHHHHHHHHHHHGGGGGHHHHHGGGGGHHHHHHHH
+@732620/1
+GCGTGTAGATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGATCTTGGATGCACTTCCAGCGGGTTGA
++
+BCCBBAFFFFFFGGGGGGGGCGGGGGGHHHFHHHGGGGGGGCGGHHGGG?GGGGFGCHFHFGGGGCHHHHHGHEHGFGGGGGGCGGGHFHHHHHGHHEHHGFFHGHHHGGGGGGGGGGGFGGGEEEFFGGFGFEFGGGGGGGFFFFBFFF
+@911769/1
+ATCACGCCCGGTTCTTTGGTCAACTGACCGTTATCGTCGAAACCGCCGTCCACCGGCAGTTCGCGGCCCGCCAGACGGTTAACTTCTAACATCCCGTAGGAGAACATCGACATCGACATATCTACCATCGTGATCGGCGTAGACGGGATGG
++
+CCCCCBFCCCCCGGGGGGGGGGHHHHHHHGGGGHHHHHGGGGGHGGGG?FGGHHGGGGGGHHGGGGGGGGGGGGHGGGDFGHHHHHHHHHHHHHHGG@DGHHHHHHFHGHGGGHGGGGGHHHHHHHHHHGHHHHGGGGGGGGGGGGGDEGG
+@1322319/2
+CTCATGCTCCATGCCCATGTTGAGGCCGTACCCGCGGCGATTACCGTCTCCTGCGCGATTCTTGGCTTAGTGCTAGTAGTGACGCGCGACGGCTGGCTCAGTCTGTTTATGGCGGCAGTCGTCGTACCGGATACCCATCTGCTGCCGCTG
++
+ABCBCFFFFFFFGGGGGGGGGGHHHGGGGFGGHGGCFGGCEHGHHGGGHHHHHHGGGCGHHHHGHHGHHHFHGHHHBGFGHGHGEGGGCCGGFGCGGHHGHHHHHHHHHHHGHGGF-A/CEF.;-.;E.9-..0=0;:/009C00;----
+@96596/1
+GGTTCAACTCCCGCCAGCTCCACCAAACATTCATTCATGATGCATCATGAACCTTAAAAAAGCCTGTAACTTCAATGAGTTGCAGGCTTTTTTGTTGCATGTGTGGTCATGATCTCTGTATGAATCTTGAGCTTTTGGCACCATGTTTAG
++
+A?3AABDFFFFBGGGG?FGFBGHCFDHDHDHHDEEFAFDDEFGHHGFFHBFGECHHFFHEEGHHFHGD5FHFF55DF5@FFHHGGFECFHHGGCFFHHHHG3FGCEG3?EFBGDHGHDF4FHFHGGGHB43?FFD3B/FGFGHHHFFGDF
+@1138652/2
+CTCTCTATACCGCTAACTACGTAGAATACCCATAATAATAAGAGAGGCTATTATGATTGAACGTGAACTGGGGAACTGGAAAGATTTTATCGAAGTCATGCTTCGTAAATAAATGCCTGGAAGGCACCGCGCTCCCATAGGGGATAAGAAA
++
+BAABBFFFFFFBGGGGGGGGGGHHGHHFHHHHHHHHHHHHHGHGFGDFHHHGBGHEHHGDGHHHHHGHHHHHGGGGHHHHGHHHHHHHGHHHFFFGGGHHHHHHGHHHHHHGHHHHFHHGHHHGHGHGGGGGGGGGHHHHHGGDGGHHHHH
+@917530/2
+TCGCGATGGTGTGCGAGGAGGCAGACGCCAGCGCGCTGGCGGCGAGATTAGACATATAGCCCAGCTCATGCACTGCCGCTTCGATTTTTTCCCGGAGTTTATCAGAGACCTGTTCCGGCGTGCGTAAGGCTCGTGATACGGTCATCGTGC
++
+BABCBBBBCFFAGGGGCGGGGGGGGHGGGGGGGGGGGGGGGGGGFEEGHHH33BFGHHHGFGHHHHHHHHHHGHHHHGGCDGGFHHGHHGHHHGGFGGHHHHHGGEHHHGHGHHHHGGGFFGGGCDGGGGGFCDFFFGGGGFGGGGFEGG
+@1361334/2
+GTTTATCGGCGCGGCGCTGGGGCTCATGCTCCATGCCCATGTTGAGGCCGTACCCGCGGCGATTACCGTCTCCTGCGCGATTCTTGGCTTAGTGCTAGTAGTGACGCGCGACGGCTGGCTCAGTCTGTTTATGGCGGCAGTCGTCGTACCG
++
+BABCCFFCCCCCGGGGGGGGGGGEHHHHHHHHGHHGFHHHHGGHHHHGGFGGGGHGGGGGGGGGGHHGGGHHHHHGGGCCGHHHHHHGFHHHHHHHGGGHHHGHHGGGGGCDGGGGGGGBFFGFFGGFGFGGGGGGFF=99/..9-9..A.
+@403208/1
+TTGCTATGCTTTCCCGTGCTGTTTTGCCGCGTATCCTCGGCGCACTGTTTTACTACTCCCCTGAGAGGCCGGAGGTGAAAGCGTTGTTCGATTGTTTGCCAACGTTGCCTGAGCTTTACCCCTGGCGCGATCGCGGACATATTGAATCA
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHGGGGGGHGHHGGGGGGGGHHHHHHHHHHHHHHGHGGHHHGGGGGGGGGGHHGHHGGGGGHHGHHHGHHHGHHGHGGFFHGGHHGFHHHHHHHHHGGEHGGGGGFGGFGFCGHHHHHHHHHH
+@282736/2
+AGATTAGGCATATAGCCCAGCTCATGCACTGCCGCTTCGATTTTTTCCCGGAGTTTATCAGAGACCTGTTCCGGCGTGCGTAAGGCTCGTGATACGGTCATCGTGCCTACACCGGCAAGTTGGGCTACATCGGCGATAGTCACTTTACCGG
++
+BBBBBBFFFFFFGFGGFGGGGGHHHHHHHGHCGFGGGGGHHBEGFGHHHGGGGEHHHFGHHHGFBFCGGGGHAEGGGG?EFEGHFHGGGEEGHHGGGHDGHHHHHGHHHGHHFFGGB?FFFGB@FHGHHFBEGGGCGGGHHGFBGHGGHGF
+@1443136/1
+GGCGGGGAGCATCACAATGCAGAGCAGCGGCAGCAGATTGGTATCCGGTACGACGACTGCCGCCATAAACAGACTGAGCCAGCCGTCGCGCGTCACTACTAGCACTAAGCCAAGAATCGCGCAGGAGACGGTAATCGCCGCGGGTACGGC
++
+BBBCCBCBBCCFGGGGGGGGGGHHHHHHGGGGGGHHHHHHHHHHGHGGGGGGGGGGGGGHHGGGGGHHHHHHHHHHGHGHHHGGGGGGGGGGGGGGHHHHHHHHHHHHHGHHHHHHFHHGGGGGGGGGGGGGGGGGGGBFFCFFAAFFFF
+@779620/2
+GAGTCGCGTAAGTGAACCCTGTATCTCGCTCGATGAGATCATTGCTGCGATGTACGAGACCGGTAAAGACATGAGCGCTAAATACCGTGAAACGTATCATGGTTCGCTGGGGAAAATTCAGCCGCGCAAGAGAGGGTAACAGCGTGAAATA
++
+@BBBBBBBBDA4GFFFFAEFEGHHHHFFFFHE?CFEGGA3FDGGHGGBEEGGHHFHGGFAFCEEEEHHE2GHH3@GEGGEGEG4F@E?FAFFB/FGGHEFGCB?FEECD?A@ADGG1FHFBGGGC@GC-<FGCDGGF/FFHHADEFGGEGF
+@1481835/1
+TCACAATGCAGAGCAGCGGCAGCAGATTGGTATCCGGTACGACGACTGCCGCCATAAACAGACTGAGCCAGCCGTCGCGCGTCACTACTAGCACTAAGCCAAGAATCGCGCAGGAGACGGTAATCGCCGCGGGTACGGCCTCAACATGGG
++
+BBBBBBFFFFFFGGGGGGGGGGGHHHHHHHFHHHHGGGGGGGGGGGGGHHGGGGGHHHHHHGHHHHFHHHHGGGGGGGGGGGGGGHGHGHHGGHHHHHHHGGGHFHHHGGGGGGGGHGGGGGGHHGGGGGGGGABGGGGGBGGGGGGGGE
+@603474/2
+GATTCAGTGTATTAAAGTAGTTAGCCATGATGGTGTACTCCGTGATGTTGTGTTGTCGCGCTTATTGTTCGGTTTACAGATTGCTATCTGTGCGAATGAACCCACATTACAACAGGAAATTTATTGCGGAAATTGATATATTCACAACGTT
++
+BABBBFFFFFFFGGCGGEFFGGHHHHHHHHHHHGHHFHHGHGEGGHHHHHHGHHHHHGGGGFGGHHGHHHGGGGGHHHHHHHGHHHHHHGGHHGGGGHHHHHGGGGHHGFHHHFHEF2GHFHHHHGGGGGGGGHHHHHGFHHHHHHGGGHG
+@496536/1
+ACCAGAATCAGTCCGTTCTCGCTGGCAAGCAGTGCGGGTACTATCGGCGGCGTCTGGATTTCCGCCAGATCAGGACAACGCTCGGGCAATAGCCGTAGCGCCAGCGACGTTCCCTGTTGATGTGTGAACGCACTGGCGCGCAGGCGCCGCG
++
+AAAA11CFFFFDE11FAC1FG00EAAGG0FCFA11E0//AABD2F/EG/////>/F0GFGHBG///>EHH1F1G</<0/////>///>F?111<//?//>/<.-.--<-A.</<0<C000::0:0;;:G.:A-AFF.A.-;-A-.----@-
+@499434/1
+GTAATATATCCGGCCTGAATAAAAAAACCGCCGCTATTACAAGCGGCGGCTCTCAGTTTTTATTTTTTAGCAGCATCTGCGGCTTTAGCGTCAGCCGCATCGGCAGGTTTAGCATCCGCTTTCGGCGCTGGTTTGATATCCAGCAGCTCTA
++
+BA3AAFFDFFFBCGEEFFGGBGHHHEGAEFCAF0EAEHHCGHHGGGCEG?EFFFHHHHGHGCGDHHGCHG3FGFGHHHBGGGGGGHFHEGDGGDHFGGGGG?AF?D?.DGF0D000<.<...0;---:--;90C.;=C0;CB:/9.BBF00
+@396928/1
+GTAGAAACAGTGAGTTATGGAATTAATTGGACTTAGTGAGAAGTGTTCATGGTGTCCCCTGCAGGAATCGAACCTGCAACTAGCCCTTAGGAGGGGCTCGTTATATCCATTTAACTAAGGGGACAACGCGGCGCCAGTATAGCGTTTTTTA
++
+A>ABBFFFFFFFBEGGGGGGGGGHFGHHHFCHHBDDGHHH55GDG5FHHHH3F5F3GBEHFE2FGGHHHHA3F0FGAGEGGHGGGFHHHFBEGC?ECGHGEGHHHGHFFHGHHHFHHHHEFEF//FG?C/BFG@FDCFHHFF1@CC@FGGA
+@1210682/1
+GAATGAACGTTAGCGTCTGCGGCTGGCGCGATGATGGCGCGTTGTCGTAATGCCACAACGCCTGATGCTGCGCATCTGGGGCGCTTTGCTTCTCGCCTTCAGCCTGAATCAGCATCTTATGCGCAAAAAGCCCTTTGCCCTCAAAGACCCG
++
+AB?AAFFFF?FFFFGEGCGGGCCGGGGGGGGGGHGFFHGGEGGGFFGGHHGFFFGCGHDE?EFHFGHDFHGEE?EEBDGFGGGGCGGHHHGHFHCFGGGFHHHHEFFHBGHFGFFHHHHHHHGG@-@HFGGEHHHB0:GGGHHHGFHHHGG
+@437893/2
+ATCATAGACAGCATAACCAGAGGATATCGCAACAATCGGTTAAATGAACTTCTCTCTATACCGCTAACTACGTAGAATACCCATAATAATAAGAGAGGCTATTATGATTGAACGTGAACTGGGGAACTGGAAAGATTTTATCGAGGTCATG
++
+>11>A3F1DF1AC11BGGGE1AFGAFDF00ABEFHBBFEEG?AG2F1A1F1D2BGB122A1FEC//EG1F1AG@GFH2EG111FFBFFFFFDF1F0/?/FG1@BDBE2FGBEGHG///FG1>GCGCCGH0GF<B0D1D1212?C//?0121
+@110472/2
+TGTTATTGCCGCTCCGATTCGCGATGCGCAGGTCGGAGAAATCGCGCTAAAAGAGGCCTGTCAGGCCGTAATTAACGGCCAACCGACGTGGGCACAGGCGCATATAGACGCCTGGAATGCGGTGT
++
+BBBBAFFFFFDBFGFGFGGGGGGGGGGE?FGGFHEGGGGHGHFGCEFFGGFHGGHHGGGGHGHFHGFFEGEGHHFHGGGGCFFFGFGGGFACFBDHHHGFGGGGHFHFHGGGHHFGGHFHGGDFG
+@1555798/2
+GGCCAACACCATGAATGAAGATCTTGTCCTGCCAGTAACCAATAAAGAGGCGGCGCAGAAGTTTGCCGCCAATGTGGAAGATGGCGTTCAGGGTTACGGCATACGCGTTACGTATAGTCAGAAATAGCGTCAGCGTGGTGGCTGACCAGC
++
+>AA1AAAA11ADG1BFG1BAAFD3DBG1B3FE0B1F122B1ABBFFGDFHCEEE/>EEGHFG1@@B1EG@EEFC2BE@>00E11>>EEFFGGE00FGFCC/B1F0E@B/C//??DG11F1<GGFDD1B?CAA.1...<...C..;://.:
+@298772/2
+CTAAACCTGCCGATGCGGCTGACGCTAAAGCCGCAGATGCTGCTAAAAAATAAAAACTGAGAGCCGCCGCTTGTAATAGCGGCGGTTTTTTTTTTTTAGGCGGGGTTATTTCTCACCCTAAATTTGTTTTGGGGTAAAGGCGCGTGCGGTG
++
+CCCBBFFFFFFCGGGGGGGGGGHGGGGGHHHHGGGGGHHHHHHHHHHHHGHHHGGHGHHHHHHHHGGGGGGGGHHHHHHHGGGGG<<?FFGGF@C--./0<-:----.09000000...:90;0:00;B9.::-9.:000.9----.9-.-
+@1438676/1
+GTCTGACATTCCCGAGTAATTTGGTCCACTATTTACTTGAGTAAATTCGTCAGGTATTTAGCGTTCCGTGCGATATTGATGCGGTCACTTGCCTTTATTCTGCTGATCAATAGACGCCAGAATCCCACGCAGAATATTCAACTCCTGGCTT
++
+A1>>AFFFFDBD1AEEFGF33F31AA1BFF033D3D1BGHF1FG2D21ABAFEB1BG2FGH1//E/BEE//AA/BADFH2FB/EE/BF2FGFBF@BEDB@GHH1@1BFFHH211BEECF@FEEFGHHF/E<BCHDDGGDGFFFBF110<0<
+@85204/2
+GTTTGCGTATCCTTTGTATAATAACCTATTGATCAGGCTAATAACCGCAGTCTATATTAGGGCAAGTCTTTTCGGCGCGTTTTGATATACGCGCTCATACGTTTCGGGATGGCATGAAAAGGCGGAGGAATCTGAATACAACGGCACCTA
++
+>>11>D1>A1133BF1FB333B33A11FB3D331A11B0FFB2FBC0E//A11222D2D21B0//AFG222D2///>/>/EE>GFDGFFFH//E/>?D1F0100B?EG@A?/B010<@D1FEAC//<<><<1><BFG1FGFF--@CCG//
+@881760/1
+GGCAGGTACAAATTCCCTGCATAGAGAGAAATGCCATCTCTGCCGTGAAAGCGATAAACGCGGCGACGATGGCGATGAGTCGCGTAAGTGAACCCTGTATCTCGCTCGATGAGATCATTGCTGCGATGTACGAGACCGGTAAAGACATGAG
++
+AA3ABBCFFFFFGGGGFGGGGGHHHHFFGFFHHCFHHHHHHGHHCEEFFFHHGGHGGFHGGGGGGGGFF1FAHGGGGHHHHGGGGGGHHHHHFCDGGFFHFHHHGGHGGGHHHGHHHHHHFHGFGGAE<FGHGGGGGGFGGGHGHHHHHHH
+@274167/2
+GACGCGTTATGAGTTTCTGCTTCTTAAAACCCTGCTGCTGTCGCCGGAGCGCGTGTACTCGCGTCAGCAATTGATGGATATTGTCTGGTCTGATGCCCAGGAGACCTTCGATCGGACGGTCGATACACACATCAAAACCCTGCGCGCTAAG
++
+CCCCCCCCCCFFGGGGGGGGGGHHHHHHHHGGHHHHHHHHHHGHGGGGGGGGGGGGHHHHGGGGGGFHHHHHHGHHHHHHHHHHHHHHHHHHHHHGHHHHGHGHGGHHHHEHHGGGGGGGGGCGHGHHHGGHHHHGHHGGHHHGGGGGGGF
+@837378/2
+GTGATGGAACGCGCGGCGCAAAACATCAGCGGCCCGCTGGTAAGCCGGCAGTTGCTAAGTTAAATTCCGGTCGCTGAGACCTTACAGGCCGGATGGCGGCGCAAGCGCCTTATCCGGTCTACCGTCCTGAGTCATTTTAAAGAATGACAT
++
+ABBBBFFFFFCCGGGGGGGGGGHHHHHHHHGCEGGGGGGGHHHHHHGGGGGHHHGGHEGDGHHGHGHFHGGGGGGGGHHHGHHHGHHHGGGFFGGGHCGGDCCGGHGGGFGGGGGGGACGGGGGGDDGFGF0BBFFFFFFFFFFFFBFFF
+@51129/2
+TTATGGACGTGCTCGGTAAACGCGCCGATATGCGCATTTCCGATCGGGTATTCGGTCACGCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATTA
++
+1A>AA1DFD1AAF1AEFGGG10000A/EE//A2E//EBF2FEGC/EEG//@2D0>FE/1>G>E//>FF010/>/EEEHBGG/</<F>G10F01>1>1FC?@/C0<?<FFHHHC.-A.>=1<A@-:C:00:00:::0:CAE@---;CFGG0
+@404482/2
+GTGCGAATGAACCCACATTACAACAGGAAATTTATTGCGGAAATTGATATATTCACAACGTTATGTTGCGGTTTATGCAACGTCAAAAACCGGAGGTCTGTCTGTGGATTTACGCGATCTAAAAACCTTCCTGCATCTGGCGGAAAGCCG
++
+AABCBABCFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHHGGHHHHHHHHHGGGGGHHHGGHHGHHGGGHHGGGGGGGGHHHHHHHHHHHHHHHHGGGGGGHHHHHHGGHHHHHHHHHHHHHHGGGCFHFFG
+@1303554/1
+CGGCCTGCACCCAGTTCATCACCGAAATTTTGGCTTTTACCGGGTTATCCGGCATCTCCGGACCCGCGGCGAATTTACGGTTAGCGCAGCCGCCGTAACCCGCAGCCCAACCGCCTTTGATGCCGACATTACCGGTAATGGTCGCCAGTAG
++
+BBBBBBAFFFFAGGGGGGGGGGHGGGGHHHHGGHHCGHHHHGGGGGHHHHGGGGGHHHHGCEGGGGEGGGC>EGHHHHGGHGGHHFGGGFHCGGGGGGGHGGGGCGEGHHDDGGGGGHHHHGHHGG??AGGFFGG-BEFFFGGA?D.@B//
+@86037/2
+CATTATGGACGTGCTCGGTAAACGCGCCGATATGCGCATTTCCGATCGGGTATTCGGTCACGCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATT
++
+BBBBBFFFFFDAGGGFGCGGGGHGGGGFGCEGGFHEEFEGHHHDFGGEGGHGGHHHHGGGHCHGGGGGFHHHHGGGGGGHHHGGGGGHHHHHHHHHHHHFDGGGGFHHHHHBGGHG?EDGHEEEGGC?GHHE0GHHHHHHGEF@D?EBFFG
+@335962/2
+CCAGGGCGGCGCGCGCGCTTTCCGCCGCCGCGCGATCGTCATCTAACTGTTGTACAGATACCGCGCCACGCTGCGACAGCGAACGGGAACGCACGTGACGTTTAGAGACGGAGTCCAGCTCAGCTTCCCGCTGTTTGACGACCGACTGCG
++
+BBBBABBBBBBBCECEGGGGGGHGGGGGGGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGGGGGGGHGGGGGGGGGGGGGGGAE?GGFGGGGGGFGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
+@1064500/2
+CTCGTACATCGCAGCAATGATCTCATCGAGCGAGATACAGGGTTCACTTACGCGACTCATCGCCATCGTCGCCGCGTTTATCGCTTTCACGGCAGAGATGGCATTTCTCTCTATGCAGGGAATTTGTACCTGCCCGCCCAGCGGATCGCAG
++
+BBBBABBCFFBBGGGGGGGBGGFHHHHHCGGGFGGGGHHGGGGHHHHHHHHGGGGGGGFHGHGFEGHDHHCFGGCGEFCHHHHGHHGHHHHGGGGGHHGHGGHHGHFHHHHHHHHGEHGGEHHFHGHHHHHGHHHGGGFGGHGGGGGCFEF
+@187401/1
+GTCGTGACATTACAGAAAGGCGGTATTCAATTGGTTATTGAGGTTGAAGGTGATGATAAAGCGCAGGTAGCAAAAGCGAATCAGGCCGGACTGGCGGTACAGGCGCTAAGCCGTTGGCGAGTGGTTTCGTCAGGAAAGGGGGGCATTTTA
++
+AAAA>AFBFFFFGGGBGGGCGGGGGGHHGHHHHHGHHHHHFFHHEHFHHFFCBDFGHHHHGHGGG?FHHFHGHHHHHGFCEGHHHHGGGGGGFGHGGEFFF2F???BCCC2FC/?AGBC<<-.><.F1C0<.<CGHF.GGGGF->FFFFF
+@1498670/2
+CATTTTGTTGTCCATGAGTCGTTTGAATCCGCTGGCGCTTATCTGAAATGGGCTGAAGATCGCGGTTATACCATTTCATGGTCGCGCGTCTATGCCGGAGAAGCGCTACCGCCCAATGCCGATGAGTTCGATATGCTCGTGGTATTTGGCG
++
+AACBBFFFFFFFFGGGFGGGGGGGGGHHHHGGGGGGGGGGFHHHGHHHHHHHHHGHHHHHHHGGGGGGHHHHHHHGHHHGHHHGGGGGGCGHEHHEGGGGGHFEFFGGCHGCD?DEHHHGCCGGHHHHHGGHHGFBFH?AGFCDGHHGEFG
+@74332/2
+GGTGTACTCCGTGATGTTGTGTTGTCGCGCTTATTGTTCGGTTTACAGATTGCTATCTGTGCGAATGAACCCACATTACAACAGGAAATTTATTGCGGAAATTGATATATTCACAACGTTATGTTGCGGTTTATGCAACGTCAAAAACCGG
++
+BCABCFFFFFBAFGGGGGGFGGHHHHGGGGGGGHHHHHHGGGGGHHHHHHHHHHHHHHHHFHGGGGHHHHHGGGGGHHHHHHHHHHHGHHGHHHHHGGCGGHHHHHHHGHHHGHHHGGHHHHHHHHHGGDGGHHHGEFHGHEGGHHEGGGG
+@128166/1
+AGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGACCGAATACCCGATCGGAAATGCGCATATCGGCGCGTTTACCGAGCACGTCCATAATGTGCGTACGCGCTTCACGCAGCA
++
+ABAAABBBBBBBGGGGGGGGGGHHHHHGHGGGGGHHGCGGGGGHHHFFGGGEFHHGGGGGHGHHHGGGGGGGGHGGGGGHHHGEEGGGGGFHHH?CG?DHHG?CFGGCGGHHHGGGGGFFCHGGFHFFFGFHGEGGGGGGGGGGGFGGGGF
+@138785/2
+GCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATTACCTCTTCAACGCTGGCGACCATTGTCGATCTGCCTTTCTTTTTCCTGTTTATGATAGTC
++
+BBCABBBFFFFFGG2EGGGGGGGGGGHHHHHHHHHHHHHGGGGGFGHHEGHHHFGEFFHGHFGGGGGHHHFGHHHGHGHGGGFGGGHGHHHGHHHHHFHHHGGFGGGGFGGGHHHHHGAFGHGHHHHHGHHHHHGHHHHHHHHFGGHGGH
+@66800/2
+CAATGAGCGCTTCACGGCTGTGGGCGCGGTAATCAGACCAGCCCTCGCGTTCAATCCAGCGGTCCTCGCCGTCGGCATCAATGATGACGCTTAACTCCGCCAGCGCCGAAGGATGTGCCGTCGAGTGGGGGGCAATAGCGATAACCGTCC
++
+BBBBBDFFBBBBGGGGGGGGGCGGGGGGGEFGHHHGHHHGHHGGFHGGGGGGHHHHHHHGGGGCEHHGEEGGGGGGGGHHGHHHGHHGGGGGGHHHHHGGGCGGGGGCCGGGGHFHHGFCDGGCGHHGGGGBBBFFFFFBBFFFFFBFF?
+@1542627/2
+GTTGTACGCTACCAGGGCGGTCACAACGCAGGCCATACTCTCGTAATCAACGGTGAAAAAACCGTTCTCCATCTTATTCCATCAGGTATTCTTCGCGAGAATGTAACCAGCATCATCGGTAACGGTGTTGTGCTGTCTCCGGCCGCGCTGA
++
+AAAABFFBABBBGGGGGGGGEAEHGHEGCGGGCGHHFGGFGFGGGFGHHHHGGE?FHHFHFGGGEEHFHHGHHHGGHHHHHHFHGFFHHHFHH4F?FGGGGGFBGHGHHHHHHGHHHFGGHGHGGDCADGHGFGDDDFHHGGGGGDF?CCD
+@1454683/1
+GTCTTTATGTTTATTCCACCAGCTCTGACGTACTCGCAGCACGCTCATCTCCCAGGCGTGTTCACCGCTGGCATAAGGGGTTACGACGCTATCCACGATTTTCGCCAGCCACAGCGTGACAGACTCTTCCGCCAGCCGCGTTGACATTTT
++
+>3>AADDFFFFFGGGGGGGGGGHHHHHHHEFHHHHGCGGGHGGGGGGHHGHHHHHGHGGGGFHFHHGGGGGGGHHHHHHGGGHHGGGGGGGGHHHHGEGHGHHGFGGGGGFHHGHGGGFGHHHGFHHHGHG?FGCGFGGGGGGEGHEHHH
+@714891/1
+GTAATATCATAGACAGCATAACCAGAGGATATCGCAACAATCGGTTAAATGAACTTCTCTCTATACCGCTAACTACGTAGAATACCCATAATAATAAGAGAGGCTATTATGATTGAACGTGAACTGGGGAACTGGAAAGATTTTATCGAAG
++
+BABCCFFFFFFFGGGGGGGGGGHHHHHGHHHHHGGGGGHHHHGGGGGHHHHHHHHHHHHHHHHHHHHGGGGGHHHHGHHHGHHHHHHHHHHHHHHHHHHHHGGGHHHHHHHHHHHHHHHHHHGHHHHHGGGGHHGHHHHHHHHHHHHGHHE
+@854826/1
+GCGCTGTGTCGCTTTTGCGGCGATTTGCACTGCAAAAAGCAGAGAGATTTTTTCGATATTATCGGTTTCAAGCAGTATTTGTTTGAACAAACCGAGATGAGCCATGGCACGGTGCGGGAATATGTCGTGCGTTTACGACGTCTTGGCAA
++
+A?AAADA13B>>ECFFGC0A0AAAGFFDBF1FBDFGFAFAGHCE0BFHFBE1EEEEHGGHGBDGEBAEFHFF1BFBF2@FF20BB>F11EFH/>E/EFGBB<0FFG0A0F?C??/>/</CHGHHFG<?>.->C?F1CE<@<CCFEH/:0
+@568154/1
+GTTTACAGATTGCTATCTGTGCGAATGAACCCACATTACAACAGGAAATTTATTGCGGAAATTGATATATTCACAACGTTATGTTGCGGTTTATGCAACGTCAAAAACCGGAGGTCTGTCTGTGGATTTACGCGATCTAAAAACCTTC
++
+AAABBFFFFFFFGGGGGGFGGGGGGGHHHGFGGGGHHHHHHGHHHHHFHHHHHHHGGGEGEHHHGHHHGHHHHHHHGGHHHGFGFHHGGGGGHHHGHHHCFFGGGHHGGGCGGFFHFHGHHHHHHHGGHHHGGGCGGHHHHHFGFHHH
+@208664/2
+AGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGACCGAATACCCGATCGGAAATGCGCATATCGGCGCGTTTACCGAGCACGTCCATAATGTGCGTACGCGCTTCACGCAGCAGAAAACCGAACAGCA
++
+BBBBAFBFFFFFGGGAAEFGFG42EGGBFA52EFGEGGC?EGG0CGFHHHEAEGGFEGE?EG1F3BEEFGFDGGGGHBEG@EFHB//>/CCB@/FG1AA/A@0-F.F.DFGGD1DF.<A?@AA@@EA0C.:--@A./BBFF?GGGG?B.C
+@227391/2
+GTCACGCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATTACCTCTTCAACGCTGGCGACCATTGTCGATCTGCCTTTCTTTTTCCTGTTTATGAT
++
+BAABBBFBDDCCGGGGGGGGGGGHHGGGGGGHHHHHHHHHHHHHGGGGGGHHHHHHHHHGCGGHHHGGGCEGHHHFFHHFHHFHHGGDGGGHGHHFFHHHHHFFHGGGDGGGGGGGGHHGHGGGGHGHHHHHHGEGHHHGGHHHCGFGBGH
+@159139/1
+GTGTTAATTGGCGAGAGATCCGGGTTGATCGCGCGTAGCTTAGCGCGCAGGGTTTTGATGTGTGTATCGACCGTCCGATCGAAGGTCTCCTGGGCATCAGACCAGACAATATCCATCAATTGCTGACGCGAGTACACGCGCTCCGGCGACA
++
+A>AABFFFFFFFGGGGGGGGGGGGGGGHHHGGGGGGGGGHHHHHGGGGGGGGHHGGHFHHHHHHHHHHGHGGGGGGGGGGGGHGGHHHHHDGHGGHHHHHHHHHHGGHHHHHHHHHHHHHGHHHHHHGGGGGGHHHHGGGGGGGGCGGAGD
+@290303/1
+CATTATGGACGTGCTCGGTAAACGCGCCGATATGCGCATTTCCGATCGGGTATTCGGTCACGCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATT
++
+CCCCCFFFFFCCGGGGGGGGGGHGGGGGGGGGGHHGGGGGHHHGGGGGGGHEHHHHHGGGHGHGGGGGHHHHHGGGGGGHHHGGGGGHHHHHHHHHHHHHGGGGGHHHHHHHHHHGGGFHHHGGGGGGHGHHHHHHHHHHGGGGGGGGGGG
+@1360531/1
+AAGAGAGGCTATTATGATTGAACGTGAACTGGGGAACTGGAAAGATTTTATCGAAGTCATGCTTCGTAAATAAATGCCTGGAAGGCACCGCGCTCCCATAGGGGATAAGAAAAGGCGACTCAACGAAAGTCGCCTTTTTTGTGCCCGACA
++
+ABBABFBBABFFGGGGCGFGGGHHHGHGHGHHHGGGGHGHGHGHHHHHHHHHHHGGGHHHHHHGHGHHHHHFHGFFHHHHEHHHCHHGGGGGGGGGFCHHFHGGGGHHHHHHFGGFEG?CGHGHGGGGG>HGGGGGHHHCCFHFGHGCDC
+@327006/2
+GGCAGATCGACAATGGTCGCCAGCGTTGAAGAGGTAATCATCTCGCGGATCTGCTCTAGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGACCGAATACCCGATCGGAAATG
++
+AABBABFFBBBBGGGGGGGGGGGGGGGGHHHHHHHHHHGHHHHGHGGGGGGHHHHHHHHHHHGGGGGGGHHHGGGGGHHHHHHHHHGGGGGEHHHHGGGGHHFGGGGGGHHHGGGGGHHHHHHGGGGGGGHGGGGGHGHGFGGGGGGGGG
+@332701/1
+ATCATAAACAGGAAAAAGAAAGGCAGATCGACAATGGTCGCCAGCGTTGAAGAGGTAATCATCTCGCGGATCTGCTCTAGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGA
++
+BBBBBFFFFFFBGGGGGGGGGGAGGGGHHHGGGGHHGGHGGGGGGGGGGGHHGHHHHHHHHHHHGHGGGGGGHHHGHHHHHHHGGGGGGGHHHGGGGGHHHHHHHHGGGBFGHGHHHGGGGGHHHGGGGFHHHGGGGGHHHHHHGGGGGG
+@1111112/1
+ATTTATATGGGCGCCAAAGACGTTGAGCGCCAGTCGCCGAACGTCTTCCGTATGCGTCTGATGGGCGCTGAGGTCATCACGGTTCATAGCGGCTCCGCTACGCTAAAAGATGCCTGTAACGAGGCGCTGCGCGACTGGTCCGGTAGTTACG
++
+AAAA?3DFFBF11EE1EGB000B0F0FEE00AAFHCEEE/AEECCGFFDFCGACEFFGECBFGHCFEEEG>GE0B>DGHG?E?EFGHHHHGGGGGEC//@BFCGGFHDGEHGHEFHHFHFAFC?-<@CCC-C@CCC?ABBB@A-99;;BFE
+@486695/1
+TTCCAACACCTTTTATTTTTCACGAAGTTGAGGTTTGAACCCCAAATTCTAGCAAAAATAGGCTTAAAAAGCACCTCAGGGAATAGTCTTAATCCGAAACTATGTCAAGTATTAACGATAACAGGCAGCAATAATGCCAATAAAATGTGGT
++
+BCCCBFFCCCFFGGGGGGGGGGHHGDGGHGHHHHGHGHHHHGGGGHHHHHGHHHHHGHHHHHHHHHHHHHDHHHHHHHHHGGHHHHGHHHHHHHHGGGGGHHHHHHHHHDGHHHHHGGHGGGHHGGEGGHHHHHHHGHHHHHHHHHHHHGG
+@396452/1
+ACGTAGAGCTGCTGGATATCAAACCAGCGCCGAAAGCGGATGCTAAACCTGCCGATGCGGCTGACGCTAAAGCCGCAGATGCTGCTAAAAAATAAAAACTGAGAGCCGCCGCTTGTAATAGCGGCGGTTTTTTTTTTTTAGCCGGATGTAT
++
+CBBCCFBFFFFFGGGGGGGGGGHHGGHHGGGGGGGGHGGFGGHHGHHHHHHGHGGGGGGFGGGHHGCEGGGHHFGGFGGHGHHHHHHGHHHGHHF2?GGHHHHHGGFGGGGGGDGFDGHH1FFGCGC:-.C.CB-:A;-.///.;-.-://
+@486154/2
+GTCAAAACGTGTTCAGCGGACATACTTGTACTCTCCCGGATTGGTCATGGTCGGTCGTCGTGGTAACGAGATCTTCAATTCTGCTGGCCGTGTCGCCGTAAAAATATAAAGCGAAATCTGTGCCAACTTTCACATTGCCCCCAAAAGGCGT
++
+AAB@AFFFBFBFGFGFGGCFGGHHHHHHHHHHHHHHHGGGEGHHHHHHHHHGEFEGAAFEEGGHHHHEF1EFHHHHBGFHFGGHHGEEF/EEHFDFGGGG?EHEGDHGGHHHGC/CGGHHDGGHHHEHHFHGHHHHHHHHGGGGFH0<FDA
+@807577/1
+TCTTAAACCTGATCACCCTGGCGGCCGCGCTGCTGCACACCAAAACCTGGTTTGAACTGGCGCCGAAGGCGGCCAATATCATTGTAAAAGACGAAAAAATGGGGCCAGAGCCAATCATCAAAGGGCTTTGGGTGGTCACTGCGGTAGTCA
++
+BBBBBFFFFFFFGGGGGGGGGGGGGGGGGGGGGHHHHHHHGGGHHHGHHGHHHGHHHHHHHGGGGFGGGHGGGGGHHHHHGGHHHHHHHHGHGGGGGHGHHHHGGGGHHHHHHHHHHHHHHHHHGGHGHGHGCFGGHHHBFGGGGGGGGG
+@567483/2
+GCCTCCAGCAACCGCTCCTGGATTGTCATTGCGCCTCCTCACTCATTTCACCTGCAAACATATCATCCAGTTGGTTAATTAACGCCGCCGCAGGGCGAGTGGTAAAAATACCCTGCTGCGGACGTTCGCTATCCACCCCGCGTAAAAAGAG
++
+ABBBBBFFFFF@GCFGGGGGGFHFFFHHFHHHGGGGGHBHHHGHHHHHHHHHHGHHFGHHHHGFHHHHHGHHHGGHHHHGHHHCGGGGFEEGGG?FGGGGGGFGGHGHHHFHGGHGGHGGG@CCACGAFGGGHHHHFGC?DFCGGHHHGGF
+@1210485/1
+CACTTGGTTTAATGACGATGGTGCAGCCACATACCAGCGCTGCGGCCAGTTTCCAGATAGCAATCATAATTGAGAAATTCCACGGCACAATACCGACGACCACGCCAATGGGTTGGCGTTGGGTAAACGCTGTGTATCTCTCTTCTCCCAT
++
+BABBBFBFCFFFGGGGGGGGEFHHHFGHHHFHGHHHHHGGGGGGFCGGHHHHDGGHHGHGHHFHHHGGHHHHHHHHHHHGHHHGGGGGHHGHHHGGGGGGGGHGGGGGHGFHFFGCHGGGGHGDGHGHCFGGAFGHGHGEHHHHHHHHHHH
+@1428147/1
+GGGCGTAGGGTTCGATCAGCTGCTGGTGGTTGAGCCGCCCTATGATCCTGAGTTGGACTTTCATTACCGCATCTTCAACGCCGACGGCAGTGAAGTCTCGCAGTGCGGCAATGGCGCGCGCTGTTTCGCGCGATTTGTTCGCCTGAAAGGG
++
+AABBC?DDBBCFGGGGGGGGGGHFHHEGGGGEHGGHGGGGGHGHHHHHHHHHHHHHHHHHHHHHHHHHGGGGGHHHHHHGGGGGGGGGGGHHGHGHGHHHGGGGHHGGGGCHGHHGGGGGGGGGGHHDGGGGGGHGGHGGBGGGGFFGFFD
+@931750/2
+GAGTATGAAGGGGATGATGCCGCCAGGCTTCCCGGGTAGATAAATATATCGAGCTACCTTATTTGCCATTTTGACGCCGGAGTGTGCTCGACAAAACACGATAGTGTTTTGAACGCCCTTTAGGGCGGCCCGAAGGGCGAGCGGAGCGAGT
++
+AAAAAFFFFFFBCGGGGGGGGGGGGGHHHHGHHGGGAEFFHHHHHHHHHHG1BEGHHHHHHHHHHHHHHHHHHGHGGGGGGGGGHHHHHGGGGGHEHHHGEHGGHGHHHHHGHHHGGGGGHHHHHGFGGGGGGGFGGEFGGGGGGGGGCG?
+@943387/1
+GCTACTTATTCCTCGATTTTACCGCCAGCAGCTTCGATAGCAGCACGAGCGCCTTTAGTAACACGCAGGCCACGAACAGTTACCGGAGTAGTGACTTCGCCAGCCAGGATCACTTTCGCGAACTCGATCTGGATACCGATAATGTTTGCCG
++
+BCCCCFFFFFFFGGGGGGGGGGHGGGGGGHHHHHHGHHHGHHHHHHGGGGGGGGGHHGHHHHHHGGGGGGEHGGGGGGGGHHHHGGGGGHHHHHHHHHGGGGGGGHHGHHHHHHHHHGGGGGGHHGGGFHHHHHHHHGGGGGHGHHHHHHG
+@530785/1
+TTTCTGCTGCGTGAAGCGCGTACGCACATTATGGACGTGCTCGGTAAACGCGCCGATATGCGCATTTCCGATCGGGTATTCGGTCACGCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCG
++
+CCDCCFFFFFDDGGGGGGGGGGGGGGGGHHHHHHGHFGGHGHGGGHGGHGGGGGGCGGGHHGGGGGHHHGGGGGGGFEHHHHHGGGHGGGGGGGGHHHHGGGGGGHHHGGGGGHHHHHHHHHHHHHGGGGGHHHGGGGFGGGCGGGGGEDD
+@1298194/2
+GCCGAAGACCTCGCGTTGCACGATGGCATCTTCCTGTTTTGCGTCTGCCAGCAACGTCGGAGCGAAATAGTAACCTTTACCTTCCGTTTGACTTCCACCAGTAATCACACGGATATGGCTGAGGGCCTTCGCCTCCTCTACAGCCGCTGTG
++
+BBBBBBBBFFFFGGGEFGGGGG?GFGHFHHGHHHHHHHHHHH?EGDFHHHHGHHHGCEEEGGGGGGGHHHHHGHHHHHHHHHHHFFGHHGHHHHHGHHHHHDGGHHHHHHGGGCFHFEEHGHHGGGGGHHHGGGGHHHHHHHGHHGGGGD<
+@563278/2
+CCAGGAAGCCATCATCGCTGCGGAACGCGCCGGGCTTGCGACCGATACGCGCACTTTCGGCGAAGCATGGGTAAAACGCTTTTCCGCGCCGCTGGTGGTGCGCCATGATAAAGACGGAGCGTGGTATTTTAGCGCGCAATCTTCCGGCGTT
++
+BAABBBFFBFFFGGGGGGGGGGGGGGGGGGGGGGGCGFHGGGGGGGGGGFGGGFFFHGGGGFGGFFHHHHHFHHHHHGGGGGHHHGDGCGGGGGG/CDDEHDCGGGHGHHFHHGGGGGDGCAEG9BF0FGGGGGFFCB;DFBB/:ABDDFF
+@543781/2
+GACAATGGTCGCCAGCGTTGAAGAGGTAATCATCTCGCGGATCTGCTCTAGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGACCGAATACCCGATCGGAAATGCGCATATCG
++
+CCCCCFFFFFCCGGGGGGGGFGHGHHHHHHHHHGHHHGGGGGGHHHHHHHHHHHGGGGGGGHHGGGGGGHHHHHHHHHGGGGGHHHHHGGGGHHHHGGGGGGHHGGGGGHHHHHHGGGGGGGHGDGGGHHHGGGGGGGGGHHHGGGGGGGA
+@323383/1
+GGGAGATACGCTGTTGCCAAATCATCTGGCCTTGTTGCATCAACACGGCGCTGACGCGGCCATTATCACCACCAACAATAGCCGCGCCGAACGCGGTTGCCGGCGCAGATTCGCCGCGCAGCGACAACGAAGGCATATCCAGGTTCACCGT
++
+CCCCCCFFFABCGGGFGGGGGGHHHGHHHHHHHHHHHHGHHHHHHGGGGGGGGGHGGGGGGGHHFHHHHHHHGGHGGHHHHHHGGGGGGGGGGGGGGGGHGGGGGGGGCHHHGGGGGGGGGGGGGGGGGGGGGGFFFFFFBFFBFBFFFF9
+@1391804/2
+CTCTTTTCCTTCCCATCCAGTTGGGATCGGCAGGCGCAATCGTGCTATTTATTACCGCGCTGGTCGCCTGGCCTCTAACATACTGGCCGCATAAGGCGCTGTGTTAGTTTATTCTTTCCTCAAAGACTTCTGCAGGTGAGGGAATTACTGG
++
+AA>ABFFFFFFFGGFGGGGBFGHHGGHGGGFFGGGGGGGGHCBFFFFHHHFHH55F1A0AE?EC50/A1EHFEHGFHHHGFHGFGHCHGFGE?GBEBEE<//232?3BBHFHEGHFHH2>@GHF2FFGFHFBGFGF011FGGDHGH111=1
+@594164/2
+GGAAAAAGAAAGGCAGATCGACAATGGTCGCCAGCGTTGAAGAGGTAATCATCTCGCGGATCTGCTCTAGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGACCGAATACCCG
++
+ABAABFFBB@FFCGGGGGGGGGGGHHHHHGGGGGGGGGGHHGGHHFFHHHHHHHHHGGGGGGHHHHHHHHHHHGGGECGGHHHGGGGGHHHHHHHHHGG@CGEFGHHGGGGHGHHGGGGGHHHGGFGGHHFHFHGFGGGGGHGGCGGHHGB
+@1167264/2
+CATCAACAGGGAACGTCGCTGGCGCTACGGCTATTGCCCGAGCGTTGTCCTGATCTGGCGGAAATCCAGACGCCGCCGATAGTACCCGCACTGCTTGCCAGCGAGAACGGACTGATTCTGGTCACTGGCGCCACTGGCTGCGGGAAATCCA
++
+BBBBBBFFBB@BGFEFGGGGGGFEDEGGFGFGGHHHHGHGGCGEAEGGHHHHHFFFBHHGCECGHHHHGFGGGGFGGG?D/DHHHHHGGGGGHFHHHFFFHGG?CGGHGC?AFEHHHHHGHHHBCGHEECGGGGHGH?F.EFGGGAGGEE0
+@698564/2
+AAAATACCCTGCTGCGGACGTTCGCTATCCACCCCGCGTAAAAAGAGATAGATGACGCCGCCGAAATGGCGTTCATAGTCGTAATTCGCCATGCGATGACGAAGGTAACGATGCAATGCCAGCGTATAAAGCTGGTACTGCAAATCATAG
++
+BBBBBFFFFFFBGGGGGFFCAFGCEEEGHGGHHGEGCCEEGGHHFFHHEFFHFHHHCD@EGGGC@EGFHHCEFGBHHFGHGFHHGFHEDDDGBFDFHGEHGG?DD<FHHGGHEDHHGHFHGFGGEGFCFHHHHHGFGHGEGFFCFGHBGH
+@616682/1
+ATATGCGCATTTCCGATCGGGTATTCGGTCACGCGTTAAGGCTGCGCAACAGCGCTTTTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATTACCTCTTCAACGCTGGCGACCATTGTCGA
++
+CCCCCFCCCCCFGGGFGGGGGFFHHHHHGGGHGHGGGGGHHHHHGGGGGGHHHGGGGGHHHHHHHHHHHHHGGGGGFHHHHHHHHHGGGEHHHGGGGGGHHHHHHGHGHHHHGGGGGGHHHHGHHHHHHHHHGGGGGGGGGGGGGGGGGGC
+@73043/1
+ACGCGGGTTTGATCCGTCGTGAAGATGCGATTGATTTCACGGAAAAAGACTGGGATGACGTCATGAACCTGAACATCAAGAGCGTGTTCTTTATGTCTCAGGCGGCGGCAAAACTTTTTATTGCCCAGGGCAACGGCGGCAAAATTATTAA
++
+CCCCCCCDBCBFGGGGGGGEGGGHFGHGGGHHGGHHHHHHHGGGGHHGGHHHGHHHGHHGGGGHHHHHHHHFHHHHHHHHHGHGFFFHHHHHHHHFGHHBFFHGGGGGGGGHGHHHHHHHHHHHHGHHGGGGGGCDGGGG?GGGGGFGGGG
+@655712/2
+GCAATGCAGTTACCGCCGGAGGTCAACCTGATTGCGGTCGCCCACTATCTGCAGGCGCTGGAATGTCAGCGTGACGCTAACCGCGTGGTGGCGTTGCTGGGCGGTAAATCGCCGCATATCCAGAACCTGGCGGTCGGTGGGGTGGCGAAC
++
+CCCCCFFFFFFFGGGGGGGGGGFHGHHHHHHHHHHCGGGGGGGFFHHGHHHHHHHGGGGGGHHHHHHHHHGGGGGGGGGGHHGGGFGGFGGHGGGGGHHHGHGGGDGFHHGGGGGGGGHHHFHEHGHHGHGGGGGGGA.EGA.@DFACFF
+@1314333/1
+GGTTCAACTCCCGCCAGCTCCACCAAACATTCATTCATGATGCATCATGAACCTTAAAAAAGCCTGTAACTTCAATGAGTTGCAGGCTTTTTTGTTGCATGTGTGGTCATGATCTCTGTATGAATCTTGAGCTTTTGGCACCATGTTTAG
++
+A3>?3DDF@@4AFGCECGC4AGHAGHHHH3ADGFGFGHFHCHFFDBGGHFHFHHFHFHEFCGFGHEGFHFHFHHHHHEHFDHFFFHGHF3DGG/GGCFHFB3GFGEEGFGGGFGFFHHGFFFHGFHEHH4FBFGHHD/GGHEFBG2GB2F
+@604724/2
+GCAAAGCGTCGAAAACCCCGTCCGCATCTTCATTTTCCAGCCCGCCGCGCATCGACTGATAGGTGCCGACGCCAAGGAATACCGCATCGTAATCTTTCAGCAGATCTTCAAGCTGTACATCACGACCCACTTCGGTATTAAGTTTGAACT
++
+CBCBCFFCBACBGGGGGGGGGGGGGGGGHHHHHHHHHGHHGGGGGGGGGGGGGGHGGGHHHHHHHHHGGGGGGGGHGHHHHGHGGGFGGHHGEHHHGHHGHHHEFHHHHHFHHHHHHHHHHGHGGGGCHGHHHGGGHGHHHFCHHHHHHH
+@859198/2
+CAGTGCGGATTCATATTCTCTTTGACCTCAATTTCCCTGGTCAGTTTCCCCATTCGTCCAGAAATGCTCCCTGCGCTCCGCCATGCGCACTAATTGTTCACAAGGCGCGTAACGAGGACCGTAAAGTGCGGCCAGGCGCTGTAATGTCGC
++
+CCCCDFCCDBCFGGGGGGGGGGHGHHHHHHHHHHHHHHHHGHHHGHHHHHHHHHHHHGGGHHHHHHGHHHGHHGGGGGGGGGGGHHGGGGGHHHHHHHHHHHGHHHGGGGGGGGGGGGHHGGHGGHHHHGCGGGHHHGGGGGHHHHFHHH
+@736879/2
+AGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGACCGAATACCCGATCGGAAATGCGCATATCGGCGCGTTTACCGAGCACGTCCATAATGTGCGTACGCGCTTCACGCAGCAGAAAACCGAACAGCA
++
+BCBCAFFFFFFFGGGEEGGGGGHGGGGHHHHGGGGGHHHGGGGGHHHHHHGGGGGGGHGGGGGHHHGGGGGGGGGHHHGGGGFHHGGGCGGGFGHHHGGGGGGGHGGGHHHHHHHHGGGGGGGGGGGHHHHGGGGGGGGGGGGGGGGGGG
+@746960/2
+GCTCTAGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGACCGAATACCCGATCGGAAATGCGCATATCGGCGCGTTTACCGAGCACGTCCATAATGTGCGTACGCGCTTCACG
++
+B@BCCFFFFFCCGGGGGGGGGGGGGHHHHHGHHHGGEGGHHHHHGGGGFHFHGGGGGHGHGGGGGHHHHHHCGGGGGGHGGGGGGHHGGCGGGGGGHHHGGGGGHGGCGGGGGGGHHHGGGGGHGHHGGHHHHHGHGGGGGGGFGGGGGGE
+@472/2
+GATTTATGTTCTGTTGCTTGGCGGCATGGTGTTCCTGTTTTTGCGCCTCCCCACCTCCTTTCTGCCGCAGGAAGATCGGGGCATGTTCACTACGTCTATCCAGCTACCGAGCGGTTCTACGCAACAGCAGACCCTGAAAGTCGTTGAAAAG
++
+CABCCFFFFFFFGGGGGGGGGGGGGGGHHGHHGHHHHHHHHGGGGGGGGGGGHGGHHHHHHHHHHHCGGGGEGHHHHHGGGGGHHHHHHHHHHGHHHGGHHHHHHHHHGGGGGGFFEHHHGGGGGHHHGHHHHHHHHHHHHHGGGHGHGGH
+@512180/2
+CATGACGAAGGTGCAGCCACATACCAGCGCTGCGGCCAGTTTCCAGATAGCAATCATAATTGAGAAATTCCACGGCACAATACCGACGACCACGCCAATGGGTTGGCGTTGGGTAAACGCTGTGTATCTCTCTTCTCCCATTGATGGCAGG
++
+1>>>A1A11>1C11B1EGFGGGHFCCGA0E0E0//EAE/B1FEB2FHHEHHHFHGG2FFHHF11/FHH1F1FHCEE?EBBGFECE?EG?ECEHGGGGEHHE0<?C/F<B/CG?EFHFBCGAC/<<1DFDGGF1DGFG1F0<==0=D0<<AC
+@1035357/2
+CACGAAATGTAGAGCGGATAAGCGCAGCGCCATCCGGCAAAATTACCAGGCGGTATGATACAGTTCGACAATGTCCGCCAGACTCGCTTCACGCGGATTGCCGCCCGTACAGACATCATCGAACGCCGCCTGCGCCAGCGCCGGGATATC
++
+BBBBAABAFFFFGGGGGGGFGGHGGGGGGGGGGHHGGGGGHHHHHHHHHGHGGGGGHGHHHHHGHHGHGGGHHHHHGGGCEHGHHGGGHGHHHHGGGGGHEGGGGGGGGGGGGHHHHHHHHHHHGFGCGGGHHGGGGGGAGGGAAADFFF
+@812922/1
+GGAAAAAGAAAGGCAGATCGACAATGGTCGCCAGCGTTGAAGAGGTAATCATCTCGCGGATCTGCTCTAGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGACCGAATACCCG
++
+CCCBCFFCCFFFGGGGGGGGGGGGHHHHHGGGGGGGGGGHHHHHHHHHHHHHHHHHGGGGGGHHGHHHHHHHHGGGGGGGGHHGFGGGHHHHHHHHHGGGGGHHHHHGGGGHHFHGGGGGHHHGGGGGHHHHHHGGGGGGGHGGGGGHGGD
+@1254695/1
+CTATCCTGTTTGAAAAGCAGGGTATTAAGCCGTTGAAGAAAACGCCTGGCGGCGCGCCGTCAACGTCGGAAGAGGTGCTGGAAGAGCTGGCGCTGGACTATCCGCTGCCGAAAGTGATTTTGGAGTATCGTGGTCTGGCGAAGCTAAAAT
++
+DDDDDFFFFFFFGGGGGGGGGGAAGHHHHHHGGGGHHGFHHHHGGGHHHHGGGGFEGEGEFEGHGGHGGGGGHHGHHHHGHHGHHHGHHGGGGGGGFGHFHHGGGGFGHGGGGGHGHHHHHHGHG0C0DGCHGEHBGEG@DGGGGGFFGF
+@832235/1
+CATTATGGACGTGCTCGGTAAACGCGCCGATATGCGCATTTCCGATCGGGTATTCGGTCACGCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATT
++
+CCCCCFFFFFCCGGGGFGGGGGHGGGGGGGGGGHHGGGGGHHHGGGGGGGHGHHHHHGGGHGHGGGGGHHHHHGGGGGGHHHGGGGGHHHHHHHHHHGHHGGGGGGHHHGHHHHHGGGGHHHGGGGGGHHHHHHHHGHHGGGGFGGAGFGG
+@838122/2
+CGTTACGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGCTCCGCGAGCTGATTACCTCTTCAACGCTGGCGACCATTGTCGATCTGCCTTTCTTTTTCCTGTTTATGATAGTC
++
+1>>>A1>1D111AA0E0CCGGGAEF2ADDFBF1GDFFBA//EAAFHHGFGGGFF@EEGD@/BEEGGEH11BDFH0>BGAA/></?B11DHGEFGH1FG1G/B/<<??C/<<CF11><..FG1=DBGGHHFGFDHHDHH0D00C0:0;;0
+@1327277/1
+ATTACCTCTCGCGCGACCGCCTGTTCTAAGGTTTCGCCGACTTCAACAAACCCGGCCAGCACGGTATGCACGCCGTTGCGGTGGCGAACGTGCCGGGCAAGGAGGATCGAATCCTCACGGCGGATCGCGACGATAATGCAAGGGGCGATTT
++
+BABCBFFFFFCCGGGGGGGGGGHHHGHFGGHGHFHGGGGGGGGHEHHHHHHGGGCFGGHGHHGG?EFHGHHGGGGGGGGGGFDGGGGGGGHHHHGGCCGGGGHHGGHGGGGFGHHHGHHGGGGGGA?EG?GFAFFFFFFFFFEFF=C@-EA
+@849952/1
+ATCATAAACAGGAAAAAGAAAGGCAGATCGACAATGGTCGCCAGCGTTGAAGAGGTAATCATCTCGCGGATCTGCTCTAGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGA
++
+BBBBBFBFFFFBFGGFGGCF4AFGAEFHFHGAEEFFHFHFGGG?CEFGGGHHFHE3FGHBGGHFGFGGFG@EFHGHHFHH4FGG?EGEGCFHFFCGGGHHHHGHFHHGG@DE/G2CCACDGFF11@@ADGFDFCGGGGEH0GGFDFGG?D
+@329389/1
+GAGATAACACCCTTGTTACCGTGGCGACCTGCCATCTTATCACCCGGCTGGATACGGCGTTTAACGGCCAGATAGACCTTCACGATCTTCAGCACGCCCGGCGCCAGATCGTCGCCCTGGGTGATTTTACGGCGCTTCGCTTCAAGTTTTT
++
+AAA?AFFFFCAAGBFAFGGDCFH?EGCECEFCFFGFBGDFFHHHHEGEGCEAGFHG?/?EGGGGHCEGGGHH1F11FGGDB1FHGFHHEFHHHHG@EEC/@C/>BEGGBBG0</AECCFAF0<FGHHH0<<EGCC@CF-EFE?BBB09BFF
+@1543270/2
+ATGTAATAACGCCTATATTTTCCCCGGCATCGGTCTGGGGGTTATCGCTTCCGGCGCATCGCGCATTACTGATGAAATGCTGATGTCAGCCAGTGAGACGCTGGCGAAACATTCTCCGCTGGTCAATAACGGCGAAGGATTAGTGTTGCCA
++
+BCCBBFFFFFDCGGGGGGGGGGGHHGGGGGHGGFGGHHHGGGGHHHHGHHGHGGGGGGGGGGFGGGGHHHHHGHHHHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGHHHHHHGGGGGGHHHHHHHHGGGGGGGGHHHHHGGGGGGGG
+@938144/2
+TACATAAAGTGTACAGTAAAAACAGGATCTGCTGCGAGGCCAGACGTCGCAGTAATACTTTTTGCGCCACGCCATAGCTCACCCACACCATCGCCGCGCCTACGCCAAAAATAACGCCCCAGGTGTAGTCGGTCAGTCGGGTAAAAATCT
++
+CCCCCFFFFFFFGGGGGGGGGGGHHHHHHHHHHHHGGGGGGHHHGGGGGGG1BBGHHHHHHHH?HFGGGGGGGGGHHHHHHHHHGGGGGHHHGGGGGGGGGGHGGGGGHHHHHHHGGGGGGGGFHGFHHHGGGGDHHHGGG<DHHHGHHH
+@433662/2
+GTCATACAGCGGCGTTGACGGCCAGGTCTGATCAACCAGTTCGCTGCCTTCATCGCTGGCGATCAGGAATCCGCCGGGAGCGGGGCTATTCAGCGACTGGGCGGCACGCGCGGTCTCGCGAGAAATAAACGGCGCCGTTGAGGTCGTGAC
++
+BBBBCFFFFFCCGGGGGGGGGGGGHGBFHHCFHHGHGGHHHHGGGGGGHHHHHHHGHCFFGGGGFFHFHHHHGGGGGGGGGFDCG@DFHHHHHHF-@?AFHHGGGDGGGGGG?EGFFGGGFF@DFFFFFFFFFAAFAFF?FFFFFF;.BE
+@1449297/1
+GGCTTATAGTAGTGAAAATAATCTATACGTCAATGGCGTATAGCATCATCGTTTCACAGTACAAAAATTAAAAACCCAGCGCCAACCGCATTCCATTTTTTGCGAACCTCTATCCAGAATCATCATCCCCTCGTTTCACCACTTTCCATC
++
+ABBCBFFFFFFFGGGGGGGGGGHHGHHHHDGFGHGGHGGGGHFCFHGHHHHHHGHHHHHHHHHHHGHHHHHHHHGGGGHGEGGGGGGGGGGGHHGHHHHHGGHGGGGGFHHHHFHHBFHHHHHHHHHHEGFGGHGGHHHHGHHGHHBGHH
+@100421/2
+CCACTTTGGTATTCAGCGATTCCGCCATGCGTAAAATATCCGCGCTGGTCATTTTGTCCGTAATACCGCGCGGGTTTTCACCGTAAGAACCGAGCGCGACATCAATTTGATGTTCGTTGCCGTGTTTCGCGTAGTAGTTGGAATAGTGAGA
++
+?AAABFFFFBFDFGGGGGAGGFHCDEGGFHGEG?HHHHFDGEEEGGGCCBFFHBGHGBGGHHEFHFHGGGCGGG?FGGHHHHGHHGHHHHGGFCFGCCFGCGHGHFHHHHFHHHG?GGHCFCA-FC/0EFGGGCEFHGFGHFGHHFHHHGF
+@77985/2
+GGATAAAGGTTAAACGGGCTGACTCGCTTCTTTAACAAAAATGGCCCTTTTAAGTTGTAGAAATGTAAATTTATTGTCAACGAACTACACTTTTCTCTTTGGCATCACCGGGAGGGTTGCCTGAAAATACCGGGATGAGGTTTTCTTAGAA
++
+AB@AAF5DFFFFGGGGG2E?EACGFFF22AEFFGCGCG2E2EFHEHEGHH35BFDAGFHB555ABGHD5FGFEG5GFHF5BEFFEEGH3BFDFD44GHHFFFHFBEGGBEGGEE?EA0/0D3BB?F?32B2?/@C/FBF22GHGB?GBGDF
+@190917/1
+GATATAAGATTCCAGGTTGCCAACAGGGGCTAAAGCTAAATTTTGCATTTCTTTGGTCATTCAAATCCTCTCAATCAGTATTGCCTGGCACCGTCAGCGAGCAACAACCGTGCCAAAGCCGATGAGCAACGAGAATATCACCCACTCTTTT
++
+BABBCFFFBFFFGGGGFGGGGGHGGHHCGGGHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHGHHHHHHHHHHHHHGHHHHHHHHHHHGHHHGGHGGGHGGGGGHHHHHGGFHGHHHHHHGGGGGHHHHHHGGGGGHHHGHHGHGGHHHHHH
+@785191/2
+TAATTAACCACATTGTTGCGAGGGATACTATGACGAATCTACATCGTCTGAAAACACTCCTGCTTGCCGGTATTGTCGCGATACTCGCGCTATCGCCAGCCTATGCAAAAGAGAAATTTAAAGTCATCACCACGTTTACCGTTATTGCCGA
++
+CCCCCFFFFFBBGGGGGGGGFGGGGHHHHHHHHHGGGHGHHHHHHGHHHGGHHHGHGHHHHHGHGHHHGGGGGHHHHCHGGGGGHHGGGGGGGHGGGGGEGHHHHHHHHFHGHGHHHHHHHHHGHHHHHHHHHGHHHHHHGFDGHHHHHGC
+@1069077/2
+GTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATTACCTCTTCAACGCCGGCGACCATTGCCGATCTGCCTTTCTTTTTCCTGTTTATGATAGTC
++
+BA@AABB4442AAEEGAGA?EF?EF5D3C2B3EFHFGGC?0EBGFHHF5DBGAEEEHHF110/>EFG333B33FDHGFEE/<EEDBB4433333BBDD1CC/>><//<@-1=F1GC?@D.DD0DFG<CCGHG/GHCCG00000000:0
+@1077304/1
+CGACAATGGTCGCCAGCGTTGAAGAGGTAATCATCTCGCGGATCTGCTCTAGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGACCGAATACCCGATCGGAAATGCGCATAT
++
+BCCCCCFFFFFBGGGGGGGGGGHHHHHHHFHHHHHHHHGCEFGGFGHHHHHHFGHGGGGGGGGHHGGGGGHHHHHHHHHGGEFFHHHHHGGGGHHFHFCGFCGHHGGGGGHEHHHHGGGCFGGHGGGGGHEHDCFGGGFGDH0GDGGGGF
+@1237373/2
+GGGATCACCACTTTGGTATTCAGCGATTCCGCCATGCGTAAAATATCCGCGCTGGTCATTTTGTCCGTAATACCGCGCGGGTTTTCACCGTAAGAACCGAGCGCGACATCAATTTGATGTTCGTTGCCGTGTTTCGCGTAGTAGTTGGAAT
++
+BCCCCCFFFFCFGGGGGGGGGGHHGCHHHHHGGGGHHGGGGHHHHHHHGGGGGGGHHHHHHHHHHHGHHGGHHHGGGGGGGGFGGHHHHGHHGHHHHHGGGGGGGGGGGHHHHHHHHHFHHHCDHHGHGDGHHHHGGGGGGEGHGGHHGFG
+@1110614/1
+GGTATTCGGTCACGCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATTACCTCTTCAACGCTGGCGACCATTGTCGATCTGCCTTTCTTTTTC
++
+CCBBCFFFFBCCGGGGGGGGGGHHHGGGGGGHHHGGGGGHHHHHHHHHHHHHGGGGGHHHHHHHHHHGGGGHHHGGGGGGHHHHHHHHHGHHGGGGGGGHHHHHHHHHGHHHHHGGGGGGGGCGGHHHHHGGGHHHHHHHHHHHHHHF
+@1536952/2
+CTCTGCTATACTCGCAGGCCTTTTCAGACCTGCGAGCAAGGAGCATGTTGTGGCCAGGGCCATGGATAATGCAATTTTAGAGACGATTTTACAGCGCGTTCGCCCCCTCATTGGCCAGGGCAAAGTCGCTGACTATATTCCGGCATTAGCG
++
+BBBB@FFFFFFFGGGGGGGGGGHGHHHHHHGHHGGGGGHGEFHH1GHHHHHGGHHFGEGEGFHHHHHHHBGHGHHHHHHGHHHHGGGHGHHHHHHGGGGGG?EFGGGGGHHHHHHHHGHGGGGH2FFGGGCDHGGBFHHHFHGGGCGHBHC
+@503463/2
+CAAGGAGCATGTTGTGGCCAGGGCCATGGATAATGCAATTTTAGAGACGATTTTACAGCGCGTTCGCCCCCTCATTGGCCAGGGCAAAGTCGCTGACTATATTCCGGCATTAGCGTCCGTCGAGGGTTCAAAGCTGGGAATAGCGATTTGT
++
+BABBC@BCCFFFGGGGGGGGGGGGGGHHHGHHHHHGHGHHHHHHHHHHGFGHGGHGHGHGGGGGGGGGGGGCGHHGHHHHFFHCGGGHHFHGGGGFHGHHGHHHHHGGGGHHHGGFGGGHHGGGGGDGHHHDFHHEHGHHHHHGC?GHGH=
+@1493720/1
+CGTGGTACACAATCAAGGCAGCGAAAGCTGCCTTTTTTAATTCCGGAGCCTGTGTAATGAAAGAAATCACCGTCACTGAACCTGCCTTTGTCACCCGCTTTTCCTGTTCTGGCTCGGCCTGTCGCGACCACTGTTGTAAGGGCTGGAAAAT
++
+AABA34D5@DFAFGE4F44BEAEECEAC3BCCGHFFGCGHHB5AC01ECEFFHFHHF55GBFGFFFBF3@FE1AFGDGGG31BGFCGGHH4@GFGC>/E/FF4EGHFHEHHEBF3<EED/?11?FCCGD/FCG1FGHGGFGEFGGG01<FD
+@1208717/2
+TGGTGGGATAGGGATGCGGTCCTGCCGCCGTGCCGAGCATATAGTGCGCGGTTTCGTAACTACCGGACCAGTCGCGCAGCGCCTCGTTACAGGCATCTTTTAGCGTAGCGGAGCCGCTATGAAC
++
+BB@AAAD@BCFFGGFGGCEEAEHHHHGEGGGCGGCAEEEHGFEHHHHGGCG101FEHGHGHHGHGG//>FGFGGGGFFGGGGGGGGHGHGHFHGAGHHHHFHFHGGGCFGG?CCEGG?CGHHHF
+@1168858/2
+GCGCATTTCCGATCGGGTATTCGGTCACGCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATTACCTCTTCAACGCTGGCGACCATTGTCGAT
++
+BBBBABBFFFBBGGGGFGGGGGHHGGGHGHGGGGGGHHHGGGGGGGHHHGGGGGHHHHHHHHHHHHHGGGCGGGHHHHHHHHGGGGHGHGGG/DGFHHHGHHHHHHHHGG?CDGHHHHHGHHHHHHGHHGGGAGGGGGGGHHGHHDEG
+@1175198/2
+GGCAATAATCGCCAGGACTATCATAAACAGGAAAAAGAAAGGCAGATCGACAATGGTCGCCAGCGTTGAAGAGGTAATCATCTCGCGGATCTGCTCTAGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTG
++
+AAAA3FDFBFB?C?EGGGCGGGFH5DDFHFHFCFC2EFHB3GGHGGHHHGGGGBD3DDAEGFGGGDEEGFEHHH3BDG4GHDFGCFE>E@EFBDEG4GFEGHGCG/<CFHGHGGGGGHHFFHCH1C@@CCCGBF<GCGDF0CDBA@EGADD
+@1188516/2
+GATATGCGCATTTCCGATCGGGTATTCGGTCACGCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATTACCTCTTCACCGCTGGCGACCATTGTCG
++
+A3AABFFBBBABGGEEFGGGGC2ABFDGHFDAFGHGAEEFFGGFFAEE?GGHEGEGFEGEHEHFFGCGHHGHG?EEGFGHGFHH4GCF@EEBHFGGGC/<GHHGFH10GDGG<<@-<->F1GF0DG0D0DGF00<@--:.@DCD?B09BB9
+@1192912/1
+CATTATGGACGTGCTCGGTAAACGCGCCGATATGCGCATTTCCGATCGGGTATTCGGTCACGCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGATGATT
++
+BABBAFFFFFDCGGGGGGGGGGHGGGGGGGGGGHGGGGGGHGHGGGGGGGEEHHGHFEEGHGHGGGGGHGGHFGGGGGGHHHGGGGGGHFHHHHHHHHHHGGGGGGHHHGHHHHHGGGGHHEEGGGGGHGHEHHFHHFHHGFGGGFCCCFG
+@722226/1
+ATTATGCGATGTCTTCTATGTTACCGTCAATAAGCCCGGAACTGGCCCGTATCGCTCCCGGCTTTCGTGCATTAAGTATTAATGTTATTGCCGCTCCGATTCGCGATGCGCAGGTCGGAGAAATCGCGCTAAAAGAGGCCTGTCAGGCCGT
++
+AAAAAFFAAAA1EGGFBE3GEGHGEEF0EEA3BB110EAEEEFD0EGEEE?GAECAFAA/>@@EG1EHGGFHHGFBF2FFGHHHEFBHHF1FGEG/EEEE/FF</@<ECGCCC/<1<B/<>GGB1//>-CCGEF<CCCCEH.0/DBCCEC-
+@488688/1
+GTAGTGAAGTGCTGCGCCACCAGCATCCGGGGATGAGCTTTGGCGCGCGCCTGCCGGAAAACATTACGCCGGAATTCGTGCGTGATGAAGTCGCCGCGGGCCGCGCGATTATTCCCGCCAACATCAACCACCCGGAATCGGAGCCGATGAT
++
+A>AA>FFFFFFFGGGGGEE24A4AGAA4AEAE?EEFEFHHHHHFGGGGGGCGHEFEF@/EFH1GFBHFEGGGC?FBEFHGFGFGAHFFHHBGGGG@CC<DDC?CCC@DCFFFF0;BABG@BE?FBFFG.EFFDB?=-./;DF--EBB?A9B
+@252321/1
+AGGTGCAGCAGGTCGCCTGCCTGGATAATCGTCCCCGGCGACGGCACCATCAGCGTGTCATCGCGTTTCAGGCGTGAGCAAATGATTTTATCGCTGTTCAGGATCGGCACATCCTGGATAGCCATATTATTGAGGTTCGGATTCTCGACA
++
+CCCCCFFFFFFCGGGGGGGGGGHHHHHHHHGHHGGHGGGGGGGGGGGGHHHHHHGGGGHHHHHGGGGGHHHHHGGGGGHHFHHHHHHHHHHHHGHGGHHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHFGHGGGGGHHHGHGG
+@368168/1
+GCCTGAGCTTTACCCCTGGCGCGATCGCGGACATATTGAATCACTGTGTGCGTCATGGTCGCTACCGGATAATGATGCGCTTACATGGCAATTTTCTGTGTTGTTTGAAGGCCAGGGAAAGATGCCCGTCCCGCCCTGGGGATCGGTCTAT
++
+CCDCDFFFFFFFGGGGGGGGGGGGGGGGGGGGGHHHHHHHHHHHHHGHHHHGGGGHHHHHGGGGGHGGGGGHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGHHHHHHHHHGGGGGGGGGGHHGGFGGGGGGGHH
+@443513/1
+CTCCGGATCAAATCTCCCGCCAGCGTGCTCTGGAACTGCTGAAGCCGCTGCTGGAAGATGAAAAAGTGCGCAAAGTGGGGCAAAACCTCAAGTACGATCGCGGCGTCTTGCAAAATTACGGTATTGAGCTGCGCGGTATCGCCTTCGATA
++
+AAA?A3AADFFFGGGBEGEEGGGCAEEGGFHCFCFHFHHFHHHBGFGGGGGHHHFHHGHHHFHFHGFHFCGGGGHBG31EE>FHGHGHGHGGEGHDGHHGCECDCGGGGHHHFGGHHHFGGHEAFHHHHHEFGGGGADEH?DGFGFHHEG
+@581374/2
+CGTCATAAGCGATAGAGTTGACGTGCGCCCAGTTACGACCGGCACCAACGCCAAGCGCATCGCCATACGGCGTATCCGGTTCGAGTTTCGCCTGCTGTCCGGCATGGGCCAGATCGACGTTCACGCATACTGCGCCCGCATCCAGCGCGC
++
+BCCCBFFFFFCBGGGGGGGGGGGGGHGGGGGHHGHHGGGGGGGGGGHHGGGGGGHGGGGGGGGGGGGHHGGGGGGHHGGGGGGHHHGHHGGGGHHHHHHHGGGGGHHHHHGHHHHHGGGGGHHHHHGGGHHHHGGGGGGGGGGGBFGGGG
+@53859/2
+TTGATATACAGCGCATCCGCACGCGGCGTGTAGATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGAT
++
+CCCCCFFFFFFFGGGGGGGGGGGGGGGCEFEHHGGHHFFGHFHHGGGGGFG?FEGHHHHGGGGGGGGGDGDHFGGGGGGGDGHHHGGGGGGHHFGGEGGGGGGGGGGG-@DFFFFEFFFFBF?BFFFFFFFFFFFBBDFFFFFFFBF?AE
+@1361142/1
+AGGCAATGCAGGGGCGCTGGCGCCGATAGCGCGCAGCGCGCTAACCCGATGTCCCGCTGAAACTAACTGAATCATCAGGATGATACCGCCGGCCAGAATAGCGTTGCCGATAAGCCCGGAAAACGTCGAGGCGGCAGAGGCGCGCAACAGG
++
+BABCCFFFFFFFCEGEGGGGEGGGGGGGGHGGGGGGGGGGGGGGHGFFGGGHHHHGGGGGHHHHHHHHHHGHHGHHHHHHHHHHHHHGGGGGGGGHHHHHGHCDGGGHGGGGGHHHGCGGGGGFGAEGGDGGFFFFFFFFFADFFFFFFFF
+@1342751/2
+ACGCACATTATGGACGTGCTCGGTAAACGCGCCGATATGCGCATTTCCGATCGGGTATTCGGTCACGCGTTAAGGCTGCGCAACAGCGCTATTCCCCTTTCCACCGGCAGTTTTATCTCGCAGTTACGCGAACTAGAGCAGATCCGCGAGA
++
+BBBBBBBFBDFFFFG22EGFGEGGFFHFGGGGGGGEEGGFFGGGGHHHGFDGCFCFEFHHHHFECHCHGEGGCHHFEFGGGGGDGHGG?CGGFHHEHHAHBHGGHFDCDGFFFFF11GHAFGEDHGFC.CCCDEFFFFEFFGFFFGEGG@?
+@1521360/1
+CAAAAAAGGCGACTTTCGTTGAGTCGCCTTTTCTTATCCCCTATGGGAGCGCGGTGCCTTCCAGGCATTTATTTACGAAGCATGACTTCGATAAAATCTTTCCAGTTCCCCAGTTCACGTTCAATCATAATAGCCTCTCTTATTATTATGG
++
+BBBBBABABBBDEGGGGGGGFGFGHGCGGDHHHHGHHHGGGHGFHFHHFGEGGGEFGFFHHHHGHHGHHHEHHHHHGGHGGHHHHFHHHGGGHGHHHHGHHHHHHHFHHHHHGHHHHHHG0FGHHGHHFHHHGFFHH2GFFFHHHHHHHGG
+@1207259/2
+GGCTAAAGCTAAATTTTGCATTTCTTTGGTCATTCAAATCCTCTCAATCAGTATTGCCTGGCACCGTCAGCGAGCAACAACCGTGCCAAAGCCGATGAGCAACGAGAATATCACCCACTCTTTTATCAGACAGTGATTTTATCCACAAGTT
++
+DDDDDFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHIHHGHHHGGHGGGHGGGGGHHHHHGGGHGHHGHHHHGGGGHHHHHHGGGGGHGHHHHHHGGHHHHHHGHHHHFHHHGHHHHHHHHHHHHHHHFH
+@135316/1
+CTCCATGAGTTCATTCCGGACGCCAATTTATTACCGGTAAGAAAAGCGAACTCACCTAATTTAACGGTCTGGTGACCAGAACCGACCGCACGCAAAAGCTTCTGAACCGATGAGGATGCTATGGGAAACACAACAATACAAACACAGAGTT
++
+CDDCCFFFFFFFGGGGGGGGGGGGGGHHHHHHHHHGGGGGHHHHHHHGGGGHHHHHHGHHHHGHHGGGGGHHHHHHHHHHHHGGGGGGGGGGGGGGHGHHHHHHHHHGGGGGHHHHHHHHHHHHGHFGHHHHGGHHHGHHHHHHHGHGHFH
+@252595/1
+ACCATCACCTTACGCCCGGATTTCTCCAGTTCGGTAAAGAAGGCGTCCAGTTCATCGAACAGTTTCTGCGCGCGGATTTTATAATCCGCCGTTTTGCTGACGCCGGGGAAGTGGTTGCCATCGTGCAGCGGCAGCAGGTTAAAGAAAGTCG
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHGGGHGHHHHHHHGGGGGHHHHHHHHHHHGHHHHHHHHGGGGGGGGGHHHHHHHHHGGGGGGHGHHHHHHGGGGGGGGGGHHHHGGHHHHHGHHGHHHGGGGGGHHHHHHHHHHGGGGGG
+@330590/2
+TGCCAGCGTAGCCGCATCGGTAATCGTGATAAGTCCGCTCGCCTGATCCAGACGGGCGCAAATATCTTTAAAGTTAAAGGTATGCGGACCCATCAGTACCGGAATCGCATGAGCGGCGGCCTCCAGCGGGTTATGACCGCCGCGTTCAAC
++
+3AAABBADBBBBGGGGGGGGEAFHHGCGFFGFF5GHGGGGGGGGHEHHHGHGGGGGGGGGGGGGHHHHHGHHHFHFHHHHHFGFFGGGGGGHHHHHFGHGGGGGGGFFGGGHHHGCGCADGGHHHHHCGGAEEGGGGFGBB?GB=;EFFF
+@1489689/2
+GATCTGCTCTAGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGACCGAATACCCGATCGGAAATGCGCATATCGGCGCGTTTACCGAGCACGTCCATAATGTGCGTACGCG
++
+BBCCDFFFFFFFGGGGGGGGGGHHGGEGGGHGHHHHHHHGGEEGHHHHHGGGGHGGHGGGGGHHHGGGGGHHHHHHGGGGGGGHGGGGGHGHGGGGCFFGFHHHGGGGGHHGCDCGGGGGHHHGGGGGHGHHGGHHHHHFFGGGGGGGG
+@1507069/1
+ATCATAAACAGGAAAAAGAAAGGCAGATCGACAATGGTCGCCAGCGTTGAAGAGGTAATCATCTCGCGGATCTGCTCTAGTTCGCGTAACTGCGAGATAAAACTGCCGGTGGAAAGGGGAATAGCGCTGTTGCGCAGCCTTAACGCGTGA
++
+>AAAAFFFFFFAGGGGGE2FGGHHHGGHHHGGGGGGHHHGGGGGGGGGGHHHHGHAFGHHHHHHHHGGGGGGHHHHHHHHHHHGGFGGGGHHHGEGGGHHHHHHHHHGGGGGGFFHGCCGDEHGHGGGGGHHHGGGGGHHHHGHGGGC:C
+@166300/2
+GATCATGATTAGTCGTGCTCAAAGCGGGCCCCCACTCTACAAGTTGCAAAATTTGTTACGGGTAACTGTTATCGGTAACATTGTCCAACCGCACCATTCACGACGCAATGACCATTCGTGCCAAAAGTGAATAAGTGTGAGCTACTTCAAA
++
+A?AAAFFFFFBFGGGGGFAGBCGHHGGGC?FEFGGHHFGHHCH5FGHHHFGFHFFFHBBF??E0FFFH5DEEFEF1?FFGHHFHHFFH@EGCCGEGFHHFFFECFFGDAGBDGFHFBFG//?GBGGHFBFHH1?11@<1111??C1=1>11
+@576536/1
+CTTCACGTATGGCTCCAGTTTTATCAACTTTAACCTGCCGCAGTTCTACCAGATAGTGAAAACCGATGGCCGCGCACAGGTGATCCCATTCCGTACGCAGCCTATCAACACCGTGCCGCCAGCAAACCAGGATCATGACGCGCCGCTATTG
++
+BBBBBFBFFFFFGGGGFGFGGGHHFHHHHHHHHHHHHHHGGCGGHHHHHHGHHHHHHHGGFEHGECGAEHEEGGGGGGHHHHHHHHGHHHHHHHHGGGGCGHHHHHHFHGGGGHHGEGGGGGGHGHHGHHGHHGGHHHHDGCGGGC@CD0;
+@948817/2
+GTCGTGAATGGTGCGGTTGGACAATGTTACCGATAACAGTTACCCGTAACAGATTTTGCAACTTGTAGAGTGGGGGCCCGCTTTGAGCACGACTAATCATGATCACCACGTTTACGTTCTGATGGGCGTATCAGGCAGCGGTAAATCCG
++
+AAABA?F?FBF@AGEGGGGGGGGG4FGHGFFGGCGGHGHHHHHHHGFEGGH3B5GGHHGHGGHHGFGDFGFHAG?ECCEEGGGGHHAGGHCFCFCHHGHHFHHHHGHFFGHHHGFGHHHGBGHGHEFCCGFHGGFHHG?-<CEEHHDHD
+@83500/1
+ATGCGTCAGGTACCGCAGGCGCAGCATATTTCGCTGACCAACTTCCTGGATAGCGGCCTGTACACCAGCCTGACCGAACGTCTGGTTGCCGCACAGCGCCACAATACTAATGAAGAGAAAGTACGCGACCATCTGAAAGACAGCTTTGAGG
++
+BBBBBBBBBF@FGGGGGGGGGGGGGHHHHHHHHGGGGHHHHGHHHHHHGHHHHGGGGGGEFHHHHHHHGGHHHHHGGGGGHHHGHHFGGHGGGGGHHGGGGGHGHHHHHHHHHHHHHHHHHHHHGGGGGGGHHHHHGHHHHHHHHHHHHGH
+@399397/1
+CCTCCATTACCTCTCGCGCGACCGCCTGTTCTAAGGTTTCGCCGACTTCAACAAACCCGGCCAGCACGGTATGCACGCCGTTGCGGTGGCGAACGTGCCGGGCAAGGAGGATCGAATCCTCACGGCGGATCGCGACGATAATGCAAGGGG
++
+BBBBBFFFFFFFGGCGG2EEEGGCGGGHHHHHHGHHHBHHGGGGGGGGHGFHHHHHGCGGGCGEEHHGGGGGHHHHGGGGGGGGGGGCDHGGGCDAGHHGGFFGGGGHGDFHHGDBHDHFHHFHGCGG@DAA.??-@;EEFFFEBFBE.@
+@207124/2
+TTGTGTTGACTGCGGTATAGAGGGGAGCAGGCGACTTTTTGGCGTCCAGTCCTCGCCTTGTAGTCCGTTACCCCGGCTGATAGCCCTGGCCAGTTTACCGTTTTGATAAACCAGTGTTACCGCTACGCCATCCACTTTTGGTTGTACCCCA
++
+AAA1>>B13BFB1111AAD331BEE?0E00G0/E/A/D1GE/FAA/A/1DA1A1EE//EFFG22B2EFFEA1BF///>E0>F211BFGHAF1/1BF2><C/CBC0?2F21<0??@12@22</<>@@GGCCAGFF11<>11-.<..==<0.<
+@953049/1
+CCCTGATATAGACTGCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTGGATCACACTAATTATGTTTGGTGTGCTGGAATGATGTACTGAGTACTGCGAAGAATGGGGGATAAACAAAACGCCCACAT
++
+AABBBFFFFFFFFGGGGGAFEGHHHHHHHFHHHBGHHFFGGHHHHHEHHHBBAGHGFFGGGHFHGGHHFGGFFHGFHHHHGHGHHHHHHHHGEEHGEHHHFHHHFGH4GHHFGHHFGHHGGGGGGHHHFFGGFGHGHHHE?FHCDGCGGGH
+@782469/2
+GTTATACAGACAGTTCAGTTGCAACTGATGCAACTGGCTTTCCGTTTGCAGTTCGGCAAAACGCGCCTGGTAAACTTCCTGCTCCGCATTAAGCACGTCGAGCAGCGGGCGGGAACCGAGGTCAAGGTATTGCTGCTGATACAGTTCGCG
++
+AABCBFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHGHHHGHHHHHHGGGGGHHHGGGGGGHGHGHHHHHHHHHHHHHGGGGGHHHHHHGHHGGGGGHHFGGGGGGGGGGGFGGGHGHHHCHHHHHHHHHGHHHHHHHHHGGG
+@187864/1
+GAAAGGCGGTATTCAATTGGTTATTGAGGTTGAAGGTGATGATAAAGCGCAGGTAGCAAAAGCGAATCAGGCCGGACTGGCGGTACAGGCGCTAAGCCGTTGGCGAGTGGTTTCGTCAGGAAAGGGGGGCATTTTACTGTCGTTTACCAAT
++
+AAAAB@ABBBBAGFFGGGGGGGGHHHGHHHHHHHHHBGFHGGHHHEGFGGFEGGHHHHHHFGFGFEGGHHGHGGCEFCHGHGF>E/?EEE?E/@A2B2/<?/C2C/@/?C<FG1AGDHGGBGGAGGGGFAFBFFFFFF/9:E9AEEFFFF/
+@1510056/1
+GACGACTACCATCACCTTACGCCCGGATTTCTCCAGTTCGGTAAAGAAGGCGTCCAGTTCATCGAACAGTTTCTGCGCGCGGATTTTATAATCCGCCGTTTTGCTGACGCCGGGGAAGTGGTTGCCATCGTGCAGCGGCAGCAGGTTAAAG
++
+AAAB3DABFFFFGGGGGGGGCGGGGG?FEHGFGFHHHHHGGGDGHHHHGFGFFGGGHHHHHHHHFGHGHHHHHHHHGGFGFG/EEGFHHHHHHHGGGGGFHGGHHFHHGGGGGC?CDFHBFDFGHHHGHGHHGHHHGGCCGDGGEFBBBFF
+@1013189/2
+CATTATGGCCTGCCGGCCCATCGTCTCCCTCAACCGCCAGGAAGCCATCATCGCTGCGGAACGCGCCGGGCTTGCGACCGATACGCGCACTTTCGGCGAAGCATGGGTAAAACGCTTTTCCGCGCCGCTGGTGGTGCGCCATGATAAAGA
++
+BBBBBFFFAFFAFGGGGGGGGCGHFHHGHHHFFHGGGGGC1EFFCGHHHHFDCEEFGGFC/EEFFGGGCGGGHGEEFFCGGGGGEDGGCGGBHFGGGGCFFFHGFHHHGHHFHGGGG.CGFGGG?@-@D;DFFBDEFCF.DEB/FFFBFF
+@703954/2
+GTAGTTCAGTTGGTTAGAATACCTGCCTGTCACGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGCCACCCTAATTAGGGGCGTAGTTCAATTGGTAGAGCACCGGTCTCCAAAACCGGGTGTTGGGAGTTCGAGTCTCTCCGCCC
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHGHGGGGGGFFGGGGGGGHGHHHHHHGHGGGHHHHGGGGGHGHHHHHHHHHGGGGGGGHHHHHHHHHHHHHHHHHGCGGGHHHHFGHGGGGEGGGHHDHGGHHGHGGGGGGGGGGGG
+@1200247/2
+GCTCCAGTTTTATCAACTTTAACCTGCCGCAGTTCTACCAGATAGTGAAAACCGATGGCCGCGCACAGGTGATCCCATTCCGTACGCAGCCTATCAACACCGTGCCGCCAGCAAACCAGGATCATGACGCGCCGCTATTGCAGCAGTATTT
++
+BCCCCFFFFFFFGGGGGGGGGGHHHGHHGGGGGHHHHHHHHHHHHHHHHHHHGGGGGGHHGGGGGGGHGFGHHHHHHHHHHHHHGGGGGGHGHHHHHHHGGGHHGHGGGGGGHHHHGHHGGHHHGGHHGGGGCFGGGGGGHHHHHHDGHHH
+@1231795/2
+GAACAGGTCGGGCTGGCGTTAAAAGCGCGCGGGGCGACCGTAACGACAGCAGAGTCCTGTACCGGCGGCTGGCTGGCGAAAGCCATTACCGACATCGCCGGAAGTTCCGCCTGGTTTGAACGCGGCCTTGTCACCTATAGTAATGAAGCCA
++
+AABAAFBBBAD2?EEE?AAAEFFGCCAEG?EF?@EC?/EEEDD?EFFFDHHHFGDDHGFFGHHFGDCG@-@?./<..<-;:./.;0;00CD.-9.9...@?-:99C:B..9.9A//AD/;/A.-99-.;BF//FB9//:B;/9;//9B/F.
+@86736/2
+TTACAGGATTATGCGATGTCTTCTATGTTACCGTCAATCAGCCCGGAACTGGCCCGTATCGCTCCCGGCTTTCGTGCATTAAGTATTAATGTTATTGCCGCTCCGATTCGCGATGCGCAGGTCGGAGAAATCGCGCTAAAAGAGGC
++
+AAABBFFFFFFFGGGCGGGGGGCHBHHHHHHHGGGGGCHHHFFGFGGGGHHHFHHG?EHHGGEHGEFFGEGHHGHEFHHHHHHGGFBHHHEGGHHHHHHGGEGGGGGGHGGGFGG?CGGCCF1CGGGCFHHF.FDGGDGHFFGHHD
+@402592/1
+ACCCCATGATCTGCTTCGTATTGGCGATCAGGAACGGCAAAGCGTCGAAAACCCCGTCCGCATCTTCATTTTCCAGCCCGCCGCGCATCGACTGATAGGTGCCGACGCCAAGGAATACCGCATCGTAATCTTTCAGCAGATCTTCAAG
++
+ABBB?AFFFFFFGGCGGCGGGGFHHGGGCGHHGHHGGGEGHFHGEFCEGGGFEGEGEEGGGGGGHHGHHHHHFFEGBFEEGGGGGGGGGAHGGDHBGDFGDFHGGCGGGGGAFFGFHHGGCCGGGHGGGHHHGHFC0CHGHHGHGFFF
+@704073/2
+GATGCGGCTTAGCGAACAGGTCGGGCTGGCGTTAAAAGCGCGCGGGGCGACCGTAACGACAGCAGAGTCCTGTACCGGCGGCTGGCTGGCGAAAGCCATTACCGACATCGCCGGAAGTTCCGCCTGGTTTGAACGCGGCTTTGTCACCTAT
++
+CCCCCCCCCCFFGGGGGGGGGGCFGGGGGGGEGGGHHHHGGGGGGGGGGGGGGGHGGGGGGGHHHHHHHHHHHHHHGGGGGGCGGDHGDDA?BFFFGGGGGGGGGAAAF.AFFADDDFFFFFFFFEF9BFDFFFFDAFA--::;9:BFFFB
+@909377/1
+ATCTGGGCGAAAAGCATAAAGTCGCAGTGCTTTCCGTGACCGAAGGTGAAGATAAGCCGCTAAAGTATCCCCATATGTTTGCCGCTGCGTCGCTCATGCTGCTCAATAAAGTCGATCTGCTGCCCTACCTCAATTTTGACGTTGAGAAGTG
++
+CCDDDFFCDCCDGGGGGGGGGGHGGGGGHHHHHHHGHGGGHGGGGGHHHHHHHHHHHHGGGGGHHHHHHHHGHHHHHHHGHHGGGGGGGGGGGGHGHHHHHHHHHHHHHGGGHFGGHHHHHHHHHHHHHHHHHHHGHFGHGGGHGHHHHHH
+@230145/2
+GTACCAATCCGCTGCTCGTCGCCATCCCGTCTACGCCGATCACGATGGTAGATATGTCGATGTCGATGTTCTCCTACGGGATGTTAGAAGTTAACCGTCTGGCGGGCCGCGAACTGCCGGTGGACGGCGGTTTCGACGATAACGGTCAG
++
+AA1>131BFF1AE11B1EEEE?FGC1GEEEEE/AFE/E////B//A//BFG1F22FDGG/>FF@/F/BE2FDF11BF?/>?/F1F2DFG1BFG21F/E/E/FHCCCG/<CC@-@A0DFCC-::CF@CC?A--;9E..9@FAAF-;-9--
+@435068/2
+GCGTGTACGCTCCGCCTTCTGCGCGCACGCCGACGCCAAACTGGCTGCAACGGTCACGCCCTGGAATCAAGCTTCATCACATGTTGATTGCTTTTTTCCCAGAAATCAGTAAAATTTTCGGGCTTTTAATATGACGCCGGGCTCCGTTC
++
+BBBBBBFFBBBBGGGGGFGGGGGGGGGGGGGGGGGGGDGHHHHHHGGGFGHGGEFGHGHGGGHHGHHHGEGHEHHHHGHHHHHGHHFHHHHGHHHHGGFHHHHHHHFHHHHHHHHHHFHGGGGGHGHFHHHHHGHGGFCGGGGHFDHHH
+@265987/1
+GTGTGTTGATTCACACTTCTGAAAGATTGATACACTACATAACCAAAAAGCATAGCAGACAGGCATGGTATTGCTGGTATAAGCAGGTAACATGGCTGTTATAAGTTGATAACAAACTCTTGCGCCGCGTCGTGATAGTTTGCAGACCTT
++
+AAAB@FFAFFFFGGGGGCGGDDGHHGFHFHHHHHHHFFFHHHHHHEFHCEFHFHHHHHHHHBFGHHGE5DHHHHHHFGHHHHGFGFAGGHHGFGFEHEFEHGGFGFGHHHHHHHFHHHHBGGF@FAEEFEEF/BGHHF3FGHHHFGHHBG
+@83001/2
+GCCAACAGGGGCTAAAGCTAAATTTTGCATTTCTTTGGTCATTCAAATCCTCTCAATCAGTATTGCCTGGCACCGTCAGCGAGCAACAACCGTGCCAAAGCCGATGAGCAACGAGAATATCACCCACTCTTTTATCAGACAGTGATTTTAT
++
+AAAABAAFAABBGGGGGGGGGGHHHFHHHHHHHHHHHHDFHHHHHHHHHHHGHHGHHHHHHHHGHHHHHGHHHEFHGG?H?FEEFHHHHHGEAGDHHGGGEFGCGGHHHHHHGGGGGGFFGHEHFFGGGHHHHGHHEDBGHHGFHHHHHF2
+@69691/1
+ACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCGCCCAGATCGAAGCTGGCCGGGCAGACGAGATTACCGACGTTTTCGATAAACAGAATACCGTGGTCAT
++
+BBBBBBB?BBB2BFGGGGGCFGAEGGHHGHF5AEEGGFHGHHHFFGHEHGGGEGGGGGGEHHFHF3DEEEEGEGFHHGBHHHGGGGGGGHHHDBFGHGG?GGGCGGGGHG//DEFHFGFFGGGF0.=@EHE<GHHFFHGGFFDEGG;GGF
+@1137719/2
+CTACGTCTATCCAGCTACCGAGCGGTTCTACGCAACAGCAGACCCTGAAAGTCGTTGAAAAGGTTGAAAACTATTACTTCACCCATGAGAAAGACAACATTATGTCGGTCTTCTCGACGGTCGGTTCCGGCCCTGGCGGGAACGGGCAAAA
++
+BCCCCFFFBFFFGGGGGGGGGGGGGGGGHHHGGGGGHHHHHHHHHHHHHHHHHGGGHHHHHHGHHHHHHHHHGHHHHHHHHHHHGHHHHHHGHHHHHHHHHGHHHGHGGGGHHHHGHGGGGGGGGGGGGGGGGHHGHGGGCDGCDGGCEGG
+@871351/2
+GACATTCCCGAGTAATTTGGTCAACTATTTACTTGAGTAAATTAGTCAGGTATTTAGCGTTCCGTGCGATATTGATGCGGTTACTTGCCTTTATTCTGCTGCTCAATAGACGCCAGAATCCCACGCAGAATATTCAACTCCTGGCTTTCCG
++
+AABBBFFFFBBBGGGGGGGGGGFGHHHHHHHHFFHHHHHHHHHHHBEGHGDEFHFHHHGGGGHGHGGGGEGGHHHHHHGGGGGHHHFEHHHHHHHHHHGHHHHFHHHHFHHGGGGGHHHHHHHGGGGGGGGHHHHGHHHHHHHHHGHHHHD
+@1529625/1
+GCCAGGCAATGAGTCTTGCCAGCGCGTTACAAATCCTTCGTCGGCAACAGCAGCTTAGCGAACGTACGCGCGAACTGTATCAGCAGCAATACCTTGACCTCGGTTCCCGCCCGCTGCTCGACGTGCTTAATGCGGAGCAGGAAGTTTACCA
++
+ABBBAAABFFFFGGGGGGGGBGEEEGGGGGHHHHGHFFHHHGGGCGGHHEGFHHHHHHHGFGGGHHHGGCGGGGGHHHHHHHEGHHGHHHHHHHHHHHHHHGGCEFHHGGGGGGGGGHHG?CFDFEFHHHHHHGCGGGHHHEFHGFGHGGG
+@1310351/1
+ACGTAACAAATATTCAGCGCCAGCGCGAGCAACACCGCGTAGCCTACCCAACTATACGCATCACCCATCCGCTCGATCGTTGCCATCATCGAAGCATAGGTATCGGAAATCGCGCCGTTGATGCCGTAAACCTCAGACATTTTCGCCACCA
++
+CCCCCFCFFFFFGGGGGGGGGGGGGGGGGGGHHHGGGGGGGGGHHHHHHHHGHHHHHHGGGGHHHHGHHHGGGGGFHHGHHHGHHHHHHHHHHGGHHHHHGHHHGGGGGHHGGGGGGDGGHHHHHGGGGHHGHHHHHHHHHHHHGGGGGHE
+@831270/1
+GTATTTAGCGCTCATGTCTTTACCGGTCTCGTACATCGCAGCAATGATCTCATCGAGCGAGATACAGGGTTCACTTACGCGACTCATCGCCATCGTCGCCGCGTTTATCGCTTTCACGGCAGAGATGGCATTTCTCTCTATGCAGGGAATT
++
+BBBCCFFFFCDDGGGGGGGGGGHHEFGGGHHGGHGHHGGGGGHHHHGHHHHHHHHHGGGGGGGHHHHHGHHHHHHHHHGGGGGGGHGHHGGGGHGHHGGGGGGGGGHHHHGHHGHGHGDGGGGHGHGHHGHHHHGHHHHGHHHHHHGGHHH
+@129760/2
+ACGGTATTCTGTTTATCGAAAACGTCGGTAATCTCGTCTGCCCGGCCAGCTTCGATCTGGGCGAAAAGCATAAAGTCGCAGTGCTTTCCGTGACCGAAGGTGAAGATAAGCCGCTAAAGTATCCCCATATGTTTGCCGCTGCGTCGCTCAT
++
+AAABAAAFFFFDGGGGGGGGFCFEGGEGAGGGFBFGFEEGHHHGGGG0FFFDGCHHHHHEHEGGGGGHH3GHHHHGFGGFG?GF4GHHHGHGGFHCEEGGGGFGHHHHHHHHGGGGGGHFHHHGHGHHHHHHHHHHHGC@C.@ECGGGHGG
+@583361/1
+ATGCAGTGCTTGCGCCGTTTCCAGCGCTTGTTGGTGATGCTTATTAACCGCCAGCGTTAGCGTTTCCAGCGAATCAGCCTGATCGTCGAGCTGCTGCTGTTCTTCGAGCAGTGACTGATAAAGCTGCGGCAGCGCTTCCGGGCTGACGTGA
++
+BBBBBFFFFFFFGGGGGGGGGGHHGGGFGGHHHHGGHHHHHHHHHHHHHGGGCGGGEEFGHGGGCHHFHHGGGGGHHHHHHCHFGHHGE?FGEHHFHHHHHHHHHGEHGGHHGFHHHHHHHHFHHHHGGG/@EGFGGGHG?CDCEFFDEG.
+@1113711/1
+TGTTAGAAGTTAACCGTCTGGCGGGCCGCGAACTGCCGGTGGACGGCGGTTTCGACGATAACGGTCAGTTGACCAAAGAACCGGGCGTGATCGAGAAAAATCGCCGCATTTTACCAATGGGTTAATGGAAAGGATCTGGTCTGTCGATTGT
++
+>A1A>DFFF3DFGF1A1AF1BGEGGEEGGGE@/FF1B>/>>EGH/@C??EEFHGGGGC/<FHCGC?/?GBGGFHHGE0GFFA---A@GGGHFACEH.CGFF/CCBAGGCBFBB00;BFEFF99A009;0/9---/;/9B;BFF/;EFEFE;
+@926644/2
+GCTATATTCGATGATTAATTAACCACATTGTTGCGAGGGATACTATGACGAGTCTACATCGTCTGAAAACACTCCTGCTTGCCGGTATTGTCGCGATACTCGCGCTATCGCCAGCCTATGCAAAAGAGAAATTTAAAGTCATCACCACGTT
++
+CCCCCFFFFFFFGGGGGGGGGGHHHGHHHHHHGHGGGGGGHHHHHHHGHGG0BFHHHHHHGHHHGHHHHHHHHHHHHHHHHHGGGGGGHHHHGHGGGGGHHGGGGGGGHGGGGGGGHFHHHHHFHHGHHGHGHHHHHBGFHHHGHFHHGHH
+@1540849/2
+CAAATATTCAGCGCCAGCGCGAGCAACACCGCGTAGCCTACCCAACTATACGCATCACCCATCCGCTCGATCGTTGCCATCATCGAAGCATAGGTATCGGAAATCGCGCCGTTGATGCCGTAAACCTCAGACATTTTCGCCACCACCGGTT
++
+CBCBCFFFFFFFGGGGGGGGGGGGGHHHGGGGGGGGGGHHGHHHHGHHHHHHGGGGHHGHGHHHGGGGGGHHGGHHGHHHHHHHHHHGGHHGHHFGHHGGGGGHHGGGGGGGGGHHHGHGGGGHHHHHHHHHHHHHHHGGGGGHHHGGGCG
+@848090/2
+TCCTTATCCTGATGCTGTTGCGCACACCACTTACGCAAGGGTTCGCCGTCTAATTTTTCAAACTCGTCTTTATGTTTATTCCACCAGCTCTGACGTACTCGCAGCACGCTCATCTCCCAGGCGTGTTCACAGCTGGCATAAGGGGTTACGA
++
+AAAABFFFBFFFGC5EFF44BA?EECG?GHHGHHGGGGGGGGHE0A1AEGGHFHHGGFHFFHFHGDG1GFHHHGHDFFFFEGHG1FB1@FFFFGAFFHFHGGCDEHAECAEEG12B?0CBCEDGCDGGFD2<GFFHGGHH?DGCDDGFGEF
+@1213993/1
+GGTAGGCGGCGCTTCTCTGAAAGCTGACGCCTTCGCGGTGATCGTGAAAGCAGCAGAAGCTGCTAAACAGGCTTAATTGCCAATCAATGTCTGATGGCGCTGCGCTTATCAGGCCTACCAGCCGAGTGCTTATGTAGGCCTGATAAGGTAA
++
+BCBCBCFCBCCCGGGGGGGGGGHHHHGHGGGHGHHGGGGGGHHGHHHGHHHHHHHHHHHHHHHGGGHHHHHGHHHHHHHHHHHHHHHHHHGHHHHHHHGGGGGGGGGGHHHHHHGHHHHHHHGGGGGHHHHHHHHHHHHHHGGFHHHHGHH
+@189190/1
+CTTTTAGCGCGATTTCTCCGACCTGCGCATCGCGAATCGGAGCGGCAATAACATTAATACTTAATGCACGAAAGCCGGGAGCGATACGGGCCAGTTCCGGGCTGATTGACGGTAACATAGAAGACATCGCATAATCCTGTAA
++
+DDDDDFFFDCCCGGGGGGGGGGGGHHGGGGGGGGGGGGHGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHGGGGGHHGGGGGGGGHGGGGGGGGHHHHHGGGGGGHHHHHHGGGHGHHHHHHHHHHHHHGGGGGHHHHHHHHH
+@409798/1
+GGATGACCACGGTATTCTGTTTATCGAAAACGTCGGTAATCTCGTCTGCCCGGCCAGCTTCGATCTGGGCGAAAAGCATAAAGTCGCAGTGCTTTCCGTGACCGAAGGTGAAGATAAGCCGCTAAAGTATCCCCATATGTTTGCCGCTGCG
++
+?A1AA1DFFAADFGFFGGGGGGFHHGHGGGHGHHGGGHCGGHHFFGHGHGGGGGGGHGHHHGEHHHHHHHGGCGGHGFGHHFHFGGGGCEBFHGHHFGHGEGHGCGGG1FFGHHHHHFHHGGG??GBFGHHGHGFEBGHHFHFFBCGGGCC
+@600237/1
+GTTCTACAACGTCCATTACGGACATAGCGGATACTGCTTCAATGATTTGATCTTTAGTGATAGACATTTAAATTGTTCCTGAATATCAGAATAAGTTTATACGTAAGCAAATGCTTGATAAAGACAACTGCGATTACGCAGCTTCTTTTG
++
+CCCCCFFFFFCAGGGGGGGGGGGGHHHGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHGHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHGHHHHHHHHHHHFHHHHHHHHHHGGCGFGHGGGGGHHHHHGGH
+@565456/1
+GTAGAGCACCGGTCTCCAAAACCGGGTGTTGGGAGTTCGAGTCTCTCCGCCCCTGCCAGAAATAATCCTTAGCATCTGCTAAGGATTTTTTTTTGCCTAAAATTACCTGATTATCTGATCAGGTAATCGTAAGTTCCCTTCTTTTTCTTTT
++
+BAABBFFFFCDCGGGGGGGGGGGGGGGGGGHHGHGGHHGHHHHHHHHHGGGGGHGHHHHHHHHHHHHHHHGGHHHHHHHHHHHHFHHHHHGGGGGHHHHHHGHHHFHHHBGHHHHHHHHHHHHHHHHHGHGHHGHGHHHHHHHHHHHHHHG
+@469050/2
+CATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCGCCCAGATCGAAGCTGGCCGGGCAGACGAGATTACCGACGTTTTCGATAAACAGAATACCGTGGTCATCCAGCGGCAGGCG
++
+DCCDDFFFCCBFGGGGGGGGGGGGHHHHHHHHHHHHHGGGGHGGGGGHHHHHHHGGGGGHHHHHHHHHHGGGGGHGHHHGHGGHHHGHGGGGGGGHGGGGGHHHHGGGGGGHGHGGHHGHHHHHGHHHHGGHGFHHHHHHHHGGGGGGGF
+@590396/1
+CCAGGACTCCAGGCACATCTGCTCTTCTTCACTCCAGAAGTATTTCTCAATCACTTCTATGGTGTAATCCAGCAATTTCCTGGCTTCAGGGTGCCCGGTCGTGACGGCGCTGGCCGCGCCCAGCAAGGCGAAGAAGTGTTGATAACC
++
+DCDDCCCFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHGHHHHGHHGHHHHHHHIHIIIHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGGFHHGGFGGGGHGGEGGGGGGGHGGGGGGGHHHHHGHGGGGGHHHHHHHHHHHHH
+@489302/1
+AATCTCGTCTGCCCGGCCAGCTTCGATCTGGGCGAAAAGCATAAAGTCGCAGTGCTTTCCGTGACCGAAGGTGAAGATAAGCCGCTAAAGTATCCCCATATGTTTGCCGCTGCGTCGCTCATGCTGCTCAATAAAGTCGATCTGCTGCC
++
+CCCCCFFCCCAFGGGGGGGGGGHHGHHHHHHHHGGGGGHHHHHHHGHHGGFEGHHHGHHHGHGFGHGCGGGFGFHHHHHHHHHGGGGGHGHHHHHGGHHFHFHHHHHHGGGGGGGGGGGHGHHHHHHHHHHHHGHHHHGGGHHHHHGHH
+@493383/1
+GCACTTCTCAACGTCAAAATTGAGGTAGGGCAGCAGATCGACTTTATTGAGCAGCATGAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCGCCCAGA
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHGGHGGGGHCHHHGGGGHHHHHHHHHHHHHHHHHGGGGGGGGGGGGFFGHHHHHHHGGGFHHHHHHGGGGCGHHHHHHHHHHHHHGGGGGGGGGFHHHHHHHGGGGGHHHGHHHHHHGGGGGGG
+@370050/1
+CAACAGCAGCGGCGACTGCTTGCCCTGGTCATAAATATGATGCGCCGCATCACGGGCTTCATCTTCTGGAGAGAGCGCGAAATAGCAGATATTAGGGAAGCTACGTACCGTTTCCGGCTGGTTGAGCGCCAGCACGTTGAGCGGCGTGTTG
++
+CCCCCFFFFFC@GGEGGGGGGGHHHHHHHHGHHHHHHHHHHHHGGGGGGGGHHGGGGGHHHHHHHHHHHHHHGGGHGGGGGGHHHHHHHHHHHHHHHEHGHGHHGHHHGGGGHHHGGGGGGHHGGHHGGFGGGHHGHHHHFHCGCGDGGGG
+@1543520/1
+GCTGAGCAGTATGACGAGCTGAAACACGAGTTCGAGAAAAAACTTGAAGCGAAGCGCCGTAAAATCACCCAGGGCGACGATCTGGCGCCGGGCGTGCTGAAGATCGTGAAGGTCTATCTGGCCGTTAAACGCCGTATCCAGCCGGGTGATA
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHGGGGGHGHHDGHHFGGHHHHEHEE?EGGGEGGFFGHHHHHHHHGHGGGGGGGGGHHHHHGGGGGGGC>CGGHHGHHHHHHHFGHHGFHB<GHHHHHG-DGGHHGGFG?EEHHFGGGFGC9-AFG
+@617587/1
+TGACCACGGTATTCTGTTTATCGAAAACGTCGGTAATCTCGTCTGCCCGGCCAGCTTCGATCTGGGCGAAAAGCATAAAGTCGCAGTGCTTTCCGTGACCGAAGGTGAAGATAAGCCGCTAAAGTATCCCCATATGTTTGCCGCTGCGTCG
++
+CCCCCFCCCAABGGGGGGGGGGHHHGGHGHHGGGHGHHHHGGGHGHHHGGGGGFGHHHGHHHHHHGHGGGGGHHHHHHHHHHGGGGGHHHHHHHGHFFGHGGGGGGHFHGHEFHHFHGGGGGHHFGHHHHGHHHHHHGHHHHGGGGGGGGG
+@1547218/2
+GGAAGAGGCCGAGTCAGAGGAGATAATTTAATGGGCGATGTGTCAGCTGTCTGCTCATCCGGGAACATTTTACTGCCGCAGCAGGATGAGGTTGGCGGTTTATCAGAAGCATTAAAAAAAGCGGTGGAAAAACATAAGACAGAATATTCCG
++
+AAAA1>>1AA11AFGG1GGGGA0BA12DGGFG21AA0A?EFEGG2F11GEFEB1D11FDF?/AEEE>GHHHGHHGHHCCEGC0B//@GGFBBFHEG?@EE/C12B2BFC1CHFH1GGB><BAACC///<?FFCEF111G1<C<B<DGGHGH
+@666893/1
+GGCGATGCACTTCTCAACGTCAAAATTGAGGTAGGGCAGCAGATCGACTTTATTGAGCAGCATGAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCG
++
+CCCCCCACFFFFGGGGGGGGGGGHHHHHGHHFHFGGHGGGHHHHHHGGGGHHHHGHHHHHHHHHHHHGGGGGGGGGGGGGHHHHHHHHHGGGHHHHHHHHGGGGGHHGHHHHHHHHHHGGGGHGGCGGHHHHGHHGGGGGHHHHHHHHHHC
+@695388/1
+GGATGACCACGGTATTCTGTTTATCGAAAACGTCGGTAATCTCGTCTGCCCGGCCAGCTTCGATCTGGGCGAAAAGCATAAAGTCGCAGTGCTTTCCGTGACCGAAGGTGAAGATAAGCCGCTAAAGTATCCCCATATGTTTGCCGCTGCG
++
+AAAAAF1@11>>AFFFGGGFFFEHFEGHEEFEBAAFAF/DF21EAEFCBGGG?EAAGFHFFEFFGEHFFGG/>E@>FBGBG1@BGEEEE/BFDGHHBE<FCFDE<</CBB<1>>GDG1G1CGGCAGD<<GGHFGGG0GFHHBGHD@CG@A-
+@1446956/1
+GTTTACACAGGAGCTGCTCCAGTTCGCTTAATGACGCCACAGTCCAGGTTGGATGAATACCCGCGGGCTGCTCGCGATGATGCGCGTTAAGCCAGCAGGTCGACAGCCCGGCGTTAATGCCGCCAAGAATATCGGATTCCGCGGTATCGC
++
+BAABAFFFFFBFGGGGCFGGGGHCHDAEHGFHHDGGGGGFHGGHHHFFBFGGBGHHFHGHHFDGGGGGGGGHHGGCEFGHHFHGGCECDEHHFHFGHAA?<DGGGGHEGGGGCGGGEHHHHFFCDFGHHHHHHGCGEDGGG?BAD?.09E
+@759174/1
+CTTCACGCGCGCTGGCGATGCACTTCTCAACGTCAAAATTGAGGTAGGGCAGCAGATCGACTTTATTGAGCAGCATGAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGA
++
+BBBBBFBFBBBBGCCGGEGGGGHHHBGHHHHDCFFGHHHHHHHHGGHGGHGGGHHGHHHGGEEFGHHHGHBGHHFDGBGHE//E@EGGGFGGCFHHHHHHFFDFGHFHHHHGHCGGGFHHHHGHHDFHHGHGFDGGGG-:@CHFHHHGGG
+@6350/2
+GAAGGGGCGTGACTTTAGCGAAATGTCGTCGCGGCGACAACTGGAATATGAAAGCAAGGCGTTACGTGCGATTAGCGTTTATGCTGAAAGGTCAAATAAAGGAGAAAAGTATGTTTACCCTGAGCTGGCAGCCGCCTTACGACTGGTCGTG
++
+BABBBCCCCCCBGGGGGGGG?FGHHHHGGGGGGGGGCGGGHHHHHGHGHHEHHGGHGHGHGGGFFEGHHGEHHGHGGDGGGHGGHHGGGHGFHHHHHHGHHHBGGFBHHFFHHHGFHHHEGHHHGHHHGHGCGCGGGGHHGGGGGHBGCFG
+@1530058/2
+ATAATATGGTCAGCGCCCCGACTAAAATGGTCAAACTTAACACCAGCGAGTAATCGCGGTTGAGCGCGCCATTAACGAAAAGCTGCCCAATGCCCGGTAAGCCATAAATAGTTTCAATCACCATTGAGCCGGTAATAATGCCGACAAAGG
++
+BBBBBBFFFFFFGGGGGGGGGGGC3GGHHHHHHHHHHHHHHHHGGHHGFFFHHHHGGGGFEGFHHGGGGGGGHHHHGGGG?HHHHHHHGHHHHHHGGGG/GHHGHGHHHHHGGHHGFHHGHHFGHFFHHHCGG-FHFGHHHHGCFGC/CC
+@344961/2
+GAAATAGCGTCAGCGTTGTGGCTGACCAGCCAGCCGCTGAATTTTGAGAAAAAGGAGAGTCTGAATGCAAGCAACAGTAAAACGGCGGCTGACGAAGGTCGCTTTAGCATTAGTAGTTGCCGGGTATTGCGCCGCGCCAGCGGTGGCGGCA
++
+AA33>DFFDBAAEGEGGEGGGGCCGGHFFHEHHGGEGGCEHHHHHHFGHHGEFGGFHGGHGDHFHHHHGHFHHHHHFGHHHHB?1ECGFGGAGDGGCD2FCFDEGH2GBHGFFGFF<GFBFCG?<@GHEH?DFGGCG@DCGGC.-9A?B-?
+@776904/1
+GAGCAGCATGAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCGCCCAGATCGAAGCTGGCCGGGCAGACGAGATTACCGACGTTTTCGATAAACAGA
++
+AAAAAFFF1DFF1AEEECEGGGCGGGGHGFHHHHCEFFGEGHHHHHCGGCEHHHEEFHHHHFHGGE/EHC?EGEHGEHGGFG@EEEGHEGFDHHHGGGGGGEHHHHFBFGFHGGFC//A<AFG<?@CGGHHBFEGC-C:CGC.::.:GFFB
+@924030/2
+GTATTTAAACGTTTCATTCAGCGTAGCGCCGCAATACTGCTTGACCAGCCAAAACAGGGAATCGGTCACGATCGTGCAGCCAATGGCGCCGGAACCAATGGCAATCGCAATGATCTCCGGGCTGACGTCAGGATAGAGCGGCAGCATGCG
++
+A>AABFFFFFBFGGGGGBGGCBAE2EGGCEGFGGGFHFHHFHHHHHH1GGH2BGHFHHFG1FHHGGGAGGGEHCB?FGHHGHFEBGF?EEGCEGCGFC2BFGGBFHEGGADGH2@2GBA?//A/GHDF?CDEGFFBGDF?-AC?D.:G0;
+@869901/2
+CCTTGACACCGGCTGCGCCAATTTAAGCTCGGTAAAATCCGCCGTGGCGCGCCACGGTTACACCCCGGTGGTCAGCCGCGAAGCGGAAATCGTATTACGCGCTGACAAACTCTTTCTGCCCGGCGTCGGCACGGCGCAGGCCGCTATGGAT
++
+BBBB@FFFFBD@E?CAAEAEEEGFHFGHHGGG2EEHHHHHCFG0AECGGFGGGFGCE11EFFGHGEEG>E?EHHHFFGGGG?@DGCGGGHHA/?0FFH.ACGC?C<D0GHBCGHC0=CCGH??:-@BB@BB@DG@B;;B-.;@--99FF//
+@386681/1
+ATAGGTGACAAAGCCGCGTTCAAACCAGGCGGAACTTCCGGCGATGTCGGTAATGGCTTTCGCCAGCCAGCCGCCGGTACAGGACTCTGCTGTCGTTACGGTCGCCCCGCGCGCTTTTAACGCCAGCCCGACCTGTTCGCTAAGCCGCAT
++
+BBBBBDFFFFFFGCGGGGGGGGHHHGHHGHGGGGGGHGHGGGGGGGHHHGEHGHHHHHHHHGGGGEGGHHGGGGGGGGGGHGGFHHHHHGHGGHGFGHGGGHGGGGGGGGGGGGGGGHHHHGGGGGGGGGGGGGGGGGGGFFFFFFFFFF
+@936536/1
+TCTTAAACCTGATCACCCTGGCGGCCGCGCTGCTGCACACCAAAACCTGGTTTGAACTGGCGCCGAAGGCGGCCAATATCATTGTAAAAGACGAAAAAATGAGGCCAGAGCCAATCATCAAAGGGCTTTGGGTGGTCACTGCGGTAGTCA
++
+BBB@AFFFFFCFGGGGGAGFCGGGGGGEECGGDHHHHHHHGHGEHHGHHGFHHGGHHHHHGGGCGGFEGGGGGGGGHHHGFHFHGFDG2F?GCC/DCHGHH1>GFFEEGEHH0<CHHHHFGE0GD.<<GFGD.CDEHHHFHFFGGGDGGG
+@1140625/1
+AGCGAAGCGCCCCCGGCAAAGCGCTGGGACGTTAGTCTTCTTTCGGCAAACACTGCAAGTGGCCGTGGCGCACGCCGCGCTGGGCGATAACATCATCGGCAAAATGCTGTACGTCGCCCATATCGCCCTTCAGAACGGCGATCTCCAGACA
++
+CCCCCBCC@BCCGGGGGGGGGGGGGGGGHHGGGHGHHHHHHHHHGGGGGHHHHHHHHHHHHHGHGGGGGGGGGGGGGGGGGGGGHGGGGGHHHHHHHHGGGGHHHHHHHHHHGGHGGGGGHHHHGGGGGHHGGGGGGGGGGGGGGGGGFFF
+@847142/1
+GTCATTGCGCCTCCTCACTCATTTCACCTGCAAACATATCATCCAGTTGGTTAATTAACGCCGCCGCAGGGCGAGTGGTAAAAATACCCTGCTGCGGACGTTCGCTATCCACCCCGCGTAAAAAGAGATAGATGACGCCGCCGAAATGGCG
++
+BBCCCFFFCCCCGGGGGGGGGGHHHHHHHHGHHHHHHHHGHHHHHHHHHHFHHHHHHIHGGGGGGGGGGGGGGGGGHGHHGHHHHHHHHHHHHHHGGGGGGGHGGGGGHHHHHGGGGGGGGHHHFGGHHHHGHHHHGGGGGGGGGGGGGGG
+@110775/1
+GTTTACCACGTTAATTACGCCATCAGGGAAACCTGCCTCTTTAGCCAGCTCAGCGAATCGCAGCAGTGTCAGCGGGGTATATTCACTTGGTTTAATGACGATGGTGCAGCCACATACTAGCGCTGCGGCCAGTTTCCAGATAGCAATCATA
++
+AA>AA1BDFAAF113AGGCEEFEGHB1F0F0BCGFHAEBGHHHCFCEGFH1FFCAE/A/A/AA/C0GFE2EGH?//E/?1F2F2ED21>FB/B1D2GHHCE/FE1FG11<<0GA1G112BGCCEBAC?@@/<<FGFGFGGHBHB1DBCGF<
+@864693/1
+GGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCGCCCAGATCGAAGCTGGCCGGGCAGACGAGATTACCGACGTTTTCGATAAACAGAATACCGTGGTCATCCAGCGGCAGGCGCGGCGCG
++
+BCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHGGGGHGGGGGHGHHHHHGGGGGHHHHHHHHHHGGGGGHHHHHGHGGHHHGHGGGGGGGHGGGGGHHHHGGGGGGHGHGGHHGHHHHHHHHHHGGHGHHHHHHHHHGGGGGGFGGGGGGGG
+@720692/2
+GCTGAATTTTCCCCAGCGAACCATGATACGTTTCACGGTATTTAGCGCTCATGTCTTTACCGGTCTCGTACATCGCAGCAATGATCTCATCGAGCGAGATACAGGGTTCACTTACGCGACTCATCGCCATCGTCGCCGCGTTTATCGCTTT
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHGHHHHHHHGGHGHHHHHGGGGGHHHHHHHHHHGGGGGHHGGHGHHGGGGGHHHHGHHHHHHHHHGGGGGGGHHHHHGFGHHHHHHHGGGGGGGHHHHGGGGHGHHGGGGGGGGGHHHHGHHG
+@1077194/2
+CCTCAGCCATATCCGTGTGATTACTGGTGGAAGTCAAACGGAAGGTAAAGGTTACTATTTCGCTCCGACGTTGCTGGCAGACGCAAAACAGGAAGATGCCATCGTGCAACGCGAGGTCTTCGGCCCGGTGGTCAGTATAACCGTCTTTGAT
++
+CBCCCFFFFFFFGGGGGGGGGGGHHHHGHGHHHHHHHHHGFGCFGFFHHHHDGFHHGHHGHHGGHGGGGGGFHGGGHGHGGHGGGGGGHHGEFGFHFFHHHHHGHFGHHHGGGFGGDGHHHHGGGGGC<@FDFHHHHHHEHHGDFHGHHB0
+@879350/2
+ATTTCAATCTCCGGGTTCACTTCACGCGCGCTGGCGATGCACTTCTCAACGTCAAAATTGAGGTAGGGCAGCAGATCGACTTTATTGAGCAGCATGAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGG
++
+ABCCBFFFFFFFGGGGGGGGGGGHHHHGGGGGGGGGGGGGHHHHHHHHHHGHHGCFEGHHHEHHHHGGHGGGHGHHGHGGGGHHHHHHHHHHHHGHHGGGCGGGGGGGGGGGACGHFHHHHGGGHHHGHHGHGGGGGGHHHHHHHHGHHHG
+@885688/1
+TCTCAACGTCAAAATTGAGGTAGGGCAGCAGATCGACTTTATTGAGCAGCATGAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCGCCCAGATCGAA
++
+BBBBBFFBBBBBGFGGG5EGFGHGGHGGGHHGHHHGGGGGHHHGHHHHHHHHHHHHGGGGGGGGGGGGGGHHHHHHHHGEFHHHHHHHHGGGGGHHGHHHHHHHHHHGGGFHGGGGGGHGGHHHGCCGGHHHHGHHHHG?DFGGHFHHEE/
+@1463526/2
+CTCATATCCTGCATCCAGTACGGCCTGCACGCCCTGACATCCCATATCGTGATAGGCAAAAATAACGGCTTTCATTGGTGACTTTCCTCAGTAAACGGCGTGCTTTCCGGGTAGATAACTTGTTGAACAAAATAGCGGGGGCGGGCGCGGA
++
+ABBBBFFFFFFBGFGGGGGGGGGGGDGHHHGGGGGHCHHHHHHHGHHHGFFGFHHGHHGHHHHHHHGGGGGHHHHGHGFFHHHHHFHHHHHHGHHHGGGGEFCFHHHHDFGEEGGHHHGHHHHHHGHGHHFGHHGHCGFC?DGGDCFFFF-
+@859015/1
+GTCCAGGTTGGATGAATACCCGCGGGCTGCTCGCGATGATGCGCGTTAAGCCAGCAGGTCGACAGCCCGGCGTTAATGCCGCCAAGAATATCGGATTCCGCGGTATCGCCAACCATTAATACGCGCGAGCGGTCAGGATTCCCCGCCTG
++
+CCCCCFFFFFBFGGGGGGGGGGGGGGGGGGHHGGGGGGHHHHGGGGGGGHHGHHGHHHFHGGGGGHHGGGGGGGGGGHHHGGGGGHHHHHHHGGGGGHHHGGGGGGHGGGGGGGGHHHHGHHHGGGGGGGGGGGGFFFFFFFFFFFFFF
+@1012501/2
+TTATTGAGCAGCATGAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCGCCCAGATCGAAGCTGGCCGGGCAGACGAGATTAACGACGTTTTCGATAA
++
+A3AABFBB@4C4FGFGGGG?EEE2FGGGGCCGFFFHD5E1BEEC3DFGHHBE?0EFHFEFG4BD3FCGHGEDEG1E/F/GFHFGHGG/EEEHHBFFHHFH2@/BDDHA?GH?CFCGFF/0/@DG@EEG-<C<<DD0<CCDCCFCC0A.CGG
+@1453770/1
+ATTCTGTCTTATGTTTTTCCACCGCTTTTTTTAATGCTTCTGATAAACCGCCAACCTCATCCTGCTGCGGCAGTAAAATGTTCCCGGATGAACAGACAGCTGACACATCGCCCATTAAATTATCTCCTCTGACTCGGCCTCTTCCTG
++
+BBBBBFFFFFFDGGFGBCGB6GF?E?AFHHGGCF5DGHHGHHHGHHHHH0EFGGGGHFHHHHHEHEHGGCGGEHGFFHGFHHHHHGCFDFHHHH3CGFHH3FHGHHHHHCGGDGHEHHHHHHHHGHH2GFFHH2FEA<EGHHHGH1F
+@814817/1
+CATCAAACGCTTCATGACTTTACGTCCGGGTGATCGAGCAAGTGGTGAACTGCATCATTTCGCCCAGCGTGCGCGTTACCTGCTTGAGGGCATACTCGACGGCAGAAACGTCGCCGGTCAGCACCACGGCACCGGTAAAGCGATCGAGAAA
++
+DDCCCFFFCCCCGGGGGGGGGGHGHHGGGGEGHHHGGGGGHHHHHGGHHHHHHHHHHHHHHHGGGGHHGGGGGGGGGGGHHHHHHHHHHGGGHHHHHGHGGGGGGGHHHGHHGGGGGGGGHHHHHHHGGGGGGGGGGGHHHGGHGGGGGGG
+@85514/2
+TAATTAGTGTGATCCACTAATTAGTTTGCGTATCATTTGTATAATAACCTATTGATCAGGCTAATAACCGCAGTCTATATCAGGGTAAGTCTTTTCGGCGCGTTTTGATATACGCGCTCATACGTTTCGGGATGGCATTAAAAGGCGAAGG
++
+BBBBBFFFFFFFGGGGGGGGGGHHHHHHGGGFGHGHHHHGHHGHGHHFHHBGHHBGHHHHHHHHHHHHHCGC0EHHHHHHHHHHGFHBHHHHHHHHG?EGCFEEEFHGHHHGHHGG?/AFHFHHHHHHGGGCGGGHHHHGFHHHGHGGAGG
+@1122956/2
+TTATTGAGCAGCATGAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCGCCCAGATCGAAGCTGGCCGGGCAGACGAGTTTACCGACGTTTTCGATAA
++
+AAAAA3DF1BFFCFD1A1EEAEGGEGCEG?EGHFHDGH10/A/FB1EGHHFAEEEEGF1FGFHG1B1BF?/E?H?EEE/BC>FGCGCEGEC1FGFBDGFD2</CA/?GDF/CGA<11CEHCC---<.0-A@..=DFH??-@@EHEHCEG..
+@1071836/1
+ACCCACAATCTGCCGCACGGCGTCTGCAACGCTATCCTGCTGCCAATTGTCGAGAACTTTAACCGTCCGAACGCCGTCGCGCGTTTTGCTCGCATCGCACAGGCGATGGGCGTGGAGACGCGCGGTATGTCTGACGAAGTCGCAAGTCAGG
++
+?A11AAAAFFFFGGGGGA00000A//1B1A//AAEECGH1A1BBA1B1AD2E/>FEHFFDG2EGF>E?@////?E/EE/EE@C@CCFGDHH///?@C/?A@FHGGC-<EFG-<<?.<G..@--A?..CF;0BFB0E.9E909?-;@9BBFF
+@1397200/1
+TCAATTGGCAGAGCACCGGTCGCCAAAACCGGGTGTTGGGAGTTCGAGTCTCTCCGCCCCTGCCAGAAATAATCCTTAGCATCTGCTAAGGATTTTTTTTTGCCTAAAATTACCTGATTATCTGATCAGGGAATCGTAAGTTCCCTTCTTT
++
+1>AAAFB11B>AGGFG11FE00AAA0AB0/AEEA//////AFAFGFGHFHHFFHHGCEGEEEEHBCF>BBGFB22BFHH112>BDDHF21011B1G1EBCCC1D1GG112?FGHGFFHEGHHFGHFHG110<F0F0GCFA1>=DDHD/D<D
+@1155736/1
+TTATTGAGCAGCATGAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCGCCCAGATCGAAGCTGGCCGGGCAGACGAGATTACCGACGTTTTCGATAA
++
+CBCCCFFFFFFFGGGGGGGGGGGGGGGGGGGHHHHHHHHHGGGHHHHHHHHGGGGGHHHGHHHHHHHHHGFGGHGGGGGHHHGHGHGGGGGHHHHGHHHHHGGGGGHHHHHGHGGHHHGHGGGGGGGHGGGGGHHHHGGGGCGHGHGGHGG
+@1488408/2
+TACCAACACGGTGGCTTGGCGTTTAAGCGTAAAGAGGGTCAGCTCGGCATCCAGACCTGGCTGAAGACGCCCTGTGGTTTTCAGATTCAGGCTATCGGCGGCCATGTGCCCCACGCACGTCATGACCTCCGGCAGCGACAAGGCGATGGCG
++
+11>A11111>11AA111A00AEEE021BAAAE/B10//A0B0111/////0A1B1//A>000>0FDGBEE//>0@BBB/>?222FG121B100>>C////<///?122210</?//</-0..0=>F111..<---.----:...---../@
+@1054190/2
+GTTTGTAACCTGGTTCGTTGGGGATGGAAAGTGGTGAAACGAGGGGATGATGATTCTGGATAGAGGTTCGCAAAAAATGGAATGCGGTTGGCGCTGGGTTTTTAATTTTTGTACTGTGAAACGATGATGCTATACGCCATTGACGTATAGA
++
+AABCCFFFFFFFGFGGGGGGGGGFDFGHHHHHHHHGGHHHGGGGEEEGGHHHHHHHHHHGHBGEGHHHGGGGEGFEGGFHHHHHHEGECGGGGGGGGGFFGGGHGHHHFBCGHHHHFHHFGHFGHGEGGGHHFHHHDGGGBFGGD<GHHF1
+@568111/1
+CATCAATGAAGCGCAGAATGAACTGGAACTCTCTCAGGGCAGCGAAGATAACGAAGGGATTAAAGAACGTACCGGCTTCCGTCTGGAACGTCGCGTCGCAGCGGTTGGCCGCTACATGGGACGAGGCAACGGTTATCTGGCGACGATCGG
++
+CCCCCFFFFFFFGGGGGGGGGGHGHHHHHHHHHHHHHHHGGGGGEGGGHHHHGGGGGGGHHHHHHHHHGHHHGGGFGGHHGHHHGHHHHGHHGGGGGGGGGGGGADGGHHGGGGGHHHHGHHGGGGGGHGFGDGGHHHHGHGGGGGGGGF
+@392403/1
+ATACAGTGGGGCTGAATCAGCTAGAAAGCGTGATGCCAGCGGAAGCTTGGGAACCTCTACACTGGCTGGCAGAAGGGCTGGATTACCAGGAAGTGCTGGAAGAGTTTAACGAACATCGTAATGAGCCTGTTGATACTAACGACTTTATTGA
++
+CCCCCFFFFCCCGGGGGGGGGGHHHHHHHGGGGHHHHHHGGGGGGHHHHGGHHGGHHHHHHHHHHHHGGGHGGHHHGGHGGHGHHHHHHGGHHHHHHHHHHGHHGHHHHHGGGGGGHGGHHGHHHHHHHHHHHHHHGHFFGGGGGGHHHHB
+@301032/2
+GACTGAATAGAGAAGCGTTCGTGCGCATCGCCCGCCTGATAATGCTGCCCGTCCACGGTACAAATCGCTATTCCCAGCTTTGAACCCTCGACGGACGCTAATGCCGGAATATAGTCAGCGACTTTGCCCTGGCCAATGAGGGGGCGAACG
++
+CBCCCFFFBFFFGGGGGGGGGGGGGGGGGGGGGGGGGHHHHHHHHHHHHHGGGGGHGGGHGHHHHGGGHGGHHHHHHHHHHHHHHHGHHGGGGGGGGGGGGHHHHGGGGGGHHHHHHHHDGGGGHHHHHHHHHHHGHHHHHGGGGGGGGG
+@48422/2
+TTACAGAAAGGCGGTATTCAATTGGTTATTGAGGTTGAAGGTGATGATAAAGCGCAGGTAGCAAAAGCGAATCAGGCCGGACTGGCGGTACAGGCGCTAAGCCGTTGGCGAGTGGGTTCGTCAGGAAAGGGGGGCATTTTACTGTCGTTTT
++
+CCCCBFFFFFFCGGEGGGGGGGHHHFHHHHFHHHGHHHGHHGHHHHHGHHHHHGGGGGHHHHHHHHFHGGGGGHHHHGGGGGGHHGGG///B43/<//>B22B</?/F2B/<//?/?F0-..><F1<FCFGFGF--/;FF09BB00?.;A.
+@1311092/1
+GTTTATCGAAAACGTCGGTAATCTCGTCTGCCCGGCCAGCTTCGATCTGGGCGAAAAGCATAAAGTCGCAGTGCTTTCCGTGACCGAAGGTGAAGATAAGCCGCTAAAGTATCCCCATATGTTTGCCGCTGCGTCGCTCATGCTGCTCAAT
++
+AAABBFFB4C?DGC4GGGGGFGGHHFFGFFGGDGGGGCHGFFHGHFHHHHHGFGFGGHHHHHHHHGFFEFGFFGHHHHGGHGEFGE>@EE3GHFFFHHHHGHCGGGG3GGHHG2FCGHEGHFGFHHHGGGFFF.<CGGEDHHBGHHHHHFF
+@1407555/1
+AACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCGCCCAGATCGAAGCTGGCCGGGCAGACGAGATTACCGACGTTTTCGATAAACAGAATACCGTGGTCATCCAGCGGCAGG
++
+BBBBBFFFFFABGGGGGGGGGG2EGCHHHHFHHFFFHFHGE2EHGGGEFHHHHGFHGEFEGFHHHHHHB3GGGGGDF1GHAECFCBCGEFE?/EGGGGGCEGGHGFDDGFG@GHGF<?FHFFHHHGHGHHF?FA@GFHGHEC0GFD?@C?
+@903778/1
+GAATATAGTCAGCGACTTTGCCCTGGCCAATGAGGGGGCGAACGCGCTGTAAAATCGTCTCTAAAATTGCATTATCCATGGCCCTGGCCACAACATGCTCCTTGCTCGCAGGTCTGAAAAGGCCTGCGAGTATAGCAGAGGGCGCCACGCG
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHGHHHHHHHHGGGGGGGGGGGGGGGHHHHHHGHHHHHHHFHHHHHHHHHHHHHHHHHHHHHHGHHGHHGHHHHHHHHHHHGHCGGGGHHHHHHHHHGHHHGHGGGGHHHHFHHHHGGGGGGGGGGG
+@476187/1
+GTATTACCGCTCGTTAACCCAAATCCGCATTTCGCCCTCGCCACGGTTGGCCCAGCTAAACCACGGAATGAACGTTAGCGTCTGCGGCTGGCGCGATGATGGCGCGTTGTCGTAATGCCACAACGCCTGATGCTGCGCATCTGGGGCGCTT
++
+AAABCFFFBCDBGGGGGGGGGGGHHGGGGGGHHHGGGGHGGGGGGGFGGGHHHGHHHHGHHHHGGGGGGHHHHFHHHGHGGGGGHFGGGGGGGGGGGGHHFHHGGGGGGGHGGHHGHHHGHHHGGGGGHHHHHHHFGGGGGHHGHGGGGAG
+@1420860/2
+GGTGAAGATAAGCCGCTAAAGTATCCCCATATGTTTGCCGCTGCGTCGCTCATGCTGCTCAATAAAGTCGATCTGCTGCCCTACCTCAATTTTGACGTTGAGAAGTGCATCGCCAGCGCGCGTGAAGTGAACCCGGAGATTGAAATTATC
++
+BCBBCFFFFFFFGGGGGGGGGFHHHHHGHHHHHHHGHHHGGGGGFEFGGFGGGFHGHHHHEHFHGHHGHGGAGHHFF3GHFHHHHHHHGHHHHGGHGGGHAGGHFHHFHHH?EECFGGGGGGGGGGHHGHHHHDC@@DFFHGFGGHGFFH
+@1169280/2
+ACATAGTTTCGGATTAAGACTATTCCCTGAGGTGCTTTTTAAGCCTATTTTTGCTAGAATTTGGGGTTCAAACCTCAACTTCGTGAAAAATAAAAGGTGTTGGAATGTATCAATCCGACCAGGAGACCTAATGATATTGACTCCCATGCGA
++
+A>AAABFBFFA@1EFG1ADGGGHGF3GGHFFGFGCHHHFFGFHHHHCG1GHGGHHGHHFFFHHGGEEEHHHHGGGHFFGEFGG0?GED1GAGHHB1EDGBFHHFFFHFFHBFHHFHCEE?EHGHGHGGHFHFHGEHDGFFHHF1/BGFH/C
+@1480741/1
+GAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCACCTTCGGTCACGGAAAGCACTGCGACTTTATGCTTTTCGCCCAGATCGAAGCTGGCCGGGCAGACGAGATTACCGACGTTTTCGATAAACAGAATACCGTGG
++
+BBABABBBBBB@GGGGCFFGGGGHHAEFEGHHFHHHHGGGEGHHHGHGFHEHGGHGFGGHGGGFGCGFHHHHGFFEGHFHFHHHHHFGGGGGHHHHHGFGGHGGGHGGCGGGGHGCGGFHGHGG?DGGGHGHGFHHEGFHHHFHHGHGEFC
+@1154049/1
+GTTACATTGAACTTGTGGATAAAATCACTGTCTGATAAAAGAGTGGGTGATATTCTCGTTGCTCATCGGCTTTGGCACGGTTGTTGCTCGCTGACGGTGCCAGGCAATACTGATTGAGAGGATTTGAATGACCAAAGAAATGCAAAATTTA
++
+BAAACFFFFFFFGGGFGGFFGGGHHHHHHHHHHHHHHGHHHGHGHGHEEHHGHHHHHGGGHGGHHHHFGFGGHGHHHHGGGGGFHGHHHGGGGGHGGGGGGHHHHHHHHHHGFHHHFHGHGGHGHHHHHHHFGHHFFEFHHHHHHGHHHGF
+@1538387/1
+CCACGGTATTCTGTTTATCGAAAACGTCGGTAATCTCGTCTGCCCGGCCAGCTTCGATCTGGGCGAAAAGCATAAAGTCGCAGTGCTTTCCGTGACCGAAGGTGAAGATAAGCCGCTAAAGTATCCCCATATGTTTGCCGCTGCGTCGCT
++
+BCCCCCACBFFFGGGGGGGGGGGGHGHHGGGHGHHHHHGGHGHHHGCFGGHGHHHGHHHGHHHHGGGGGHHHHHHHHGHGGGGGHHHHHHHGHGGGHGGGGGHHHHHGHHHHHHGGGGGHHFGHHHHGHHHHHHHHHHHGGGGGGEGGGG
+@794673/2
+TTATTGAGCAGCATGAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTATCTTCAACTTCGGTCACGGAAAACACTGCGACGTTATGCTTTTCGCCCAGATCGAAGCTGGCCGGGCAGACGAGATTACCGACGTTTTCGATAA
++
+A11AA331BFFFGEG1B11EEEE000A///AF0GHBBDH0A/BBFGHFF11EE?/>11B2E2B1121F/EF/E@/A///0B/BF1>EE?/EF0/1D22>DG//C//F/DFF/?CGFGF/?/-@--.CG?@@<<GHHHG.-::./;9:.;AE
+@500661/1
+CGTCTATCCAGCTACCGAGCGGTTCTACGCAACAGCAGACCCTGAAAGTCGTTGAAAAGGTTGAAAACTATTACTTCACCCATGAGAAAGACAACATTATGTCGGTCTTCTCGACGGTCGGTTCCGGCCCTGGCGGGAACGGGCAAAACGT
++
+@BB?ABFFFFFFGGGGGGGGG?FGGHHHGGGGGHHHGHHHHHGHHGHHDG?FGHEHHHHGHHHHHHHHHHFHHHGGFEGFHGHHHHEHHHHHFFHHHH4GFGHHG?AEHHHGEEEGGFDGC/DGHGGGCDEH/GDGGGCGGCDGFGAHFB9
+@1453364/1
+CTATCTGTGCGAATGAACCCACATTACAACAGGAAATTTATTGCGGAAATTGATATATTCACAACGTTATGTTGCGGTTTATGCAACGTCAAAAACCGGAGGTCTGTCTGTGGATTTACGCGATCTAAAAACCTTCCTGCATCTGGCGGAA
++
+BBBBBFBFFFBBGGGGGGGGGGGHHGHHHHHHHHFHHHHHHHHHGGGCFHHHHHHGHHHHHHHHGGHHHHHHHHHGGEGGHHHGGHHGHHGGHHHGGGCGGCEFHFHHHHHHGHHHHHHGGGGCGHHHFHHGGHGHHHHGHHHHGHHFGCG
+@226330/2
+AATCAGGATAATTTCAATCTCCGGGTTCACTTCACGCGCGCTGGCGATGCACTTCTCAACGTCAAAATTGAGGTAGGGCAGCAGATCGACTTTATTGAGCAGCATGAGCGACGCAGCGGCAAACATATGGGGATACTTTAGCGGCTTAT
++
+AA?AAFFBCFBFGGGGGGCGGGECEFGHFHFHHBB2FEGGGGGGGGCGGEHFDGDF@GEHFAFEFHBGH3GB2B33FCGG1EFH3FGHFGGCHGHHHHF3FCHHFBGHGGGCCGCCCCGG//0<FHFBBGHGF.<G0DFFH0<-<-CFF
+@1519654/1
+ACACTGGTCTGGTAAAGGCAGATCCGCAGTATCCTGCGGCATCACGTTGAGCCACAGCTTGCGCCAGAGCGGCGTTTGCCGCTCGCCCTGATATTCCTGCAATTCAACCAGCGTGGTCAGTGGCCCGCCGCCGCGCAGCCCGGTACGATAG
++
+BBCC@FFFFFFFGGGGGFGGGGHHHHGGGGHHHHHHHGGGGGHHHGFHHEHHHHHHHHHHHHGGGGGHGHGGGGGGGGGGGGEGGGGGGHHHHHHHHHHHHHHHHHHHHGFHGGGGEHHHHHHGHHGGGGGGGGGGGGGGGGGGGGGGGGF
+@1239925/1
+ATGCCCAGTGTTACATTGAACTTGTGGATAAAATCACTGTCTGATAAAAGAGTGGGTGATATTCTCGTTGCTCATCGGCTTTGGCACGGTTGTTGCTCGCTGACGGTGCCAGGCAATACTGATTGAGAGGATTTGAATGACCAAAGAAATG
++
+>AAB3CFAFFFFGGFGGFGGGGHHEGGHHHHHGHHHHGGEGHHHHHHHGHGHHHGG2BGFHHHHHGGFGHGHHHHFH?AF0CG3F@FEEFEEGHHFGHGGGGGHGGGHGHHHHHGFHGFHHFHFHHHHHGFFHHHGHHFGHHGHHHEHHHH
+@861827/2
+GTGTTATCTCCGGTCACTCATCATTCCGGGCGGTTTGGCGCACCGCTTGATGTCAGTCATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGCTCGTCGGTTGTGAACTGGTCACGCCAATGGCGCCGGAAATTAAACAAG
++
+1>AAA33333B11A111FGFBEFF33FAAA00AA/AAFFAFG/E//>EA0B2FDB@@11BGFFFHBFBFGF0@B10EFG1G22DDGH1F0CFG///B2>B1F1>B/<A@/CC///2@FF10?F1?<G/AC111>-.--<-<;:00CG0CC:
+@412936/2
+CGCCAATGGCTACTGGGGGCACCCGGCAATGCAGTTACCGCCGGACGTCAACCTGATTGCGGTCGCCCACTATCTGCAGGCGCTGGAATGTCAGCGTGACGCTAACCGCGTGGTGGCGTTGCTGGGCGGTAAATCGCCGCATATCCAGAA
++
+AAAB?@FFFFFFCCDBCA2EEEFD2?AEEFFFHBG5GFFDEEF000>>>F>FG3FGHBFHF/1>/EEEGGGF4?E?GH3FE@?CCGHGGHHFHGHFAD/F//C//GGGGC<CC.<C.@.<-;CCCAGCB@AEGEFGGG@?-99B/B/9;/
+@1029636/1
+GTTTTTCCACCCCGCGTGAATGCGCATAAATGACGCTGATAATAAAAATACCGATAATGATTGCTGCGAACATAACGTCACTGTCCTTCTAAGAAAACCTCATCCCGGGATTTTCAGGCAACCCTCCCGGTGATGCCAAAGAGAAAAGTGT
++
+BACCCCFFFFFCGGGGEGGGGGHGGGGGHHHHHHGGEFGHHHHHHHHHHHHGGGGGGHHGHHHHHHHGGGGGHHHHGHHGGHGHFHFHHHHHHHHHHFGHHHHHHHGGGGGGHHHHHBFGFHHGHHGGGFCCGHGHHHGHHHGGHHHHGH0
+@1133977/1
+GCCCAGGAGACCTTCGATCGGACGGTCGATACACACATCAAAACCCTGCGCGCTAAGCTACGCGCGATCAACCCGGATCTCTCGCCAATTAACACGCATCGTGGAATGGGATACAGCCTGAGGAGCGTCTGATGCGCATCGGAATGCGTTT
++
+BBBBBBBBBBBBGGGGGGGGGGGGGFGGGGHGHHHGGHHHGHHHGGHHHGGFCGGGHHGHGGGGGGGGGGHHHGGGGGGHHHHGGGCGHHHHHGHGGGFGG?GGGHHGHFHHHHHHHEGHFGGHGHGGGGGGHFHFGGGGGGGGGGFGGGG
+@579710/1
+CCTTTATGACTCTGGAGCAGGAGCAACAGGTTAAAACCCGCACCGCCGAACAAAACGCTAAAATTGCCGCTTTTGAGGCCGAGCGCCATCGTGAAGCAGAACAGACGCGCATTCTTGCTGAGCGGCAGATCCAGGAGACGGAGATCGAACG
++
+CCDDDFFFFFFFGGGGGGGGGGGHHHHHHHHHHHHHHGGGGGGGGGGGGGGGHHHHGGGGGHHHHHHHGGGGGHHGGHGGGGGGGGGGGHGHHHGHHHHHHHHHHHGGGGGGGHHHHHHHHHHGGGGGGHHHHHHHGHGGGGGGGGGGGGG
+@50749/1
+ACCGGAGGCTGCTTTAATAAAGTCACGTCTGTTCACGGTTATTCTCCCCGTGAGTCAGCGTTATCTTTCTTTTGCTGACGCCCCAGTTCACGTACCGCCATCACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGACAG
++
+CCBBBCCCCCFCGGGGGGGGGGFHHHGHHHGHHHHHHGGGGFHHHHGHGGEEGGHHHHHGGGGHHHGHFHHGHHHHHFHGDGGGGGHHHHHHHHHGGGGGGHHHGFGGGHDDGGCGGGHGGEHGHG?CGGHDGGGGGGGHGHFHHGGGGGB
+@239626/1
+AGCCCAGCTCATGCACTGCCGCTTCGATTTTTTCCCGGAGTTTATCAGAGACCTGTTCCGGCGTGCGTAAGGCTCGTGATACGGTCATCGTGCCTACACCGGCAAGTTGGGCTACATCGGCGATAGTCACTTTACCGGTACTGCGCCGTTT
++
+BBBBB@AFFFFFFGFFGGCGGGFGGG4EFEHHGHGGEGGGGGHHHHHHGHHH1FFGFAGDEGGFGGGFGGHGHGFEGHCGFHGGHGGFHHEHAGHFBGHFGGGGGGHBHHGEEFFHHG?DDDGC?ADGEHHHHHGHGGDGGHCFEDD@@AC
+@911685/1
+CCGGGGAAGTGGTTGCCATCGTGCAGCGGCAGCAGGTTAAAGAAAGTCGCGGAGCGGGAATTGGCTTCACGTTCTTCCCCTGTCAACCAGCGGTTCAGGACCGCCAGATCGTCATATACCGGCGAGCCGTCGAATGACAGCAGGGCGGTTG
++
+BBBBBBBABFFFGGGGGGGGGGHGHHHGGGGGGFGHHHHHHHHHHHHHGGGGGGGGGGGGHHGHGHHHHHHHHHGHHHHHHGHHHHHHGHHGGDGGHGHGGHGGGGGHHHHFHHHHHHHHGGGGGGGGGDCCD.FGGGGGGGGGGGGFFAF
+@1310326/2
+CACGCCGGTCATGTATCAGCCTGGCATCATATTTCTCTTTTCCGGCCATAAAATTGGCTATATTAACAAGCGCAAGTTTCGTTATGACGCTAATGAATATCTCTTACTGACCGTGCCGCTCCCTTTTGAATGCGAGACCTGGGCGAAGCCG
++
+AA33A>@DDA?FF6FGDFGGGGGCH2AGCGHHFFHHBEFFFHG22EEEHEFEGGCE33FGHEFFHGFHHHHGCGCG3B@EABC1CEHFGCEE?GGEEGHHHHGFFF4FGBFH?EEEHGGGGGGGGBGFE1@@DEFGG/<CCCAGGC-<DF@
+@920038/2
+CTTTGAAGGTCTGCAAACTATCACGACGCGGCGCAAGAGTTTGTTATCAACTTATAACAGCCATGTTACCTGCTTATACCAGCAATACCATGCCTGTCTGCTATGCTTTTTGGTTATGTAGTGTATCAATCTTTCAGAAGTGTGAATCAA
++
+BBBBBFBD4CFFGFFGGGGGFGGHGGG2E?EEG?E0EHAGHHGHHFFHFGFDBB55DFHHFFHHHHGHFHHHFHFHHHEHHFHHBBF3GHHHHHFHFCGHEGHHF3GFGGHG?FHHHEFGBGH?DFGG2FDGBHDFBDFCGGDBDG1?1?
+@492160/2
+GGTCTAGCGTCGCCTGTTCGTCAGGTAGCGGAATTACTCGATTCATCATGGTTTACGTCAATCACATCAGGGTTAACAATACGCCGCAGCGTAGTAAAAAGATCGGTCGCCAACATGCCGCGAGCGCCATAACGCGCTGCCAGTAAGTCCG
++
+AA1>AFFBAAADCFEAFE3EE0GEGBFFHCG?EFFGFD1BG0DFH2BBGFHHHGHGFGFAFHHGEHGFBFHHCFCFGH1FEC/>/E/EEECGGGGHGHHHGEH1FECCGGG?CFAHFFC?C@?CCCCCG.<DGC@--ACGFB0CGFG090C
+@118535/1
+AGTCACGTCTGTTCACGGTTATTCTCCCCGTGAGTCAGCGTTATCTTTCTTTTGCTGACGCCCCAGTTCACGTACCGCCATCACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGACAGCGCCCGCAGAGATATTGCCG
++
+1AA1>FA>>CAFGGGGG?FAEGH3GDBEE?BAF?G11FGCAECHHHHHEAGGEF1FBFFECG?EFEHHG2EGHGEC?E@/?F1B/CEEC0?EE//EG@FHEGAFH//<@/G?AF/<><<F.FG<GGCGGG-:-@?---A--C/;000;F0-
+@51675/2
+GTATGAGCGCGTATATCAAAACGCGCCGAAAAGACTTACCCTGATATAGACTGCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTGGATCAAACTAATTATGTTTGGTGTGCTGGAATGATGTACTGA
++
+1>AAAFF1ADD>00BFFDEDFAEEE??EGGG/A/BEDBGFFBFGG2G2BDD1C0E?//A1BEFFCGH0GFFB12BFFGFFFFFFF2F11GD2GD/EE/<FGHEHHHGFB0G1BC1BGHF1>FDDG@F2@F<FFEFFFEAGDCGGF1FGB1<
+@1387565/2
+TCGATACCCCGTAAACGGCGCAGTACCGGTAAAGTGACTATCGCCGATGTAGCCCAACTTGCCGGTGTAGGCACGATGACCGTATCACGAGCCTTACGCACGCCGGAACAGGTCTCTGATAAACTCCGGGAAAAAATCGAAGCGGCAGTG
++
+BABBBBBFFBDAGGGGGGGGG?GFGHFEFFGGGHHHHHHFHHGEDEGFGHGGEHHHHGHHHHHGGGGEGFFHFFEGAF4FFFFHHHHGGFECGHHHGGGGFGGGGGGGCEHGHHFHHHHGHG11FGFGGGGGHFHGHHGHGFGGGGGGGG
+@108853/1
+ATCTTATCTGGATTGAAGAACCACTAGATGCTTACGACATCGAAGGCCACGCCCAGCTTGCTGCCGCGCTGGATACGCCTATCGCCACCGGGGAAATGCTGACCAGTTTCCGGGAACACGAGCAGTTGATTCTGGGCAATGCCAGCGATTT
++
+AB?ABFF5FFFFGGGBGGGGBGFGFGEHFFHHBGGFF2AAF?CHE22F2FEAE?1GFHH3EG5FAEGGCEEEGDGHGGGGGHHGGAEDGFC/EEE/FG1?GGHHFGFGHHHFGGCCFHFDDCCCGHFHFHGGDD1FHFEFFH0GC.CCEHA
+@635321/2
+GACTAATAGCGTGGTCTGTCGCCTTTATCAGCGCGCAGTGTCCCATTCCATCATCAGAGTCCAGAATAGCGACTGAAGGCGAAATCTGTTCAATGCTGAATGTTGCTTTTGGATTGAGCCCGCCTGCGTTCAGGCGGGTACAATAGTGCT
++
+AAA1>1B3B11AA1AABFD30FEAAG13FFGHGGEGC/EHD2AGGFDGHHGGHGHDGDGFHFBHFHHH11>/>E>C@E1>//EEFHHBFHF2FB212FB122BB>11FGFE?1FHFBGHHGGCGGCFC?CG1GGBAG-<-<0<=00<000
+@215257/1
+CGGTTATTCTCCCCGTGAGTCAGCGTTATCTTTCTTTTGCTGACGCCCCAGTTCACGTACCGCCATCACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGACAGCGCCCGCAGAGATATTGCCGCCTTCTTTCATATTG
++
+ABBAAAFFFFFFGGGGGGGGGGHHFGGGHHHHHHHHHHHHHHHHGGGGGGGHHHHHHHHHGGGGGGHHGGHFGDGGGGGGGGGHHGHGFHGGGGGHGGFGCCFGHGFGHHGGCGGGHGGFCGGGGGHHHHHEGEFGGAGGGGGGGFGFFGF
+@226257/2
+CGGTTATTCTCCCCGTGAGTCAGCGTTATCTTTCTTTTGCTGACGCCCCAGTTCACGTACCGCCATCACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGACAGCGCCCGCAGAGATATTGCCGCCTTCTTTCATATTG
++
+>AA>AAFFFFFBGGGCAAEGGGHFFGGGHBGHHHHHHHHHHFBCFEAEEEDHHHFHFGGHGGGGGGHFGGFEGDHDEEGCC/@FGEGEFH?/C@CCDDGGCGFG/CGFGHHG-CCFGGGGGGGG?DHCCHHHHGGG?CAFGBFGGFGGFFF
+@890868/1
+GAGTAATATATCCGGCCTGAATAAAAAAACCGCCGCTATTACAAGCGGCGGCTCTCAGTTTTTATTTTTTAGCAGCATCTGCGGCTTTAGCGTCAGCCGCATCGGCAGGTTTAGCATCCGCTTTCTGCGCTGGTTTGATATCCAGCAGCT
++
+AAAAABFFFFB3BAAEEGEFGFFGFGHGG?EGGGGC?EEEHFEFHCC//>/E@EF1FGDFHHG/GGHHHGHHHGHFC<GFBGCCGG@GDGF<<CCCBFGGGC@.E@CGG.0=<0=00</.:.CF00:0:----9CF.0;;00C0CB/.//
+@1355229/2
+ACTGATGGGTCCGCATACCTTTAACTTTAAAGATATTTGCGCCCGTCTGGATCAGGCGAGCGGACTTATCACGATTACCGATGCGGCTACGCTGGCAAAAGAAGTTTCCTCTTTACTGACCGACGCTGATTATCGTAATTTCTACGGACGT
++
+3ABBCBFBBFFBGGGGGGGGGGHGHHHHHHHHHHHHHHHHGGGGGGGHGHHHGHHHHGGGGGGGGGHHHHHGGGHGGHHGGGGGGGGGGHFGGGGGHHHHHGHHGGFGHHHHHHHHHHHHHGGGCGGGGHHHGHHGHHGHHHHHHGGGG?.
+@1213709/2
+ATAAACGTCCCGTCGCCGTTACCGCCTGATGATAGGACGTATGGACGCGCCCGGTTTTCGGGTTAATCATCAGCGGCAGCTTATCGGTATAGGTGGATTTTAGCTTCGCCAGACCACGATACTCCAAAATCACTTTCGGCAGCGGATAGT
++
+AAA11BABAAA>GECEF0E0EFGEAEGHBGFHGHB0BFE//FF01BEECEGG/E>?ECGEGF>//FFFGGHH1FA@E?E?GGGFFHC?/F>GHFFFCG1F1>CDGHDCCFCGHG/<C/>FCCHHGFF1FHFFC=DGH.-A-@CCCC?./;
+@598921/2
+GTCTTCCAGTTCTTTCATCTCTTTCATCAGCGCGGCCGGAGACAGCACAACACCGTTACCGATGATGCTGGTTACATTCTCGCGAAGAATACCTGATGGAATAAGATGGAGAACGGTTTTTTCACCGTTGATTACGAGAGTATGGCCTGCG
++
+BABCCFFFFFFFGGGGGGGGGGHHHHHHHHHGGGGGGGGGGGGHHHHHHGGHGGGHGGGHGFGGHHGHHHHHHHHHHHHHHGGGGCGGHHHHHHHGHHHHHHEHHHHHHHHHHHGGGGGGGGHHHHGHGGHHHHHGEGGFHHHHHHHHGHG
+@306276/2
+CGGTTATTCTCCCCGTGAGTCAGCGTTATCTTTCTTTTGCTGACGCCCCAGTTCACGTACCGCCATCACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGACAGCGCCCGCAGAGATATTGCCGCCTTCTTTCATATTG
++
+>AAAAAFFFFFBGFGFGGGFGGCHFEGGHHHFHHGHGHHHHHC2EFGGFGAGGHEFHGFFGGGGGGFFHGHGG?FEAF///@@GHEHFEH?ECCGEDFGGGGGCFGHGBFCF-CFGHGG-AFGGG-CGGHHBCFF?G?EFGGG0FFEFBFB
+@318573/1
+CCATAAGGGCATTCACCAGCTTGCTCATGTCGAAAACCAAACTCCGCGTTCAGAGAAACCTGACGTCAATATGAAAGAAGGCGGCAATATCTCTGCGGGCGCTGTCGGTCTGCTTGGCGGCGTGGTCGGTCTGGTTGCCGGCGTCAGCGTG
++
+CCCCCFFFFCCFGGGGGFGGGGHGH5FFGGFHHGGFHGHHGHHHHGGGEGGHHHHHHHHHHHHHGEEEEHHHHHHHFHHHGHGGGEEGHHHHHGHHGGGGGGFGGHGGGGGGHHHHGHGGGGCCDCHDGAEDHFGGGGGGGGGAGFGGGFF
+@242215/2
+TTTCGATACCATGCGATAGCCTGTCTGTCGCTTTGCGCGACGCCGCGACCAAATGCAGACATGATGCCCAGATGCGTTTGCGCAGCAGGCAGCCCCTGGCGAGCGGCTTTGCGATACCACGCCAGCGCCTGTTGGTAGTCCTGAGAAACG
++
+AAAAAAFADFBDF1A1GCGGGG0EGHH3FFEGFFHHGGCAE?E?EEEEECGHHHEHHHHHHHHGHFHHFH>CFHD@//EFFGGECGGGHGEGGHG?GGGF@CCGGCG@C/DFCCHFGHGFGGEFGGGGGGGFGFGCFBB0FBFGGGEFG?
+@644773/2
+CTGTTGTATGGTGTTGAACCGGGGCCGCGCACGCCGGTCATGTATCAGCCTGGCATCATATTTCTCTTTTCCGGCCATAAAATTGGCTATATTAACAAGCGCAAGTTTCGTTATGACGCTAATGAATATCTCTTACTGACCGTGCCGCTC
++
+>AAAB4BDDDB@FE?FGGFGA2AEGGGGEGGGGGGGGGCGHBGGHHHGFFFHHGFHHFFGHFH4GHHFFHHFEEGGGHHHHHHGGFBFGEHHDGFFHHHEA@@DCFHGHGHHHGHGFFGCEAGHHEGFFHBFDGEBGGHHFGDEAEDGCG
+@772895/1
+GTGATCATGATTAGTCGTGCTCAAAGCGGGCCCCCACTCTACAAGTTGCAAAATTTGTTACGGGTAACTGTTATCGGTAACATTGTCCAACCGCACCATTCACGACGCAATGACCATTCGTGCCAAAAGTGAATAAGTGTGAGCTACTTCA
++
+AAABCFFFFFFFGGGGGGGGGGHHHHHGGGGGGGGGGHHHHHGHHHHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHGGHGHHHHHHHFHHHGGGGGGGHHHHHHGGGGGGGHHHHHHHHHHGGHHHHHHHGHHHHHHHHHHGHHHHHHHHH
+@332604/2
+CCGGAGGCTGCTTTAATAAAGTCACGTCTGTTCACGGTTATTCTCCCCGTGAGTCAGCGTTATCTTTCTTTTGCTGACGCCCCAGTTCACGTACCGCCATCACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGACAG
++
+AAA???@A>FAFGGGFGGFGGAEGHFHGFGDGFHHHGEFGHGH5FFHEE1EEDHFHHHGGEGHHHHGHHHGHHHFHHHGGEEGGEFHHHFFGFGEFCGGGHGHGFFG/E/EGC?CCGHG<FAFHCCGGCHDGGGCCGCCEHFHHEGGGBG
+@94405/2
+ATTCTGGTGAATAACGCGGGTTTGATCCGTCGTGAAGATGCGATTGATTTCACGGAAAAAGACTGGGATGACGTCATGAACCTGAACATCAAGAGCGTGTTCTTTATGTCTCAGGCGGCGGCAAAACTTTTTATTGCCCAGGGCAACGGCG
++
+BBBBBFFFFFFFGGGGGGGGGFGGBFHHHGHGGGFFHFFHHCFHHGEHGHHHHHDCGGGHGAGHHEHHFGHHGGGGHHHEHHHGEGHFGHHHEGHHGEAEAFGHHHHHHHHFHFBGG/BCDGGGGFGBGDGHHHHHHGCBEEFGGEG@AAA
+@216098/2
+ACCTGGGGGAGGCAATCAGTGTTTACACAGGAGCTGCTCCAGTTCGCTTAATGACGCCACAGTCCAGGTTGGATGAATACCCGCGGGCTGCTCGCGATGATGCGCGTTAAGCCAGCAGGTCGACAGCCCGGCGTTAATGCCGCCAAGAATA
++
+BBCCCFCBCBCCGGGGGGGGGGGHHHHHGHHGDHHHHHHHHHHHHGGGHGGHHHHGGGGGHHHHHHHHHHHGHHHHHHHHHHGGGGGGGGGHHGGGGGGHHHHGGGGGGGHHGHGGHHHHFGGGGGHFGGGGGGGGGGGGGGGAGGGGGGF
+@516724/2
+ACGTATAGTCAGAAATAGCGTCAGCGTTGTGGCTGACCAGCCAGCCGCTGAATTTTGAGAAAAAGGAGAGTCTGAATGCAAGCAACAGTAAAACGGCGGCTGACGAAGGTCGCTTTAGCATTAGTAGTTGCCGGGTATTGCGCCGCGCCAG
++
+>AA3>FFFFFBFGGBGGEGEGEGGHGGGG2EGHHGGHHHHGGHHGGGGGGGEHGHHGFFEHHHHGGHHHGHHFHFFHHHHGHHHGHHHHHHHHHGGGGEGGGGHGGG?DGHG/BGFDBFFHEF1GHHHHHHHGC@<<1DHHFGFGGC?CG-
+@432112/1
+AGTTCACGTACCGCCATCACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGACAGCGCCCGCAGAGATATTGCCGCCTTCTTTCATATTGACGTCAGGTTTCTCTGAACGCGGAGTTTGGTTTTCGACATGAGCAAG
++
+CCBBCFFCFFCCGGGGGGGGGGGGGHGGGGGGGGHHGHHGHGGGGGHGGGGGGGGHGHHHHHGGGGGHGGGGGGGGGHGHHHHHHHGGGGGHHHHHHHHHHGHHGGGGGGGHHHHHHHHHHHGGGFDCGGGGCFGGGGGGGGGGGGGGG
+@75872/2
+GGGGAGCGACGAGGCGCAAAAAAACGCCTCTATTTGCGATAAGCACCACATTTTATTGGCATTATTGCTGCCTGTTATCGTTAATACTTGACATAGTTTCGGATTAAGACTATTCCCTGAGGTGCTTTTTAAGCCTATTTTTGCTAGAATT
++
+?A@AABBBDDB2E?EEGGEGGCGGGCEGHGHHHHHHFGGGGGHHGHEFGCGGHHHHGHHGHFHHHHFEFFHHHHHGFHHCGHHGHHHHHHHGDFHFGGHHGG?FFFHHHFHHHHGFFGHHGGGHHG1FGHHHHECFHHGHFHCGHHGHFHB
+@452473/1
+AGCTTGCTCATGTCGAAAACCAAACTCCGCGTTCAGAGAAACCTGACGTCAATATGAAAGAAGGCGGCAATATCTCTGCGGGCGCTGTCGGTCTGCTTGGCGGCGTGGTCGGTCTGGTTGCCGGCGTCAGCGTGATGGCGGTACGTGAA
++
+BBBCAFCFFFFFGGGAGGGGGGHHHGHHGGGGGGHCFHHHHHHGHFFFGGGGGHHHHHGHHHGGHGGGGGHHHHGGHGBEGCGGGGG?GFGFGGFFFGFGFGGGGGGFHHGGCFDGHHHGHECCGAGGGGGGGDBFFFGGA;AD?:B;?
+@684135/1
+ACACCGTGCCGCCAGCAAACCAGGATCATGACGCGCCGCTATTGCAGCAGTATTTCTCCTGAGGATTTTCGCCCGGTGGCGGCTACGCCTTACCGGGCCTACAGTAAGCCGGATAAGCAAAGCGCATCCGGCAAATAAATCAACGAAAA
++
+BBBBBBFBBBBBGGGGFGFGGGHGHHHAGHHGGGGGGGGGGGHHHHFHHHHGHHGHHHHHHHHGEHHHGHEGGGGGGCFHGGGGDHGGCHGGHHGCCCGGFHHHHEH?FGGGGGGHHHHHBGHGGGGGHGGGGGGHFGFHHGHGGEFAG
+@730250/2
+CCATCATATTAAAAGGCCTTTTTTATTTGAAAATGACTCCATGAGTTCATTCCGGACGCCAATTTATTACCGGTAAGAAAAGCGAACTCACCTAATTTAACGGTCTGGTGACCAGAACCGACCGCACGCAAAAGCTTCTGAACCGATGAGG
++
+ABB?BFFFFFBFGGGGGGGGGGGGGHHHHHHHHHGHHHHHHHHGHHHHHGHHHGCFFGGGGGHHHHHFFHHGGCGEFHHHGHHGGGGHFHHHHHGFHHGFHGGGGGHHGEHHHHHHGHCFCCCCCGGGGCCGBFHHGHHGFHHHGCGGHHH
+@129201/2
+GTCTATCACTAAAGATCAAATCATTGAAGCAGTATCCGCTATGTCCGTAATGGACGTTGTAGAACTGATTTCTGCAATGGAAGAAAAATTCGGTGTTTCCGCTGCTGCTGCTGTAGCTGTAGCTGCTGGCCCGGCTGAAGCTGCTGAAGAA
++
+AAAA?FFFFFFFGGFGGGGGGGHHHHHHHGGHHHCFHGGGGGFHHHGEFGGHECFGGGEFHHGHHHHHGHGHHHHHHHHGBFHHHHHEHHHFHGEFGHFHCGGGGHHHHHGGFHHHHHGFHHHHHHFHBEAGGGCGGGGFEFHHHGHGGBF
+@1416808/1
+TAATGAACCCTTCCATGCTGAACGCGACCCTACTAACAACTGCGCCATCTCGCGCAGTGGTCGTCGTGCGTGTGGTGGTGGTCGTCGGCAATGCGCCGTAGGGTCCGGAACACACACGATTCCAAAACCCCGCCGGCGCAAACCGGGCGGG
++
+BBBBBFFFABFFGGGGGGGGFGHAEGGFCCFFHHGHHHFHFHH?FGGGHHFFAEGGGGHHHHGEFFEFGGFFGFC2FE?FEEHGGGGCFCDHHHGGGGGGGGF0GEFCFGGGHHGGGDDHHFHGBGGFGGGGGGGGGGGGABFEA>=-@DF
+@575941/2
+CCCCGTGAGTCAGCGTTATCTTTCTTTTGCTGACGCCCCAGTTCACGTACCGCCATCACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGACAGCGCCCGCAGAGATATTGCCGCCTTCTTTCATATTGACGTCAGGTT
++
+AABABAAAAFFFCGEGGGEBGGHGBFDHHCHHCGFGGGGGGFGHGHGGEHGCEGCGGHHGHGGDFFG@EECEFFFFFFGHGGGGGCGGGGGGGGHGHGHHHGGGGGHGGGGGGGGFHEHGHHFHH?FGDFFFGFF00C9FBBFD9CEDFFF
+@683138/2
+CGGTTATTCTCCCCGTGAGTCAGCGTTATCTTTCTTTTGCTGACGCCCCAGTTCACGTACCGCCATCACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGACAGCGCCCGCAGAGATATTGCCGCCTTCTTTCATATTG
++
+AABAAAFFFFFFGGGEGGGGGGGHGEEGHHHHHHHHHHHHHHHHGGGGGGGHHHHHHFHHGGGGGGHFFGHGGGHGGGGGGGGHHGHHGHFGGGGHGGGGGGGGHEGFHHHGGFGGHGGGGGGGGGHHFFFHHGGGGADDFFGGGGGEFG0
+@1269558/1
+AACATGATGTGCCCGGTCAACATGATGGTGCGAATACCGGTAATGCGTCGCAACAAGACGTAACAAATATTCAGCGCCAGCGCGAGCAACACCGCGTAGCCTACCCAACTATACGCATCACCCATCCGCTCGATCGTTGCCATCATCGAAG
++
+CCBCCFBFFFFFGGGGGGGGGGHGHHHHHHHGGGGGHHGGGGGHHHGGGGGGGGHHHHHGFHHGHHHHHHHHHHHGGGGGGGGGGGGGHHHGGGGGGGGGHHHHHHHHGHHHHHHGGGGHHHHGHHHGGGGGGHHGGHHGHHHHHHHHHHG
+@1067901/1
+GCGCTTCGCCGCGCAGGCTTTGGGTCAGCGAGGTTTTTCCGCACTGGCTGGGGCCGATAAACATCAAACGCTTCATGACTTTACGTCCGGGTGATCGAGCAAGTGGTGAACTGCATCATTTCGCCCAGCGTGCGCGTTACCTGCTTGAGGG
++
+BBBA@?ABBA@DCGGGEFGGGFBFFHHCHGGGGEGFAFGGGGG?EGFEHEAEFGGGGGGGHHHFFFHFFGGGGGHHHFHHHHHGEGFFGGGDDEFFCDFFGHHHHHHGHHHHHGHHHHGHHHHGGGGHHGGDDGGFFGGGHHHHGGGGFFA
+@623770/1
+GTCCCAGCGCGTCGTTATTCATCAGGATGATTTTCACATCCAACTGGTTTTCACTGGCGGTAGCCATCTCCTGAATATTCATCATCAAACTACCGTCGCCGGAAAAAAACAGCACCTTGTTGCCCGGATTCGCCAGCGCCGCGCCAATCG
++
+A11>>1FCDAD>AEEEGFGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHGG>/?FG1FFE@GE11FDEGH2BFB2@22GHDF@GH/?/E@F@E/>CHH/<?<00@FG<G1FH01GH/C<AA1.AEC-.-<C-:-;A.ABB.
+@739855/2
+AATATCTCTGCGGGCGCTGTCGGTCTGCTTGGCGGCGTGGTCGGTCTGGTTGCCGGCGTCAGCGTGATGGCGGTACGTGAACTGGGGCGTCAGCAAAAGAAAGATAACGCTGACTCACGGGGAGAATAACCGTGAACAGACGTGACTTTAT
++
+CCCCCFFFFFFCGGGGGGGGGGGGGGHHHHHGGGGGGEGGGHGFGGGHHHHGHHGGGGFFEGFDDGFHHGHGC>DGGGFHGFHHHHGGFCFGGFHGHFH.CGHHHHHHGGGDDGGGGGGGGGB?EFFGGFFFFFFFFFBFFFA.AEFFFFF
+@1258095/2
+ATGCTGTGCAGCCATTGCCGCGAGCGTTACTACCCGCAAATCGCCCCTTGCATTATCGTCGCGATCCGCCGTGAGGATTCGATCCTCCTTGCCCGGCACGTTCGCCACCGCAACGGCGTGCATACCGTGCTGGCCGGGTTTGTTGAAGTCG
++
+BBBABFFFFFFFGFGGGGGGGGGCGGEGFEHHHHHGGGGGGHGGGGGHGHHHGHHGHHFHGGGGGGGHGGGGGGGGEFHHGHGHGHGGHHGHGHGGGGGGHHHGGGGGHGGGGGGGGG-<EHFFHHGCCEEFHGHGAF.CFGBGGGGGFGD
+@742316/1
+TCACCCTGGCGGCCGCGCTGCTGCACACCAAAACCTGGTTTGAACTGGCGCCGAAGGCGGCCAATATCATTGTAAAAGACGAAAAAATGGGGCCAGAGCCAATCATCAAAGGGCTTTGGGTGGTCACTGCGGTAGTCACCGTAGTCATT
++
+CCCCCFCFCFCCGGGGGGGGCGFHGHHHGHFHHHGHHHGHHGHHHHHHHGGGGGGGGGGGCEGGHHHGGHHHHHHHHHGHGGGGGFGHHHGGCGGHEHHHGGHHGHHHHHHHGGHHHGHGCEGEHHHFHHGC;DFFFGGGGFEFGGGGF
+@847768/1
+CCATAAGGGCATTCACCAGCTTGCTCATGTCGAAAACCAAACTCCGCGTTCAGAGAAACCTGACGTCAATATGAAAGAAGGCGGCAATATCTCTGCGGGCGCTGTCGGTCTGCTTGGCGGCGTGGTCGGTCTGGTTGCCGGCGTCAGCGTG
++
+BABBBFFF@ABFGGGGGGGGGGHHGHGHGHHHFEGGFFHGGHHHHGGGEFFGHHHHGGHHHHHHGEEGGHGHHBGFHHHGHGFGGGGHHHHHHFHHFGGGGGGGGFF?<EDHBHHHGHGGCGDGGHHGG:CDFHFFFGFAGGGDCG?FFFF
+@1438912/1
+CAATAGGATCTTCCAGCGTCAGGATGTGTTTATCGGCATGTTGATTAAGATGTCCCACCATCGCCGCCAGCGTAGTGGATTTCCCGCAGCCAGTGGCGCCAGTGACCAGAATCAGTCCGTTCTCGCTGGCAAGCAGTGCGGGTACTATCGG
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHGGGGHFHGBFHHHDEGFHHGHHHGGHHCEGECGCEEE?AE?FGEHHHFHHEEEECHFFHGHGFGGGG?GDHHHHFGGHGFHHHBHHBCGFEFDGA0GAGBH?GGGGGFGHHH0GAE
+@370134/2
+CTTTCTGATCTCCCTTCTGGACCCGTTCAACCAGGACCTGGTCCGTTAACTGCTCGCTCATCCGAGGTAATGTCTCCCCAAACCAAATTTCCACGCGCTTTCGAAACGCCACTCCATAAGCCGCACTATGAGCAAGCAACAGGTTAGAGTG
++
+ECCDEFFFFFFFGGGGGGGGGGHGGGHHHHHHGHGHHHHHHHHHGHHGGHHHHHHGGGHGHHHGGGGGHHHHHHHHHHGHGHHGHHHHHHHHHHGGGGGGGHGGHGGGGGGGHHHHHHHGHHGGGGGHHHHHHHHHHHGHHHHFHHHHH1F
+@659264/2
+GATCCAGCACGGCCTTGAAGTTATCCAGCGCCCGCTTCATCTGCGGATTTTTACGTAACTCCATGCCCACACAACGGGCTTTTAGCCGCGCCTGAATATGCGTCAGGTGTTCGCGATTTTCATCAAGCCATTGCGCGCCGTTCGCGGTAAT
++
+BCCCCFFFFFCCGGGGGGGGGGHHHHHGHGGGGGGGGGHHHHHGGGEGGGHHHHGFHHGHHHHHHHHHHGGGGGGGGFGGHHHHHHHGGGGGGGHFHGHHHGGGGGHGHHGHGGGCGHGHHHHHHHHHGHHGHHGGFGGGGGHGGGGGDE;
+@531695/2
+GTATGGACGTGAGCGAGGAAGGCGGGCAACATTCGGTCGCGCCCCATTGAAAATAACACTCTGGACACCGCCGTTTGCGCGGTAATAATGTTGCCGACGGCGCACACAAACGCCACAATGATGGAAAACGCCACTTTGAGCCAGATACCG
++
+AABCBFFFBCCCGGGGGGGGGGHGGGGGGHHHHHGGGGGGGGGGGGHHHGHHHHHHHHHHHHHHHGHHGGGGGGGHGHGGGGDGGHHHHHHHHHHGGGGGGGGGGGHGGGHGGGGGGGGGEGGGGGGGGGGGGGGGGGGFFFFFFFFFFF
+@1508596/1
+CCTGAACGCAGGCGGGCTCAATCCAAAAGCAACATTCAGCATTGAACAGATTTCGCCTTCAGTCGCTATTCTGGACTCTGATGATGGAATGGGACACTGCGCGCTGATAAAGGCGACAGACCACGCTATTAGTCTGGCGAGAGAGACGGGG
++
+AAAAAFFFADDDGGGGG/GGGF1FFHHHBA1GA00FFFH1FFHHGGEHHGDHHF0>EEE@@GFFGG?FGHGFFFFF1GFHBGH2DBHBHFHHHEFFCEGHCEGGGCGB2GHEHH?/@?CFFEHHGGGGGGFEGHFHCFC@@-:EACGCCCG
+@1303115/2
+GAATAATCTGGGTAATGAACAGGCTGGAAAACATCGCGACAAACGCCGTAACGGTGACCGACTGACCGGCGACGCCCTCGGAGATCCCCAGATCCTGCGCCATCGGCGTCAACAGACTAACGGGCAAAAACTCAACGGTAATCAGGCAGG
++
+BAABCFFFFFFFGGGGGGGGGGHGHHGHHHHHHHHGGGGGGGHHGGGGGGGGGGFHGGHGGGGGHHHGGGGGGGGGGGHGGGGGHGHHGHGGHGHHHHGGGGGHGGGGGGGGHHHGHFHHHGGGGGGHHHGGGGGGGGCEGGGGGGGGGG
+@209923/2
+GTGTTTCGCCGCCAGATCCATAATCTTCAGGAAAGGAGAGATACCGCCGACACGCGGCGCATCTGGCTGAACGAAATCGCTGGCATTGCCCAGAATCAACTGCTCGTGTTCCCGGAAACTGGTCAGCATTTCCCCGGTGGCGATAGGCGTA
++
+AAA3AFF??AB?AEEGGFFGGBFG5FFHDE3BGFGCFAGGEGH53EEAEGGGEGGEEG@ECECEFHHHEHGHF?F?FGDEADGAC11FGGFCGAGHHH1FFF1DGF<CF0<FG?@A-AGHHGHHHEHHHBD<<DC@@:AEH?D-A.9FBFG
+@66625/2
+CTCCAACGCCGCCGAACTGTTCGCGCAGCCGGACATCGACGGCGCACTGGTAGGCGGCGCTTCTCTGAAAGCTGACGCCTTCGCGGTGATCGTGAAAGCAGCAGAAGCTGCTAAACAGGCTTAATTGCCAATCAATGTCTGATGGCGCTG
++
+CCCCCFFCBBBCGGGGGGGGGGGGGGGGGHGGGGGHHGHGGGGGGGGGHFGHHGHGGGGGGGGHHHGHGHHHHHHHGGGHGHHGGGDGGHHGHHHGHHHHHHHHHHHHHHGHHHHHGGGGGGGGGGGGGGFFFGGGGGGGGGGGGGGGAF
+@933950/2
+CGCTGTCGGTCTGCTTGGCGGCGTGGTCGGTCTGGTTGCCGGCGTCAGCGTAATGGCGGTACGTGAACTGGGGCGTCAGCAAAAGAAAGATAACGATGACTCACGGGTAGAATAACCGTGAACAGGCGAGACTTTATTAAAGCAGCCGCCG
++
+?AAA?1B>1AAABE3D10FAEE///EA1/EAE/0AFB/B1>//EEE/>1?E//?21>E/>/E/B0FF111B/@A>/ACA11F1G0FAC><GB11A.<<>B1=G<C?C--<DCBCG0G-..:;GF/.:9-9-.90BFF00;0BBBBBA--9;
+@941372/2
+CCACCGGAGGCTGCTTTAATAAAGTCACGTCTGTTCACGGTTATTCTCCCCATGAGTCAGCGTTATCTTTCTTTTGCTGACGCCCCAGTTCACGTACCGCCATCACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGA
++
+3>ABBABBBBABCEGFGGGGFGHGHHGHGHFHGHGHHHHGFFGHFFBHFGG2B3FEFGHHHEEFGHHHHHHHHHGHHHGBF1FGGGGGHHHHHEHFHGGGGGGHBGGHF/FGGGGGGGGGHEFEHGHGGGGGHCGGFCDF-:E/GHGGFG
+@1216904/1
+AGGTAAACATGCGATACGGCTCTTTGGTGCCCAGCGTACAGAGATCGTCCACCAGCACGCCGAGATAAGCCTGAGAACGCGCAGGCGCCCAGCCCTCTTTGTCGGCGGAAAGACGCGCGGCATTCAGACCAGCGAGCAAGCCCTGCGCCG
++
+1AA1ADFFD1CF?1A111AE?ACFBGHF0DHHFCA0EEAGHBGF1FEBEEFFGHHHGH/EF//EE>GFFDE1GHGHHGGCGGCGGGGEC@EGHFCEHGGGHDDB@C?<C@-FF0A?CGGC-CCC0990FAFAE?@?AABB..AFF?@<B@
+@498097/1
+ACTCAGGACGGTAGACCGGATAAGGCGCTTGCGCCGCCATCCGGCCTGTAAGGTCTCAGCGACCGGAATTTAACTTAGCAACTGCCGGCTTACCAGCGGGCCGCTGATGTTTTGCGCCGCGCGTTCCATCACTTCCTGTATCACTGAAGAG
++
+BBBBBFFFBDBBGGGGGCGFGGHHHHGGGGGHGGGGGGGGHHGGGGGGHHHHHHHHHHHGGGGGGGGGGHHHHHHHHHHHHHHHHHGGGGGHHHHHHGGGGGGGGGGHHHHHHHHGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGF
+@781151/2
+ATGCCTATGGCGAGCTGGTGGCGCAGGGCTGGCTGGAGCGACGTGGCCAGGCAGGCACGTTTGTGAGCAACGCTCTACGGTTTGAGACGGCGCCGCCGATACCCGCTGTTTTTGCCGGAGAAAGTCCGGAACCGAAACCCTTTCAGATGGG
++
+BBCCCFFFFFCCGCCGGGGGGGGGGGGGGHGFGHGGHGHGGGGGGGGHHHGHHGGGHHGHHGGHHFHHHHGGGGGHEHGGGFFGGFEFGGGGGGGGGGGAFGHHGGGGDHHHGGGFGGGGGFHFGFGFFGGGFGGGGGG?FFFGGFGFFFF
+@978740/1
+CACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGACAGCGCCCGCAGAGATATTGCCGCCTTCTTTCATATTGACGTCAGGTTTCTCTGAACGCGGAGTTTGGTTTTCGACATGAGCAAGCTGGTGAATGCCCTTATGG
++
+BBBBBB@?FABBGGGGGGGGGGDHGGGGGH?EEEFGGGFGHGHGHG@EEGECGGGGGGGGHEHGHHFFGGGGGGEHHHHHHHHGDHHDGGGGH1?GBHHHHHEHHGGGGGFHHHGEHHGHGGGGGHHGGGGBEGGFFFGGGGGGGFFFFGG
+@264376/1
+TTAAAGTAGTTAGCCATGATGGTGTACTCCGTGATGTTGTGTTGTCGCGCTTATTGTTCGGTTTACAGATTGCTATCTGTGCGAATGAACCCACATTACAACAGGAAATTTATTGCGGAAATTGATATATTCACAACGTTATGTTGCGGTT
++
+BBBBBF5FFDFFGGGGGGGGGGHHHHHHHHGHGGHHHHHHGHHHHHGHGGGGGHHHHHHGGGGGHHHHHHHHHHHHHHHHHGGGGFGHHHHGGGGHHHHHHHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHFHHHHGGHHHHHHHHHGGEG
+@1188139/1
+CCATAGAAGTGATTGAGAAATACTTCTGGAGTGAAGAAGAGCAGATGTGCCTGGAGTCCTGGGACGAAGCCTTTAGCAAAACCGAAGATTACCGTGGCGGTAACGCCAATATGCACGCCGTCGAAGCGTTCCTGATTGTTTATGACGTTA
++
+AAAAAF111@D3BFG1ECFFGBGHHHHHHDG1AFGHFHBFGHHGHHFGDDG1AC0BEFGFEHGHA?AECE0GFF1GFHGBFEFEEEEEHHFBGGGG?EEEG/F1>EEE/GHEHFG1F?FCBC?@E/<@/?<FDFFHFEHB<GFBHGGCFH
+@1086410/1
+TTCTTTTGCTGACGCCCCAGTTCACGTACCGCCATCACGCTGACGCCGGCAACCAGACCGACCACGCCGCCAAGCAGACCGACAGCGCCCGCAGAGATATTGCCGCCTTCTTTCATATTGACGTCAGGTTTCTCTGAACGCGGAGTTTGGT
++
+BBABBFFFFFFFGGGGGGGGGGHHHHGGGGGGGGGHHHGHGGGHGGGGGGGFHHGHHGHGGGGGHGGGGGGGGHGGFFHGGCCDGHCGCFGGGG?GGDGHHHHGGGGFGHGHHHHFFHCBBGFGGGGHGHHHHGGEFFFGGGGGGEGGGFA
+@398831/1
+CCGGGGATGAGCTTTGGCGCGCGCCTGCCGGAAAACATTACGCCGGAATTCGTGCGTGATGAAGTCGCCGCGGGCCGCGCGATTATTCCCGCCAACATCAACCACCCGGAATCGGAGCCGATGATTATCGGCCGCAACTTCCTGGTCAAAG
++
+CCCCCCCCCFFFGGGGGGGCGGGGGGHHCGGGGGHGHHHGGFGGGGGGGHHGFGGGGGFHHGHHGHGGGGGFGGCCFCGFC?DHGHHHHHGGGGGEGHHHHHHGGEGGGGGGGGGGGGGGGGFGGGFFFFFFFDFFFFFFFFFFF9BFFFF
+@1087870/2
+TCTCCATGCTGTAGGTCAGTGTATCAACACGCCAGTTGGTATAACGAGCGCCGAGAATCAGATGCAGCGGGTCGGCCAGCGAAATGCGCGTAGCGGCATACAGCGATTTCATATGCGTGGTATCGTCCTGCGCCAGATTTTGTGGCGCCCA
++
+A1>A1FFFFFF@D3BGFFGEBBA3EAD0GFGGC00BA110FFBFHGAE/A/////AF1111@GFFBEGE?CEE>EE?EEF/>///1EEFG>C/F?CCC?GHFFHC/</>GHEGGGFFCGG.D0D?<CE.0BCCGCCF0;GF0//:C@F@G.
+@498823/1
+ATCTGAAAGGGTTTCGGTTCCGGACTTTCTCCGGCAAAAACAGCGGGTATCGGCGGCGCCGTCTCAAACCGTAGAGCGTTGCTCACAAACGTGCCTGCCTGGCCACGTCGCTCCAGCCAGCCCTGCGCCACCAGCTCGCCATAGGCATTTT
++
+CCCCCFFFFFCFGGGGGGGGGGGGGGHHHHHHGGGGGHHHGHHHGGGGFHFGGGGGGCGGGEEFHFHHHGGGHGGHHGBD?DFGHHHHHEDHEGHHHHHFGHHHFGGHHFCEHDFGFGHHGGGHHHGGGGGGGGGBFDCD?EGFGG0FGFG
+@946762/2
+GAATTAATTGGACTTAGTGAGAAGTGTTCATGGTGTCCCCTGCAGGAATCGGACCTGCAACTAGCCCTTAGGAGGGGCTCGTTATATCCATTTAACTAAGGGGACAACGCGGCGCCAGTATAGCGTTTTTTATTCGCCGGAGTAAGTGTAG
++
+AAAAAFFFFFFFGGGGGGGGGBHGHHHGHHHHHFBGHHHHHCHHHHGGGHH2AEEHHHHHFHFHHHFGHGEFFGF?GGFHGGGFHHHGHHHHHHEHFBFCHGGFFEGH/@EECGGGDBHFHHGFGGGGGGGHEGGFDGGGFGGBGCCFGCC
+@367237/2
+GTGGTACACAATCAAGGCAGCGAAAGCTGCCTTTTTTAATTCCGGAGCCTGTGTAATGAAAGAAATCACCGTCACTGAACCTGCCTTTGTCACCCGCTTTTCCTGTTCTGGCTCGGCCTGTCGCGACCACTGTTGTAAGGGCTGGAAAAT
++
+AABBAFFFFFBFGGGGFFGFEGGGGFHHGGHHHGHHGHHCGBFGGDEGGHHHGHHHHHHHHHHGHGHHHHGHGGGHHGHHHHHHHHHHHHHHGHHGGGGGHHGHHGGHHHBGHHGGGGDGG?FGGGGGCEFHHHHHF<1<FEFG?FFHGH
+@992455/2
+ATCGTACATAAAGTGTACAGTAAAAACAGGATCTGCTGCGAGGCCAGACGTCGCAATAATACTTTTTGCGCCACGCCATAGCTCACCCACACCATCGCCGCGCCTACGCCAAAAATAACGCCCCAGGTGTAGTCGGTCAGTCGGGTAAAAA
++
+CCCCCFCCFFFFGGGGGGGGGGHHHHGHHGHHHHHHHGHFGGGGGHHHGGGGGGGGGHHHHHHHHHHCHGGGGGGGGGGHHHHHHHHHGGGGGHHHGGGGGGGGGGHGGGGGHHHHHHHGGGGGGGGFGGGHFHGGGGGHHHGGGGGFHHH
+@1416513/1
+GGCCGACGAGGTGCAGCAGGTCGCCTGCCTGGATAATCGTCCCCGGCGACGGCACCATCAGCGTGTCATCGCGTTTCAGGCGTGAGCAAATGATTTTATCGCTGTTCAGGATCGGCACATCCTGGATAGCCATATTATTGAGGTTCGGATT
++
+BBBBBBBBBB@AFGGGGGGGGGGGGGGHHHHHHGHHHHGGHGGHGGGGGGGGGGGGHHHHGHGGGGHHHHHGGGGGHGHHHGGGGGHGHHHHHHHHGHHHHGHGGHHHHHHHHGGGGGHHHHHHHGHHGHHHHHHHFHHFHHHHHHGGGGG
+@192800/2
+GTTCAAAAAGTGACGCGGCCTGGTGCGCCGCACATTATCACCGTACTGCGCAACACAAACTTTGAAGGTCTGCAAACTATCACGACGCGGCGCAAGAGTTTGTTATCAACTTATAACAGCCATGTTACCTGCTTATACCAGCAATACCATG
++
+BBCCCFFFCCFFGGGGGGGGGGHGFHGGGGGGGGHHHHHHHHGHHGHGHGGGGGHGHGHHHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGGGHHFHHHFGFHHHHHGHHHHHHHHGHHHHGHHHHHHHHHHHHGHHHHHHHHHGGGC
+@482707/2
+CTTAATTGCCAATCAATGTCTGATGGCGCTGCGCTTATCAGGCCTACCAGCCGAGTGCTTATGTAGGCCTGATAAGGTAAAGCCGCCATCCGGCATTTATGCTGTGGAGGGTAAGAAAGTAGTATCCCCGGCAACCTTAAACATCGCCCT
++
+CCCCCFFFFFFFGGGGGGGGGGGFHHHGGGGGGGGGGHHHHCHGHHHHHHHGGGGGHHHHHHHGHHHHHHGHHHHHHGEDHHHHGGGGGHFGGGGGHHHHHGHHHHHFGGGEGHGGFHHGHHFFGHHGGGGGGGHGHHHHHHGHFGDDDG
+@269152/2
+TGACATTCCCATTGAGCAGCCGACCAGTAAGAGAACAATAGAGCTGGTTACTACCGAATCCAGCAGAATATCGCGCAACTTACTCACATTAATTTCTCGATAAATGGCCGCCAGCGCCAGGCTATAGATTACCGCGATCGCAGAGGCCT
++
+AA?AAFFFFFFFGGFGGGGGGGGGGGHHHGHHHGGHHHHHFHCFFGFCGFHFHGHGGGGGGHHGHFGEHHFHF?FGFFGGFGGH33FHFGFEGGHFBGGHFHGHHE3FHCGGE@F@CGDCEGCGHF2FFFFH2EG@@?FC?FEDGCEEH
+@126153/1
+GCATTATCGTCGCGATCCGCCGTGAGGATTCGATCCTCCTTGCCCGGCACGTTCGCCACCGCAACGGCGTGCATACCGTGCTGGCCGGGTTTGTTGAAGTCGGCGAACCTTAGAACAGGCGGTCGCGCGGGAGGTAATGGAGGAGAGCGGG
++
+ABBBBFFFBFBDGGGGGGGGGFGGGGHHGHHFHFHFHHHHHHHHHCFEGGGHHFGGGGGGGCFCECGGGEGGHGHHHGGEGGHCDHGGG/FDDCGHFHGFFDFGGGGCFHHHHEHHFGGGGG@CC9:AD--9;B.9BBBF/BD.9.99;DF
+@1068057/1
+GCCGCTACATGGGACGAGGCAACGGTTATCTGGCGACGATCGGCGCCATTTCCCCCTTCGTCGGGTTGTTTGGCACCGTATGGGGCATTATGAATAGCTTCATCGGTATTGCGCAAACGCAGACCACCAACCTGGCGGTGGTCGCTCCTGG
++
+BBBCCBCCFFFFGGGGGGFGGGHGGEGGFHHHHGGGFGGGHGCFGGGGGHHGHHHGGHHHHGGGGHGFGHHHGHHHGG0FGHGGGGGHHHHHHHHHHGHGHHHHHGGHGHHHGGGGGHGGGGGGGHHGHHGDHHHHGCBAFGGGG.ADFGG
+@127896/1
+AAAAAACGCCTCTATTTGCGATAAGCACCACATTTTATTGGCATTATTGCTGCCTGTTATCGTTAATACTTGACATAGTTTCGGATTAAGACTATTCCCTGAGGTGCTTTTTAAGCCTATTTTTGCTAGAATTTGGGGTTCAAACCTCAA
++
+CCBCCCCCBCFCGGGGGGGGGGGCHHGHHHHGGHHGHHHHHGHHHGHHHHHGHHHHHHHHHGHHHGHHHHGHGHHHHEHFHHFGEGFHHHHHGGHHHHFFFHHFGGHHHHHHHGHHHHHHHHHHGHHGHHGHGHHHGCFFHHHHHGHHHH
+@650051/1
+GTCTTTGAGGAAAGAATAAACTGACACAGCGCCTTATGCGGCCAGTATGTTAGAGGCCAGGCGACCAGCGCGGTAATAAATAGCACGATTGCGCCTGCCGATCCCAACTGGATGGGAAGGAAAAGAGTGCCTGCGCCTACAGCCGTTCCGT
++
+ABBBAFFFAFFFGGGGGGGGCFHGHHHHHGGGEGGHHFG?EGFGHFHGHHHHFBFFEEECGFCGGG@CAEGCEEEFGHFHHHGEF3EEHHEBEEFDFHFGGGCGEHHGHGHHHGFHHFDCFHHG0<0<FGFGGGG@AAEFFGHECFDCCAC
+@539229/1
+TTTTTGGCGTAGGCGCGGCGATGGTGTGGGTGAGCTATGGCGTGGCGCAAAAAGTATTATTGCGACGTCTGGCCTCGCAGCAGATCCTGTTTTTACTGTACACTTTATGTACGATAGCGCTCTTGCCGCTGGCAAAACCGATGGTGATAG
++
+BBBBBBBFBBB22FAAECGG?EEEGGHDFFGGFHFHHHHHHGEGGGGGC/>GH1GDGHHFHHHGCGGGGFEFFGHHGGGG?GHGHHHHHHBHFFFHHHHGFHHGHHFDGFGHHEEEEFCGEGHHFBCDCG@CAGCGCHDG-@AEFFFGGG
+@566083/1
+CAGCCGCCGTAACCCGCAGCCCAACCGCCTTTGATGCCGACATTACCGGTAATGGTCGCCAGTAGAGTCGAGCCGCGCGCGGTGCGCTCGCCGCAGTTGTGGCGCTGTGGTCCCCACCCCTGAATCAACGCGGCAGGTTTGGTATTCGCGT
++
+CCCCCCCCBBCCGGGGGGGGGGHHGGGGGGGHHHHHGHGGGGGHHHHGGEGGHHGHGGGGGGHGHHHHHGGEEEGGGGGGGGFCGGGFGGGGGGGGGHHFGGHGGGGEHHHHHHHHGGGGGGGGGGGGGGGGAGFFFFFFFF.BFFFFFF-
+@470140/1
+GAAGAAAACGCCTGGCGGCGCGCCGTCAACGTCGGAAGAGGTGCTGGAAGAGCTGGCGCTGGACTATCCGCTGCCGAAAGTGATTTTGGAGTATCGTGGTCTGGCGAAGCTAAAATCCACCTATACCGATAAGCTGCCGCTGATGATTAA
++
+AAAAB4FFB@DBGGGCEGEGGGCGGGGCEHGFHGGEFEAGCHHCFHFGHHCGFFHHGG/>EEFHHFFGBEEEEGHGGGGF1>@?DGHHCCFGFFHGHHGAGFGHBCC<DCHGHHGHH/DFHFGHFHBD:@CFHGFFGFBBBB.;F0BFFG
+@1315293/1
+TTCAAATCCTCTCAATCAGTATTGCCTGGCACCGTCAGCGAGCAACAACCGTGCCAAAGCCGATGAGCAACGAGAATATCACCCACTCTTTTATCAGACAGTGATTTTATCCACAAGTTCAATGTAACACTGTGCATAATTTGCACAAAT
++
+ABBBAFF4CFFFGBGGFG4GGFHFHFHHCHHHGG4EE2EEGCGEHHHH2EGAGDGHHHEBHGGGGGFFEHHGFGGCGGFFFHHHEEHHHHHHGHHHGHHHHHHGHHGHHFBGHGHHFD4GHF4FF4GHFGHHFFFGHHGHGFHE2FGHHH
+@286129/2
+GACCACGCTGGTTGAATTGCAGGAATATCAGGGCGAGCGGCAAACGCCGCTCTGGCGCAAGCTGTGGCTCAACGTGATGCCGCAGGATACTGCGGATCTGCCTTTACCAGACCAGTGTGATGCGACCGTTTTCCCGTGGCTTGCCGCGACG
++
+AA3AAABBBBBFFEF5FGGGGGHCEFFBGFHFH?EEEGGGCCAFHGGGGG?EHFHHCFE@EHHHHGHHAFFHHGHHGHHFHGCGGGGHHHEHHGG?//GHHH1FGHHHHHEGHHFFHFGFEHGGDCGCGDHGHGHGGGCGFHGHFGB?@BB
+@503291/2
+CCTTACAACAGTGGTCGCGACAGGCCGAGCCAGAACAGGAAAAGCGGGTGACAAAGGCAGGTTCAGTGACGGTGATTTCTTTCATTACACAGGCTCCGGAATTAAAAAAGGCAGCTTTCGCTGCCTTGATTGTGTACCACGTGTCGGTGAA
++
+BBBBAFFFF@FFGGFGGGGGGGFCEGGCGEEHHHHHHHHGHF2GHGCGEGHHHHHHHHEEGGEGHHHHHHGGGHEFHHGHHHEGHHHBHGHHHGHEGGGGGGEHHHHHGDDGF??GFHHGGGDDFHHF1FFFHHHHBHFHGGHHHGCCFGH
+@978473/1
+GTAACGAAGAAGGTATCGGCTTCCATAAGGGCATTCACCAGCTTGCTCATGTCGAAAACCAAACTCCGCGTTCAGAGAAACCTGACGTCAATATGAAAGAAGGCGGCAATATCTCTGCGGGCGCTGTCGGTCTGCTTGGCGGCGTGGTCGG
++
+CBBCCCBBBCFFGGGGGGGGGGHHHHHHHHHGGHHHHHHHHHHHHHHHHHHHHHHGGGHGHHHHHHHGGGGGGHHHHHHHHHHHHHGGGGGHHHHEGFFGAGCEGGGGGHHHGHHHHHGGGGGFGGFHGGCGGHHHGHGHGGGGGGGGGGG
+@1364206/1
+GGGCAGCGAAGATAACGAAGGGATTAAAGAACGTACCGGCTTCCGTCTGGAACGTCGCGTCGCAGCGGTTGGCCGCTACATGGGACGAGGCAACGGTTATCTGGCGACGATCGGCGCCATTTCCCCCTTCGTCGGGTTGTTTGGCACCGTA
++
+CCABCCCCDCCCGGGGGEGGGGHHHHHHHHHHGHHHGGGGGGHHGHHHGHHHHGHHGGGGGGGGGGGGGGGGHHGGGGGGHHHHGHGGGGGGHHGGCFGHHHHHHGGGGGGGGGGGGGGGHHHHGGGGGGGGGGGGGGGGGGGFFFFFFF9
+@52853/2
+ACGCCAAGCGCATCGCCATACGGCGTATCCGGTTCGAGTTTCGCCGGCTGTCCGGCATGGGCCAGATCGACGGTCACGCATACTGCGCCCGCATCCAGCGCGCCGAGCAGCGCATCACGCATTGGGTCGAGGATTTTGGTTAAATCCCAAA
++
+1>A11A>111111E0000FG0000AEE/02EEA/BEAB1/AA////>E//BFFE>//>00>0>>/>B1/E@E@AEEF/0>//11BDCGAC/<A/@0110>---A-<AC-/=C@-.::0..:A.909./=---=9090B?E-BF/9/:9B/-
+@257215/1
+TTGCTGTTCGATCTCTTTAATACGTACTTCACGCTCGGCCTCAACTTTCCTGGACCGTACTGCTTGCTCACGTTCGATCTCCGTCTCCTGGATCTGCCGCTCAGCAAGAATGCGCGTCTGTTCTGCTTCACGATGGCGCTCGGCCTCAAAA
++
+DDDDDFFFFBBFGGGGGGGGGGHHHHHHHHHHHHGGGGGGGHHHHHHHHHHHHHHHGGHGHHHHHHHHHHHGHHHGHHHHHHGHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHGGGGGGGHHHHHHHHHHHHGHGGHGGGGGGGGGHHHGH
+@931938/2
+TTGCTGTTCGATCTCTTTAATACGTACTTCACGCTCGGCCTCAACTTTCCTAGACCGTACTGCTTGCTCACGTTCGATCTCCGTCTCCTGGATCTGCCGCTCAGCAAGAATGCGCGTCTGTTCTGCTTCACGATGGCGCTCGGCCTCAAAA
++
+BBAAAFFFFBAFGGGGGG5GGBGHHHHHHHHGHHGGGGGGGGFCGHHHGHH5A3ABAFHGHHFFHHHHHAF1BGHGHHHHHBEHHHGHHHB2@FHHGH/EECDHH3FGFGFGB?EGGGFGHHHHHHHGHHFEDHECFBD/AG?/>AF1FHH
+@675444/1
+CGTATAGTCAGAAATAGCGTCAGCGTTGTGGCTGACCAGCCAGCCGCTGAATTTTGAGAAAAAGGAGAGTCTGAATGCAAGCAACAGTAAAACGGCGGCTGACGAAGGTCGCTTTAGCATTAGTAGTTGCCGGGTATTGCGCCGCGCCAG
++
+BCCBCFFFFFFFGGGGGGGGGGGHGEGGGGGHHGHHHHGHGHHGGGFEGGHHHHHHGGHHHHGGGHHHGFHHHHHHHHHHHHHHHHHGHHHHHFDCFGGGGHEDGGFGGHGGDHGHHHHHHHHGHFGFFEGFDC.>1GGEGGGGGGGCGF
+@236642/1
+GACCACACATGCAACAAAAAAGCCTGCAACTCATTGAAGTTACAGGCTTTTTTAAGGTTCATGATGCATCATGAATGAATGTTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACATCCTCGGTACTACATGCTTAGTCA
++
+CCCDCCCCDFFFGGGGGGGGGGHHHHHHHHHHGHHHDGHHHHHHHHGHHHHHGHHHHHHHHHHHHHGHHHHHHHHHHHFHHHGHHGHGGHHHHHHGGGGCE?HHHHFHGGGGCGGGDDGHHHHHFHHHHHEFDFAGGHHHHGHHHHGHHHE
+@1357428/2
+AAGTATAGTCAATCCTTGATTATTATTTCGCCACTAAGGAGGCATTCAGTGCGGATTCATATTCTCTTTGACCTCAATTTCCCTGGTCAGTTTCCCCATTCGTCCAGAAATGCTCCCTGCGCTCCGCCATGCGCACTAATTGTTCACAAGG
++
+BBBABFFFFFFFGGGGGGGGGGHHHHHHHHGGGGHHHHHHCGGGHHHHHHHGGFGGGHGHHHHHHHGHHHFHFHHHFHHHGGHHHHHGHHHHHHGHHHHHHHFGGGHGGHHGHHHHGHFH?EGGGGGFGGGGGGGGGFHHHHHHHHHHFAF
+@87702/1
+CTATCGTACATAAAGTGTACAGTAAAAACAGGATCCGCTGCGAGGCCAGACGTCGCAATAATACTTTTTGCGCCACGCCATAGCTCACCCACACCATCGCCGCGCCTACGCCAAAAATAACGCCCCAGGTGTAGTCGGTCAGTCGGGTAAA
++
+AAA1AAC?AAD@1FDBBG33F3DBGBFGEC00FHF00A000E////AA/0B/ABE/EE/B1D@1B2BFD/1>E>?EE/?EGCGF21B>0>FEEG/CDF//?@@CG/AA0<BC/@<G/0<?1/>->@<../<0<<00<-A..;::E-AC@CF
+@149652/2
+ACTACACCTGGGGCGTTATTTTTGGCGTAGGCGCGGCGATGGTGTGGGCGAGCTATGGCGTGGCGCAAAAAGTATTATTGCGACGTCTGGCCTCGCAGCAGATCCTGCTTTTACTGTACACTTTATGTACGATAGCGCTCTTGCCGCTGC
++
+11>111B1CBF11FA000AB22A0/1E/E/EG/?A/A//>//11>//E/>/EEE>>1BF@E/ECCC///BFCGD2?22>FG/CCCGAC.F1F1<<C-<-.C/<GHD<//0<<:GH0G0C00;CG0GGHBGE.:C.0-9C..0:0/-;-9.
+@578654/2
+GGTAAGCCGGCAGTTGCTAAGTTAAATTCCGGTCGCTGAGACCTTACAGGCCGGATGGCGGCGCAAGCGCCTTATCCGGTCTACCGTCCTGAGTCATTTTAAAGAATGACATCAGGTAAAAAAACCCGCTTCGTGAAGCGGGTTTTTCGTT
++
+AA>3AFFFDBDDEGGGFGFEGGHHHHHHGFHFGGGGEGGHGHGHHHGHFFGAFGCFGGHCCGGGGGGGGGGGGHHHGGGFGGFGGGGGGGHHGBH2FGFFGFEGGFHEFHGGFHHGHGHFHFGGGGGGGG?FFHGHEBGFGGBGGEGFD;F
+@17140/1
+GGATAATCCTGCCCGTATCCAACTACTCTTCGCTGAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCTCTTCCATTAACAG
++
+CCDCBFFFFFFFGGGGGGGGGGHHHHHHHHHHGGGGHHHHHHHGGGGGGGGGGHHHHHGHHHGHHHHHHHHGGGGGHHHGGGGGGGGGGGGGGGHGGHHHHHHHGGGGGHHHHHHHHHHGGGGGGGGHHHHHHHGGGHHHHHHHHHHHHHF
+@776429/2
+CTGTTGAGAATGTCGCGGATCTGGTCGCGATCCTCTCCCGTGAACGTCAGGCTCAGAACGCCGGTATCTTTGCCGGTTTCCGTTACGGTGAGGTTATTTTGCAGGTTATTAATCATGCCAAGCGTTGAGGATTTACTCACCGTAAATT
++
+AABBA@B4>DFFGFFGGCEE?G5B5G?EG?EEAGHHFFCGGFFCG1FGEDBFHH3?35BEFGEEE@FFFHFHFF//>EAGFGHHFGGE0//FGCFFHHHHFHHBAGDFHHHHHGFH1GF11CAEED<FH0<F><D1FGDGHGHHGFHF
+@521524/1
+CAGTAATTCCCTCACCTGCAGAAGTCTTTGAGGAAAGAATAAACTGACACAGCGCCTTATGCGGCCAGTATGTTAGAGGCCAGGCGACCAGCGCGGTAATAAATAGCACGATTGCGCCTGCCGATCCCAACTGGATGGGAAGGAAAAGAGT
++
+AAAAAFFFFFFFGGGGGGGGGGHHEGHHHGHGHHGFHHHHHHHHHHHGHHHHHGGGGGHHHHGGGGGHHGHHHHHHFHHGGHHHHGGGGGHHGGGGFGGHHGHHHHHHHGGHHGHGGGGHHHGGGCGHBGGHHHBDHGHHHGGGGFGHGH0
+@22138/1
+ATCCAGGGATAATCCTGCCCGTATCCAACTACTCTTCGCTGAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCTCTTCCAT
++
+AAA11F1A>CC1FGC3BGFGG0EFFDHGGGHHFCEDEEAEGAGFBGHAFEEGAEGCG?F/FBDFF/GFCFFF@BDFGG@ECEGHHGG?ECGECCGCCCCGHGCHHFHGFFCC@@CFBFFHH1GCHGGCCCGGF.CGHHFHCCCFFHFHHHF
+@60780/1
+TCGCTGAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCTCTTCCATTAACAGACGGTCAAGGTTACGCAGCAGCGCGCCG
++
+CCBCCCCFFFFCGGGGGGGGGGGGHHHHHGHHHGHHHHHHHHGGGGGGHHGGGGGGGGGGGGGGGHGGHGHHHHHGGGGGHHHHHGHHHHGGGGGGGGHHHHHHHGGGHHHHHHHGHHHHHHHHGGGGGHHHGGHHGGGGGHHHGGGGGG
+@1370730/2
+GGTCTGAATGCCGCGCGTCTTTCCGCCGACAAAGAGGGCTGGGCGCCTGCGCGTTCTCAGGCTTATCTCGGCGTGCTGGTGGACGATCTCTGTACGCTGGGCACCAAAGAGCCGTATCGCATGTTTACCTCCCGCGCCGAATATCGCCTGA
++
+ABABAFFFFFFFGGGGGEAEFGHHGGGGGGCGHFFGAFGGEECC?FGGHHGGGGGGGHHHGHHHFFHGHGGGGGGGGHF2BFFHGCEGGFFH2DGHGGGFGFEGGHHAHFFH<@.AAFGFE.ADGGEH0GHEGG??@DGAGFGGGGGGGGC
+@74546/2
+GAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCTCTTCCATTAACAGACGGTCAAGGTTACGCAGCAGCGCGCCGCCGCCG
++
+BBBABFA4FBBBEAEGCEFGGFHH2AGHCHHHGHBFHGEGEEHHBEEEEEE>EGGGGGGDAG?FEFHFCGDEGGCHHFFGHHHHHGFFGCGGFH0GFBCGACDFHF1FG1GHHBHHHFFCDFGFDGH0<FGED??CFG/@-A?-?BG@BGB
+@1029251/2
+AAACATCAGCGGCCCGCTGGTAAGCCGGCAGTTGCTAAGTTAAATTCCGGTCGCTGAGACCTTACAGGCCGGATGGCGGCGCAAGCGCCTTATCCGGTCTACCGTCCTGAGTCATTTTAAAGAATGACATCAGGTAAAAAAACCCGCTTCG
++
+@B@BBBFFFFBBGFFC?EGGGGHHHGGEGGGFGHHHHCFFHHBGFBAFG0AAEEFGGHHHEHFFFFHGGGECEGCFGEE/@?DCDEDGGF?HHHHDG-@DHHGGGGGGHE<DDBGFH0D<GH=GC00;C0;CFHBFHHGF-9.CD??-9C-
+@386439/1
+CTTGAAGTTATCCAGCGCCCGCTTCATCTGCGGATTTTTACGTAACTCCATGCCCACACAACGGGCTTTTAGCCGCGCCTGAATATGCGTCAGGTGTTCGCGATTTTCATCAAGCCATTGCGCGCCGTTCGCGGTAATCGCGATTTTTTT
++
+CCCCAFFFFFFFGGGGGGGGGGGGGHHHHHHGGGGGHHHHHGHHHGHHHHHHHHHGGGGGGGGGGGGHHHGHHHGGGGGGHHHHHHHHGGGGGHFGHGHGGGGGHGHHHHHHHHHGHHHHHGGGGGGDGGGGGGGGGHHGGGCGHGHHGG
+@751365/1
+CATCATGGTTTACGTCAATCACATCAGGGTTAACAATACGCCGCAGCGTAGTAAAAAGATCGGTCGCCAACATGCCGCGAGCGCCATAACGCGCTGCCAGTAAGTCCGCCGCCGCGCCGTGAGCCACACATCCCACACATGCCGCATCATA
++
+BBBBBFFFBFFFGGGGGGGGGGHHHHHHHHHHHHHHHHGHGGGGGGGGGGGGHHHHHGGHHHGGGGGGGGGGHHHHGGGGGGGGGGGHHHGGCFGGGHHHHGHHHHHGGGGGGGGGGGGDCEGHHHHHGGGGGGGGFGGGGGGGGGGGGGG
+@1223804/1
+TTACACAGGAGCTGCTCCAGTTCGCTTAATGACGCCACAGTCCAGGTTGGATGAATACCCGCGGGCTGCTCGCGATGATGCGCGTTAAGCCAGCAGGTCGACAGCCCGGCGTTAATGCCGCCAAGAATATCGGATTCCGCGGTATCGCCAA
++
+BBBBBFFFAFBBGGGGGGGGGGHGGGHGGHHHGGGGGGHHHHHHHHHHHGHHHHHHGHHHGGGGGGGGGHHGGGGGGHHHHGGGFGGGHHHHHGHHHGHGGGGGHHGGGGGGGGGHHHHGGGGGHHHHHHHGGGGGHHHGGGDGGGGGGGG
+@501998/2
+TAATAGCGTGGCCTGTCGCCTTTCTCAGCGCGCAGTGTCCCATTCCATCATCAGAGTCCAGAATAGCGACTGAAGGAGAAATCTGTTCAATGCTGAATGTTGCTTTTGGATTGAGACCGCCTGCGTTCAGGCGGGCTGAATATTGCTCTA
++
+A1?1>31@AAD11AAB1F0EE0B13333B00E/AE/B2FG1BFF22FA1A2DFGGCFFFEBG0F1FD//>E/G1@F0?/B1FDGFB222@221BD112@BBFF1>FGG/>1F011<1?>/B/FF/CEAC21@B/@-<..<<000000000
+@1309557/1
+GCTATGAGAGCGCTGGGCGATCATGACAGGAAAAACGATCTGCGAGGCAATAAAAGCCGCCGCTCTGCTTCCGGGGACGCTATCCGCCTGGTTGTCATTCATACGGAGAACCTTTTTATTATCAAGATCGCCAAATAGCCAGATCCTGAAA
++
+AAAAAFF111>>11E1EC0AAFEFFHFFBA00BGFEG/EEAGHGGG?AFGHFBED1GF?EE/E/EGHHHHFG/EEGEGGGGFCFFAECCHHHGCCDBGHHHFFFHGAECHHAGHHHEEB11FDGFFDBGHCGG?GFDDBGHHCGBGHHEHH
+@1178586/1
+GGAAGTTGCGGCCGATAATCATCGGCTCCGATTCCGGGTGGTTGATGTTGGCGGGAATAATCGCGCGGCCCGCGGCGACTTCATCACGCACGAATTCCGGCGTAATGTTTTCCGGCAGGCGCGCGCCAAAGCTCATCCCCGGATGCCGGTG
++
+BBABB4DFBDDBGGF?EGGGGGFHCEDEGFEGDHGHGCAAEAFAGFEGHGHHF?@EGFFGHFEF></<<>////>@@CCFDF0=DDF..CCCDFHHHFB?-B?FDEFGGGFBFG?BC-@.99>@@@F?>FBFB//9BFEF-@-9-B/;B--
+@663850/1
+TTAGATGTCAGTCTCATGTCTTACTTAACCTCAAACTCGCCCCTGCCCGGGGTTTTTTATTGTAAAATGGGGGTATTGCATAGCAGGGACAAGTCTGACATTCCCGAGTAATTTGGTCAACTATTTACTTGAGTAAATTAGTCAGGTATTT
++
+BBCABFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHGGGGGHGHHHGGGGEGGGGGHHHHHHHHHHHHHGGFGHHHHHHHHHHHEGGGGHHHHHHGHHHHHHHGGGGHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHHHGGHHH
+@990309/2
+CTTTTACAATGATATTGGCCGCCTTCGGCGCCAGTTCAAACCAGGTTTTGGTGTGCAGCAGCGCGGCCGCCAGGGTGATCAGGTTTAAGATCACCACCACCGGGTTTTGTAAAAAGCCGACGAATCCCATCCAGGATTCCGCGCCGTGTTT
++
+ABBCCFFFFFFFGGGGGGGGGGGGGHGGGGGGGGHHHHHHHGHHGHHHGHGHGEGHHGHHHHGGGGGGGGGGGHG??GHHHHHGGHHHHGGHGHHHHGHHGGGGEFGGHHHHHHHGHHGGGGGGHGHHHHHHHHHEHHHHHGGFGGGGGGF
+@122379/1
+CTATGTTACCGTCAATCAGCCCGGAACTGGCCCGTATCGCTCCCGGCTTTCGTGCATTAAGTATTAATGTTATTGCCGCTCCGATTCGCGATGCGCAGGTCGGAGAAATCGCGCTAAAAGAGGCCTGTCAGGCCGTAATTAACGGCCAAC
++
+CABCCFFFFFCCGGGGGGGGGGGGGGGHHHHHHGGGHHGGGHGGGGGGGHHGGFGHHHHHGFGHHHHHHFGHBHHGHGGGGGGGGGHGGGGFFGGGGGGFHGGGGGHHHHGGGGGGGHFHGGHGGHGHHHHFHGGADGGHHHHGGGFGGG
+@1149131/1
+GTTCAGGATCGGCACATCCTGGATAGCCATATTATTGAGGTTCGGATTCTCGACACGGATATTCATTGTCTGAATTAATGAATGGCCGTTAGCGAGAGAGGATTCGTGCTTCTGCGCCTCCGCCTCGACGTTAACGCGAAAAATCAGCCG
++
+BBBABFFFFFBBGGGGGGGGGGGHHHHHHHHHHHHHGHHHFGHGEFGGHHGGHGGGDGGGGHHGHHHHHHHHHHHHHHHHHHHH3CGGEGGGHGGGGGFFGHHHHGHGGGHHHHHGGGGGHGGGGGCDGGGGHEHGGGGGGCHHHFHHHG
+@491570/1
+CGATGAGATCATTGCTGCGATGTACGAGACCGGTAAAGACATGAGCGCTAAATACCGTGAAACGTATCATGGTTCGCTGGGGAAAATTCAGCCGCGCAAGAGAGGGTAACAGCGTGAAATACAATACGATGAATAACGACGAGATTATC
++
+CCCCCFFFFFFFGGGGGGGGGGHGHGGGGGGGGGGGHHHHHHHHHHGGGGGHHHHHGGHGGHGGHHHHHHHHHHHGGGGGGGGGHHHHHHHHHGGGGGGGHHHGGGGHHHHHHGGGGGHHHHHHHHHHGHGHHHHHHGGGGGGGGHHHG
+@16302/1
+GTCTTATCCAGCGTGATTTTCCAGCCCTTACAACAGTGGTCGCGACAGGCCGAGCCAGAACAGGAAAAGCGGGTGACAAAGGCAGGTTCAGTGACGGTGATTTCTTTCATTACACAGGCTCCGGAATTAAAAAAGGCAGCTTTCGCTGC
++
+BCCCBFFFFFFFGGGEGGGGGGHHHGGHHHHHHHHHHGHHHGGGGGGGGGGGGGGGHHHHHHHHHHHHHGGGEEGHHHHHEGGHFGFHHHHHHFHGG?FFHHHFHHHHHHHHHHHHHHGHHFGGGGFHHHGHHGFGHHGGHHHHGGGGG
+@1466402/1
+GTTGCTGTTCGATCTCTTTAATACGTACTTCACGCTCGGCCTCAACTTTCCTGGACCGTACTGCTTGCTCACGTTCGATCTCCGTCTCCTGGATCTGCCGCTCAGCAAGAATGCGCGTCTGTTCTGCTTCACGATGGCGCTCGGCCTCAAA
++
+1>>AAFFFFF?AFAFABFGGFFBFHFEFGEGHHGHCEG?GGGHFHGHGHHEBGGGH0EEFE/GHHHFABFEGEGFFGADGFFGFHHHHHHHGFGHF1BDEG/>?GFEFGBG1GHCFG<@EAFBDGDGHHHB1GGHG/GGGCGAC.EC<FCG
+@325051/1
+GTTAATGGAAGAGACGGGCATTCCTGTCGTGGTTGCTGAAGATCCGCTGACCTGTGTGGCGCACGGCGGCGGCAAGGCGCTGGAAATGATCGATATGCACGGCGGCGACCTGTTCAGCGAAGAGTAGTTGGATACGGGCAGGATTATCC
++
+>>>1A@3FFFF1FA11E?EE0DFHFD11F0EE0BAGH1E1F11110/AA/B0DAFFFG///EA@E/E/EC//B?/FEHG?/B/01?FH111??C/@1FGFF-C?--A---;BBF0FGGB9--:CCFF//99FFF9----9-;;F/BFFF
+@27449/1
+TTGTTTGACTCGCCGGTCGCGGCCGCCAGCTTCGTCACCAACTGATTCAACGTATTATGTTCAGCAGGCAATAATGGCCGATCCGTTGCCGGACGTTGCTGCGGCTGCGGAATGGAAAGCTGCCCCTGTTGCAGGAGCGTCAGCACGTTTT
++
+CCCCCFFFFFFCGGGGGGGGGGGGGGGGGGHHHGHGHGHHHGHGHHHHHHHGFGHHHHHHHHHHHHHHGHHFFHHHGHHGGGGGHGHGGHGGCGGGGHGEHHGGGGGGGGGGGHGHHGHHHGGHHGHGHHGHHHHGGHGGGGGGGGGFFGG
+@1104490/1
+GTCATAAATATGATGCGCCGCATCACGGGCTTCATCTTCTGGAGAGAGCGCGAAATAGCAGATATTAGGGAAGCTACGTACAGTTTCCGGCTGGTTGAGCGCCAGCACGTTGAGCGGCGTGTTGCTTTTCATCAGCGCTTCCACATTGTTT
++
+AAA@A3B1BFFFF33B11EAEGGCHH?EGE/GGFHCBG2GGE10AEFFHECE??ECDF1FG>EG2F2GHHHHGHGHEEGBH/BFDDHBFEECCE0B<ECHCGGFGGHHG0FF/CFBCCCC?>GCHFF110=D00DCC-CA.:00:0CGC0C
+@72275/2
+GGTTACTACCGAATCCAGCAGAATATCGCGCAACTTACTCACATTAATTTCTCGATAAATGGCCGCCAGCGCCAGGCTATAGATTACCGCGATCGCAGAGGCCTCTGTTGGCGTAAATACGCCGCCGATAATGCCGCCGATAATAATAAAT
++
+ABABBFFBFFBBGGGGGFFGGGHHHHHGGGGGGGHHHHHHHHGGHHHHHHHHHGHHHGHHGHHHGGGGGGGGGGGHHHGHHHHGGHHHGGGGGGFGG?EHEDEHHHH?BGGHGFGDEHFHHFGCGFGGGG.DHHHG?CGGG@CCHHGGGGG
+@1076570/1
+GTTTATCAGAGACCTGTTCCGGCGTGCGTAAGGCTCGTGATACGGTCATCGTGCCTACACCGGCAAGTTGGGCTACATCGGCGATAGTCACTTTACCGGTACTGCGCCGTTTACGGGGTATCGACATACAAATTCCTGCGTCATTACAACA
++
+BBBBBFFFFFFFGGGGGGFGGCEGGGGGGGGGGHHFFGHGHHHGGHGGHHHHHGHHHHHHHGCCCGGHHHHGHHHHHHHGGGGGGGGHHHHHHHHHHDG/CGHHHGGGFCFHHHGGGG?DHHDF?GADGHHHHHFHHHGGGGFHHHHHHHE
+@1469579/1
+CTACAAGTTGCAAAATTTGTTACGGGTAACTGTTATCGGTAACATTGTCCAACCGCACCATTCACGACGCAATGACCATTCGTGCCAAAAGTGAATAAGTGTGAGCTACTTCAAAGTTGTCAGACTAAATAGATCCGCCCGGTGACAAGGT
++
+CCCC@FFFFFFFGGGGGGGGGGHGGGGGHHHHHHHHHHGGHGHHHHHHHHHHHGGGGGGHHHGHHHGGGGGGGHGHHHHGHHHGGHHGHCHGHHHHGGHHHHHHHHHHGHHHHHHHHHHHHHHHHHHHHHHHGHHHGGGGGGGGGHHHGH=
+@425784/1
+GACATCTCCGAGCGTGGTATGGTGCTCACCGGCGGCGGCGCGCTGCTGCGTAACCTTGACCGTCTGTTAATGGAAGAGACGGGCATTCCTGTCGTGGTTGCTGAAGATCCGCTGACCTGTGGGGCGCACGGCGGCGGCAAGGCGCTGGAAA
++
+AAAAAFBFBADDE?AA00FGFCADGHGHFAE0AEGCEEC/EE/EECH11<E<C?FGFFFGFC/CCFGHE2GHF1FHGFC0///A?GFFGFFG1<F...<AGB0=GF0DD:.CCCFHHH/<C/.9A----9@?-@?@?>@@-E-@@@@?-9F
+@431508/1
+TTCATAGGCTATGCGTATTCTCGCGTCGGAGAGGCAGGACAATCCAGGGATAATCCTGCCCGTATCCAACTACTCTTCGCTGAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAG
++
+DDEDEFFFFFFFGGGGGGGGGGGGGGGGGGGGGGGGGGGHHHHHHHHHGGHHHHHHHHHHHGGGHHHGHHHHHHHHHHHGGGGHHHHHHHGGGGGGGGGGHHHHHGHHHGHHHHHHHHGGGGGHHHGGGGGGGGGGGGGGGHGGHGGGGG
+@452000/1
+GACCTGTGTGGCGCACGGCGGCGGCAAGGCGCTGGAAATGATCGATATGCACGGCGGCGACCTGTTCAGCGAAGAGTAGTTGGATACGGGCAGGATTATCCCTGGATTGTCCTGCCTCTCCGACGCGAGAATACGCATAGCCTATGAAGC
++
+CCCCBFFFFFCCGGGGGGGGGGGGGGGGGHGGGGGHHHHHGHHGGHHGHHHHGGGGGGGGGGGHGHHHHHGGGGGHHHHHHHHHHHHGGGGGGGGHHGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFFF
+@1524722/1
+GGCTTTGCCCTACATCGCTTCCCATGGCGTGCGAGGTCATCTGCGGGCAAGAGAAGTTACACTCAATCATATCCGCGCCGGCTTCTTCAACCAGACGCGCCAGTTCCTGCCACTGCTGCTCATTTTCCCCCATGATGGAAGCAATCAGCA
++
+ABBBBFBFFFFFGGGFFGGGGGHHHHFHGGGFFDEGAGGGHFFHGGEFGFFHHGHHFGHFHFGHHHHHHHHFFHEFEGGGGGGGHHHFFHGHGGHGGGGGGFGHHHHFFFFHHHHHHFGHHHHHHGHHHHGGHHGHHHGGHHHGHHHHGH
+@297106/2
+GGCGTATAGCATCATCGTTTCACAGTACAAAAATTAAAAACCCAGCGCCAACCGCATTCCATTTTTTGCGAACCTCTATCCAGAATCATCATCCCCTCGTTTCACCACTTTCCATCCCCAACGAACCAGGTTACAAACTGTACATACATA
++
+ABBBBDBFFFFFGGGGGCGGGGHFHHFHHHHHHHHHHHHHGGGGHGCGGGGGGGGGGGHGHHHHHHGEHGGGGGHHGHHFFGHGHHHHFFHDEHHGHGGHGGHHGHEHHHHHHGGHFHEHGGDGGGGHGGHHHHHB1GHFGHHGHHHHFH
+@462379/2
+ATGCGTATTCTCGCGTCGGAGAGGCAGGACAATCCAGGGATAATCCTGCCCGTATCCAACTACTCTTCGCTGAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAG
++
+ABBBBAABFFFFGGGGGGGGGCFGGGGGGHHHHHHHHGGGHHHHGHHBGHECEEHHHHGHHHGHHHFHHGGGGHGHHHGHCGGGGGGEEGHHHHHGHHHGHHHHHHHGGGGGGEFF?CGGGC@FCGCFGGGHGGGGHGEGHGGGGGGGGGF
+@670405/2
+CAGTTTCCCCATTCGTCCAGAAATGCTCCCTGCGCTCCGCCATGCGCACTAATTGTTCACAAGGCGCGTAACGAGGACCGTAAAGTGCGGCCAGGCGCTGTAATGTCGCCACCATTTCACCCGGCCCGAGAGCATCCATATAGCGGAACGG
++
+AABBBFFFFFFFGGGG?EGGGGGHHHHGHGHFHGG?EGGGGGGHGGGGGGGEGFHHHHHHGHHAGCFGGGGGGGGGGGHGGH?GHGHHCGGGGEFGGGGGFHHHH2FGHGGGHHHHHHHGHGGGGGGGCGCDHHHHHHFFHGHHGGGCCGE
+@569149/2
+CCTGCACCCAGTTCATCACCGAAATTTTGGCTTTTACCGGGTTATCCGGCATCTCCGGACCCGCGGCGAATTTACGGTTAGCGCAGCCGCCGTAACCCGCAGCCCAACCGCCTTTGATGCCGACATTACCGGTAATGGTCGCCAGTAGAGT
++
+AAA?AFFFBBAFGGGGGGGGEG?EHHGHHCHHHGHHFFGGG2FGHGHGCGGGHHHHEFGGGGGGGGGGC?EHHGHGGFFGHHC@@FGEGGGGGDGCHFCGGGGHGHHGGCGCGGHFGFHHFFCDAGGGGGGA99CFFFFGGFGGGGGFFFB
+@488624/1
+GAAGATCCGCTGACCTGTGTGGCGCACGGCGGCGGCAAGGCGCTGGAAATGATCGATATGCACGGCGGCGACCTGTTCAGCGAAGAGTAGTTGGATACGGGCAGGATTATCCCTGGATTGTCCTGCCTCTCCGACGCGAGAATACGCATAG
++
+CCDDDFFFFCCDGGGGGGGGGGHGGGGGGGGGGGGGGGGGHGGGGGHHHHHHHHGGHHGHHHHGGGGGGGGGGGHGHHHHHGFGGGHHHHHHHHHHHHGGG-AGGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFF
+@206148/2
+CCATAGAAGTGATTGAGAAATACTTCTGGAGTGAAGAAGAGCAGATGTGCCTGGAGTCCTGGGACGAAGCCTTTAGCAAAACCGAAGATTACCGTGGCGGTAACGCCAATATGCACGCCGTCGAAGCGTTCCTGATTGTTTATGACGTTA
++
+BCCBCFFFFBFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHFHHHFHHHHFHHHHGEHHGGGGGHHHHHHHHHHHHGGGGGGHGHHHGGHGGGGEGGGGEC?GHHHHHHGGGGGGGG?EFFGGGGGHHHEFG<GHFHHFFGGGB
+@510464/1
+TGGTATGGTGCTCACCGGCGGCGGCGCGCTGCTGCGTAACCTTGACCGTCTGTTAATGGAAGAGACGGGCATTCCTGTCGTGGTTGCTGAAGATCCGCTGACCTGTGTGGCGCACGGCGGCGGCAAGGCGCTGGAAATGATCGATATGCA
++
+BBBCCFFFFFFFGGGGGGGGGGGGGGGGGGGGHHHGGGGGHHHHHHHGGGHGHHHHHGHGHGGHFHGGGGCHHHHGHHHGFDFGGGHGHHHHHHHHGGGGGFHHHHHFHGGGGGFGGCDGACFFFFFFFFFCBF?FFFFFFFEBFFFFFF
+@1031276/1
+GCAACAAGAGATGCTGAATGCGGTTGGCGCCGAGTCGTTAAACGCGCTGACAGGTCAGATTGTGCCGAAAGACATTCAGCTCGCGACTCCGCCGCAGGTTGGCGAGGCGGCAACCGAATATGCCGCACTGGCGGAATTAAAAGCCATCGC
++
+CCCCCFCFFFFFGGGGGGGGGGGGGGGFGGGGGGGHGGGHGHHGGGGGGGHHHGGHHHHHHHHHHHGGGGGHHHHHHHHHHHGGGGGGGHGGGGGGGGFFHGHGGGGGGGGGGHHGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFF
+@1136632/2
+GAGATACACAGCGTTTACCCAACGCCAACCCATTGGCGTGGTCGTCGGTATTGTGCCGTGGAATTTCTCAATTATGATTGCTATCTGGAAACTGGCCGCAGCGCTGGTATGTGGCTGCACCATCGTCATTAAACCAAGTGAATATACCCCG
++
+AAABAFFFFFFBGGGGGGGGGGGGGGGGGGGGHCHHHGGGGFGGGGGG0GFHHFGHHCEFGFHGHHHHFHHHHHHFGFHHHHHHHHHGFFHHHEHGHFGGGGGGGGGHHHHHHHGHGGHHHGHHGHHHHHHHHHHHHHHHHHHGHHHHGH?
+@335964/2
+CCCGGAAAGCACGCCGTTTACTGAGGAAAGTCACCAATGAAAGCCGTTATTTTTGCCTATCACGATATGGGATGTCAGGGCGTGCAGGCCGTACTGGATGCAGGATATGAGATTGCCGCGATTTTCACTCATGCCGACAATCCTGCGGAAA
++
+?AABBBBBFFFFGGGFFGGGGGHCHGFHHHHHHHHGHHHHCFGGHEGGGHHHHHFHHHHHGHHGFHFGHGHGHGHHHHFFGGGGGHHHGGGGGGGHGFHHHGFFFHHHHHFFHFFHHGGGGGEFFGHGHHHHHHHFCCDCHFHHFHGGCGG
+@531680/2
+GCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCTCTTCCATTAACAGACGGTCAAGGTTACGCAGCAGCGCGCCGCCGCCGGTGAGCACCATACCACG
++
+CCCDCFFBCCFDGGGGGGGGGGGGGHHHGGGGGGGGGGGGGGGHGGHHHHHHHGGGGGHHHHHHGHHHGGGGGGGGHHHHHHHGGGHHHHHHHHHHHHHHHHCGGGGHHH?GHHGGGGGHHHGGGGGGGGGGGGGDGGGGGGGGGGGGGGD
+@545123/1
+GGACAATCCAGGGATAATCCTGCCCGTATCCAACTACTCTTCGCTGAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCT
++
+AABBBFFFFFFFGGGGGGGGGGHHHGEGHHHHHGHHHHHHFHHGGGGHHHHHBGCGGGGGGGGGHHHHHGHHHGHHHHHHHHGGGGGHHHGGGGGGGGGGGGGGGHGGFEGHHHHGGGCGHHHHHHHHHHGFGGGDFGHGHHHHHGDGH
+@639452/2
+ACGCAGCACGCTTGGCGTTCGCCACGCGATCGCCAAGCGTGCTGCGTGGGATCAACAGCAGCGGCGACTGCTTGCCCTGGTCATAAATATGATGCGCCGCATCACGGGCTTCATCTTCTGGAGAGAGCGCGAAATAGCAGATATTAGGGAA
++
+CCCCCCCFFCCAGGGGGGGGGGGGGGGGGGGGGGGGHGGEEGGHHFEGGGGGGHHGHHHHHHGGGGGGGGHFGHHHHHGHFGHHHHHGHHHGHHGGGGGGGGGGHGGGCCHGBHHHGHHHHHHGGGGHGGGGGGGGGGGGGGGGGGFFFG.
+@578849/1
+GGAGCGTCGTCTGGCCTACGTCGGCGTTACCCGTGCCATGCAGAAACTGACGCTAACCTATGCCGAAACTCGCCGTCTGTATGGTAAAGAGGTCTACCATCGCCCGTCGCGTTTCATCGGCGAACTGCCGGAGGAGTGCGTGGAAGAGGT
++
+CCBBCCAABBCCGGGGGGGFGGGGGGEGEGHHGGGGHHHHGHHHHHHHHHHGGCGGHHGHHFHHGGGGGHHGEGGEGHFGHGHHHHHHHEHHHHHHHHHHHGGGGGGCGGGGGGHHHHHGGCGFGHHHGGGGGGGGHHGGGGGGGGGGGF
+@914444/2
+GAAGTAATATTGGTAAACGACAGTAAAATGCCCCCCTTTCCTGACGAAACCGCTCGCCAACGGCTTAGCGCCTGTACCGCCAGTCCGGCCTGATTCGCTTTTGCTACCTGCGCTTTATCATCACCTTCAACCTCAATAACCAATTGAATA
++
+CBBBBFFFFFFFGGGGGGGGGGGHHGHHHGHHHGGGGHHHHHHHHGGGGGH0AEAFGFGGGDFGGGHEFCGGGHGHHHGGGGGHHHGGGGGGHHHGGGGHGHGHGFHHHHHGGGGGFHHHHHHHHFHHGGHHHHHGFHHHHHGGHHEHHG
+@842924/1
+CCCCGCGTGAATGCGCATAAATGACGCTGATAATAAAAATACCGATAATGATTGCTGCGAACATAACGTCACTGTCCTTCTAAGAAAACCTCATCCCGGGATTTTCAGGCAACCCTCCCGGTGATGCCAAAGAGAAAAGTGTAGTTCGTTG
++
+1AA1>1>1>1ADFDAAEFA1F2DDHGGGG/GDD2FF1F1F1A1AAFECEGGGHH1FGBG/EGEHH11?FGF/21FGHHHFHHFF1@GH0>FCCFH1//E///01>B2BFF/<FG/GHGA/<>@FHB11F?CBCGFC<?G1=1FFDFHF<00
+@637558/1
+GCGTCAGACATCTCCGAGCGTGGTATGGTGCTCACCGGCGGCGGCGCGCTGCTGCGTAACCTTGACCGTCTGTTAATGGAAGAGACGGGCATTCCTGTCGTGGTTGCTGAAGATCCGCTGACCTGTGTGGCGCACGGCGGCGGCAAGGCG
++
+?AABBBBFFFFFGGFECEGGEEGGHFGHGFDGFHHHFGGEAEEGCEGGGGGGGF2CFDDDHGFHFFHCDDFGFFHHHHHHFHHFGHGDCFCGHFFFHHFF.<DHGGHGFHHHFHFFHGFCDHFGGGGFFGGGGGGCGGFFFCAABCFFFF
+@134455/2
+AGCCTGACGTTCACGGGAGAGGATCGCGACCAGATCCGCGACATTCTCAACAGTATTACCCGTAACTATCAGCAACAGGATATTGCGCGGAAATCTGAAGAGGCGGGGGAAAGCCTGGCGTTTTTGGCAAAAAAAATGCCGGGAGGCCGCA
++
+CBCCCFFFBCCFGGGGGGGGGGHHGGGGGGGGHGHHHHGGGGGGHGGHHHGHFHHHHHHHHGGGEGHHHHHHGHHHHHHGHGHHHHGGGGGGGHGHHGHHHHHGGGDG-A.../.0;;??.-;..-;009FB.:B-.;0;9--:-:.;---
+@641348/2
+GGAGCTCACCGGCGGCGGCGCGCTGCTGCGTAACCTTGACCGTCTGTTAATGGAAGAGACGGGCATTCCTGTCGTGGTTGCTGAAGATCCGCTGACCTGTGTGGCGCACGGCGGCGGCAAGGCGCTGGAAATGATCGCTATGCACGGCGG
++
+>A3>A?FFFFBDCFFGEFGCEEGGGGHHHCGGGGFHHF?FGFFD0F3BBFFHG?FF?GFFDDCCFGHFGGHFHF/A<GF?FHFFDBFHHHFEDGFHHEF0G=CFECADGGCGGAABFF-@FEFFFFFFFFFBBFFFE.ADDBBBFE-@--
+@790090/2
+CTCTGCAAACGACGAAATGGGCATTTCTGTACAGATAGTGCGTTGTTCAGCATCTGTAGACTTATAATGGAAGATAAGACCTGTCTACAACATGACAAACAAAAACAAATGCGTAACGGAACTTTACGAAACATAGACACTCTAACCTGTT
++
+BCCCCFFFFFCCGGGGGGGGGGHHHHHHHHHHHHHHHHHHHGFGGGHHHHHHHHHHGHHHHHHFHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHFGHHHHHGHGHHHHHHGGGGGGGGGGHHHHHGGHGFHGHHHHHHEHFHHHFHFGF
+@664671/1
+GGCTATGCGTATTCTCGCGTCGGAGAGGCAGGACAATCCAGGGATAATCCTGCCCGTATCCAACTACTCTTCGCTGAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGAT
++
+33AAAFDDAAAAGGF5AFCEEAFFEGGGECFCFHHHHF2GGFAEG2D5AFGHHFHG>EG1G53B?F@3FGF3?>FGEHGHHHF@E/EEE/EEEDFBFD2CGHEAHF2GHFDG@B@ADGH1</>-A@D<-<A::ACG..:C0//:CD-;-
+@574363/1
+TCGACTGATAGGTGCCGACGCCAAGGAATACCGCATCGTAATCTTTCAGCAGATCTTCAAGCTGTACATCACGACCCACTTCGGTATTAAGTTTGAACTCAATACCCATGCCGGTGAAGATCTCGCGACGGCGGGTCATCACCTCTTTTT
++
+CCCBCCCFFFFFGGGGGGGGGGGGHGHHHHHHGGGGGGHHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGGGCHGHHHGGGHGHHHHGHHHHHHHGHHHHHGFEGHHHGGBDGHHHHHHHHGGGGGGGGCG-DFHHHGGGGGGGGG
+@1329514/1
+GTTCTACCAGATAGTGAAAACCGATGGCCGCGCACAGGTGATCCCATTCCGTACGCAGCCTATCAACACCGTGCCGCCAGCAAACCAGGATCATGACGCGCCGCTATTGCAGCAGTATTTCTCCTGAGGATTTTCGCCCGGTGGCGGCTA
++
+BBBBBFF54CCFGGGFFGFGGEGG?EDHHCFEGGEGBAA3BG5FGHFFHHHGGGGGGGGHFHHHHHHGFGGEHGEEGGEEFHHHFGHHGHEGHGHHBAE@BFGGGGGHHGFHHGH?GFDFGFHHHFHHGHFGFHHCFGGGGC<EGC@CCG
+@692128/1
+GTATTCTCGCGTCGGAGAGGCAGGACAATCCAGGGATAATCCTGCCCGTATCCAACTACTCTTCGCTGAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAA
++
+AAABBBFFAABDEEGG?EG?FFCEDEFFGHHFHCEFFHHHHHHHHGHGAGHHHHGHHGFFGDGGHGGGFHGFHHGFGCEEFGE>EGHHHGHGHHHGFHHHHHHHFGGDEGHFFGC@DGG@GGCCDDFEAECHGHHFHGGGGGFFFBFFGG
+@457343/2
+ACTTCAGCGCCTTTAACGGTAATTTCCCCCAAACCCACTGGGCGCCACAAAATCTGGCGCAGGACGATACCACGCATATGAAATCGCTGTATGCCGCTACGCGCATTTCGCTGGCCGACCCGCTGCATCTGATTCTCGGCGCTCGTTATA
++
+CCCCCFFFCCCCGGGGGGGGGGHHHHHHHGGGGHGGGGHHHHHGGEGGHHHHHHHHHHGGGGGGHGGGGGHHHGGGGGHHHHHHHGGHGGHHEHHGGGGGGGGGGGGHHHGGGGGHGFCGGGGGGGHHGHHHGHHHGGFGGGGGGGGGGG
+@361582/2
+GTCTGGGGGTTATCGCTTCCGGCGCATCGCGCATTACTGATGAAATGCTGATGTCAGCCAGTGAGACGCTGGCGAAACATTCTCCGCTGGTCAATAACGGCGAAGGATTAGTGTTGCCAGCGCTTAAGGACATCCAGGTCGTGTCGCGCG
++
+BAABCFFCCCCCGGGGGGGGGGGGGGGGGGGGGGGGHHHHHHGHHHHHHHHHHHHHHHHFFGHHHHHGGGGGGGGGGGHHHHHHHGGGGGHHGHHHHHGGGGGGGGHHHGHHHHHHHHHHGGGGGGHHHHHHHHHHHHGHGGGHHGHGGG
+@1349790/2
+ACCCTCTCTTGCGCGGCTGAATTTTCCCCAGCGAACCATGATACGTTTCACGGTATTTAGCGCTCATGTCTTTACCGGTCTCGTACATCGCAGCAATGATCTCATCGAGCGAGATACAGGGTTCACTTACGCGACTCATCGCCATCGTCG
++
+AAABBBFFFFFFGGGCGFGGGGHHGHHGHFGHGGGGGHHHBHHHGHFHFHHHGGHGHHGGHGCFGGHGFGHHGHHHGEEE>GFFFHGFHGGG/EHEGH3EGHHFDFHEFDDDGGGFGFHHE<FFHFGDGE/ECGGGDFDDGGDGEFGEC@
+@668247/2
+CAAGGGTTCGCCGTCTAATTTTTCAAACTCGTCTTTATGTTTATTCCACCAGCTCTGACGTACTCGCAGCACGCTCATCTCCCAGGCGTGTTCACCGCTGGCATAAGGGGTTACGACGCTATCCACGATTTTCGCCAGCCACAGCGTGACA
++
+BBBBBBFFFDBBGAFGGGGGGGHHHGGHHHGHGHEHHHHHHHHHHGHHGFFHHGHGHHHGFGGHHGGGGGHHGGGGGHHHHHHFHGHGGGGHHHHHGGFFGGGHHHHHEGEDEHGGGGGGGGHHHHGGHHGHHGGGGCGGHHHHHGDGGED
+@754692/2
+TGGTATGGTGCTCACCGGCGGCGGCGCGCTGCTGCGTAACCTTGACCGTCTGTTAATGGAAGAGACGGGCATTCCTGTCGTGGTTGCTGAAGATCCGCTGACCTGTGTGGCGCACGGCGGCGGCAAGGCGCTGGAAATGATCGATATGCA
++
+BBBAAFFB@FFFGGGGGGGCEFGGGGGGCFGEF3GFGGGGHHHHFGGFEEGE3BDGGHHCDF0CCBDGGFGHHHFFHFF?FDFFEDFHFG1GGFFDGGG@.CGFHDC==EHGGF?CGCDGGGF@-DAEEFF;--.;FBFBBFFAEE=FFB
+@652069/1
+GCGCTCGTGCTGCTATCGAAGCTGCTGGCGGTAAAATCGAGGAATAAGTAGCAGATGGCTAAACAACCGGGATTAGATTTTCAAAGTGCCAAAGGTGGCTTAGGTGAGCTGAAACGCAGACTGCTGTTTGTTATCGGCGCGCTGATTGTGT
++
+ABCCCCCBABCFGGGGGGGGGGHHHHHHGGGEGGHHHHGGGGGHHHHF5DBGHGFFGHHHHHGFHHHGGGGCCHHHHGHHHFBHHBGHGHFHHEFFFG0GGHHE3BFGGHHDGHDFC/<BGHHGDGGHHHGHHFHEG@/CCC@@.DD0<<<
+@801476/1
+TCCAACTACTCTTCGCTGAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCTCTTCCATTAACAGACGGTCAAGGTTACGCA
++
+AAAAA1CFFFFDGFG?1E1G1G0F1FE?EGCGGGECCGHG2FAGF?GGGFFHHHGCGGAF11//EEEEG/E?E/>?EHFGHEHFFBFC@CC/GGHBHHBFG0CFAC/AC.0FBFDGBEC.0CGEDDFFG0<<GHHH?FA..:CC:CCFGCG
+@945259/1
+GGCGGAGAGACTCGAACTCCCAACACCCGGTTTTGGAGACCGGTGCTCTACCAATTGAACTACGCCCCTAATTAGGGTGGCGGAACGGACGGGACTCGAACCCGCGACCCCCTGCGTGACAGGCAGGTATTCTAACCAACTGAACTACCG
++
+BBBB@DBBAAFFGGEGGCGGGFGEFFAEGEGGGGHGG3CFGGGAEGHFDGHDF3BG3GFFHFFGGFGFHGHHFGHF1BF?CEFEGGEGFGGGGG@FHFABGCDGCGGGGC?FGGHGGGGGFFGEED?A09FGFFFGFGG./C00BFFGGG
+@219522/1
+CTGGTCCGCGTCGCGGCAAGCCACGGGAAAACGGTCGCATCACACTGGTCTGGTAAAGGCAGATCCGCAGTATCCTGCGGCATCACGTTGAGCCACAGCTTGCGCCAGAGCGGCGTTTGCCGCTCGCCCTGATATTCCTGCAATTCAACCA
++
+BBBBBFFBBBDDEECGCFGGGGHGFGGGGHHHGGGGGGGGGHHGHHGHHHHHHGHHHHHHHGGGFGHGGGEGFHHHHHGGGGGHHHGHHHHHHHGHHHHHGHHGGGGGHHHGGGG@DFGHHGGGGGGGGGGGGGGFGGGGGGGGGGGFGGE
+@712898/1
+CAGTTATTACAATATGCGCGAAAAAGTGGTTGAGCATCCGCATATTCTCGATATCGCCCAGCAGGCCATGCGTGACTGTCATATTACGCCGGAGATGAAACCAATTCGCGGCGGTACAGACGGGGCGCAACTGTCGTGTATGCGCCCGCCG
++
+AAAAAFFFF31@FGGDGGC10E?E0AFD1GF0BE1GFFB/F/EA2GG2GFCCEE1B/AAEC0F0//FEHCGEA>EEB1BGHGHGH2GF/EEEE?/BD11E1GF/<1B/EC/<>-C.AGD1.-.<CGCGG??//;;...;;B;09;E--9--
+@1243793/2
+ATGAAATGGTATAACCGCGATCTTCAGCCCATTTCAGATAAGCGCCAGCGGATTCAAACGACTCATGGACAACAAAATGAACTCGCACGTTATTTTCTCCTGTTAGCGATTTAGCGCCTGATGGATATCAGCCGCCAGCGTGTTGATCTCG
++
+CCBABFFFFDFFGGGGGGGGGGHHHHHHHGHHHHHHHHHHHHHGGGGGGGGGGGGHHHHGGGFGHHHHHHHHHHHHHHGHHHGGGGGGGHHGHHHHHHHHHGFHHHHGGHGGHHECFDGHHHHHHHHGHHHHHGGGGGGGGGGHHHHHHH.
+@851792/1
+GGCTATGCGTATTCTCGCGTCGGAGAGGCAGGACAATCCAGGGATAATCCTGCCCGTATCCAACTACTCTTCGCTGAACAGGTCGCCGCCGGGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGGCAGCGGAT
++
+AAAAAFFFAAAAG3A3110A0EEECAA/B//EAABGGGBFHHC/FBF2F21E1CCE@EFGBHFEFFG1FGHHHFG//11FEE11/>?EGGE/B/>FCDFEGEHGHGGHGB1FCCCCGE1<-<-<----A.--:E.CACF?.9CF?--9A
+@1006893/2
+GTCTTCTATGTTACCGTCAATCAGCCCGGAACTGGCCCGTATCGCTCCCGGCTTTCGTGCATTAAGTATTAATGTTATTGCCGCTCCGATTCGCGATGCGCAGGTCGGAGAAATCGCGCTAAAAGAGGCCTGTCAGGCCGTAATTAACGG
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHGFGGGGHHGHFAEEG2GGGHHGGEFGGGHHGGGGEHHHGGHHHGHDGHGHHHHHHHFGGGGGCEGGFDCEGFGGGFCGGHGDFGGCGHEFGGGGGFGHFG0.EEGEHHBF/CA@CAFGHGGFFG
+@1409172/1
+GTCATAACCCGCTGGAGGCCGCCGCTCATGCGATTCCGGTACTGATGGGTCCGCATACCTTTAACTTTAAAGATATTTGCGCCCGTCTGGATCAGGCGAGCGGACTTATCACGATTACCGATGCGGCTACGCTGGCAAAAGAAGTTTCCT
++
+BCCDCFFFFDDDGGGGGGGGGGGGGGGGHHHGGHHHHHGGGGHHHHHHHCGHGGGGGHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGHHHHHGHHGGGGGGGGGHHHHHHGGHHGHHGEDGGGGGGGHGGGGGGHHHHHGGFHHHHHH
+@957171/2
+GAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCATGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCTCTTCCATTAACAGACGGTCAAGGTTACGCAGCAGCGCGCCGCCGCCG
++
+CCCCCFCFFCCCGGGGGGGGGGHHGFHHGHHHHHB5CAEFGGFFFG0EFGE0?BFEFGGGHFGHGHGFGBEGCGGHHHHHEHGHHGGGGCGGGHFHFFHHGGGHHGFFHHHHHGH11FACGGGDGFHFGGHG?DG@CCGC@CGGGGGCGG?
+@1190250/2
+CCTTGACACCGGCTGCGCCAATTTAAGCTCGGTAAAATCCGCCGTGGCGCGCCACGGTTACACCCCGGTGGTCAGCCGCGAAGCGGAAATCGTATTACGCGCTGACAAACTCTTTCTGCCCGGCGTCGGCACGGCGCAGGCCGCTATGGAT
++
+ABBBBFFFFCBBGGGGGGGGGGHHHHHHHHGGEGFHHHGHGGGGCGGGGGGGGGGGGFFGHHHHGGGFEGGGHHHGHGGGGGGGGGGGGHHG?GFHHHGGGGGGGHHHHHHHHHHHHHHHHGFGFDGCGGDGGGGAFFFFFFFFFFFFFFF
+@1004455/1
+ACCTTGACCGTCTGTTAATGGAAGAGACGGGCATTCCTGTCGTGGTTGCTGAAGATCCGCTGACCTGTGTGGCGCACGGCGGCGGCAAGGCGCTGGAAATGATCGATATGCACGGCGGCGACCTGTTCAGCGAAGAGTAGTTGGATACGGG
++
+AA1AABFCFD>1G1BFGFGFGA1AFGFHG?EEAGHGDHFHHGE//A/AGA11FDGBFDGEE/EGF1FG1@BFH@EEEEEGC?E?C//B<CGGGGC@F11FD11DFAGHGFBGHGGGG-?@@@GGFGB00BFB@-9--;BFFFFFBFBB-->
+@591407/2
+TTTCGATACCATGCGATAGCCTGTCTGTCGCTTTGCGCGACGCCGCGACCAAATGCAGACATGATGCCCAGATGCGTTTGCGCAGCAGGCAGCCCCTGGCGAGCGGCTTTGCGATACCACGCCAGCGCCTGTTGATAGTCCTGAGAAACG
++
+A3AAB3FABFFFGGGGGGGGGGH4GHG5FFHGGGHHGGC?EGGGGEGEEGGAHHHHGGFHGHFEFHHGHHHHHHGGEFCGHEGGCDFHGGHFDGGGHGHHGCGGGGGGCHB<CDEGGHHEDGGGGGGGGGGFGGBFGFG0BFBFFGGGFG
+@391121/2
+CGTAGGTGCAGTTGTATTCATATTCCTTCGCCTTTTAATGCCATCCCGAAACGTATGAGCGCGTATATCAAAACGCGCCGAAAAGACTTACCCTGATATAGACTGCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAA
++
+ABABBBFFFFFDGGGGGGCBEFHHFHHHHGEGGFHHHHGHHHHHGGHGGGGGGHHHFHGBGGGEEGHHGHBFGGCE?FEG@EGGHGHHHHFHHHGHGHHHHFHFHHGGDGDHHHHHHHGFHHBGHHHG2FGHHHHHFGHGGHHHHGGGGGF
+@494876/1
+CCACAACTGCGGCGAGCGCACCGCGCGCGGCTCGACTCTACTGGCGACCATTACCGGTAATGTCGGCATCAAAGGCGGTTGGGCTGCGGGGTACGGCGGCGGCGCTAACCGGAAAATCGCCGCGGGGCCGGGGGTGCCGGATAACCCGGTA
++
+BBBABBBFFFBBGGGGGGGGGGCFGGGGGGGGGGGGGGHHHHHGHGGGGGHHHHHGGFGGHHHHHGGGGHHHHHHHGG<AFGGGBDAC?D-AA:CDGGG---9;-9-A/9---;;9F/9.;9--9---;>B-9---.;-;-..;//A-@--
+@436556/1
+ATCTTAGAGATAACACCCTTGTTACCGTGGCGACCTGCCATCTTATCACCCGGCTGGATACGGCGTTTAACGGCCAGATAGACCTTCACGATCTTCAGCACGCCCGGCGCCAGATCGTCGCCCTGGGTGATTTTACGGCGCTTCGCTTCAA
++
+DCDDDFFFFFFFGGGGGGGGGGHHHHGGHGGGGGGGHHHHHGHHHHHHHHHGGGGGGGHHHGGGGGGGHHHGGGGGHGHHHHHHHHHHHGGHHHHHHHHHHGGGGGGGGGGGGGHHHHHGGGGGHHGCDEHHHHHHGGGGGGGGGGGGGFF
+@209506/1
+GGAGAAAATAACGTGCGAGTTCATTTTGTTGTCCATGAGTCGTTTGAATCCGCTGGCGCTTATCTGAAATGGGCTGAAGATCGCGGTTATACCATTTCATGGTCGCGCGTCTATGCCGGAGAAGCGCTACCGCCCAATGCCGATGAGTTCG
++
+BBBBBFFBFFFFEBACEEEEFGGFHHHHHHHHCHGHHHHHHGFGGGFHHHHDGEEGGGGGGGHGHFFFHHFFFFFGHHHHBFHGGFEFGHHHHHHHGGHGHHHHGGGGGGGGHHGFHGC@/DHHCCCGFGH@CC?DEGHHHGDFGFHHBGE
+@1505752/1
+GAATTGAAGATCTCGTTACCACGACGACCGACCATGACCAATCCGGGAGAGTACAAGTATGTCCGCTGAACACGTTTTGACGATGCTGAACGAGCACGAAGTGAAGTTTGTCGATCTGCGCTTCACCGATACCAAAGGCAAAGAACAGCA
++
+BABBBFFFFFFFGGGGGGGGGGEEGGGGGGFGGGHFHHHFGHHHGG?EE1BBFGHHHBGDEBGHE/AEEE3DGDGHHEHGHGGFGGHGEEGCEEGGGGFGG/2GFGGF22<F?GFEGHHGC?DDFHHGG@?<<00<C<GHFEFGFHFFGG
+@696056/1
+GTCTACCGCAAAATGGAAAGCGATATGCATAACCTGCAACCCGCGATTGGCGAAGTGAATGGCGATCGCGGCAACTTTATGTATAGCCAGTGGAACGGCGGCGAAGGTCAGTACGGGCAGTGCGCCATGAAAGTGGATTTCAAAGCGAAG
++
+BBBCCFFCCCCCFGGGGGGGGGGHGGFHHHGHHHHHHHHHHGGGGGGHGHHGGGGGHHHHGHHGGGGGGGGGGGHHHHHHHHGHEHHHHHFHHHHHGGGGGGGGGGGFFFGDHHGGGGGGGFFCGGGGGGGGG9CFFGGGGGGGGGGGGF
+@1291914/1
+GGACAATCCAGGGATAATCCTGCCCGTATCCAACTACTCTTCGCTGAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCT
++
+ABBCCFFFFFFFGGGGGGGGGGHGHGGGHHHHHHHHHHHHHHHGGGGHHHHHFHGGGGGGGEGGHHGHHGFHHGHHHHHHGHGEEGGFGHGGGGGGGCCDGGGGGHGGGHHHHHHGCFGGHHHHGGHHHHGGGGGGCGF:GHGHHG:CG
+@6733/1
+GATTTTTTCGATATTATCGGTTTCAAGCAGTATTTGTTTGAACAAACCGAGATGAGCCATGGCACGGTGCGGGAATATGTCGTGCGTTTACGACGTCTTGGCAACTACCTCAGCGAGCAAAACATTTCCCACGATCTGCTGCAGGACGGTT
++
+>1>AAF3AFDAF1EFDGEEEGAA1FE2FFF1BDADFFGFCDGHHFC/AE/EEGHHHHHF1BCAA1EE/?/>CE//BGHHDDG>EAEGGGGDGFFG@ECFHEFDCCG1FGHFHECCGGG@F10FFGHHF1?1FC@FGAHH1<GCGGA.<@.E
+@810454/2
+GAATAATGTAGCGCTTGCTTTTGCTTTGCTCTGCATCCACAGCACGAAAACTCTGTGTTTGTATTGTTGTGTTTCCCATAGCATCCTCATCGGTTCAGAAGCTTTTGCGTGCGGTCGGTTCTGGTCACCAGACCGTTAAATTAGGTGAGTT
++
+ABBCBFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHGHHHHGGGGGHGHHHGHHHHHGFHHHHHGHGHHHHHHHHHHHGHHGHHHHGHGGGFHHHHGHHHHHGGGGGGGEGGGCGGGHHHHHHHHHHHGHGGGGGHHHHHGGFFHHH
+@1355072/2
+ATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCTCTTCCATTAACAGACGGTCAAGGTTACGCAGCAGCGCGCCGCCGCCGGTGAGCACCATACCACGCTCGGAGA
++
+DDCCDFFFFFFFGGGGGGGGGGGGGGGGGGGGGGGHGGHHHHHHHGGGGGHHHHHHHHHHGGGGGGGGHHHHHHHGEFHHHHHHHHHHHHHHGHGGGGGHHHHHHHGCDGGHHHGGGGGGGGGGGGGCFGGGGGGGGGGGGGGGGGCAGGC
+@1414028/2
+TCCGCACGCGGCGTGTAGATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGATCTTGGATGCACTTCCA
++
+AABBBBBBBDBBGGGFGGGGGGHHHHHHHGGGCEFGG3AFFHHHGGFCEGGFGGG3G?FC?/DGGFGFFEDGG?@DHGHBGEHAEGGGCGGFGGAGEEFFEFBFGGE.FFFBAAEFFFFFBFFFFFFFFFFFFEEFFF/BFFFBFBFFFF9
+@1375428/2
+CTGTTAATGGAAGAGACGGGCATTCCTGTCGTGGTTGCTGAAGATCCGCTGACCTGTGTGGCGCACGGCGGCGGCAAGGCGCTGGAAATGATCGATATGCACGGCGGCGACCTGTTCAGCGA
++
+CCDDCFFFFFFFGGGGGGGGGGHHHHHHHHGGGGGFGHHHHHHHHHHHGGGGHHHHHHHHGHGGGGGGGGGGGGGGGGGHGGGGGHHHHHHHHGDGHGHHHHGGGGGGGGGGGGGGGGGGFF
+@1173298/2
+TGGTTATCGCGTTGATTGGCTGCTTCGTGGGCACGATTGTCGGTCTGCTGCCGGGCCTGGGACCGATCAACGGCGTGGCAATCTTACTGCCGCTGGCCTTTGCGTTGCATCTGCCTGCGGAGTCGGCGCTAATTCTGCTGGCGACGGTGTA
++
+AA@AA5@D?ABBGGGGGF4GB2FFHH?FA?E22AEEGHGF5EECGGHEHCDGFGG?@FFEF1GD?EECEHFGCGCEEC@F3F3FDHFHHD2@/B/>DH2?<22<<?//?111<BF1>0@---<<<-<A-C@:0000;G00/.--;--..A9
+@1399802/1
+TGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCTCTTCCATTAACAGACGGTCAAGGTTACGCAGCAGCGCGCCGCCGCCGGTGAGCACCATACCA
++
+BBBBBFFF@BAFEGGGGGFGGGGGGGHGHGGGGGGGGGGGGGGGHGGHHGGHHFGGGGGFHHHGHHHHHGGGGGGGFH2GHGHHGGGHHHHHHHHHHHHHHGHGGDGGHHHHHHHGFGGGHFHGGGGGGGGFGGGGFGFGFFGGGGGGGG
+@1418908/2
+ATCCTGTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGTTCGTCGGTTGTGAACTGGTCACGCCAATGGCGCCGGAAATTAAAA
++
+BBCCCFFFFFFFGGGGGGGGGGHHHGHHCHHGGEGGGGHGGHGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHGHHGHHHHHHHHHHFHHHHGEGGFHHGHFFHH?FGEGDGCFGHHFFHHHFHGGHGGGHHGHGGGDC-DGHGHFHH
+@1408173/2
+TAATGGAAGAGACGGACATTCCTGTCGTGGTTGCTGAAGATCCGCTGACCTGTGTGGCGCACGGCGGCGGCAAGGCGCTGGAAATGATCGATATGCACGGCGGCGACCTGTTCAGCGAAGAGTAGTTGGATACGTGCAGGATTATCCCTGG
++
+B?ABBBFFFC?FGGEEEEGGG6DEF4FFA2GCDGHFF3FGFFFAFG?EFGHHHEDAEEGGGEECEGCGEEGGGGGECCGGGHG1FDGHFE?FHGHHHHGGCG-:--9AGG0CBB0BEG@GG?99F0CFF//BF./;AEF..//;BBBBB9.
+@145026/2
+CCATAGAAGTGATTGAGAAATACTTCTGGAGTGAAGAAGAGCAGATGTGCCTGGAGTCCTGGGACGAAGCCTTTAGCAAAACCGAAGATTACCGTGGCGGTAACGCCAATATGCACGCCGTCGAAGCGTTCCTGATTGTTTATGACGTTA
++
+A>ABBFBFDFFFGGGGGGGGGGHHHHHGHFHHHHHGFHGFHHHCHHGHHHGHHHGHHHHGFHGFHF?ED?HBHFFHHHFHHGGGGGGFHHHBGGGHGG/E@EFDEGGGGFFHFFBGFFFGGGF?FGGC?CEHFFHHHHFFBFHFEHGGFH
+@1425540/1
+GTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCGGATCTTCAGCAACCACGACAGGAATGCCCGTCTCTTCCATTAACAGACGGTCAAGGTTACGCAGCAGCGCGCCGCCGCCGGTGAGCACCATACCA
++
+AAAABFFFFBBBGGGGGGGGFGCGGFGHHHGGGGGGGEFGFGGGGHGGHEHHHHHGGFGGHHHHHHGHHHGGGEGGGGHHHHHHHGGGHHHHHHEHHHHHGGFHGGGEDFGFGHHHGGGGGHGHGGGGGCGG-CGGGDGGEGFFGGGGGG9
+@1184220/2
+CACCAGCCGGGCGCAACCCACAATCTGCCGCACGGCGTCTGCAACGCTATCCTGCTGCCAATTGTCGAGAACTTTAACCGTCCGAACGCCGTCGCGCGTTTTGCTCGCATCGCACAGGCGATGGGCGTGGAGACGCGCGGTATGTCTGACG
++
+BBBBBFBBBBBBGGGGGGFGGGHHGHCHHGGGGGGGGGGGGHGHHGGGGGHHHGHHHHHHGHHHHHGHGHGHGHHHHHHGGGGGGGGGGGGGGGGGDGDGGGHHGHGGGGGGGGGGHEGGGFFDGGG?FDGGFEGGGFFA.AAFFFFFFFD
+@258437/1
+GTGCGAATACCGGTAATGCGTCGCAACAAGACGTAACAAATATTCAGCGCCAGCGCGAGCAACACCGCGTAGCCTACCCAACTATACGCATCACCCATCCGCTCGATCGTTGCCATCATCGAAGCATAGGTATCGGAAATCGCGCCGTTGA
++
+AAAAAAD??1C1EEEFGDGFAEGCECG0G00FEFFFEBE0AAGEG221A/AEEEEEEGEEGF0G///EE@E>/<G1<GC<FEFFHHB<CAC?BGHHG0FH/?/@C/<C@?/0A1=DFHHFGHEGC/0<0<=0=G?CGGAFC.CA-A?-.;;
+@1165175/1
+GCTCATGCACTGCCGCTTCGATTTTTTCCCGGAGTTTATCAGAGACCTGTTCCGGCGTGCGTAGGCTCGTGATACGGTCATCGTGCCTACACCGGCAAGTTGGGCTACATCGGCGATAGTCACTTTACCGGTACTGCGCCGTTTACGGGGT
++
+BAABAFFFFFFFGG22AEFECG52EDE3FEE22EAGDF5GHHEFC2F3A5BG5E0AAFG1@11EA3B?>ECGFFDFFGEEF4C?0?/?30?BFEEG/</12BF<GGHHBFHGDC//<..FH11<FF1FD.?DCGHHHGGG?-:C.CCEC@-
+@367916/2
+CCCCTTGCATTATCGTCGCGATCCGCCGTGAGGATTCGATCCTCCTTGCCCGGCACGTTCGCCACCGCAACGGCGTGCATACCGTGCTGGCCGGGTTTGTTGAAGTCGGCGAAACCTTAGAACAGGCGGTCGCGCGAGAGGTAATGGAGGG
++
+BBACCFFFFFFFGGGGGGGGGGGGHGGGGGCFHHHHHGHHHGHHHHHHHHGGGGGGGHHEGGGGGHGGGGGGGGG?EGHHHHHGGHGGHGDFBFG/FDGHHHHHHDGGGGGCGGGHHHHHHHHHGHEGC:ABG?-C-;;AA///;BFF/D-
+@1485492/1
+TCATAGGCTATGCGTATTCTCGCGTCGGAGAGGCAGGACAATCCAGGGATAATCCTGCCCGTATCCAACTACTCTTCGCTGAACAGGTCGCCGCCGTGCATATCGATCATTTCCAGCGCCTTGCCGCCGCCGTGCGCCACACAGGTCAGCG
++
+BBBBBFFFFFFFGGGGGGGGGGGGGGGGGGGAAEGGGGGHHHFHHHHGEHHHHHHHHHHHGFGHHHHHHHHHHHHHHHGGGGHHGFHBGEGGGFGFGGGHHHHHGHHGCHHHHHHHHGGGGGFHHCGGGGGCGGGGGG?DCFGFEFFFGGG
+@1548137/1
+CCTTTATTTGACCTTTCAGCATAAACGCTAATCGCACGTAACGCCTTGCTTTCATATTCCAGTTGTCGCCGCGACGACATTTCGCTAAAGTCACGCCCCTTCTTCACTGGCATGGGGATTTTAAGGAGTTTATAGGATTTGATTACGGTA
++
+A?A3?FFFFFBDFGGFGGF5DGFFFGD?AEEABA22EEFHFAE??GFFB5A5A5FFFEEG5FGGHHFAGFG?EECE?EE1FHEBAEEGFFB4FFE0?EE/0BFDG3BFBGEBG00?/C/@FF2<?<1?FCFBGHHFFD?11<BG1>F.FG
+@328649/2
+ATACAGTGGGGCTGAATCAGCTAGAAAGCGTGATGCCAGCGGAAGCTTGGGAACCTCTACACTGGCTGGCAGAAGGGCTGGATTACCAGGAAGTGCTGGAAGAGTTTAACGAACATCGTAATGAGCCTGTTGATACTAACGACTTTATTGA
++
+CCCCCFFFFCCCGGGGGGGGGGHHHHHHHGGGGHHHHHHGGGGGGGHHHGHHHGGHHHHHHHHHHHHGGGHGGHHGGGHGGHHHHHHHHGHHHGGHHHHGHHHHHHHHHHGGGGGHGGGHHGHGHHHHHHHHHHHHHHGHGGGGGGHHHHE
+@1530973/1
+GATAAGCGCAGCGCCATCCGGCAAAATTACCAGGCGGTATGATACAGTTCGACAATGTCCGCCAGACTCGCTTCACGCGGATTGCCGCCCGTACAGACATCATCGAACGCCGCCTGCGCCAGCGCCGGGATATCCTCTTTTCGAACGCCGA
++
+CCCCCFFBCCCBGGGCFGGCEEEEHFGHGFGHHGHEGAEFGFEFBGHFDGFEFEGHHHHGGEGFGHGBGFGGHGHHHGGGGEFHBGCC/BB>CFGFHHHHHHHHHGHGFDDGGGGFHGCGGGECGGGGGD?FGB0FBFGGGGGGGFCE@B=
+@533498/2
+ACTGAATTCCATTGGTGGTGAAGTCTTTGGCAAGGTGGAAGTGTTTCTTACATTCGGTATGTGGACTACCCTGACCATCTTCGGTTTACGCGGGATCCTGTTATCCCCGTTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGT
++
+1A11>133BB3331B111AA11DD33AFF0GAFFF11001B11ADCFA1DGHBG120BCFHBD1FGDGE0B1F0B0BFAA2AA/FEF11B/>//>EFHH1B>>G2FGE>/0B11B<E1B2B222F//<////</<@/?ACC@@C.<011<
+@1515631/1
+GTGGTATGGTGCTCACCGGCGGCGGCGCGCTGCTGCGTAACCTTGACCGTCTGTTAATGGAAGAGACGGGCATTCCTGTCGTGGTTGCTGAAGATCCGCTGACCTGTGTGGCGCACGGCGGCGGCAAGGCGCTGGAAATGATCGATATGCA
++
+A>AA3DFCCFFBGGGGGG?EGGGCGGEGGCFGGHHGGGGGGHCFHHFFGEGEEFGFHHHHHFFCGHHG?FCGHHGHHHHHGFDGGEDHHHGHEDGHHHGGGGGBGHHFDG?E-ADC@A?DGFGFFFFFFFFFFFFFFFFFFBBEFFFFFFB
+@1520871/2
+GTGTGGCGCACGGCGGCGGCAAGGCGCTGGAAATGATCGATATGCACGGCGGCGACCTGTTCAGCGAAGAGTAGTTGGATACGGGCAGGATTATCCCTGGATTGTCCTGCCTCTCCGACGCGAGAATACGCATAGCCTATGAAGCCAATTT
++
+AAAAABCCDDCCGGGGGGGGGGGGHGGGGGHHHGHHHHGGHHGHHHHGGGGGGGGGGGHHHHHHHGACGGHDHHGHHHHHHHFDFCGDGEHHHHHHHHGGFFGGGGGGGGGGGGGGGGGGGFFFAFFFFFFFFFFFFFFFFFFFFFFFFFF
+@319490/1
+CTCTCCAGAAGATGAAGCCCGTGATGCGGCGCATCATATTTATGACCAGGGCAAGCAGTCGCCGCTGCTGTTGATCCCACGCAGCACGCTTGGCGATCGCGTGGCGAACGCCTTCACCCAAGAGTGGCAAAAACTGGGCGGCGGCATCGTG
++
+BBBBBFFFFFFFGGGGGGGGGGGFHGHGGGGGGGGHHHHGHHHHHHHHHEGGGFGGHHGHGGGGGGGGGHHHHHHHHHHHGGGGGHHGGGGGGHGGGGGGGGGGGGGGGGGGHGHHHHHGHHHHDDEGHHHHHGHGHHHGGGGFFCFFFFF
+@1331426/2
+ATACCGATGAAGCTATTCATAATGCCCCATACGGTGCCAAACAACCCGACGAAGGGGGAAATGGCGCCGATCGTCGCCAGATAACCGTTGCCTCGTCCCATGTAGCGGCCAACCGCTGCGACGCGACGTTCCAGACGGAAGCCGGTACGTT
++
+>AAAABBBBFFFGGGGGGGGG5DFGGHDGHHHF2GH?GFHHHFFFEGGCGGGGGGGGGG1GFHHEEEEEEEFGHHF?E<EGHHFHFGGGGGGBC?FDDDGHHHEHHG/CCFHGC-<@CDGCCGGGGCC9EFFB099B9..;EGG-@-9AB9
+@369170/1
+TTCGTGCGCATCGCCCGCCTGATAATGCTGCCCGTCCACGGTACAAATCGCTATTCCCAGCTTTGAACCCTCGACGGACGCTAATGCCGGAATATAGTCAGCGACTTTGCCCTGGCCAATGAGGGGGCGAACGCGCTGTAAAATCGTCT
++
+CCCCCCCCCCCCGGGGGGGGGGHHHHHHHHHHHGGGGGHGGGHGHHHHHGGHGGGHGFHHHHHHHGHHHGHHGGGGGGGGGGGGHHHHGGGGGHHHHHHHHHGGGGGHHHHHHHHHHHHHHGHHGGGGGGGGGGGGGGGGGGGGGGGGG
+@1162920/2
+TAGTCATACAGCGGCGTTGACGGCCAGGTCTGATCAACCAGTTCGCTGCCTTCATCGCTGGCGATCAGGAATCCGCCGGGAGCGGGGCTATTCAGCGACTGGGCGGCACGCGCGGTCTCGCGAGAAATAAACGGCGCCGTTGAGGTCGTGA
++
+BBCABFFFFFFFGGGGGGGGGGGGGGHHHHGHHHHGGFHGGHHHGGGGGHHGHHHHHGHGGGGCGEDHHHHHHHGGGGGGC?EDGGGGGHHGGFGHDGFGGHHHGGGFGGCFGGGAD?FGG?@FFFFFFFFFFFFFFFFFFFFEFFFFFD/
+@1011320/1
+CATAATGCCCCATACGGTGCCAAACAACCCGACGAAGGGGGAAATGGCGCCGATCGTCGCCAGATAACCGTTGCCTCGTCCCATGTAGCGGCCAACCGCTGCGACGCGACGTTCCAGACGGAAGCCGGTACGTTCTTTAATACCTTCGTTA
++
+AAA?AFFFCFAAGFGF?FAEBG1CGCCGEFG?AEEGCGF?CGGCDEBCAAEEGGGEHH//>EECGBGFHGEAAEEFBEHF??G1FGH2DBCC@@EEC@CGG?CGGGGC?CCGE/:CFF:@...9;.?-@?9./;9EFFFBF00://BAFF-
+@246082/2
+GTCTTATCCAGCGTGATTTTCCAGCCCTTACAACAGTGGTCGCGACAGGCCGAGCCAGAACAGGAAAAGCGGGTGACAAAGGCAGGTTCAGTGACGGTGATTTCTTTCATTACACAGGCTCCGGAATTAAAAAAGGCAGCTTTCGCTGC
++
+ABBBBFFFFFBFGGGGGGGGGGHHHGGHHGHHGHHHHHHHFGGGGGG?AFGFGGFGFGEGHGFEHHHHHHGGGGGHHHHHHHHHDGFHHGHBFGEFC/FFHFFFHGFFFHFHHHHHEHEFG/C?CCGFHHHHHGG?ACGGBGFHGGGGG
+@844047/2
+ACTCAGTGAAGGAGAACATCTGGCAGGCAGCGCTGGCCTGTTTGAGCTGGTACAAAATATGACGCCGGAGCAGCAACAGATCCTGTTGCGCGCCTCTGCCGCCTCGACGTTTTCCGGGCTTATCGGCAACGCTATTCTGGCCGGCGGTAT
++
+BBCBAFFFFFFFGGGGGGGGGGHHFECDHFGGGGGGGHHGHGHHFGGHHHHHGFHFHHHHHFH?EGGGGGGEHGHGHHFFGFHFHHHEGGGGGGGGHGGHGGGFGDGFGCGGGGHGFCGGHHHGHFDGGHGGGFGHHHHHHHGGG?FAFG
+@302835/2
+GATAAAAGAGTGGGTGATATTCTCGTTGCTCATCGGCTTTGGCACGGTTGTTGCTCGCTGACGGTGCCAGGCAATACTGATTGAGAGGATTTGAATGACCAAAGAAATGCAAAATTTAGCTTTAGCCCCTGTTGGCAACCTGGAATCTTAT
++
+CBCCCFFFBFFFGGFGGGGGGGHHGGGHGHHHHHHGGGGHHHHHHGGGGGGGHHHHGGGGGHGGGHGHHHHGHHHHHHHHHHGGHHHGGGHHHHHHHHHHHHHHHHHHHHHGHHHGHHHHHHGHGHHHGGGHHHEHHHHHHHHHGHHHHHF
+@909677/1
+CCATGAGACAATGCGACGTTTATCGTCGCCAGGGAACATAACAGAATGGAAAACCTCGTTTTGTGCTATGAGAGCGCTGGGCGATCATGACAGGAAAAACGATCTGCGAGGCAATAAAAGCCGCCGCACTGCTTCCGGGGACGCTATCCG
++
+AA@ABFBDFCFFGGGGCEEFGGHHGHGGGGGGHGAHGGHGHHGHGHHHHHHHHHEHHFFFCFHHHHHGHHHGGFHGGGGGGHFGGGGHHHGHHGHHHHHGGGHGHHGCDCGGGHGHHGHBGFGGGGGGGGFHHFHFGGGC??DGGGGHHD
+@577899/1
+GATAAAAGAGTGGGTGATATTCTCGTTGCTCATCGGCTTTGGCACGGTTGTTGCTCGCTGACGGTGCCAGGCAATACTGATTGAGAGGATTTGAATGACCAAAGAAATGCAAAATTTAGCTTTAGCCCCTGTTGGCAACCTGGAATCTTAT
++
+BABCCFFFCFFFGGGGGGGGGGHHGGGHGHHHHHHGGGGHHHHGHGGGGGGHHHHHGGGGGHGGEHGHHHHHHHHHGHHGGHHHHHHGHHHHHHHHHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHGHHHHHHHHHHHHEFHHHHHF
+@457700/2
+GCTGGAACCATGTCACCAAAGTGATGATGGTCGCCATCGTTTTGCTGTTTGTGTTGAGCGGCTTCTTCCGCGGCTTCGACATGAAAATGATCGAGTCTTTCAACATGACGGTACCGAACTGGCTTGAACTGATCCACAACTCGCTCAGCGG
++
+CCCCCFFFCFFFGGGGGGGGGGHHHHHHHHHHCGGGGHGHHGGHHHHHHHHHHHHHHHHGGGGGHHHHHGGCEGGGHGHGGGHHHHHHHHHHGGGHHHHGGHHHHHHHHGGGHGHGGGGHHHHHHGHHHHHHHHHHHHHGGH.CFGDFHDC
+@1215083/2
+TGCTGAAACCTTCTGGAATGCCGACGCGTTTGCTCAGCGTACGGATAGCGTTAATCGCTTCCTGACTTGCGACTTCGTCAGACATACCGCGCGTCTCCACGCCCATCGCCTGTGCGATGCGAGCAAAACGCGCGACGGCGTTCGGACGGTT
++
+CCCCCFFFFFFFGGGFGGGGGGGGGGGGGGGGHHHHGHGGGGGGGGGHHGGGGGHHFGHHGHHHHHGHGHGGGGGHGHGHGGHHHHHHGGGGGGGGHHHHGGGGGHHGGDFHHFHGGHGGGGGGGFHHH@CDFD?DGAGGGGGGGGFFFFF
+@793994/2
+AGCTGGCGCTGGACTATCCGCTGCCGAAAGTGATTTTGGAGTATCGTGGTCTGGCGAAGCTAAAATCCACCTATACCGATAAGCTGCCGCTGATGATTAACCCGAAAACCGGGCGCGTCCATACGTCCTATCATCAGGCGGTAACGGCGA
++
+BAABBFBDABBBGGGGGGGCGFGGHGEAEEDFFHHHHHGHGFGFFGBGEGHHFFHEFG?EGHHHHGFHFCGGGGHHHGGGGFEHHHHEEGGGGHHHHHGHHFHGGGGGHGDC?DGCCCDCDDGFG0<<ADGDGGHFGHHGC@AEFECGBB
+@916217/2
+TTATTACGCTGATCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAGCCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTT
++
+CCCDDFFCCCCCGGGGGGGGGGHHHGGGGGHHHHGGGGGGGGHHHHHHHHH5DBBEEGGGHHGGGGGHGHHHHHGHHHHHHGGGGHHHFGHHHHHGGGGGHHHHHHHHHHHHHHGGGGGHHGGGGGGGGGGGGHHHHHHHGGGGGCGHH?E
+@338181/1
+CCTTTCAGCATAAACGCTAATCGCACGTAACGCCTTGCTTTCATATTCCAGTTGTCGCCGCGACGACATTTCGCTAAAGTCACGCCCCTTCTTCACTGGCATGGGGATTTTAAGGTGTTTATAGGAT
++
+BBBCCFFFFFFFGGGGGGGGGGGGGGGHHHGDGGHGHHHHHHHHHHHHHFHGGHGGEHGGGGGGGGGGGHHHHGGGGFHHHFHGHFGGHHHHHHHHGFHHHHHGHGGGHHHHHHHDFGEHGHHEHHH
+@1393627/1
+GCCCCATACGGTGCCAAACAACCCGACGAAGGGGGAAATGGCGCCGATCGTCGCCAGATAACCGTTGCCTCGTCCCATGTAGCGGCCAACCGCTGCGACGCGACGTTCCAGACGGAAGCCGGTACGTTCTTTAATCCCTTCGTTATCTTCG
++
+BBBAABFFFC2BAEGGGGGGGGD?ECEGAEEGGGGGGGHGHHGGGGEEGGHHGGEAEFHHFHHGGGGGHHHGHG?EHHBGHHHF/@BDHGGGGGGGGGGGGGGFGDEFGHFGGGGCAEGGGGGFGDF/FFGFGGGGFBBGGGFFFFFFFF.
+@670410/2
+GGCATATAGCCCAGCTCATGCACTGCCGCTTCGATTTTTTCCCGGAGTTTATCAGAGACCTGTTCCGGCGTGCGTAAGGCTCGTGATACGGTCATCGTGCCTACACCGGCAAGTTGGGCTACATCGGCGATAGTCACTTTACCGGTACTG
++
+>AABCFFFFFFFGGGGGGGGGGHHHHHGGGGGGHHHGHHGHHHGGGGGHHHHHHHHHHHGHHHHHHGGGGGGGGGGGGHHHHGEHHHHHGGHGFHHHGHGHHHHHHHGGGGGFHHHHGHHFHGHHGGGGGGGGHHHHGHHGHHGGGGGHH
+@357711/2
+CCTTTAAACCGGTGGTGGCGAAAATGTCTGAGGTTTACGGCATCAACGGCGCGATTTCCGATACCTATGCTTCGATGATGGCAACGATCGAGCGGATGGGTGATGCGTATAGTTGGGTAGGCTACGCGGTGTTGCTCGCGCTGGCGCTGAA
++
+BBBBBFFFFFBBGGGGGGGGCGGEGHFGHHHHGHHHHHGGGGGHHHHGGCGGGGGHGHHGGGGGGHHHHHHHHGHHHHHHGHHHHGGHHGGGGGGGGGGHFAFHHHGGGGHHHHHGGGHGGHHHHGGGGA@EGHHHHGGGGAGGGGGGGGG
+@138908/2
+GGTGATGCGTATAGTTGGGTAGGCTACGCGGTGTTGCTCGCGCTGGCGCTGAATATTTGTTACGTCTTGTTGCGACGCATTACCGGTATTCGCACCATCATGTTGACCGGGCACATCATGTTCCAGCAGGCGGGGCTGATTGCGGTCTCTT
++
+A@>AAFFFBBBBFGGGGGGGCFGFHHHGGGGGGGGGGHHDGGEGCGGGFGGDHHHHHHHHHGHGFHHGHGFHGFEGEGEGGHHHGFEFGFHHGDGGHHHGGHHHGFHHCFGGGGHHGHHHFBFHFHGHHGGFCFGA-..0B009-9-E09B
+@286848/1
+GTCGACCTGCTGGCTTAACGCGCATCATCGCGAGCAGCCCGCGGGTATTCATCCAACCTGGACTGTGGCGTCATTAAGCGAACTGGAGCAGCTCCTGTGTAAACACTGATTGCCTCCCCCAGGTTGATGGGTAAAATAGCCGCATTTTTCG
++
+CBBCCCCDFFFFGGGGGGGGGGGGGGHHHHGGGGGGHGHGGGGGGEGHHHHHHHHHHGHHGHHHHHHHHGGGGHHHHHHGGGGHHHHHHHHHHHHHHHHHGHHHHHFHEHHHHHHHHGGGGGGHHHGHHHHGHHHHHHHHHGGGGGHHHHG
+@18831/2
+TTCCAACACCTTTTATTTTTCACGAAGTTGAGGTTTGAACCCCAAATTCTAGCAAAAATAGGCTTAAAAAGCACCTCAGGGAATAGTCTTAATCCGAAACTATGTCAAGTATTAACGATAACAGGCAGCAATAATGCCAATAAAATGTGGT
++
+CCCCCFFCCBFFGGGGGGGGGGHHEEFFHHHHHHHHGGHHHGGGGGHHHHFFHFFHHHHG33FGHHHHHHCHHHHHHHHFHGHGHHEGHHHHHEHGGGGGFHHGHFHHHHHHHHHHGEHFGGFFAFHGFHHHHHHFHHHHHGHHHBG?FD2
+@996552/2
+GCGTTTGCGCAATACCGATGAAGCTATTCATAATGCCCCATACGGTGCCAAACAACCCGACGAAGGGGGAAATGGCGCCGATCGTCGCCAGATAACCGTTGCCTCGTCCCATGTAGCGGCCAACCGCTGCGACGCGACGTTCCAGACGGAA
++
+AAAA?DAFDDDDEGGB0A0E1D1CGEGGHHHDFHHGBFGGHGHG?GGGHHFBGHHHCAECGGEGGGGGCEGHGG1GECEGECGGEG//CGG0BGBHHC<//CFHFGCCEGHHFFGBHGCCC?GFG?--:A@CCGGG@GG?AFGBF0A=BFF
+@1093711/2
+GGTCAGTTTCCCCATTCGTCCAGAAATGCTCCCTGCGCTCCGCCATGCGCACTAATTGTTCACAAGGCGCGTAACGAGGACCGTAAAGTGCGGCCAGGCGCTGTAATGTCGCCACCATTTCACCCGGCCCGAGAGCATCCATATAGCGGAA
++
+BBAAABFFFFFFGGGGGGGGGGHHHHGHHHHGGHHGGGGGGGGGGGHHGGGGGHHHHHHHHHHHHHHHGGGGGGGGGGGGHGGGHGHGGFHGGGGGHEHGGGGGHHHHHHHHGGGFHHHHHHHHHGFGGGGCCCGHHHHHHFFHHFGGGGG
+@828621/1
+TTGGTGCCCAGCGTACAGAGATCGTCCACCAGCACGCCGAGATAAGCCTGAGAACGCGCAGGCGCCCAGCCCTCTTTGTCGGCGGAAAGACGCGCGGCATTCAGACCAGCGAGCAAGCCCTGCGCCGCAGCCTCTTCATAGCCGGTAGTA
++
+CCCCCCFFFFCFGGGGGGGGGGHHHHGGHHHHGHHGGGGGGGGHHHHHHHHHHHHGGGGGGGGGGGGGHHGGGHHHHHHHGGGGGGGGHHHGGGGGGGGGHHHHHHHHGHGGGGGHHHGHHHGGGGGGGGGGGGGGGGGGGFFFFDFFFF
+@303306/2
+TGTGTGTTCCGGACCCTACGGCGCATTGCCGACGACCACCACCACACGCACGACGACCACTGCGCGAGATGGCGCAGTTGTTAGTAGGGTCGCGTTCAGCATGGAAGGGTTCATTAGGGGCCTTGTCTGTTTGTTATTAACACGTTTTATA
++
+AAAAAFFFFFADEGGGGCGFCEECAEGHCGEAEC/E///FG>FCCGECEEEEEEE/E/E/FHGEE/ECCEGGHGGGC/GF1/?D>@GBA0F@/CCGGEDDFFG0GGH??.<GDFFD00:AC@AH/0C;G:0G/GFGFGGFFFF?:CFG0FB
+@449867/2
+CCTCAATAATATGGCTATCCAGGATGTGCCGATCCTGAACAGCGATAAAATCATTTGCTCACGCCTGAAACGCGATGACACGCTGATGGTGCCGTCGCCGGGGACGATTATCCAGGCAGGCGACCTGCTGCACCTCGCCGGCCAACCTAC
++
+>>>>ACFFFFB3EGGBDBCFD1AF1F1DBGE00EEFF1AGFHCG?GEEG12BDFGHH2FGHB/0AA/FADFFGG/EEBG1@EE/AEE11@1BFE/>/>AEGE//////??>DGHFC/FC/?//->CFH<1GGGF/<E---:@@-GEC//F
+@227837/1
+GATCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTTCGCTATTGAA
++
+CCCCCFFFFFFFGGGGGGGGGGHHFGGCGGGGHHHHHHHHHHHGHGGGGGGHGGGGGHGHHHHHHHHHHHHGGGGHHHGGHHHHGGGGGGHHHHGHHHHHGHHGGGGGGHGGGGGGGGGGFHGHHHHHHHGGGGGGGHGGHHGGGGGGGFG
+@542712/1
+AAAGTGTACAGTAAAAACAGGATCTGCTGCGAGGCCAGACGTCGCAATAATACTTTTTGCGCCACGCCATAGCTCACCCACACCATCGCCGCGCCTACGCCAAAAATAACGCCCCAGGTGTAGTCGGTCAGTCGGGTAAAAATCTCGATCA
++
+ABBAAFFFFFFFGFGGGGGFGGHHHHHHHHGCEGGGHCHGEFEGGGGGHHGHHHHHHHFHGGGGGGGGGGHFHHHHHHHGGGGGGGHGGGGGGGGGGHGGGGGFHHHFHHGGGGGGGE?CHGBGHGC@EDH=GEGGCCFFHHHHHHHFGHD
+@1150833/1
+AACTTTATTCGTACCGCGCGGGCAAAAGGATTACCGATGCGCAGAATTATCTTCCGCCATGCGTTAAAACCTGCGCTGCTGCCGGTTTTATCCTATATGGGGCCAGCCTTTGTCGGCATTATTACCGGCTCAATGGTGATTGAAACTATTT
++
+AAAAAFFBDFF1FCCCGCEG?EEGFCFGEFHHHHHGGGGGCGGGGHHHFGHHHHHGGGGGHHGFEECGFH?FHFGCEGFHHHEEEBACGHHHFFFFHHFDGCCCGHGGHHHGHGF/@CCHGBFGHFCCCCCGG0GC=DGGFFFHG0CFFFF
+@1119821/2
+CAGGAACGCTTCGACGGCGTGCATATTGGCGTTACCGCCACGGTAATCTTCGGTTTTGCTAAAGGCTTCGTCCCAGGACTCCAGGCACATCTGCTCTTCTTCACTCCAGAAGTATTTCTCAATCACTTCTATGGTGTAATCCAGCAATTT
++
+>>AABFFBBAAAGGFEGGGFGGHG5FGEGFFFEEFBFGGEEEEEAFEGEHFHGF?EGFEEFHD3DAGHF?GEFEFFFEEBC?F?GEGFHDGFHFGGG2FGBFFDGHHFHFGHHGHHEGFHGHFGFGHBBDDDG1FGHH1FFHF10F0DHH
+@287593/2
+CCGACCAGGGTGGTGGCGATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGATCAGCGTAATAAGCGGCAGGTTCTCTTTAAGACGAGATTCAGGCGCGGCGTCGCGCGAATCTTCG
++
+CCCCCCCFCCFCGFGGGGGGGGHCHHHHHHHHHGHGGGGGGGGGGFCHHHHHHHHGHHHHGGGGGGHHHHHHHGGGGHHHHHHHHHHHFHGDGGGGGGGGGGGGG:BGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
+@295801/2
+CTTATTACGCTGATCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGT
++
+BBCBCFFFCCCCGGGGGGGGGGHHHGGGGGGHGGHHGGGGGGGFFHHHHHHHHHGHGGGCGHHGGGGGHGHHFHHHHHGHHGGGGGGFHGGHHGHHGGGGGHHFHGHGFHHHHHHDGGGGHHGGGCFFGGGC<DHFFBDHFGGGCG;CBFA
+@1406384/1
+CTCTTTTCCTTCCCATCCAGTTGGGATCGGCAGGCGCAATCGTGCTATTTATTACCGCGCTGGTCGCCTGGCCTCTAACATACTGGCCGCATAAGGCGCTGTGTCAGTTTATTCTTTCCTCAAAGACTTCTGCAGGTGAGGGAATTACTGG
++
+BCCCBFFFFFFFGGGGGGGGGGHGGHFGGGGGGGGGGGGGHGDHGGHHHHGHHHHFEFCEGGGGHCGGGHGHHHHHHHHGHFHHHHHHGGCFEHFFHGGGGDFHHFHHHHHHHGHHHHHHHHHBFFHHHGFFHBGHGGFHF?DHHHHHHGH
+@1203404/2
+GTGCGCGGTTTCGTAACTACCGGACCAGTCGCGCAGCGCCTCGTTACAGGCATCTTTTAGCGTAGCGGAGCCGCTATGAACCGGGATGACCTCAGCGCCCATCAGACGCATACGGAAGACGTTCGGCGACTGGCGCTCAACGTCTTTGGCG
++
+BBBCCDDBBBCFGGGGGGGGGGGGGGHHHHGGGGGEGGGGGGGHGGGHHHGHHHHHHHHHHGGGGGGGGGGGGGGGGHHHHHGGGGGGHHHHHHHHGGGGGHHHHHHGGGGGGHGDGGHHGEGHGGGGGGGGGGGGGGGGGGEGFEFGFF-
+@509430/1
+ATATGATTGAGTGTAACTTCTCTTGCCCGCAGATGACCTCGCACGCCATGGGAAGCGATGTAGGGCAAAGCCCGTAGCTGGTTGAAAAATACTGCCGCGCCGTAAAACGCGGTTCATCTTTGCCAATGCTGGCGAAAATGACGCCGAATAT
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHGGGGGHHGHHHHGGGGGGGGGHHHHGGGGGHGHHHGGHGGHGHHHGGGGGHHHHHDHHHHHHHHHHHHGGGGGGEGGHHHGGGGGGGHHGHGFHHHHHHHHHHHGGGGGGHHEGFGGGGGGGH
+@330673/1
+GATCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTTCGCTATTGAA
++
+CCCCCFFFFFFFGGGGGGGGGGHHHGGGGGGGHHHHHHHHHHHHHGGGGGHHGGGGGHGHHHHHHHHHHGHGGGGHHHGGHHHHHGGGGGHHHHHHHGHHHHHHGGGGGHHGGGGGGGGGGHHHHHHHHHGGGGGHHHGGHHGGGGGGGGG
+@162999/2
+AACTTGGCGTTTCTCGCGCCACGGTGGAAAATGCCTATGGCGAGCTGGTGGCGCAGGGCTGGCTGGAGCGACGTGGCCAGGCAGGCACGTTTGTGAGCAACGCTCTACGGTTTGAGACGGCGCCGCCGATACCCGCTGTTTTTGCCGGCGA
++
+AAAAAFBC1>DDFGGAFGGG?EG00AA/1BE11EFFFHFHHE/EAE1FABAF//>/>EEA?E?FEE0FGG?CE@E//GFEA/FFGCEGGC00??0GFEGHHCC//FGD/?CCCABF.>>.<<----:::@AA0BEG--.00:A@FG---9-
+@365840/2
+GCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTTCGCTATTGAAACGCTGATGAGCGTCGCCG
++
+A?AA333ADBBBGFFGGGGGGGHHGGGACABGEGGGEAFFEHHFBFHHGEFEGD?GHA?EAFHB@E>EDEFGFGFHHDD4BGHFD?@<EEC/BD/A/B@CDGFBGGFFFFDGGC->>FFEADCCDEDF0;;GGEGG.;C:0:CBG?--:-
+@1138057/1
+GTATCAGCCTGGCATCATATTTCTCTTTTCCGGCCATAAAATTGGCTATATTAACAAGCGCAAGTTTCGTTATGACGCTAATGAATATCTCTTACTGACCGTGCCGCTCCCTTTTGAATGCGAGACCTGGGCGAAGCCGGAGGTACCG
++
+ABBBBFFFFFFCGGGGGGGGGGHHHHHHHHHGGGGGHHHHGHHHGHHHHGHHHHHHFHHGGGGGHHHHGHHHHGHGGGGGFHHHHHHHHHHHHHHHHHHHGGHGHGGGGGGHHHHHGHHGHGGGGGGHHHGHGGGGGHGGGGGGHHHG
+@175886/2
+GGCGTCATCATCGCGCCAGCCGCAGACGCTAACGTTCATTCCGTGGTTTATCTGGGCCAACCGTGGCGAGGGCGAAATGCGGATTTTGGTTAACGTGCGTGAATACTGTGCCGGACGGCCCCTGCGCCTTGTCCGTCCTACTATATCTGCA
++
+11>11>1BD333111AEEAF000AE0AAA//AG/00BGBHB2FBAE//B11DB21AAAA/>/>///>>///>>/>/E/11?/E/<F12///11>/0<////??GG1F1@GF1@---------...-:EC./;00..9.9BF0000;0;090
+@539141/1
+TACAATATGCGCGAAAAAGTGGTTGAGCATCCGCATATTCTCGATATCGCCCAGCAGGCCATGCGTGACTGTCATATTACGCCGGAGATGAAACCAATTCGCGGCGGCACAGACGGGGCGCAACTGGCGTTTATGGGCCTGCCGTGTCCTA
++
+AAAAAFF333>AEEA00CA1B1B0EG1FGFHH?EAEGHHFHCCCCHGHAEEEG/FF0/?/FFF1EEE/FGGHB22EGGHG>EGGCGCEFE1FBFGHEHHG/CC?CC?<-><<CC@E?C--9@@@FB/.-.-AEB0;..E?--;;-;9BFBB
+@190705/2
+AAACTGGACGGCGTCAACGTGCTGCTACGCCCCGTAAGCGCAGAGTCGCTGGAAAATCTGGTCACGACCTCAACGGCGCCGTTTATTTCTCGCGAGACCGCGCGTGCCGCCCAGTCGCTGAATAGCCCCGCTCCCGGCGGATTCCTGATCG
++
+AAABBFFFFDDDEGGGGGGGGEFGHFHHAF?EEGFEC1GCE?EEHFGGGEEGEFGBGBGEFBFGHF?E/EHHHHDG?EEGG/?G/?2FHHEEGGGCCDGGGGCGDCGECG?FGHFHGGA9EG0FGG0FFAGGAGGA-B-@=>DFFFFFFFE
+@93921/1
+GTATAATAACCTATTGATCAGGCTAATAACCGCAGTCTATATCAGGGTAAGTCTTTTCGGCGCGTTTTGATATACGCGCTCATACGTTTCGGGATGGCATTAAAAGGCGAAGGAATATGAATACAACTGCACCTACGGGCTTGCTGCAGCA
++
+CBCCCFFFFFFFGGGGGGGGGGHHHHHHHHHGGGGGHHHHHHHHHHHGHHHHHHHHHHGGGGGGGGGGHGHHHHHHGGGGGGHHHHHHHHGGGGGGGGHHHHHHHHGHGGGGGHHHHHHHHHHHHHHHHHHHHHHHGGGGGHGHHHHHHHH
+@433573/1
+GTTATACCTTGCGTAGCGAAGATTCGCGCGACGCCGCGCCTGAATCTCGTCTTAAAGAGAACCTGCCGCTTATTACGCTGATCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCG
++
+CCCCCFFFFFFFGGGGGGGGGGHHHGGGGGGGGGGGGGGGGHHHHHHHGGGHGHHHHHHHHHHHHHHGGGGGHHHHGGGGGHHHHHHHHHHHHHGGGGGHHHHHGGGGGGGHHHHHHHHHHGHHGGGGGHHGGGGGGGGGGGGGGGGGGG
+@1267521/2
+CTACATAACCAAAAAGCATAGCAGACAGGCATGGTATTGCTGGTATAAGCAGGTAACATGGCTGTTATAAGTTGATAACAAACTCTTGCGCCGCGTCGTGATAGTTTGCAGACCTTCAAAGTTTGTGTTGCGCAGTACGGTGATAATGTG
++
+AAABAFFFFFF?G4EEGGGGGGHHHHHHAFGHHHGHFHBFHGFHGHHH5EGGH2FGFGHHFEBFFGHFHFHDG5GBHFHHDFHHHHHGD@EEEE?EEE>EBFFBBFGBDFEHHFGGBGBFGHFFFFBGGA1/<CCDFHGGGHEHGFHHFH
+@19624/2
+GTGCCATAAAATAAGCAAATTGCCGTTATTGCAACTGCAATCACACTTCCAGGTGGCATACTAATAACCAAACGAAAGAGAAAGGAAGAACATTCATGCCTTTAAGCGCACAACAATTAGCCGCACAGAAAAATCTATCCTATGTTCTGG
++
+A3ABBFFFFFFFGGGGGGGGGGHHGGGGHHHHHGHHHGHGHHHHHHHHHHHHHHHFHHHHHHHHHHHHHHFHHGGGGGHGHHHHHHHHHGHHHHHHGGHHHHHHGFHFFCGGHGHHHFGHBFEGGGGHGHHHHHHFHHHGGHHHHFHHHH
+@696661/2
+AGGTAAATATCAATATCCGTTTGTTGCCCAAGATCCTGCGTAATGTAGGGTTGCCAGTGGGCAGGGTAAATAAGGTCGATGATGCCCAGCGAAATATTGTTAATCTGCTCCTGATTATTCTCCCCAAACAGTCCCCAGCGGCGGGGGGTT
++
+AABAADDFFFFFGFGGGCEFBFFHHHHHHGFHHHFHFHHGGEFGHFGEFGACACGGH3GFEGFGFGGFFBFEFHGGGE0EHHHHGGGGHHGGGGHHHEHHHGDHHHHGHHGHF3FGFHEHHEFHGHGGHGFGHGHHGFFGGGCG-C:--9
+@1463171/1
+TCATGACGCGCCGCTATTGCAGCAGTATTTCTCCTGAGGATTTTCGCCCGGTGGCGGCTACGCCTTACCGGGCCTACAGTAAGCCGGATAAGCAAAGCGCATCCGGCAAATAAATCAACGAAAACTCACCTTTTCACCCGCTTGCTGCGTT
++
+BBBABFFBBADDCEEEFGGGGGHGFGHFFHHHFHHGGBCHH5GFH?EGDEFEE1B>EECEHGGGFGHFFGGGGGGHHHGHFF?DGCCGGGHHHF2GHGGGGGGHGGGC-0FDGFGHHGHGGFCCHF0GHFFHHFHHHFGGC?EAGHHGADG
+@1336678/2
+GTTGCAAACCATGCGCGGTTTCTTCGACGTCCTGCAATCCTCCGTCAAACAGAGTCGCCAGCGTATGTATCTCGTTCCGCCCGTATTCTCAAAGCTGACGGAACAACACCAGGCAGTGATGGACGCCATTCTGGACGGTAACGCCGAGGG
++
+CCCCCFFFFCBFGGGGGGGGGGHHHHGGGGGGGHHHHHHHHHHGHHGGHHHHHHHHGGGGGGGGGGHHHHHHHHFGHHGGGGGEFHHGHHHHHHGHHHHGGGGGHHHHGGHHGGHGGHHHHHGHGGGGGHHHHHHGFDDHGGDGGGGGGG
+@500710/2
+GGGTGGTGGCGATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGATCAGCGTAATAAGCGGCAGGTTCTCTTTAAGACGAGATTCAGGCGCGGCGTCGCGCGAATCTTCGCTACGCAA
++
+BBBABBBBAFBBGGGGGGGGGGHHHHGHGGGGGGGGGGGGHHHHHHHHHHHHHGGGGGGHHHHGHHGGGGHHHHHHHHHHHHHGGGGGGHHHGGGGGGFGGGGGGGGGGGGGGGGGFFFFFFFFFFAFFFFFFFFFFFFFFFFFFFFFFFF
+@397745/2
+GTGCCAAAAGCTCAAGATTCATACAGAGATCATGACCACACATGCAACAAAAAAGCCTGCAACTCATTGAAGTTACAGGCTTTTTTAAGGTTCATGATGCATCATGAATGAATGTTTGGTGGAGCTGGCGGGAGTTGAACCCGCGCCCGAA
++
+AAAAAFFFAFFFGF1F1AFEGFFFFFCF0DBCGFFGHHGCGGB1BGHHGCGFGC/A0BFGHHHHE1GFBGFHDBEHFEGGHHHHH/G1FBHHFHGB2F2FFGHGF1EGBFHHHHFG2FF>>E>/FCC0?/><///?1?<1<C>>--->---
+@1220460/1
+ATCAGCTGTTGCGCTATCTCACCGCCAGCACCGTTTACCACGTTAATTACGCCATCAGGGAAACCTGCCTCTTTAGCCAGCTCAGCGACTCGCAGCAGTGTCAGCGGGGTATATTCACTTGGTTTAATGACGATGGTGCAGCCACATACCA
++
+CBCCBFFFFDFFGGGGGGGGGGHGGGGGGHHGGFEHHFHHGGHHHGGHHHGGGGGHHHHHGHHHHHHHHHGHHHHHGHHFGHHHHGGGGGGGGGGGHHFHFHHHHGGGGFGHGHHHHGHHGGFHHHGFHHHGGGGGFGGHHGHHHHHGHHH
+@1015692/2
+GCGGTTGGACAATGTTACCGATAACAGGTACCCGTAACAAATTTTGCCACTTTTAGAGGGGGGGCCCGCTTTTAGCACGACTAATCATGATCACCACGTTTACGTTCTGATTGGGGTATCAGGCAGCGGTAAATCCGCTGTCGCAAACGC
++
+1AAA>>D?111BAFFGFFG000AEG1A0B11AFA0EE/11FAGGHF11BF1A112B1A0AEECG??A;?-AE/////9-9-9;///;B/BFBFFFF??9ABA9A9/-;//9/:---99;F//9/A-A-;-;:F///-----/;A---;A@
+@1039016/1
+CTCATTGGCCAGGGCAAAGTCGCTGACTATATTCCGGCATTAGCGTCCGTCGAGGGTTCAAAGCTGGGAATAGCGATTTGTACCGTGGACGGGCAGCATTATCAGGCGGGCGATGCGCACGAACGCTTCTCTATTCAGTCTATTTCGAAAG
++
+BBCCAFFFFFFCGGGGGGGGGGGGGGHHHHHHHHHHGGGGHHHHGGGGGHHGEFGGEHHHHHEHHHHGHGHHHHGGHHGHHHHHGGHGGHGGGGGGGHHHHHHHHHHGGGGGGGGGGGGGGGGGGGGGGHHHHHHHHGGGGGGGGGGGGGG
+@865068/2
+GATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGATCTTGGATGCACTTCCAGCGGGTTGACGTAGAAG
++
+BBBBBFFFFFFFG?ECECEGGGHHHHHGGGGGGGGEGFFHDEEGFGGGCDHFHGGGGGGHHHFGGFHGGGGC@ACFDGGGAGHHFHHG/CCGBECCGEHEGHHGHDH0FFGFBFGGFFGFFFFBFFGGFBFBF0BBBA--A@FFFFFFEF/
+@1139421/1
+CCCTTGTTACCGTGGCGACCTGCCATCTTATCACCCGGCTGGATACGGCGTTTAACGGCCAGATAGACCTTCACGATCTTCAGCACGCCCGGCGCCAGATCGTCGCCCTGGGTGATTTTACGGCGCTTCGCTTCAAGTTTTTTCTCGAA
++
+CCCDDFFFFFFCGGGGGGGGGGHHHHHHHHHHHHHHGGGGGGHHHHGGGGGGGHHHGGGGGHHHHHHHHHHHHHHGHHHHHHHHHHGGGGGGGGGGGGHHHHHHGGGGGGHGFEHHHHHHHGGGCFGGGGGGHGFHHHHHHGGGGGGGG
+@619923/1
+CGACCAGGGTGGTGGCGATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGATCAGCGTAATAAGCGGCAGGTTCTCTTTAAGACGAGATTCAGGCGCGGCGTCGCGCGAATCTTCG
++
+BCCCCDFCCFABGGGGGGGGGGHHHHHHHHHHHHGGGGGGGGGGGGHHHHHHHHHGHHHGGGGGGHHHGHHGGGGGHHHHHHHHHHHHHGDGGGGGGGGGGGGGFGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
+@742006/1
+TTACTAACCTGAATACTCAGATATCGAATCTGGATACCCGCGTCACCAATATCGAAAACGGCATTGGCGATATCGTCACTACCGGCAGCACCAAGTACTTCAAGACCAACACCGATGGCGCAGATGCAAATGCCCAGGGTGCGGACAGCGT
++
+BBBBBFFFFFFBFGBFD4B4B5ED5F44GF5DBF55F3FEEEEGF2GHGGFGHGAEE?3AEEGGGHBBE@EEEGAGEEEHHHHGG//>EFG/0FEB?G4BF??EG00FFDEEC@/BEGECD@CGGEBFFG1GF1<1GFD<FADC-CCEE:.
+@625574/1
+GATCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTTCGCTATTGAA
++
+CCDCCFFFFFFFGGGGGGGGGGHHHGGGGGGGHHHHHHHHHHHHHGGGGGHHGGGGGGGHHHHHHHHHHHHGGGGHHHGGHHHHHGGEGDHHGHHHHHGHHHFHGGGGGHGGGGGGGGGGGHHHHHHHHHGGGGGGHHGGHHGGGGGGGFF
+@1184449/1
+GGTCATGGTCGGTCGTCGTGGTAACGAGATCTTCAATTCTGCTGGCCGTGTCGCCGTAAAAATATAAAGCGAAATCTGTGCCAACTTTCACATTGCCCCCAAAAGGCGTTATCATGCGCACCATCGTGCAAAAGGGCTGCACCACGGTGA
++
+CCCCCFFFFFCBGGGGGGGGGGHHHGGGGGHHHHHHHHHHHHHHHGHGEGHHGHGGGGGHHGHHHGHHGHGGGGHHHHHHGHHHGHHHHHHHHHGHHHGGGGHHHGHGGGGHHHHHHGGGGGHHHGHHGHGHHGGGGGGGHHHHHGFEHG
+@985041/1
+GAACAAACATGCGCGCGACGTTTTGCCCGTTCCCGCCAGGGCCGGAACCGACCGTCGAGAAGACCGACATAATGTTGTCTTTCTCATGGGTGAAGTAATAGTTTTCAACCTTTTCAACGACTTTCAGGGTCTGCTGTTGCGTAGAACCG
++
+AABBAFFBFFFFEGEGEGEEGFHGHHHHGEGGGHGGGGGDGGGGGGGGGGGGCGGFGGGHGHGHHGGGGGHHHGHHGHHHFHHHHHHHHHFD<1?FGHHHFGHGHHHHGHHHHHHGHFDGGGGHHHGHHHHHFGHHHHGG?DGGGGHHC
+@212992/2
+TACTTGAGGTTTTGCCCCACTTTGCGCACTTTTTCATCTTCCAGCAGCGGCTTCAGCAGTTCCAGAGCACGCTGGCGGGAGATTTGATCCGGAGCGTCCAGATAATCATGCGCGACAGGTACATACGCGGCAACGCCAGGTTCGATGGCAA
++
+B@BABFBCFCFFFGGGGEFFFDFDHEGEEGHHHHHGFHHFHHGHBBHHG0EEEHHHFB1DFGHFGHHFEHGE1EECEE?/>?GBGFGF4GHG/C/<</>/FFGFHHGHH1FDFGC@C-C1<1=GHFHGGC-@DHGC@DGEBFGB.9BAFFF
+@1445743/1
+GTGCGAATACCGGTAATGCGTCGCAACAAGACGTAACAAATATTCAGCGCCAGCGCGAGCAACACCGCGTAGCCTACCCAACTATACGCATCACCCATCCGCTCGATCGTTGCCATCATCGAAGCATAGGTATCGGAAATCGCGCCGTTGA
++
+ABBCBBBBAFFCGGGGGGGGGGGGGG?GHHHHGGGHGGHHHHHHHHHFCGGGGGGGGGGGGHHHGGGGGEFGGHGHHHHHHGHHGHGCFGFGHHHHGHHFGGGGGGHHGHHHGHHGGHHHHFHGGGHFHG=DHFGGDGGGHGGGGGG@CD9
+@433001/2
+GCGCGGATATGATTGAGTGTAACTTCTCTTGCCCGCAGATGACCTCGCACGCCATGGGAAGCGATGTAGGGCAAAGCCCGTAGCTGGTTGAAAAATACTGCCGCGCCGTAAAACGCGGTTCATCTTTGCCAATGCTGGCGAAAATGACGC
++
+AABBCDDDAFFFGGGGGGGGGGHHHHHHHHHGHHGGGGGHHHHHHGGGGGGGGGGHHGGHGHGGGGFHFHGHGGHHHHHGGGGGHGHGHGHGHHHHHHHHHHGGGCGGGFGHHHGGCGGGGHHGHGHHHHHHGHHHHEGGCGGGHHEHGG
+@953565/1
+TTCCCGCACCGTGCCATGGCTCATCTCGGTTTGTTCAAACAAATACTGCTTGAAACCGATAATATCGAAAAAATCACTCTGCTTTTTGCAGTGCAAATCGCCGCAAAAGCGACACAGCGCCACCCACTCCTTCTGCTCCCGCTGCCAGGCA
++
+BBBBBBBBBBBFGGGGFGGGGEHGHGHHGEGFECFHHFHHHGHGHEHHHHHHHHHHHGGGGGHHGGFHHGGHGHHHHHHHHBEGHFDEGHHHHBHHHHHGGGFGGGGHHHGGGGGHHHGCGFGFDGCCHFHHGGHFHFHGGGGGFHHHHFG
+@633104/1
+GCCCTTTAGATGTCAGTCTCATGTCTTACTTAACCTCAAACTCGCCCCTGCCCGGGGTTTTTTATTGTAAAATGGGGGTATTGCATAGCAGGGACAAGTCTGACATTCCCGAGTAATTTGGTCAACTATTTACTTGAGTAAATTAGTCAGG
++
+AABBBFFFF@DFGGGGGGFFGGHHHHHGHHHGHHHGHHCHHHHGGFEFHGHHHGCFEEFGGFGHHHHHGFHHHHHHGGEGHHHGHHHHHHGHGGGGGGGHHHHHHHHGHFGEGGHFGGHHHHHHHHHGHHGFHHHHHHGFHHHFHHHHGHH
+@164670/1
+ACAAGGTGCTGTGTTTTTCCGGCGACGGTAGTTTGATGATGAATATTCAGGAGATGGCTACCGCCAGTGAAAACCAGTTGGATGTGAAAATCATCCTGATGAATAACGACGCGCTGGGACTGGTACATCAGCAACAGAGTCTGTTCTATAA
++
+A?AAA?@BFFFDGFGFGGGFGGCGAEEE2A235FGHHH5FFBGGFFH5G53F1GH33BCGGC>EC/EFE3FGF311?GFFHFFH3@GFH34FFHFF333GFDGE4EGAA</</B@DDDFAGCG<FB1<F1D1<GHGHFFFFGEGFHHFHFG
+@786063/2
+GCGGTCAGCTAGGTATTTTCGCCAATGGCTACTGGGGGCACCCGGCAATGCAGTTACCGCCGGAGGTCAACCTGATTGCGGTCGCCCACTATCTGCAGGCGCTGGAATGTCAGCGTGACGCTAACCGCGTGGTGGCGTTGCTGGGCGGTAA
++
+AAB?ADAFFFFFGDFGGGDEEGGGGHBGHHHFGHHGGGGGGGGFGFEGHHEHHFBB@FFEEGG?EE1GFHBFCGBGHFEAEEFG?FGGGHHGHHHHHHHGGFFFDAGGHHHHEFGGGDGGGDGGBFDGFCFGCFGGC;@@DGGGGGGF-AE
+@306534/1
+CTTCACGTATGGCTCCAGTTTTATCAACTTTAACCTGCCGCAGTTCTACCAGATAGTGAAAACCGATGGCCGCGCACAGGTGATCCCATTCCGTACGCAGCCTATCAACACCGTGCCGCCAGCAAACCAGGATCATGACGCGCCGCTATTG
++
+CCCCDFDFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHHGGGGGGHHGGGGGGGHHGHFHHHHHHHHHHHHGGGGGGHHHHHHGHHGGGGHGHGGGGGGHHHHGHHGHHHHHHHHGGGGGGGGGGHG
+@250994/1
+GCTATCCTGCTGCCAATTGTCGAGAACTTTAACCGTCCGAACGCCGTCGCGCGTTTTGCTCGCATCGCACAGGCGATGGGCGTGGAGACGCGCGGTATGTCTGACGAAGTCGCAAGTCAGGAAGCGATTAACGCTATCCGTACGCTGAGCA
++
+BBBBBBFFFFFFCGGGGGGGGGHGHEFHHHHHHHGEDFGGGGGGGGGFGGCGGGGGGGFHDDFGGFGGGGGFHGGGGGCHH@BGC/CCFGG@@DC/CFHHHFGGHGGGFGHGGGGGDGEHGFFHGGGGHGHHGGGDDGBEGFGGGEGEFEF
+@213469/1
+GTATTAAAGTAGTTAGCCATGATGGTGTACTCCGTGATGTTGTGTTGTCGCGCTTATTGTTCGGTTTACAGATTGCTATCTGTGCGAATGAACCCACATTACAACAGGAAATTTATTGCGGAAATTGATATATTCACAACGTTATGTTGCG
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHGHGGHHHHHHGHHHHHGHGGGGGHHHHHHGGGGGHHHGHHHHHHHHHHHHHHGGGGHHHHHGGGGHHHHHHHHHHHHHHHHHHHHHGGFGGHHHHHHHHHHHHHHHGGHHHHHHHHHG
+@1263900/2
+AATAATATGGTCAGCGCCCCGACTAAAATGGTCAAACTTAACACCAGCGAGTAATCGCGGTTGAGCGCGCCATTAACGAAAAGCTGCCCAATGCCCGGTAAGCCATAAATAGTTTCAATCACCATTGAGCCGGTAATAATGCCGACAAAGG
++
+BABAAFFFFFFFGGCEGGGGGGGGGHGHGHFHGHHHHHHHHHHHGHGGGGGCFBGBFEGGEEGHHGGGGGGGGHHHHGGEEEHHHHHGHHGFHGHHGGFGGFGHHHHHFHEGHFHFHHHFHHHHHHHGFHHGGGGGHHFHGGHGGGGGHHE
+@761110/1
+CCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGATCAGCGTAATAAGCGGCAGGTTCTCTTTAAGACGAGATTCAGGCGCGGCGTCGCGCGACTCTTCGCTACGCAAGGTATAACCCGCCTT
++
+AAAA>BFFFFD1AA0E?0ECE/EDFDEFHBHH<<<FGACC/<F11DGCCC/FHHEDGD<?<FDGHG<CAFHH1>@-CCGC.0CGG0G00C0::C-:..CCBB0B@A?AA-9@9@@;---;;B9B?-;--:--;@AFFBFBF/--@@B-
+@458084/2
+TCTCGTTGCTCATCGGCTTTGGCACGGTTGTTGCTCGCTGACGGTGCCAGGCAATACTGATTGAGAGGATTTGAATGACCAAAGAAATGCAAAATTTAGCTTTAGCCCCTGTTGGCAACCTGGAATCTTATATCCGGGCGGCGAACGCGTG
++
+B@BBBAAFAFFFGGCEGGGGGFFHFGGFEGGGHHHHGEFEGHFCEGGGFFAFFHHHHHHHHHHGHHHGHGHHFFHFHGGHEHEHHHGHGHHHHHHHGHFHHHHHFGHFEHGHHGHHFHFAEGHHHFHFFHHHHGHGFC@GGG?-ACDGG@D
+@395219/2
+TCCACACGCAGCATCAGGCGATATTCGGCGCGGGAGGTAAACATGCGATACGGCTCTTTGGCGCCAAGCGGACAGAGATCGTCCACCAGCACGCCGAGATAAGCCTGAGAACGCGCAGGCGCCCAGCCCTCGTTGTCGACGGAAAGACGCG
++
+111111>1>AD1111B1FCAF0AE2BFC0EE//EE///12111BGF///>//?EE/011101>>E//??<////FFB01B/BGCCGFHHHGAC/?@/-<FG1>11<FCB1=C.ACC-:-.@@-:.....;9-.9/.;9.9:----9/;-;-
+@765899/2
+CAGCCGCAGCGCCTGGCGGGCAATAGGATACAGACCGACCAGGGTGGTGGCGATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGATCAGCGTAATAAGCGGCAGGTTCTCTTTAAGA
++
+AAABA3DBBBBBGGGGGGGGGFGGHGHHHHHGGHHGCGGEFGGDECE1?EHFEGGC3GGFFHHGFGFFFEGCCCGGGGGFFEFFFFFFEFFFFBFDFFFFFFFFFFFFDAEFFFFFFFEFFFFFFFFBEBBFFFFFFFCFFFFBBFFFFFB
+@147409/2
+TAATTGTTGTGCGCTTAAAGGCATGAATGTTCTTCCTTTCTCTTTCGTTTGGTTATTAGTATGCCACCTGGAAGTGTGATTGCAGTTGCAATAACGGCAATTTGCTTATTTTATGGCACGTTAAGCACGCTATTGATGAAAAAAGAGACA
++
+CCCDCFFFFFDFGGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHGHHGGFHHHHHHHHHHHHHHHGHHHHGHHHHHHHHHHHHHHHHGFHGHHGGFGGHHHHHHHHHHHHHHGHGHHGHHHGHGHHGGGGGHHHHGFFHHHGGGHHHH
+@1133974/2
+ATGATAAAATAATCAGCGAGCGGCTGGCGGGCATTCGTCTGTTGTATGGTGTTGAACCGGGGCCGCGCACGCCGGTCATGTATCAGCCTGGCATCATATTTCTCTTTTCCGGCCATAAAATTGGCTATATTAACAAGCGCAAGTTTCGTTA
++
+@ABBBF5DDFFFFGFFGGEGGGGGCECGC20AE2G5FC?CEFGC233@G@3GA13F31/EEF/><?CCGGGCE??<<C1?GB1<1DFFF0FF0F01=1DHHHHHHGGH00.--A-/0:CGHHGB/:C0;:CBFFFGB?A-:DAFFFG?AB.
+@400129/1
+GTACCGGTAAAGTGACTATCGCCGATGTAGCCCAACTTGCCGGTGTAGGCACGATGACCGTATCACGAGCCTTACGCACGCCGGAACAGGTCTCTGATAAACTCCGGGAAAAAATCGAAGCGGCAGTGCATGAGCTGGGCTATATGCCTAA
++
+BBBBCBCCCCFFGGGGGGGGGGGGGGGFGGFHHHGGHHHHHGGGGGHHHHHHGGHGGHHGGHHHHHGGGGGHHHHGGGGGGGFGGGGGHHHGHHGHHHGHHHGHHGGGGGHHFGHHGHHGGGGGGGHHFFHH0GFHHGDGHHHBCGHHHHE
+@761801/2
+CCTCAAGATTTACGCCCGCCACCGCATGGCTTTCCAGTTCAAGGATGTCCGCCTGAATCCGATGCAAAAGATTATCTGGCGTAATATCAACAAACGCATCCAGCTCCTGGCTGTTTTCCAGTTCAGATAGCAGGTAGATATAATCCCGTC
++
+AAAAAFFFFFFFG2EEGCGGGGGGGGGGHHHHHHHH5FGHCGHHHHHHGHGGGGGHGHHHC1BEGHBHBFAGHHHHHBFHGEG?FHHGHHHHHGHGGGGEFHBGFHHGFFHHGHHHHHHBGFG2GHFFFGDGHAFG<GHHHHFF2FHEHG
+@1154822/1
+GATTAAGACTATTCCCTGAGGTGCTTTTTAAGCCTATTTTTGCTAGAATTTGGGGTTCAAACCTCAACTTCGTGAAAAATAAAAGGTGTTGGAATGTATCAATCCGACCAGGAGACCTAATGATATTGACTCCCATGCGACGATATGGGG
++
+BAABBFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHGGGGHHHHHGHHGHHHHHGHGHGHHHHHHHHHGHHHFHHHHHHHHHHHHHHHGGGGGHGHGHGGHHHHGHHHHHHHHHHHHHHHHGGGGGGGGHGHG
+@180836/2
+CTACTAACAACTGCGCCATCTCGCGCAGTGGTCGTCGTGCGTGTGGTGGTGGTCGTCGGCAATGCGCCGTAGGGTCCGGAACACACACGATTCCAAAACCCCGCCGGCGCAAACCGGGCGGGGTTTTTTGTTTAAGACACCTTCCCGGAA
++
+BBCBCFFFFFCFGGGGFGGGGGHGGG?EGHHHGGEGGGGGGGGEHGFFGEGGGHGEGGGGGGHGHGGGGFGFGGHHHGGGGGHHHGGGGGGHHHHGGHHGGGGGGGGGGGGGGHGGGGGGGGF9BDFFFFBFFFBFFFFFFFFFFFFFFF
+@163408/2
+ATGTCGATGTCGATGTTCTCCTACGGGATGTTAGAAGTTAACCGTCTGGCGGGCCGCGAACTGCCGGTGGACGGCGGTTTCGACGATAACGGTCAGTTGACCAAAGAACCGGGCGTGATCGAGAAAAATCGCCGCATTTTACCAATGGGGT
++
+BBBBBBBBFFFBGAGBGGGGGGFGGGGEAFFFGHHHHHHFHHHGGGHGHHGC?EGGC/EEGHHGFGGE/E?FEGCCG@DADCCECCFGGHGGDGGHGGHFGGFHHE:GHGCDCCG@@EGB:CE.EFFGGGGGD@--.AFF:/FFFFFFF.:
+@995418/1
+GAATATTCTGTCTTATGTTTTTCCACCGCTTTTTTTAATGCTTCTGATAAACCGCCAACCTCATCCTGCTGCGGCAGTAAAATGTTCCCGGATGAACAGACAGCTGACACATCGCCCATTAAATTATCTCCTCTGACTCGGCCTCTTC
++
+33ABAFFFFFFFGGGGGGFGGGBHHGCFEEGGHHGGHHHHHHHHHFHHFGHHHGGGGGGEHGHHHHHHHHGHCCEEEGHFGHHHFHHHGGEGGGGHHHHGHHBHHFHHGFHHF?DGGGHHHFHHGGHHHHHFCGBFHHHADAEDHHFF
+@1372756/1
+GCGTGCATATTGGCGTTACCGCCACGGTAATCTTCGGTTTTGCTAAAGGCTTCGTCCCAGGACTCCAGGCACATCTGCTCTTCTTCACTCCAGAAGTATTTCTCAATCACTTCTATGGTGTAATCCAGCAATTTCCTGGCTTCAGGGTGC
++
+BBBBBBBFFFFFBGGGGGGGGGGGGGGFHGHHHHHGGFGGGHHHHHHHGHFHHGHGGGHHGHHHHHGHHHHHCGHHHHHHHHHHHHHHHHHHHHHHFGHHHHHHHGHHGHHHHHEHHHHHHHHHHHHHHHGHHHHHHHHHHHHHHHGHGG
+@857985/1
+GGATACAGACCGACCAGGGTGGTGGCGATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGATCAGCGTAATAAGCGGCAGGTTCTCTTTAAGACGAGATTCAGGCGCGGCGTCGCGCG
++
+ABBAAFFFFFBB2EFEGGCGGGGFGFEFGGGHFGCGHDG5FFFFEGEGGDF0E?-ACB<GHGHHHHFFFFGFGG?HHHFHHEFFAEGFGBBGGGFFFFFDDGGFFGFGGGG-B=9BFFFFFFFFB9F.--.A/FFFFFAFFFAFFFFF;FD
+@858202/2
+AAAGAGAACCTGCCGCTTATTACGCTGATCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGA
++
+AAA11>CBF1C>GGCGAEAGFBFGE000BG2FGHBGBGDGHG?/EFHHE1BBEEEAGCHHHHGGDG22FFGFEGCGEHEEGG?/FGFGHCFHFFHHHGGG?0G/FGHHGG1B/>?CC?1<FFG1?<11<FACC?<..<@CCCCCCC-.;G0
+@106589/1
+TAAGATCCCGGCCAGCCTGATACGAGGTGTCGGGCACAAAAAAGGCGACTTTCGTTGAGTCGCCTTTTCTTATCCCCTATGGGAGCGCGGTGCCTTCCAGGCATTTATTTACGAAGCATGACTTCGATAAAATCTTTCCAGTTCCCCAGTT
++
+CCCCCFFFFCCBGGGGGGGGGGHGEEGFGHFGGGGGGGHHHHGEDHGGGGGHHFHHFFGHHGGGGGHHHHHHHHHHGHGGHHHHGGGGGGDGCGHHHHHHGHHHHHGHHHHHGGHGGHGHHGHHHGFHHGGFHHHHHHGHHHHEHHHHGHH
+@492027/1
+GTTAAAACCCGCACCGCCGAACAAAACGCTAAAATTGCCGCTTTTGAGGCCGAGCGCCATCGTGAAGCAGAACAGACGCGCATTCTTGCTGAGCGGCAGATCCAGGAGACGGAGATCGAACGTGAGCAAGCAGTACGGTCCAGGAAAGTTG
++
+CCCDDFFFDDCCGGGGGFGGGGGHHHHGGGGGHHHHHHHGGGGGHHGGGGGGGGGGGGGGHGHHHGHHHHHHHHGHHGGGGGGGHHHHHHHHHHGGGGGGHHHHHHGGHGGGCGCGFHCHGGGHHGHHHGGHHGHHGFGGGGGFGGGF0CF
+@1072353/2
+ACACAGCAGACTACACTTTTATGAAAAACGACGTCATTTCACCGGAATTTGATGAAAACGGTCGCCCGCTGCGCCGTATTCGTAGTTTTGTTCGTCGCCAGGGGCGACTGACAAAGGGGCAAGAGCACGCGCTGGAAAACTACTGGCCGGT
++
+BBCCDFCFFFFFGGGGGGGGGGHHHHHHGGGGGGGGHHGHHHGFGGGGHHHHHHHHHHHGCGGGGGGGGGFGGGGGEFHHHHHHGGHHHGHHHGGGGGGGGHGGGGGGGGHHHHHGHCGGGGGHGHHHGGGGGGGGHHHGGGGGGGGEFG-
+@988073/2
+GGATACAGACCGACCAGGGTGGTGGCTATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGATCAGCGTAATAAGCGGCAGGTTCTCTTTAAGACGAGATTCAGGCGCGGCGTCGCGCG
++
+>A11ACFFFFADCEGGGCGBF?E0EHAGFHBEE1AFGGHHCGFCECEGGGF@ECCCHHHHHHGFDGGHFGGGGCCHFHFHH.CCGGHGHHHGGGGEGBBBFBCEFBFF@??@@@FFFFFFEFFFFBFF@@-EFFF/9F@@=??@@@-@>??
+@1005425/2
+TTATTACGCTGATCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTT
++
+AAAAA3FA??1AGC3AGG3BGF3AGGCGGGFFBEBEAE/E?EFFBG0GHGHGGHHGGG//>GECEE@HGHHBGAGFGBGBFAECEFGHFGHG/EGEB//CHGD2FDGHHFFB1FGGCCCEEG/ACCG-@C-.DDF<D0G..@@?-:00;.C
+@74537/2
+TTAACGACCAGCGCAAGCGCCGTTATCCGCAAATCAAATTATGGTGAGTAATATATCCGGCCTGAATAAAAAAACCGCCGCTATTACAAGCGGCGGCTCTCAGTTTTTATTTTTTAGCAGCATCTGCGGCTTTAGCGTCAGCCGCATCGG
++
+AAA??1ADDD11EEA?A000E0/BACGGGF?A/AEDFFGGBDFHF1AF12DGBGFFH2E/EEEGF1@BGF1GGEEE?E/EG?EEDGDD1GG/B@C<@@CF11>11<=.GHF0<0<CGBDGGCFC000--:-;/;9F@;;..0:--@B@AE
+@1443718/1
+TCATCAGGCTACTGACGCCACGATTGAGTTCTTCATTCATGGCGCGCTGTGTGTCGCTTATTCTGGGCAGTGTTATATCTCTCATGCGCAAACCGGGCGCAGCGCCAATCGGGGCGACTGTTCGCAAGCCTGTCGCTTACCGTATACGTTA
++
+CCCCCFFFFFFFGGGGGGGGGGGGHGHHHHHHHCHHHHHGHHHGGGGGGGHGHHHGHGHFHHHHHHGGHGHHHHHHHHHFFHHHHHHGGGGGHGGGGGGGGGGGGGGGHHGGGGGGCGGGHHHGGGGGHGGGHHGHGHGHGGGEFFFGGGG
+@1033809/2
+TTTCAATAGCGAACCAACTGCCGCTTTTCATCAGCCGCAGCGCCTGGCGGGCAATAGGATACAGACCGACCAGGGTGGTGGCGATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGAT
++
+CCCCCFFFFFCCGGGGGGGGGGGGGGGHHHHGFHHHGGGGGGGGGHHHGGGGE?FGGHHHHHHGHHHGGGGGHGGGFGDFGHGGGGCHHHHHEHHGGFHHGGGGGGGFGFFFFFFFFFEFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFB
+@688962/1
+CCCCATGCCAGTGAAGAAGGGGCGTGACTTTAGCGAAATGTCGTCGCGGCGACAACTGGAATATGAAAGCAAGGCGTTACGTGCGATTAGCGTTTATGCTGAAAGGTCAAATAAAGGAGAAAAGTATGTTTACCCTGAGCTGGCAGCCGC
++
+ABBBBFFFFFB4GBGBE44FE?ECE?EGHGB555EE0ECGEGA1FEFGCEGE@EEFGHB33G3GFGHGGHG3GFHGECDFF0FH?DECC<FC/DGGH1BDG1??G0FG111=G1<F10.>FGF0<D0D<DHFGFHFH//CFFB?FFDGDG
+@1114541/1
+ATGTAGAGCGGATAAGCGCAGCGCCATCCGGCAAAATTACCAGGCGGTATGATACAGTTCGACAATGTCCGCCAGACTCGCTTCACGCGGATTGCCGCCCGTACAGACATCATCGAACGCCGCCTGCGCCAGCGCCGGGATATCCTCTTTT
++
+ABBABFFFFDCBGGGGGGGGGGFGGDFHHGGGGGHHGHHHHHHGHGGE?EGHHHGHHFHHGHGGGHHFHHGGGFGHGHHGGGHGHHHHGGGGGHEHGGGGG@CGGHHHFHFHGHHHHHGGGGGGGHGGGDDFE?DFAAA?ABGGGFGFFFF
+@1165335/1
+ATCGGGTTGATCTTAGAGATAACACCCTTGTTACCGTGGCGACCTGCCATCTTATCACCCGGCTGGATACGGCGTTTAACGGCCAGATAGACCTTCACGATCTTCAGCACGCCCGGCGCCAGATCGTCGCCCTGGGTGATTTTACGGCG
++
+>AAA1@1>1BFDGG3FDGGGFGHHCAECFGB1221ABAE?E//AECF0FABFBGHE2FF0////>FFFEGAF?E//E>21EEEEEH0F>F1FFGFEBGF/F/0GFFHBHAC/F/BC/>CCC?FDCC0<<-<A-.C<<..CGCCGGFCC?
+@671520/1
+GGTCTGGCTGGACTGTTGGTCGCCAATAAGTCTTCGCGCAAATTATTAACCAAATACGGTACTGGCGCTTTGCTGGTGGGCGGCGGCGCGGTAGCGGGTTCCGTATTGTGGAATAAGTACAAAGATAAAGTACGCGCCGCGCATCAGGGGG
++
+CCCCDFFFFDDFGGGGGGGGGGGGGGHHHHHHHHHHGGGGGGHHHHHHHHHHHHHHHHGHHGHHHHGGGGGHHHHHHGGGGGGGGGGGGGGGGGGGGGGGHHGHHHHHHHGHHHHHHHHHHHHHGGGGGGGGGGGGGGGGFFFFFFFFFFF
+@951507/1
+GTGTTGATTCACACTTCTGAAAGATTGATACACTACATAACCAAAAAGCATAGCAGACAGGCATGGTATTGCTGGTATAAGCAGGTAACATGGCTGTTATAAGTTGATAACAAACTCTTGCGCCGCGTCGTGATAGTTTGCAGACCTTCAA
++
+AAAAABFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHGGHHHHBFGHHHHHHGHHHHHGGHHHHHHHHHHHHFGHHHHHHGHHHHHGHHHHHHHHHGGGGGGGGEGGGGHHHHGHHBHFHGHHHHHHH
+@822304/1
+CGCCGTACCGGGGCTGGTGCTGGGTATTTTGATCGGTAAAGGCGTAGAAGAGAGCGGCTGGAACCATGTCACCAAAGTGATGATGGTCGCCATCGTTTTGCTGTTTGTGTTGAGCGGCTTCTTCCGCGGCTTCGACATGAAAATGATCGAG
++
+BBBBBB@BBBDDGGGGCGFGGGHG3FFGGHGEFGGGGHGHFFGGGGGEGHGHHGGGGCFGGFFHGHHB@GFFDHEHHFEGFFFGHBEFEGGGGFGCEEFHHGHGFDGGHHHEHFBCDC/AGFHHF/ADGCFGHGHGCCHFGHHHHHHFGGG
+@1409108/1
+TCACTGAACCTGCCTTTGTCACCCGCTTTTCCTGTTCTGGCTCGGCCTGTCGCGACCACTGTTGTAAGGGCTGGAAAATCACGCTGGATAAGACGACGGTTAAAAAATATCTCGCCAGTAAAGACACGACGATTCGTACCATCGCGCAAGA
++
+CDDDCFFFFCFFGGGGGGGGGGHHGGGGGHHHHGHHHHHGHHHGGGGGGGHGHGGGGGHHGGHHGHHHHHGHGGHHHGHHHHGHGGGHHHHHHHGGGGGGGGHHHHGHHHEHHHGGGGHHHHHHHHHGGGGGGHHGHHHGHHHDGGGGGGC
+@757522/1
+CCGTTATTTGCCGCTGAGCGAGTTGTGGATCAGTTCAAGCCAGTTCGGTACCGTCATGTTGAAAGACTCGATCATTTTCATGTCGAAGCCGCGGAAGAAGCCGCTCAACACAAACAGCAAAACGATGGCGACCATCATCACTTTGGTGACA
++
+AABBAAAFFFFFCGGGFGGG2EEFHHG?DGHHHGHHFHFHGBGGFFGGGHGHGGGGGHHHHHGFHHHHHGHHHGHGHGHHHHHHGGFGGHGEGGCGEFG3FH@CCGDHGBFGGHHHGFHGHHHCGHGDGGCGGGHHHHHHHGHEHH.EHHH
+@1183660/1
+GATCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTTCGCTATTGAA
++
+CBCCCFFFFFFFGGGGGGGGGGHHHGGGGGGGHHHHHHHHHHHHHGGGGGHHGGGGGHGHHHHHHHHHHHGGGGGHHHGGHHHHHGGGGGHHGHHHHHHHHHHHGGGGGHHGGGGGGGGGGHHHHHHHHHGGGGGHHHHGHHGGGFGGGFF
+@318161/1
+GGCATCTTTCCCTGGCCTTCAAACAACACAGAAAATTGCCATGTAAGCGCATCATTATCCGGTAGCGACCATGACGCACACAGTGATTCAATATGTCCGCGATCGCGCCAGGGGTAAAGCTCAGGCAACGTTGGCAAACAATCGAACAACG
++
+AAACCFFFFFFFGGGGGGGGGGHHHGHHGHHGHHHHHHHGHHHHHHHHGGGGGHHHHHHGGGGGGHGGGGGHHHHGGGGGHGHDFHHHHHHHHHHHHHGGGFGGGGGGGGGHGGFGHHGGHHHHHHHHHGEHHHHHHHHHHHHGHHHGHHC
+@1162709/2
+TTCGGTATGTGGACTACCCTGACCATCTTCGGTTTATGCGGGATCCTGTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGTCTGTTTGGTTATATTGGCATGGCGATGTTTATGTTCG
++
+AAAA1>>1F33B1GGGCCGFFFC0GFF1GDEFGFEHE2G00//AFCEHGG2FGFAFAA/EEGGG>EBBG2FEBEE/>/?FE?FG?EEEEGGGGF0>F>>B1BGDGHDGHBFFFDGF0BGHF/F<FFHHFBFGHH0GH?CCCGHBGH1111.
+@1249459/1
+TTTCAATAGCGAACCAACTGCCGCTTTTCATCAGCCGCAGCGCCTGGCGGGCAATAGGATACAGACCGACCAGGGTGGTGGCGATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGAT
++
+AABBBFFFBDDBGGGGEGGGGGGGGGGHHHHHHHHFGGGGCGGGGGFHECGGEGHFHHHHHHGHGHHGGGGGGGG??@CF?HGGGDGGFGHHEHHHHFHHGGGGGGGGFC=@FFFFFFFFFFFFFEFFFFFFFFFFFFBDDFFFFFFFFFB
+@1272148/1
+CATCAGCGTTTCAATAGCGAACCAACTGCCGCTTTTCATCAGCCGCAGCGCCTGGCGGGCAATAGGATACAGACCGACCAGGGTGGTGGCGATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCAT
++
+AABBAFFBAADFFGGFGGGGGGGHHGHHGHGGGGGHHHHFFFGHGGGGGGGGGHHHGGGFGGBFFBGHHHHHHHGGGGGGHGGFFGGGGHGGGGGHHGFGFEGHFF1GCGGGGGGGGFFFFFFFFBFFFFFFFFFFFFDFFFFFFFFFFF
+@1012342/1
+CTCCTCAGGCTGTATCCCATTCCACGATGCGTGTTAATTGGCGAGAGATCCGGGTTGATCGCGCGTAGCTTAGCGCGCAGGGTTTTGATGTGTGTATCGACCGTCCGATCGAAGGTCTCCTGGGCATCAGACCAGACAATATCCATCAATT
++
+ABBAAFFFFFFCGGCGFGGGGGFHHFGHGGGFGFHHHHHHHHGGGG0FGFHHGGGGGGHBF?EGFGGGGHGHHHGGGGGGGG2GGGHCGGBBBGHHHDDHGGGFGGGGGGGDHGDHGHGGHHFGHHHHHHHHGHHGEHHHHHHGHHHHHHH
+@1299200/1
+GCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTTCGCTATTGAAACGCTGATGAGCGT
++
+BCCCBCBFFFFFGGGGGGGGGGHHHHHHGHHHGGGG1GGHHHHHGGHHHHHHHHHHHGGGGHHHGGHEEGGGCEFGGHHHHHGHHHGHHHGGGGGHHGGGGGGGGGGHHHHHHHHGGGGGGHHHHGHHGGGGGHHFGHHGGGGGHEHHHA;
+@914563/2
+TATTCCATCAGGTATTCTTCGCGAGAATGTAACCAGCATCATCGGTAACGGTGTTGTGCTGTCTCCGGCCGCGCTGATGAAAGAGATGAAAGAACTGGAAGACCGTGGCATCCCCGTTCGTGAGCGTCTGCTGCTGTCTGAAGCCTGTCCG
++
+CBBCCFFFFFFFFGGCFGGGGGFCEGGHHHHHCHHGHHHHHGHHGCGGGGCEHGGHHGGHHHHHGHGGGGGEF?FGEHHGFHH3FFHHHHHHHHHHHGHHHHHHGFHFGFBGHHGGGGHFGGHGHGGGGGHGGHBBFFEGGHH1GFFHHHD
+@1532218/2
+TCCACTGGCTATACATAAAGTTGCCGCGATCGCCATTCACTTCGCCAATCGCGGGTTGCAGGTTATGCATATCGCTTTCCATTTTGCGGTAGACCGGGTCTTTAGCGCAGTTTTTTCGCCCGCCGTCCTGCCAGCACTGGCGCTGATGAC
++
+AAA1AFFBAFFFF1AAA11B3BFFFCEC0AFEGGGFGFFGDGFAEGGCFB//A//>?/FGFGFHGHHG2BEBDFEFHGGEFBGBGD1EEEC/F1B//B?B0>GFFBCC@CBF></AG?/..-<CGCG?A0CG/<ECF0//;@E@@.FBFG
+@1316855/2
+CAATAGGATACAGACCGACCAGGGTGGTGGCGATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGATCAGCGTAATAAGCGGCAGGTTCTCTTTAAGACGAGATTCAGGCGCGGCGT
++
+AA>AAFFBFDFFG5FFAAEGCGGGBFGGGGHGGFGCEGHHHHHHFH3GHGGGGGCGGGG@DHHHHFHHHHHHHHGGGGGGGHHGHHHGGGGGGGGGGGGGEGFFF;EGGGGGGGFFFFFFFFFFFFFFFFFFFFF.EFBBFBF;F->>CF
+@1332714/2
+TTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTTCGCTATTGAAACG
++
+CCCCCFFFFFCBGGGGGGGGGGGGGGGHHHHHHHHHHHGHCGGGGHHGGGGGHGHHHHHHHHHHHGGGGGHHHGGHHHHHGGGGGHGHHHHHHGHHHHHGGGGGEGGGGGGGGGGGHHHHHHHHGGCGFGHHHHGHGGGGGGGBFGGGG
+@398636/1
+GTTCAATCTTATCTGGATTGAAGAACCACTAGATGCTTACGACATCGAAGGCCACGCCCAGCTTGCTGCCGCGCTGGATACGCCTATCGCCACCGGGGAAATGCTGACCAGTTTCCGGGAACACGAGCAGTTGATTCTGGGCAATGCCAG
++
+BABCCFFFFFFFGGGGGGGGGGHHHHHHGHHHHHHHHHHHGGGGGGGHHGGHHHGGGGGGGHHHHHHHHHGGGGGGGHHHHGGGHGHHGGGGGHGGGGGGHHHHHHHHHGHFHHHHGGGGGEHHGGGGGGFHHHHHHGHHHHHGGHGHHH
+@1142297/2
+TCTGTAGACTTATAATGGAAGATAAGACCTGTCTACAACATGACAAACAAAAACAAATGCGTAACGGAACTTTACGAAACATAGACACTCTAACCTGTTGCTTGCTCATAGTGCGGCTTATGGAGTGGCGTTTCGAAAGCGCGTGGAAATT
++
+BBBBBFFBFFFFGGGGGCFFGGHGGHHHHHHFHHHHHGHCFHHHHHFHFHHHHGHHHHHHGEGGGGCEFEHHHHHGGHDCFHHHHHHHGHHGHHHHHFHFHHHHEHHHHHHGHHGFGGGGHHEHFHHGEGGGGHCFHGGEDGGCCFDFFGH
+@1132783/1
+CTTTTCCTTCCCATCCAGTTGGGATCGGCAGGCGCAATCGTGCTATTTATTACCGCGCTGGTCGCCTGGCCTCTAACATACTGGCCGCATAAGGCGCTGTGTCAGTTTATTCTTTCCTCAAAGACTTCTGCAGGTGAGGGAATTACTGGCG
++
+BBBBBFFFFFFFGGGFGGGGGGGFHGGGGGGGGG?EEGHG1GDGFHHHFFHG5GGGGGGCFE@E?EAFHFHHHHHHHHHHGHHHEHGGGGEHHHGFGGGFHGGHHHHHHHHGFHGHHHHHFGFHHHHHHBGBFHHGHEFGGGHHHHHHGHC
+@1374519/1
+GGCAATAGGATACAGACCGACCAGGGTGGTGGCGATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGATCAGCGTAATAAGCGGCAGGTTCTCTTTAAGACGAGATTCAGGCGCGGCG
++
+BBCABFFFFFFFGGGGGGGGGGGHGGGGGEGGHGGGGGHHHHHHHHHHHHHGGGGGGGGGGGGHHHHHHHHHHHHHGGGGGGHHHHHGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFD
+@1391417/2
+GCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTTCGCTATTGAAACGCTGATGAGCG
++
+BAAAABBFFFFFGGGGGGGGGGHHHHHHHHGHGGGGGHHGGCGGHGHFBGHHHHHGHHGGGGGHHGGGHHFHGGEGGFFGHHHHHHHHHHHGGGGGGHGGGCGGGGFGHGHHHHHHGGGCGCGHHHAGHGGGGGHHHGHHGFDGEFGGFB?
+@1475116/2
+TCAATATGCCCATCGCTTTTTGCAGCAAAAACCAGCGCCAGGATCAGTCGCTCAGTGCGAACATCCAGCGGCGTACTTTGGCTGCCGAATTGCGGCTCCCCCTGATGCGCGGCGCGTACTTTATCTTTGTACTTATTCCACAATACGGAA
++
+CBBBCFFFFFFFGGCEGGGGGGHHHHHHHHHGGHGHGGGGGHHHHHHHHGGFHGFHHHGFGECFHHHHHGGFGEGGHHHHGHHGGHGGGGHHHACCCDFGDGCEHHHHGGGGGGGGCCGHHHGGFHFGHHHGHHHHGGGGFGEFGGEGFE
+@23573/2
+TCCGTACGCAGCCTATCAACACCGTGCCGCCAGCAAACCAGGATCATGACGCGCCGCTATTGCAGCAGTATTTCTCCTGAGGATTTTCGCCCGGTGGCGGCTACGCCTTACCGGGCCTACAGTAAGCCGGATAAGCAAAGCGCATCCGGCA
++
+BABBBFBBBBDBGGGGGGGGGGGGHFGGGGGGGGHGGGGFGGHHHGHHHHDFGGGGGGGGHGFHHHHHBGBGGHGFHHHHHGFFFHFFFEGGGGG</GCGCCDFC?CHFFHHGGGGGGFHECGFFHGECGDGCHHHFCFFFGCGGGGGGB-
+@64720/2
+GTTGAAGTATTTGGCAAGGTGGAAGTGTTTCTTACATTCGGAATGTGGACTACCCTGACCATCTTCGGTTTATGCGGGATCCTGTTATCCCCGGTCACTCATCATTCCGGGTGGTTTGGCGCACCGCTTGATGTCAGTAATCTTTCTGGT
++
+AAAA?FDF3B3FF11A11AEFAG1F1B3D033FGFFBGGD00BFFHHBFGHGHC0FG0FFGFC1D2A/FEGHHHGCCAEE/FGFHHGH211/E?/>/1@FEFB222220EEGGGEGF?FFCFC?/B?/?F0<FFHG1?1GFH1FFFHEFG
+@1334198/2
+TCGTAACCCCTTATGCCAGCGGTGAACACGCCTGGGAGATGAGCGTGCTGCGAGTACGTCAGAGCTGGTGGAATAAACATAAAGACGAGTTTGAAAAATTAGACGGCGAACCCTTGCGTAAGTGGTGTGCGCAACAGCATCAGGATAAGGA
++
+BBCABFCFCBCFGGGGGGGGGGGGGHHGHFGGHHHGHGCHHHHHGGGGGHHGGGGEGGHHGGGHGHHHEGGHHGHHHHHHHGHHGHEEGGGHHHHFHHHHHHGHGGGGGGCCGCGHHFEGGHHBHHEHGGDGCC@GHGHHFHHEHHHHHHF
+@1479407/2
+TATTGATATACAGCGCATCCGCACGCGGCGTGTAGATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGA
++
+BBBBBFFFFFFFFGGGGGGGGGGGGG?EGGEEEGHHHH5BGHHGHHGCGFEGGGHHHHHHHGGGGGGGGGGHHHCGCGCCGGDGHFHFG?CFGH.BBEGG?EGGECCDFG9DFFF?BE/BF..A.;BEFFFEFFFBFBFFFBFFFFFFFF.
+@1465807/2
+GACCAGGGTGGTGGCGATAAAGGCCAGTTGGCCGAACGGGGGGTTAAATTGCTCCAGCCCCCAGCTTATCGCCATCATAATGATCAGCGTAATAAGCGGCAGGTTCTCTTTAAGACGAGATTCAGGCGCGGCGTCGCGCGAATCTTCGCTA
++
+?AAAAFAABADAEEGC?EEFGFHHHHCGGFHHHGGGGGGGGCGCCHFHHHEGGDFFHHA.ADCDHHHHHGGGGGGHEHHBCGFHFHHEFFGGGGHHGGBG?BGGGGGGGGGGF0BFFBBFFFFFFFFB<B;B?9B<BBBBBB<DFFFFFFD
+@415107/1
+CGGCTGGATACGGCGTTTAACGGCCAGATAGACCTTCACGATCTTCAGCACGCCCGGCGCCAGATCGTCGCCCTGGGTGATTTTACGGCGCTTCGCTTCAAGTTTTTTCTCGAACTCGTGTTTCAGCTCGTCATACTGCTCAGCCAGTTGT
++
+CCCDCCCFFFFDGGGGGGGGGGGGGGHHHHHHHHHHGHHHGHHHHHHHHHHGGGGGGGGGGGGHHHHHHGGGGGHHGGEEHHHHHHGGGGGGGGGGGHGHHHGHHHGGGHHGHHHGHGHHHHHHHHHHHGGGHHHHHHHHHHGHHGHHHHF
+@1493402/1
+TCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTTCGCTATTGAAA
++
+AAAAABFFFB3@CE1EAF11FGHC?0EGEEFAGGBHGFFHHHH/EEEGHH?EEFEAFFFFGHHHHHHFEEEECFEHC/EBFHD?/EAE0FB>F>GBHFGHH1CCC<BHE/@?CGGGC-<0FDDDDGB.A-A-:CGHE::;A-CEGGBB00
+@1502097/2
+GGTTATACCTTGCGTAGCGAAGATTCGCGCGACGCCGCGCCTGAATCTCGTCTTAAAGAGAACCTGCCGCTTATTACGCTGATCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCG
++
+ABAA?FDFFFFFGGGGGGFGGG?GHHFEGGGGGGGGFCGGGDFBBGHHHHGGHGGHHGHHHHHHBGHGGGGGGHHGGGGGGGHGFHFGHH2BFFHG?DGEHB2GHGFCCGD?GHHEGHHHEHHHHGGC-;CBD-CDGEGGB/CFGFB0BF.
+@1542793/1
+GTACAGAAGGCGGGTTATACCTTGCGTAGCGAAGATTCGCGCGACGCCGCGCCTGAATCTCGTCTTAAAGAGAACCTGCCGCTTATTACGCTGATCATTATGATGGCGATAAGCTGGGGGCTGGAGCAATTTAACCCCCCGTTCGGCCAA
++
+CCCCCFFFFFCCGGGGGGGGGGHHHGGGGGGGGGGHHHGGGGGGGGGGGGGGGGHGHHHHHHGGHGHHHHHHHHHHHHHHGGGGGHHHHGGGGGHHHHHHHHHHHHGGGGGGHGHHHGGGGGGGHHGGGGGGGGGGGGGGGGGGFFFFFF
+@1140044/1
+AACCAGGATCATGACGCGCCGCTATTGCAGCAGTATTTCTCCTGAGGATTTTCGCCCGGTGGCGGCTACGCCTTACCGGGCCTACAGTAAGCCGGATAAGCAAAGCGCATCCGGCAAATAAATCAACGAAAACTCACCTTTTCACCCGCTT
++
+BBBBBBAAFFFFGGGGGGGGGGGGGHHHHHHGHHHHHHHHHHHHHHGFHHHHHGGGGGGEGGHGGGGGHGGGHGHHHGGGGGGGHHGHHHHHHGGCFGHHHHHHHHGGGGGHGGGGGHHHGHGHHHHGGGGGHHHHGHHHHHHHHHHGGGG
+@375909/1
+GTGAACGCCTTATCCGGCCTACAGAACTGCACGAAATGTAGAGCGGATAAGCGCAGCGCCATCCGGCAAAATTACCAGGCGGTATGATACAGTTCGACAATGTCCGCCAGACTCGCTTCACGCGGATTGCCGCCCGTACAGACATCATCGA
++
+BABBCFFBCFCFGGGGGGGGGGHHHHHHHHHHGGGGHHHHHHHHGGGGGHHHGGGGGGGGGGHHGGGGGHHGHHGHHFGHGG>EFHHHHHHHHHHGHGGGHHHHHGGGFGHGHHGGGHGHHHHGGGGGHHHGGGGGGGGCHHHGGGGGGGG
+@533008/1
+ACCGTATCCGCGCCCCAGCGGGTTGACCACACCAGTTTTTCCACCTCTTCTTCGATAGAGGAGGTCACCGCCGAGTTACCGATGTTGGCATTCACTTTGACCAGGAAGTTGCGGCCGATAATCATCGGCTCCGATTCCGGGTGGTTGATGT
++
+BCBABBFFFCCCGGGGGGGGGGGGGGHHHHHGGHHHHHHGHHHHHHHHHHHHHHHHHGHGHGGGGHHHHGGGGGGGGHHHGGGGFHHHHGHHHHHHHHFHHHGHGHGHHHHHGGGGGCGGGHGHHHFGGGFGGGGGHHHGGEGGGGFFGGG
+@350961/2
+CAATTTAACCCCCCGTTCGGCCAACTGGCCTTTATCGCCACCACCCTGGTCGGTCTGTATCCTATTGCCCGCCAGGCGCTGCGGCTGATGAAAAGCGGCAGTTGGTTCGCTATTGAAACGCTGATGAGCGTCGCCGCCATTGGCGCG
++
+CCBCCFFFFFCCGGGGGGGGGGGHGHHHHHHHGHHHHGGGGHGHGGHHGHHGGGGGHHHHHHHHHHGHHHGGGGGHHGGGGGGGGGGFHHHHHHHHGGGGGHHHFCHHGGGGGHHHHHHGGGGFHHHHHGGGGGGGGGCEFGGGFGF
+@1413624/2
+GCCAGCGCCGTCACGACCGGGCACCCTGAAGCCAGGAAATTGCTGGATTACACCATAGAAGTGATTGAGAAATACTTCTGGAGTGAAGAAGAGCAGATGTGCCTGGAGTCCTGGGACGAAGCCTTTAGCAAAACCGAAGATTACCGTGGCG
++
+BBBBBBBBB@BBGGGGGGGGGGG?FFHFHHHHHGHHHHHHGFHGHHHHHHHHHHHHHHHEFFHHFHHHHGHFHHHHHGHHHHGGHHHDGHGGFHHHHGGFGFGFHHFGFGGFFF/FFDCFGCFHHFHFDGFHHHGCGGC?HHHHHGF.D?C
+@974397/1
+GCATATTCGGTTGCCGCCTCGCCAACCTGCGGCGGAGTCGCGAGCTGAATGTCTTTCGGCACAATCTGACCTGTCAGCGCGTTTAACGACTCGGCGCCAACCGCATTCAGCATCTCTTGTTGCTGTGCGGCGTCCGGTCCGATGTGGCGTT
++
+CCCCCFFFFFCBGGGGGGGGGGGGGGGHHHGGGGGGGGHGGGGGGGHHHHHHHHHHHGFGGGHHHHHHHHHHHHHHHHGGGGGGHHHGGGGGGGGGFGGGGGGGGGGHHHHHHHHHHHHHHGHHHGHGGGGGGGGGGFFFFBDFFFFFFFF
+@574028/2
+TAGTCGTGCTCAAAGCGGGCCCCCACTCTACAAGTTGCAAAATTTGTTACGGGTAACTGTTATCGGTAACATTGTCCAACCGCACCATTCACGACGCAATGACCATTCGTGCCAAAAGTGAATAAGTGTGAGCTACTTCAAAGTTGTCAGA
++
+BBBBBBBABBFFGGGGGGGCEGGGGFHHGHHHHHHHHFHCGHHHHHHGHHGGGGGHHHHDGHHHHGGHGHHHHHHHHHHHGGGGGGHHHHGHHGGGGCGGHGHHHHHHHHGGHGHHGGGFGHHHHHHHFHHHHHGHHEFD<FHGHHHGFHG
+@1420276/1
+GGATGCGGTCCTGCCGCCGTGCCGAGCATATAGTGCGCGGTTTCGTAACTACCGGACCAGTCGCGCAGCGCCTCGTTACAGGCATCTTTTAGCGTAGCGGAGCCGCTATGAACCGGGATGACCTCAGCGCCCATCAGACGCATACGGAAGA
++
+CCCCCFCCCCCFGGGGGGGEGGHGGGGGHHHGGFHHGGGGGGGHGHGHGHHHHGGGGGHGFGGGGGGGGGGGGGGHGGGHHHGHHHHHHHHHHGGFGGGGGGGGGGGGGGHHHGGGGGGGHHHHHHHHGGGGGGGGGGGGGGG?FGGGGGF
+@234332/1
+TGTTTTTCGTAAGAGACCACCCGCCCCTGATCGTCTTTTAACGTATACGGTAAGCGACAGGCTTGCGAACAGTCGCCCCGATTGGCGCTGCGCCCGGTTTGCGCATGAGAGATATAACACTGCCCAGAATAAGCGACACACAGCGCGCCAT
++
+BCBCCFCFDFFFGGGGGGGGGGGGGGGHGHHHGHHHGHHHHHGHHHHHHGHHGHHGGGGGGGHHGHGGGGGHHHGGGGGGFGGGFHCCEEFFGGGGGCGGDFCGGGGHHGHGFHHHHHHHHHHHHHHHHHHHHHGGGGGHGGGHGCGGGGE
+@372390/1
+TGTTTAGCCATCTGCTACTTATTCCTCGATTTTACCGCCAGCAGCTTCGATAGCAGCACGAGCGCCTTTAGTAACACGCAGGCCACGAACAGTTACCGGAGTAGTGACTTCGCCAGCCAGGATCACTTTCGCGAACTCGATCTGGATACCG
++
+AA>AAFFFFFFFGGFGGGGGGGHHHHHGGHHGFHHHGEGF?DFHHGGGCHHGEHHEGHEGGECGGGGGHHBEGHHHHGGGCGFGHG?FEEFHHHHHGGGGFFFFGHHHHGFGGGGFFGHFHEHHHHGGHHGGGGGGHHGHHHHGGHHGHFA
+@1051245/2
+CTGAGGTAGTTGCCAAGACGTCGTAAACGCACGACATATTCCCGCACCGTGCCATGGCTCATCTCGGTTTGTTCAAACAAATACTGCTTGAAACCGATAATATCGAAAAAATCACTCTGCTTTTTGCAGTGCAAATCGCCGCAAAAGCGA
++
+B@ABBCFFFFFFGGGGGGGGGGGFH4FHGGGGGGGGGHHFGHHDFGGGGGEGEFFGGHHHHHHHGHGF?EDGHHHHHHFHHFHHHHGHHHHHHHGGGGGGFHHGGHGGGE@HHHHHGHGHGGHHECDFGHFHHHGHFAFACGGGFHHGGG
+@27332/2
+AACAATTAGTGCGCATGGCGGAGCGCAGGGAGCATTTCTGGACGAATGGGGAAACTGACCAGGGAAATTGAGGTCAAAGAGAATATGAATCCGCACTGAATGCCTCCTTAGTGGCGAAATAATAATCAAGGATTGACTATACTTACGCCAT
++
+BBBBAFFFFFFFGGGGGGGGGGGGGGGGGGGGGHHHHHHHHHHGGGHHFHGGGHHHHHHHHHGGGHHHHHHHHGHHGHHHHHHHHHHHGHHHGGGGGGHHHHHGHHHHHHHHHHGGGGGHHHGHHHHHHGHHHHGHHHGHGHHHHHGGGGG
+@84418/2
+CGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTGCGGTGAAAATCCGCGAA
++
+1AAAADD111AAGGCBFFCA0CGBDG1AAE000AGEGHEA/EEFHHHGGHGGCFEC?//E@CEHHFF21BE?HHGGHB0//>@/?//<ACC/?F/?CGHGCCG/BCCG-CCC-:??FFFB0????@;@F/;B@?;@-/BF///A-@==
+@1476635/2
+TACTCGCTCCGCTCGCCCTTCGGGCCGCCCTAAAGGGCGTTCAAAACACTATCGTGTTTTGTCGAGCACACTCCGGCGTCAAAATGGCAAATAAGGTAGCCCGATATATTTATCTACCCGGGAAGCCTGGCGGCATCATCCCCTTCATA
++
+CCBBBBBCCCCCGGGGGGGGGGGGGGGGGGGHHHHH?GGFGGHHHHHHHHHHHGBFGHHGHHHGGGGGHHHHHBEFFGGGGGHHHHGHHFGHHHHHHEFGHHGCFGGHHFHHHHGGHHHGGGGFGGHHGEAFGGGGGGGGGGGGGGGGG
+@422077/1
+GGTTCGACACCCCACCGACCGCCAGGTTCTGGATATGCGGCGATTTACCGCCCAGCAACGCCACCACGCGGTTAGCGTCACGCTGACATTCCAGCGCCTGCAGATAGTGGGCGACCGCAATCAGGTTGACCTCCGGCGGTAACTGCATTG
++
+AAA?1>11>1AAE1EEGE0EEGGGGHHFEGHHHGHHG2EEGGGGHGGBGGGGGGHHFBFEEEEGFEEEEE@GGF0BBCCAC?0CFGHHHHHHHHH?CGGHHHHFHHHHFHHGGCCGG@CC?GHHHHFGGBFEG.E@-A@@BFFFFFBFFF
+@133301/1
+GGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTGCGGTGAAAATCCGCGAACTGGCAGAAATATTTCATCATAACACCACCATGTTGATGG
++
+BBABABFFFFFBGGGGGGGGGGGGHHHHHHHGGHHGGHHHGGGGGEHGGGGGGHFHHHHHGGGGGHHHHGGGGGGGGHHHHHGGGGGGGHHHHGGDGGFHHHHHGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
+@50711/1
+ACCTGGATGTCCTTAAGCGCTGGCAACACTAATCCTTCGCCGTTATTGACCAGCGGAGAATGTTTCGCCAGCGTCTCACTGGCTGACATCAGCATTTCATCAGTAATGCGCGATGCGCCGGAAGCGATAACCCCCAGACCGATGCCGGGGA
++
+CCCCCFFFFFFFGGGGGGGGGGGGHHGHGHHHHHGHHHHGGGGGGHHHHHHHHHGGGGGHHHHHHHGGGGGGGGGGHHHHHHHHGFHHHHHHGHHHGHHHHHHHHHHHGGGGFGGGGGGGGGGGHGGHGGHHGGGGGHGHGCGGGGGGGGC
+@218134/1
+CCCATACGCTGGTGGAAAACGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTG
++
+CCCCCFFFCCCCGGEGGGGGGGGGGGHHGGGHHHHGHGGFGHHHHHHHGGGGGHHHHGEEGGGHHHHHHGGGGGGGGGGGGGHHHHHHHGGHHGGHHHGGGGGGHGGDGGGHHHHHHHGGGGGHHHHCGGGGACF/BFFFFFFCDFFFFF
+@237794/1
+GTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTGCGGTGAAAATCCGCGAACTGGCAGAAATATTTCATCAT
++
+BBBBBFFFFFFAGGGGGGGGGGGDEFFHHHHHGGGGGGGGGGGGGHHHGHHHGGHHGGFFHG/ECFGGGGGGGCEHHHHHHGGG@FHG0CFCGGGGG@HHHHHGCFGBDGGGGGGGDG9FGGGGEAFFF;AEFFEFFFEFFFFFFFFFFFF
+@1240331/1
+GTCCGTTAACTGCTCGCTCATCCGAGGTAATGTCTCCCCAAACCAAATTTCCACGCGCTTTCGAAACGCCACTCCATAAGCCGCACTATGAGCAAGCAACAGGTTAGAGTGTCTATGTTTCGTAAAGTTCCGTTACGCATTTGTTTTTGTT
++
+AAAABBFBAFFFGGGGGGGGGGHGGGFEFHHGHHHHHHGHGHHGHHHHHHHHHHEGGGGGGHGGHGGGGGGGHHHHHHHHGHGGGGGHHHHGGHHHHHHHHHHHHHHHHHHHHGHHHHHHHGHHHHEFGHHGFHAGGGGEGHHHFFHGGHH
+@310418/1
+GATGTGGCGTTAATGTTGGGGATCGCCCATACGCTGGTGGAAAACGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGG
++
+BABCAFFCCCCCGGGGGGGGGGGGGGGGGHHHHGGGGFFGGHHFHGGEGGGHHGGGHHHHHHGGGGHHHHHHHGGGGGHHHHGGGGGGHHHHHHGGGGGGGGGGGGGHHHHHHGGGGHGGHHHGGGGCAGGGGGGGHHHHHHHGGGGGGGG
+@328116/1
+GTTGGGGATCGCCCATACGCTGGTGGAAAACGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTG
++
+AAAAB3>AAABAGGGBGGFG2EG3CAAE3FGFG2FECGFAEFFGHHGHC1EEAFGHE33BE0>EHHFFEGEE>FHGHFGHG?CEF@/<E@EGGFBDDDHHG?FGGGFG<CCG@@><.EGG<@GFH.CG.--:@EGGCG?--9@@>?F/B/
+@822459/2
+AGGCCTAACTGGTCAGCCGTTTTTGCCGTGGCGTTTTGTGTCGCCTGCCTGATTACCGTTGAGTTTTTGCCCGTTAGTCTGTTGACGCCGATGGCGCAGGATCTGGGGATCTCCGAGGGCGTCGCCGGTCAGTCGGTCACCGTTACGGCGT
++
+3>ABBFF4CFDFFGGGGGGEGBCAE4G2EEEECEEGFH2AFGGC1EE1GHFHFHFFGGGGAEHFGFFE0GGBEEEEE4FGHFHFEDEFGCFCEGGGF?EGGHGDDGH/FA/FBG?@FFGGG?C-@AC--<?/0;A?A::::?C;AEE.?B9
+@1257053/2
+GTATAGCATCATCGTTTCACAGTACAAAAATTAAAAACCCAGCGCCAACCGCATTCCATTTTTTGCGAACCTCTATCCAGAATCATCATCCCCTCGTTTCACCACTTTCCATCCCCAACGAACCAGGTTACAAACTGTACATACATACAGT
++
+A>ABCFFFFFFFGGGGGGGGGGHHHHHGHHHHHHHHGGEGGHGGGGGGGGGGGGGHHHHHHHHGGHGGGGGHHHHHGGHHFFHHHHHHHHHHGHGGHGGGHHFHHHHHHHHHHFHGHGGGGGGGGGGHHHHHEDGFFGHHHHHHHHHHHHF
+@1011008/2
+ATCCCGCTCTCCTCCATTACCTCTCGCGCGACCGCCTGTTCTAAGGTTTCGCCGACTTCAACAAACCCGGCCAGCACGGTATGCACGCCGTTGCGGTGGCGAACGTGCCGGGCAAGGAGGATCGAATCCTCACGGCGGATCGCGACGATAA
++
+ABBBAADDDBFFFGFGGGGGGFHHHDF222EFCGCGEHFGHHHHHBGHHFGGDCFGGGHHGFFGFCGFFC?EGGGFHGCGAFHHHGFGG?/CDDCGDDDH<DGCC>CGFF<CFCGGACGFEGH..FHFGGFHG?DG?DADA.?-;-@-99E
+@945161/2
+ATTTTACAGCGCGTTCGCCCCCTCATTGGCCAGGGCAAAGTCGCTGACTATGTTCCGGCATTAGCGTCCGTCGAGGGTTCAAAGCTGGGAATAGCGATTTGTACCGTGGACGGGCAGCATTATCAGGCGGGCGATGCGCACGAACGCTT
++
+3AAAAF4DFFBBG2EF?FGGGGGGGHHGHGC3BAEGAFAGHHGGGGEFFBH5DADGE?EGGH34?/FEFGFAEGGEGAGHHEFFHHHFFFF233B<DGCFHHHHHGFF/?G/AF??CAHFHFH111FB?@C?:BG?DGDBDCD.@FF?A
+@950829/2
+ATGTAGCCCAACATGCCGGTGTAGGCACGATGACCGTATCACGAGCCTTACACACGCCGGAACAGGTCTCTGATAAACTCCGGGAAAAAATCGAAGAGGCAGTGCATGAGCTGGGCTATATGCCTAATCTCGCCACCAGCGCGCTGTCGT
++
+1AAAABB111>A1FCFG?0AEEFG11CEE0BCBFBEEHFFGCEAE/AEHHG1FDE//FEG@/>BF/G@1GBF1FF21FDGHE/EGE/0B/01/GF//B<CC/011B22FGGFBGCE0<F2@DDG1F<11?10/>.>GA0.<--<-C.:EC
+@290063/1
+CCGTCAATCAGCCCGGAACTGGCCCGTATCGCTCCCGGCTTTCGTGCATTAAGTATTAATGTTATTGCCGCTCCGATTCGCGATGCGCAGGTCGGAGAAATCGCGCTAAAAGAGGCCTGTCAGGCCGTAATTAACGGCCAACCGACGTGGG
++
+BBBBBBBFFFFFGGGGGGGGGGHFHGGGHGGGGHGGGGGGGHHGHGGHGHHHHAGGFHHBGFHHHHEHHGGGCFEGGGHGGGGEFGGGGGGHHG@@CGHFHHGGFGGGGHBFFHHGFHGHHHGBFFGCDDEGHHEGC@FGHFGGGFGGGEF
+@1374378/2
+TTTCCGCAGTGCGCTTCATGCTTGCATCCGGCAACTAACTTTGGATAATGCCCGTTTTCAGAACTCAAACACAGCAGACTACACTTTTATGAAAAACGACGTCATTTCACCGGAATTTGATGAAAACGGTCGCCCGCTGCGCCGTATTCGT
++
+CCCDBCCDDCFFGGGGGGGGGGHHHHHHHGGGCEHHHHHHHHHHHHHHHHHHHGGHHGHHGHHHHHHGHHHHHHHHHHHHHHHHHHHHHHHHHGHHGGGGGGGEHHHHHHHGGGEGHHHHGHHHHHHGGGGGGGGGGGGGGGGGGFHHHF<
+@229753/1
+GGCCGAGTCAGAGGAGATAATTTAATGGGCGATGTGTCAGCTGTCTGTTCATCCGGGAACATTTTACTGCCGCAGCAGGATGAGGTTGGCGGTTTATCAGAAGCATTAAAAAAAGCGGTGGAAAAACATAAGACAGAAT
++
+AAB@ADDAFFFDGFGGCGGDFGHFGFHHHGEGGGGBGHBEGHHH3GHFHBHHHH1EAEFGCGED5FB5F5BEE@0EHHHFGHEGHBFGEHGFGGGFGHHHHHHHHHGHFHHFGGAFGGEGFHFFH0AFF11?FDCF0GH
+@751891/2
+TTTCTGACGCAAATGCGTGAAGCAATGCCTTCCACGCTCTCTTTTGATGAATTTATTTCGGCCTGCCAACGCCCGTTGCGCCGCAGTATACGCATCAATACGCTTAAAATATCCGTGGCTGATTTCCTTGCCCTAATCGCGCCCTACGG
++
+BBBBBFFFBBBBGGGGGEFEGGHHHGHHHHHHHHHGGGGHHHHHHHGHHHHHHHHHHGHHGGGGGHHHHGGGGGGGHGGGGGGGGGGHHHHHGGFEHHHGFHGGGGHHFFHHHHGGGGGHGHHFHHHHGFHHHHHFHHGGGGFGFHGDG
+@586658/1
+CGTTACTACCCGCGAATCGCCCCTTGCATTATCGTCGCGATCCGCCGTGAGGATTCGATCCTCCTTGCCCGGCACGTTCGCCACCGCAACGGCGTGCATACCGTGCTGGCCGGGTTTGTTGAAGTCGGCGAAACCTTAGAACAGGCGGTCG
++
+CBBBCBFFFFFCG2FFGGGCGGGHHHHHHHHGHHHHFGGGGGGHGGGGGGGHFHHHGHHHGGGHHHHHHHGGGGGGHHHGGGFGHGGGGGGGGGGGGHHHHHFFGGEHGGHGGFFEFGHGGBGFGHGGGG?FGGGGFBFGGGBF.ECFAF-
+@891630/2
+ATCCAGAACCCTTCATGACACCACGGAATTGGCGTGAGCGACCAGCCGTAGGGCGCGATTAGGGCAAGGAAATCAGCCACGGATATTTTAAGCGTATTGATGCGTATACTGCGGCGCAACGGGCGTTGGCAGGCCGAAATAAATTCATCAA
++
+ABCBBFFFFBBFGGGGGGGGGCGHG?EGGHHBFCEGGGHG2EGGGHGGGGGGEFEEEE@G?G312F1?FHHHHHGHHHHGGGGG/FHHFGBGHGEFGFHHFGHG/?<FDGHHCC/CCCGGGGGGGCFGAFFDC.EFGCGE0FFFFFE0BFB
+@1333087/2
+GCTTCAATGATTTGATCTTTAGTGATAGACATTTAAATTGTTCCTGAATATCAGAATAAGTTTATACGTAAGCAAATGCTTGATAAAGACAACTGCGATTACGCAGCTTCTTTTGCATCGCGTACAGCAGCCAGTGTGCGAACCAGTTTG
++
+CCCBCFFFFFFFGGGGGGGGGGGFFFFGGHHHHHHHHGHHHHHHHHHHHHHHHGHHHHHHHHHHHHHHFGGHHHHFHHHHHHHHHHHHHHHHHGHHGGHGGHGGGGGHHHGGHBHFFHFGFGGGGGHHHCFGFFHHHHHGDGGGHHGHHH
+@520245/2
+GTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGTCATAACCCGTTGTGCAGCGGGCAAGGAACGCTTCATCCTGCCAACCGTTTTCCACCAGCGTATGGGCGATCCCCAACATTAACGCCACATCGGTGCCCATAT
++
+BBBBBFBFFBBBGGGGCFGGGGHGHFHHHGHFGHHGHHDEEGGGGGGGE@DGHHHHHGGFGGGHHHHGGGGGGEGHGFGGGGGGHHGHHHHHHEGFDFHGHHHHHHFHGDGGHHEGGGGGGGGHFGGHHBGHGGFDFHHFGGEDCFGGGGG
+@1507175/1
+GTGCCAGTGTAGAACAATTTTCTGCGTCTGACAGCGCCTTGCCGGCGTGTTTGCTGGTTTTCTCAACGGTCTATACTTAGGCTGTCAGGAACCCGTGAGGTAGTGAAGATGAAAACGGCAAAAGAGTACAGTGATACGGCCAAGCGCGAAG
++
+>>A335CFBFFBDGGGGGGGGGHHHGGGGGHH4GHCGGGEHBHGGECEE1AFB55FF3BGG5EEFGHGCGGGGBB3BBDGHFHE1BFGH3GGGGC?A/EF333?F4BFDD34DGH0><BGGHHB/@DGHB2@GDGFFA//<>CGED<-<C-
+@468293/2
+CGGCTGGATACGGCGTTTAACGGCCAGATAGACCTTCACGATCTTCAGCACGCCCGGCGCCAGATCGTCGCCCTGGGTGATTTTACGGCGCTTCGCTTCAAGTTTTTTCTCGAACTCGTGTTTCAGCTCGTCATACTGCTCAGCCAGTTGT
++
+BCBCCCCFFFFCGGGGGGGGGGGGGGHHHHHHGHHHHHHHGHHGHHHHHHHGGGGGGGGGGGGHHHGHHGGGGGHHGHGHHHHHHHGGGGGGGGGGGHGHFHDHHHGGHHHGHHHHHGHHHHHHHHHHHGGGGHHHHGHHHHHHHFHBGHC
+@758467/1
+ATGATGGAGATTGCCAAAAAAGTCGGTAAGGGGCTGCATCCGGACTGCTATATCGAACTGGTGATTGAAGACAGTTATTACAATATGCGCGAAAAAGTGGTTGAGCATCCGCATATTCTCGATATCGCCCAGCAGGCCATGCGTGA
++
+BBBBBDCFFFFFGGGFGGCGCEHHGGGHGFB2AECDFHHHHGCEFFFFHDGFHGEGHHEHH52F5FGGFHEFFE@GHEDGHGBHHHH4EEEE/E/E?EFFGGFFHHFFHFGG?DDGFHB3FHFHGHAFGGCHGHHHGFEFFGGEGG
+@596295/2
+TTCCCCAGCCAGCCATCAACATGGTGGTGTTATGATGAAATATTTCTGCCAGTTCGCGGATTTTCACCGCAGAAACGCCGCAAATTTCCGCCGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCG
++
+CBBCBFFBFBFFGGGGGGGGGGHGHHGGGGGGHFHHGHHHHHHHHHHGHHEBFGGGGGGCGGHHHHHGGGFGGGGH1EGGGGCGHHHHHGGGGGGGGHHHHHGGCGGHGFGHHGGGGGGGGGGGGGHHHHHHHFCHGHHHHHGGGFGGFGG
+@1089773/1
+TCCTTATCCATACCAGCAACGGTCAGTTGCAGGCGCTAAATCAGGCGGATGGCGCCATTAAATGGACGGTGAACCTGGATATGCCTTCGTTGTCGCTGCGCGGCGAATCTGCGCCGGCAACCGCGTTCGGCGCGGCTATTGTTGGTGGTGA
++
+CCCCDFFFFFFFGGGGGGGGGGGGGHHHHHHHHGGGGGGHHHHHGHGGFEGGHGGGGGHHHHHHGGHGGGHGHHHHHHHHHHHHHHHGHHHHGHGHGFGGGGGGGGGGGHGHGGGGGGGGHHGGGDGGDDFGGGGGFFFFFFFFFDFFDEB
+@628788/2
+GCTGACGATGCATTCCCCAGCCAGCCATCAACATGGTGGTGTTATGATGAAATATTTCTGCAAGTTAGCGGATTTTCACCGCAGAAACGCCGCAAATTTCCGCCGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATA
++
+A1A1AC1>1>1@3B33AFGE0AGHGGHH1FGHBGBF1FEFGAEFHFGGFGF12AFH222AD211A22D1ECF?/F1GG21?/E@GHHBA@/>EEG?GF1FGE/?/>//?FHBGGAC@/@100/11/<//?//>C?AEAGFDGFH.GGHEGG
+@653315/1
+GTTGGGGATCGCCCATACGCTGGTGGAAAACGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTG
++
+BBBBBDBBBCABGGGGGGGGGGGGHGFFHHHGGGGAEHHGCFHHHFHHGEFGHHHHFHHGGGGGFHHHGGGGEFHHHHHHGGGGGGGGGGGGGHHHHHHBCGHHGGHHHGGGGG?GGGGGGGHFHHHHEGGGGGHHHHGGAGF-@>FFFF
+@662011/1
+CCCCAGCCAGCCATCAACATGGTGGTGTTATGATGAAATATTTCTGCCAGTTCGCGGATTTTCACCGCAGAAACGCCGCAAATTTCCGCCGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGT
++
+?AAA?ACACBAAFDGFGGGGBCEF?GDFE55GF5ADDFFAE55DGFGGFGGGGEEEE0AEGHHHHEGGGEGHHGGG/ECEG/GHHFFDGFC?EE/?FF?FFDG<DGF?/1F/BDDEDCECCCDDH1FCGFC.CCCGGH00.---AC@-A?.
+@1104103/1
+ATGTGAAAGTTGGCACAGATTTCGCTTTATATTTTTACGGCGACACGGCCAGCAGAATTGAAGATCTCGTTACCACGACGACCGACCATGACCAATCCGGGAGAGTACAAGTATGTCCGCTGAACACGTTTTGACGATGCTGAACGAGCA
++
+BBBBBFFFFFFFGGGGGGGGGGGHGGHGHHHHHHHHHHEGGFGFGGGFGGGHGHHHGHHHGD55FGHHHGGHGHDHDFGGGGGGGGGGHGHHHHHHHCFGGGGGGHHGHHHHHHGHHGGGGG?GHHHGGHHGHGHGGGGGHHHGHF?EFF
+@153331/1
+GCGTGTAGATGTAGTGACCGAGAGAGGTGAGCACGCGGGCGATGTTCGGCGGGCAGCAGGCGCAGCCAAACCAGCGCTGGCGGATGGGCTTAACGTGATCGTAAATATGGTTGAATTTTAACGATCTTGGATGCACTTCCAGCGGGTTGA
++
+ABBA@AFFFFFFGGDEGFGGEEGGG2EB2FGFH2EEGGGGGGGGHHHGGGGGGGGGCHFHG@CGGFHHGHHGHGH@CGGGGGGCGGGHHHGFHFGGHEFHFHHHHHBHFG0FDGGGGGGGGGGEGG.FFFFGFBFGGGGGFEFCAF@ECF
+@880432/2
+GATTTGCGCGTCGTTGATATCGCTGTGGTTTATCCGCAGATCCAGCACGGCCTTGAAGTTATCCAGCGCCCGCTTCATCTGCGGATTTTTACGTAACTCCATGCCCACACAACGGGCTTTTAGCCGCGCCTGAATATGCGTCAGGTGTTCG
++
+AA3?ADDDBBDBGEGGGGGGGGGHGGCGFFFFHHHGFEGGHFGHHHG1EAEEFFHGFFGHGFFDGBHGGGCECGGGHHHHHHGG>EFHHGHHGCHHGHHHEFHFFGGGGDFEDDCCDGHHFFCEFA@CCFDHHHHHHHHG.AF.C;GF.GG
+@736272/2
+GCGTTAATGTTGGGGATCGCCCATACGCTGGTGGAAAACGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGG
++
+33A>AAAFF55DGGECECFGAEDHFHHGGGCGGGHBDCGGGAFAEFGEE1CBBGBAE1BE2FGHFFGE?//EGFDHGE>ECGHB?E3GE?/?<>E/CDC/BF1GFDD<BDHF//CC0CDCCC.<CD?G-CEFHH:/:C?@?EB/C.?B?@B
+@151174/2
+ACTCACCTGAATACTCAGGTATCGAATCTGGATACCCGCGTCACCAATATCGAAAACGGCATTGGCGATATCGTCACAACCGGTAGCACCAAGTACTTCAAGACCAACACCGATGGCGCAGATGCAAATGCCCAGTGTGCGGACAGCGGCG
++
+>A>33@CFCFFFFGGGFFGGGGH?A4FEGH5FEF4BAE2E22A2BDF33F5FHHGGH0E00EFGG?EEGDGHG2C1E3BE1@/>>/3FF?GHFEGEBF4D3BGGHHF/?/E?/CAEG?ADCGHHHHFB1FD<<F.1<1<1>CGGGG.----
+@121669/2
+CTCTGGAACTGCTGAAGCCGCTGCTGGAAGATGAAAAAGTGCGCAAAGGGGGGCAAAACCTCAAGTACGATCGCGGCGTCTTGCAAAATTACGGTATTGAGCTGCGCGGTATCGCCTTCGATACCATGCTTGAGTCTTACATTCTGAACAG
++
+AAAAAFD1111B3A1F1BFEGGGAEFGBGHHHGGHCB00AA1A/E/AA0/E//</FA0?/0F1FG<?DC<GH/<<@-@--:CFHFCCC0CCCCAG.990;BBFFG??A-.;EFCA9--/AEB->B/;B/B/F-B99/BBFF/9FBB9B///
+@759898/2
+GTGGTGTTATGATGAAATATTTCTGCCAGTTCGCGGATTTTCACCGCAGAAACGCCGCAAATTTCCGCCTCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGTCATAACCCGTTGTGCAGCGGG
++
+1A>1>1>A3DD3F33FGGGFDGH3DBG11BFGEEC00EEBF2AFA/EEAGG1AA/AA>/EEHGHHHGGC////BGGHFB?EEGGHHH@1B/ECA?EFFC/B?A11?G1<G0GCFFB1FF/>@/?-AC-CCC.0<=GHHGAC.;.00:;-@-
+@770613/1
+CGTTAATGTTGGGGATCGCCCATACGCTGGTGGAAAACGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGA
++
+BABCBBFFFFFCGGGGFFGGGGHHHHGGGGGGDHGHHHGGEDGGHHDFFHFHGGHGGGGHHFHFFHGGGGGHHHHGGGG/FHFHHHFGGGGGGGGGGGCGFFFFHHHGGHGGGHFHGGGGGGEFGGGGGFHEHEHHCCG-CBFFGGFGFF-
+@801426/2
+CAACATGGTGGTGTTATGATGAAATATTTCTGCCAGTTCGCGGATTTTCACCGCAGAAACGCCGCAAATTTCCGCCGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGTCATAACCCGTTGTG
++
+BBBBBFFFDDAAFGGGGGGGGGHHHHHHHHHHGHHHHHHGGGGGGGHHHHHHGGGGGHHHGGGGFGGGHHHHHFGGGGGGGGHHHHGGGFHHHHGHHGGGGGCGGGG@EDHHHHHHHHHHEH1FGHDFGGCCC@@DDFGGFHCFGGGGGGD
+@804306/2
+AGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTGCGGTGAAAATCCGCGAACTGGCAGAAATATTTCAT
++
+AAABAABCFFFFGGFGGGEGGCFGGGGGGGHHCBGGGGGGGGGGGGGGHHHHFHF?EHHGGHHHGGGGGGHGGGGGGHCGHHFFCGGGCGEGH/@@?CCDDHGCBG?CGG@BDGFBFGGDDGFFFFFF.EC=BFAFFFFDFFFFFFFFFFF
+@826795/1
+CTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTGCGGTGAAAATCCGCGAACTGGCAGAAATATTTCATCATAACACCACCATGTTGATGGCTGGCTGGGGAATGCAGCGTCAGCAGT
++
+ABCCCFCCFFCCGGGGGGGGEGEDFGGGGHHHHHHGGGGGHHHHG?EGGGGGHHHHHGGGGGGGHHHHGGGGGHHBHHHGGGGGGGHHHHGGFHGHHHHHHGHHHHHHGGGGGGGGGGGGGGGGGGGGGGEGGGGFFFEFFFFFFFFFFFB
+@831989/2
+CCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTGCGGTGAAAATCCGCGAACTGGCAGAAATATTTCATCATAACACCACCATGTTGATGGCTGGCGGGGGA
++
+>3AAAABD2ADDEECFGGGFGGCCAGDDFHHGGGGCEHGEGGGCHHGHHFFGGGCGGFAAEE?CGDDGHGH1D@C@DGGGHHGHGGFGGHGEHBGFGGG?BGFGGFDFEGGGGGGGGGGGGGGGGG?.AEEFFBFF/BFBFFFF?-;>B;-
+@837692/2
+GATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTGCGGTGAAAATCCGCGAACTGGCAGAAATAT
++
+BABBBFFBD?AAGGGGGGGGGGGGGHHGGFGGGFHHFHHHGGGGGGCGFGGGGHHHHHHHGGHHGGHHHGGCGGGGFGGGGGFHEFHHEGGGCGHFHHGGGGGFGGH:GFHGGGAABDGGGGGG;BEFFFFFFFFFAACFBFEFDFFFEFF
+@838540/1
+CCCATACGCTGGTGGAAAACGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTG
++
+CCCCCBFFCCCCGGGGGGGGGGEGCEGHGGGHHGHHHGGGGHHHHHHHGGGGGHHHHGGGGCGHHHHHHGGGGGGGGGGGGGHHHHHHHGGHHGGHHHGGGGGGHGGGGGGHHHHHGHGGGGGHHHHGGGGGGGFFFFFFFFFFFFFFFF
+@1108958/1
+CATGTTCTGAGTGGTAGCGTTTGCGTTATATCGTCACAGACAGCGCCTCAGGGCGCTGTTTTCGATCGGACATGTCGCTTTCGCAGGAGGGGACGTTATTCGGCGACCAGCCACATATCAGCCTCTTCAAACATCTCTTCCAGCATACGGT
++
+BBBBAFFFFDFFGGGGGGGEFGGHGFGGHHHHGHHHGHHFHHHHFGGGGHGHGGGGGGGHHHHGGHHGGGGGHHHHHHGHGHGGEGGAFGFGGGCDFGHHHHHGGGGGGHGGHHGHHHHHHHGHHHHHDHHHFHHHHHHHHHGHHHGHHG:
+@1294851/1
+ACACCGCGTTAGCAAGCGCGCCTTGTGTTGACTGCGGTATAGAGGGGATCAGGCGAATTTTTGGCGTCCAGTCCTCGCCTTGTAGTCCGTTACCCCGGCTGATAGCCCTGGCCAGTTTACCGTTTTGATAAACCAGTGTTACCGCTACGC
++
+CCCCCCCCDDBCGGGGGGGGGGGGHHHHHHHHHHHGGGGGHHHHGGGGGGHHHHGGCEHHHHGGHGFGGGGHHHHHGGGGGHHHHHGHGHHGGHHHGGFGGHHHHHHHHFEHHHHHHHHHHGFGHGHGHHHHHHHHHHHHHGFGGGGGGG
+@782773/1
+CACTATGAGCAAGCAACAGGTTAGAGTGTCTATGTTTCGTAAAGTTCCGTTACGCATTTGTTTTTGTTTGTCATGTTGTAGACAGGTCTTATCTTCCATTATAAGTCTACAGATGCTGAACAACGCACTATCTGTACAGAAATGCCCATTT
++
+ABBBBFFFFFFFGGGGGGGGGGGHGHHHHHCHHFHHHHGHHHHGHHHHGHHGGGGGGGHHHHHHGGGHHHHHGHHHHFHHHFHHHGHHHHHHHHHHHHHHHHHFHGGHHHHFFHHHGEFGHFHHGGGEGGHHHGHFHHFGFGGHGHHFHHH
+@1472575/1
+AACCAGGATCATGACGCGCCGCTATTGCAGCAGTATTTCTCCTGAGGATTTTCGCCCGGTGGCGGCTACGCCTTACCGGGCCTACAGTAAGCCGGATAAGCAAAGCGCATCCGGCAAATAAATCAACGAAAACTCACCTTTTCACCCGCTT
++
+BBBBBBBBFFFFGGGEGGGAFGGGGFFHHGHHHAFHHHFHFHHHHHGHHGHHGFG?EEF0E?1ECGGGGGGGGEHHGGGCGGGHHHHHHFDGHGGGGGHHFH2GHFG/@??HFCFGGFHGHHHHHHHGEEGGHHHHGGHHGHBGBGACF?D
+@877399/2
+CCCATACGCTGGTGGAAAACGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTG
++
+AAABAFFFBBBBFF?GEFGGGGEAEEFFGGGHHHHFHGGGFBGHHHFHGGGGGGGHHGEFG0FHHHFHHEGEGGGGGGGGGGHGHHFGFCGFHFGGHGGDCCCGHGGGGGFGBCGHHHCD@DEHEHHCCFGF-?BBFFFFFFAFDACFFF
+@1062443/2
+AACATGTTCTGAGTGGTAGCGTTTGCGTTATATCGTCACAGACAGCGCCTCAGGGCGCTGTTTTCGATCGGACATGTCGCTTTCGCAGGAGGGGACGTTATTCGGCGACCAGCCACATATCAGCCTCTTCAAACATCTCTTCCAGCATACG
++
+BBBCCFFFFFBFGGGGFGFGGEGEGHGGGGHHHHGFHHGHHGFGFHGGGGGHGHHGGGGGEHFHHGGFGGGGGGHHHHHHGHGFEGGGGGGGGGGGGGGHEHHHFGGGGGFGHGGHHHHHHHGCGHFFHHHHHHHHFHHHHHGGFHHHHGF
+@24713/2
+GTTGTATTCATATTCCTTCGCCTTTTAATGCCATCCCGAAACGTATGAGCGCGTATATCAAAACGCGCCGAAAAGACTTACCCTGATATAGACTGCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTG
++
+?AABBBFFFFFBGGGGGGGEFCGGHHHHFGHHHGBGHGGCGEGHHHHGFH?E?FFECHHB5G3FAEEEEEGGFEHGHHGFHHHHHFHFFFEHHHFHGEEEGHHHGHHHHGGFFHHHHEGHHHHHGHFHGFHBFGHHEDD<@FFG1DHHH1G
+@549776/1
+GATCGCCATTTCGACCACTACGGGTTCGCTGACCGCGCCATGCTGCGCCAGAGTCTCTTCACGCACGCCAATCATCTGCGCTTTGGCTTCATTACTATAGGTGACAAAGCCGCGTTCAAACCAGGCGGAACTTCCGGCGATGTCGGTAATG
++
+BBBBBBAAAFFFGGGFGGGGGGEGGGHGGGGGHHGCGGGEAGFHHHGGGGGHHHHEHHHFHHGHGEGGGGCHHGHHDEHCGGGFHHHFGHHBGGHHEHGFE4?FGFFFHHHGGCCGEHHGHGGHFEGFCGGHHHGA-CC-CGFHHAAEEGG
+@412450/2
+TTTTACTACGCTGCGGCGTATTGTTAACCCTGATGTGATTGACGTAAACCATGATGAATCGAGTAATTCCGCTACCTGACGAACAGGCGACGCTAGACCTGGGGCAACGGGTAGCCAACGCCTGTGATGGCGCGACCGTTATTTATCTGTA
++
+BAABCFFFFCCCGGGGGGGGGGHGHHHHHGHHHHHHHHHHHHHGGHHHGHFHGHHHHHHHHHGHHHHHFGHGGGGHHHHHGGGGGHHGGGGGGGGGHHHHHHGGGGGGGCCCGGHHHHGGGGHHGHHHHGHGGGGGGGGGGHFHHGHGGHH
+@110200/2
+CACAGCGGCTGTAGAGGAGGCGAAGGCCCTCAGCCATATCCGTGTGATTACTGGTGGAAGTCAAACGGAAGGTAAAGGTTACTATTTCGCTCCGACGTTGCTGGCAGACGCAAAACAGGAAGATGCCATCGTGCAACGCGAGGTCTTCGG
++
+CBCCCCCCCCCFGGGGGGGGGGGGGGHGGHHHHHHHHHGHHGGGHHHHHHHHHHHHGHGHFGDHHHGGEEGGBFHEGHGHHHHHHHHHFGGHGGGGGGGHGHHHGHGGHGGGGGFGHHHHHHFHHGHHHHDCHGHHECGGDFGGGHHHHG
+@976958/2
+TCGCGGATTTTCACCGCAGAAACGCCGCAAATTTCCGCCGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGTCATAACCCGTTGTGCAGCGGGCAAGGAACGCTTCATCCTGCCAACCGTTTT
++
+BBBBBB>DBFFFGGGGGGGGGGHGGGGGGGGHHHHF?EGFGGGGHGHHHGGGGEHHGEHHGGGGGCEEEGGGGHFHHHHHHHEGFFGGHCGCCGC?DFGGGGBGFHGHC?HGE?FFFGGCGGGGGGGGGD?.CEFFFFFFFGGGGGGGDFE
+@788448/2
+CTGATAGCGCGATCCAGCCATTTTTTGTCATGGGTAACGTCATAAACAATCAGGAACGCTTCGACGGCGTGCATATTGGCGTTACCGCCACGGTAATCTTCGGTTTTGCTAAAGGCTTCGTCCCAGGACTCCAGGCACATCTGCTCTTCTT
++
+BCCCCFFFCCCCGGGGGGGGGGHHHGGHHHHHGHHHHHGHHGHHHHHHHHHHHGHHHGGGGGGHGGGFEEGGHHHHHHHHGGGGGHGGGGGGGGHGHHHGHHGGGGGHHHHHHHHHHHHGHGGGHFGGHHHHGHHHHHHHHHHHHHHHHHH
+@1368821/1
+GTTACCGATGTTGGCATTCACTTTGACCAGGAAGTTGCGGCCGATAATCATCGGCTCCGATTCCGGGTGGTTGATGTTGGCGGGAATAATCGCGCGGCCCACGGCGACTTCATCACGCACGAATTCCGGCGTAATGTTTTCCGGCAGGCG
++
+AAABCFCBBBFFGGGGGGGGGGHHHHHHHHGHHHHHGHGGGGGGGGGHHHHHHGGGGGGGGGHHHGGEEGGGGHHHHHHHHGGGGGHHHGHEGGGGGGGGGGGGG?DGGFFGHHHHGGFGADFGGFGGGGGADGGFFFFFFFACB=DFFF
+@1342799/2
+GCCTGGTGCGCCGCACATTATCACCGTACTGCGCAACACAAACTTTGAAGGTCTGCAAACTATCACGACGCGGCGCAAGAGTTTGTTATCAACTTATAACAGCCATGTTACCTGCTTATACCAGCAATACCATGCCTGTCTGCTATGCTTT
++
+@AABBAFFB@DAFCGAEGGFFF5ECG2GGGGHGCECEGGHGFCHEHGHHHHHHHFGGHHGHHHHHGEEGGCCGEEGGGGGHDBGFGFBDHHHHGHHHGGFDFG/<GFHHHHHGFGHHHFHFHFGGGGFHHGHGHGHHGHFGHGBGFGDGHH
+@1104130/2
+ATACTTGACATAGTTTCGGATTAAGACTATTCCCTGAGGTGCTTTTTAAGCCTATTTTTGCTAGAATTTGGGGTTCAAACCTCAACTTCGTGAAAAATAAAAGGTGTTGGAATGTATCAATCCGACCAGGAGACCTAATGATATTGACTC
++
+CCCCCFFFFFFFGGGGGGGGGGHGHHHHHHHHHHHHHHGHGHGHHHHHHHHHHHHHHHHGHHHGHHHGFHGGGFEHHHHHGGHHHHHHHGGGHGHHGHHHHHHGGGHGHFHHHHHHHGHHHGHGGGGGHGHGHGGHHHHHHHHHHHGFHE
+@783541/1
+CCTTTATAAAGCATGTCAGTCTCCTGAATCCACAAGGTGATCTGGTCGTACCAGATGAAGCGAAGTGTGTATTTTGTGTTAATAAAATGCAAATAAATGATTAAAGAAATGCCGATGTGATCACGCTCGGCAGAGATCACGCTCTCGTGGG
++
+3AABADDDD5DDCGEFGFDAGDEGFHBGFFFFHHCGH4F5EAGFHDGE?GHFHFF3GHGHHGGGGGFHGBFHHHHG2FFGFGFGHGFFHFHE5FHHHGHHHH4GFHHHHHHBF/EEE1@FFFHFGH/E@EGEEE/0FFHHCFD/G1A?GGG
+@1225485/2
+AACTTATTCTGATATTCAGGAACAATTTAAATGTCTATCACTAAAGATCAAATCATTGAAGCAGTATCCGCTATGTCCGTAATGGACGTTGTAGAACTGATTTCTGCAATGGAAGAAACATTCGGTGTTTCCGCTGCTGCTGCTGTAG
++
+BAAABDBBF5FBDGGGGGGGGGHHCFCHBA5GDGHHFHHFFHCGFGHHFFFFGEFFFHEGGHFF5FBHHGFEEEGAFE11AEFB5GC?11C?BGEFFHHBFHHFFFBBBGDBC3F1F33BFG4F1FEEEFHFEGEGGEF3??DGFGHB
+@833311/2
+GTCAACGTGCTGCTACGCCCCGTAAGCGCAGAGTCGCTGGAAAATCTGGTCACGACCTCAACGGCGCCGTTTATTTCTCGCGAGACCGCGCGTGCCGCCCAGTCGCTGAATAGCCCCGCTCCCGGCGGATTCCTGATCGCCAGCGATGAAG
++
+CCCCCFCCCDCFGGGGGGGGGGGGGHHGGGGGHHHGGGGGHHGGHHHHHHHHHGGGGGHHHHFGGGGGGGGHHHHHHHHGGGGGGGGGGCDGFGGHGGGGGGHHGGGGGFHHHHHHGGGGGGGGGGGGDGFFFFFFFFFFFFFFFFFDFFF
+@315672/1
+GTTCACAACCGACGAACATAAACATCGCCATGCCAATATAACCAAACAGACCAGAAAGATTACTGACATCAAGCGGTGCGCCAAACCACCCGGAATGATGAGTGACCGGGGATAACAGGATCCCGCATAAACCGAAGATGGTCAGGGTAGT
++
+3>ABAFFFB@BDGGGGGGGGGGGHGFGGGGGHHHHHHHHHHHHHHHHHHHHHHHGFGHFFFHHHHEGGHFHHHHGGEFGEGEGCHHEHGAEEGEGGHHHGHHHHHHHGGDFGD@DHHHHGHBGHDCGGGFFGHGGGG?GHHHHBGFF</E<
+@565078/1
+GTGTTACATTGAACTTGTGGATAAAATCACTGTCTGATAAAAGAGTGGGTGATATTCTCGTTGCTCATCGGCTTTGGCACGGTTGTTGCTCGCTGACGGTGCCAGGCAATACTGATTGAGAGGATTTGAATGACCAAAGAAATGCAAAATT
++
+BABBBFFFFFFBGGGGGGGGGGHHHGHHHHHHHHHHHHHHHHHGHGHGHEGEFHHHHHHGGGHGHHHHHHGGGGHEHHHHGGFGEGHHHHHGGGGGFGCAFGHEHHHHFFHHHHFGHHFHHGGHHHHFFGHGFFFHEHHGHHHHEFHHHHF
+@1087349/2
+CGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGTCATAACCCGTTGTGCAGCGGGCAAGGAACGCTTCATCCTGCCAACCGTTTTCCACCAGCGTATGGGCGATCCCCAACATTAACGCCACA
++
+CCDCDDFFFFFBGGGGGGGGGGGGGGGGGGGGGGGHHHHHHHHHHGHHGHHFCGGGGGGGGGGGHHHHHHGGHGGGHHHHGFGGGGGGHHHGGGGGHHHHHHHHHHGGGAGHGHHHFFHHHGDDGGHHHGGGGGHGHGGGHHHHHFGGFG?
+@1189705/1
+CGCATATTCAGGCGCGGCTAAAAGCCCGTTGTGTGGGCATGGAGTTACGTAAAAATCCGCAGATGAAGCGGGCGCTGGATAACTTCAAGGCCGTGCTGGATCTGCGGATAAACCACAGCGATATCAACGACGCGCAAATCAAACGCATTAT
++
+BBBBBAD5DFFFGGEFGGGFGGHGFGHGGH?AEABE1FFFHFFBCFGFE2FFHHFFFB>CGF0DGHHFGFE/E@C@EF0FFFHHHHHDHFFGF/<?F2GA2FFHHGG/A/FGHGAFEF.@-<ACHH0<CEFCC@DCAFFGFFFF?B-C.;;
+@388268/1
+GATTGATACATTCCAACACCTTTTATTTTTCACGAAGTTGAGGTTTGAACCCCAAATTCTAGCAAAAATAGGCTTAAAAAGCACCTCAGGGAATAGTCTTAATCCGAAACTATGTCAAGTATTAACGATAACAGGCAGCAATAATGCCAAT
++
+@BCCCFFFFFFFGGGGGGGGGGHHGHHHGHHFHHGGGGHHHHHEHHGHHHHGGGGHHHHGHHGHHHHGHHHFHHGHHHHHGGHHHHHHHHHGHHHHGHHHHHHHHGGGGGHHHHHHGHHFHGHHGHFGHFGGFHEFGFGGHHHHHHHHHG2
+@648561/2
+CGCGAGGGGGAGCGACGAGGCGCAAAAAAACGCCTCTATTTGCGATAAGCACCACATTTTATTGGCATTATTGCTGCCTGTTATCGTTAATACTTGACATAGTTTCGGATTAAGACTATTCCCTGAGGTGCTTTTTAAGCCTATTTTTG
++
+ABCBABCCCCCDGGGGGGGGGGGGGGHHGGGGGGHGHHHHHHHGGHGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHGHHHHHHHHHHHHHHGGGGGHHHHHHHHHHFHHHGHGHHHHHHHHHHHHHHHHGHHHG
+@1133911/2
+GTAGTTGGCAAAACCGACTTTCTCGGTCTGCTGGCGCAGGTGGTGGCTGACCGTCAGAACATGAGTACGGGTTTCGTCGCGATAAATTTCGATGTCGTCACCCACACGGTTCGCCGGGAACAGGCCCACCACGCCACGCGGATTCAACAGT
++
+CCCCBFFFFFFFGGGGGGGGFGHCFGGGGHHHHCGGGEEGHGGGGGGHGGHHCEGGCHHHHHHHGHHHGGCFGGHGHGGGGEGGGGHHGEHFHHFHHGGHGGGFGGGGGGGFGGDGGCD?FHH.FF?GEGHHCGGGGGDDGG?EG0CGFGF
+@1488068/1
+CGGTAAGCGACAGGCTTGCGAACAGTCGCCCCGATTGGCGCTGCGCCCGGTTTGCGCATGAGAGATATAACACTGCCCAGAATAAGCGACACACAGCGCGCCATGAATGAAGAACTCAATCGTGGCGTCAGTAGCCTGATGAATAGCCG
++
+ABBAAAFFBBBDGGGGGGGGCEGGHHHGF2EEEGGGGHFEECGGEGGGCFFCEEGGGGGGFHGHGHHHHGHHGHBHHHFHGFHGHGHGGGGCHGGFE/CDGGGGHHHHHGFHHGHHHHHHHGGHGGGACDGHHGGHGGGFHHHCGFFFD
+@3935/2
+CTGTATCCCATTCCACGATGCGTGTTAATTGGCGAGAGATCCGGGTTGATCGCGCGTAGCTTAGCGCGCAGGGTTTTGATGTGTGTATCGACCGTCCGATCGAAGGTCTCCTGGGCATCAGACCAGACAATATCCATCAATTGCTGACGCG
++
+BCCCBFFFFFFFGGGGGGGGGGGGGHHHHHHHHGGGGGGHHHHGGGGGHGHGGGGGGGGGHHHHHGGGGGGGGHHGGHGGHHHHHHHGHGHGGGGGGGFGGGGHGGGHGHHHHHGHHGHHHHHHGHHGHHHGHHHHHHGDGHFHFHHHGGG
+@1187675/1
+TATGGGCACCGATGTGGCGTTAATGTTGGGGATCGCCCATACGCTGGTGGAAAACGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACA
++
+BBBAA?FFBADDGGGGGGEEFFGHHHGHFCGGGGGGGGGHHHHGGFGGHGHHHHHGGEGGGHHGGGHHHHHFGFGGHHHHHHHGGFFGGHGHGEGGGGHHHHGHGGGGGGGGGFDGGHHHHGGHGGGHGGGHGGGGGGDGGGGGGGGGGGE
+@250697/1
+CTTCACGTATGGCTCCAGTTTTATCAACTTTAACCTGCCGCAGTTCTACCAGATAGTGAAAACCGATGGCCGCGCACAGGTGATCCCATTCCGTACGCAGCCTATCAACACCGTGCCGCCAGCAAACCAGGATCATGACGCGCCGCTATTG
++
+CBCCCFCFFFFFGGGGGGDGGGHHHHHHHHHHGHHHHGHGGGGGGHHHHHHHHHHHGHGFHHHGGGGGGHHGGGGGGGHGBGHHHHHHHHHHHHHGGGGGGHHEHHGHHHGGGHHGHGGGCDEHHHHGHEFHHHGHHHHGGGGGCGGGGHH
+@1259222/1
+AGCCAGCCATCAACATGGTGGTGTTATGATGAAATATTTCTGCCAGTTCGCGGATTTTCACCGCAGAAACGCCGCAAATTTCCGCCGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGTCATA
++
+DDCDDFCCFFFFGGGGGGGGGGGHGHHHHHHHHHHHHHHHHHGHHHHHHGGGGGGGHHHHHHGGGGGHHHGGGGGGGGHHHHFGGGGGGGGHHHHGGGGGHHHHGHHGGGGGGGGGGGGGHHHHHHHHHHGHHHHHGGGGGGGGGGGGGGG
+@1267299/1
+TCATTCCAGCACACCAAACATAATTAGTGTGATCCACTAATTAGTTTGCGTATCATTTGTATAATAACCTATTGATCAGGCTAATAACCGCAGTCTATATCAGGGTAAGTCTTTTCGGCGCGTTTTGATATACGCGCTCATACGTTTCGGG
++
+BBBBBFFFBFF@GFFGGFGFGGHHHGHHFGHHHHGHHHGHGHHHHGHHGFGGDAGHHHHHHHHHGFHHHHHHHHHHHHFBFHHHHHHHG@EGGGHHHHHHHGFFHHHHGHHHHGHHCEGCEEEEGGGGHHHHHHGGG?FGHHHGFGHHGGC
+@1287065/1
+CCGCAAATTTCCGCCGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGTCATAACCCGTTGTGCAGCGGGCAAGGAACGCTTCATCCTGCCAACCGTTTTCCACCAGCGTATGGGCGATCCCCA
++
+BBAAA3AFFFFFGGGGGGGFGGHBGDGGEDFGGGHHGE1BFGD?ACEEEFEHHB3?1ECFFG3GDE/>/EEECGGG/EGF43GED/FD/CFF2B<//<@CFGGHA.E?AEF1FB>0GFGFCEGD.GFFFEGG.GE@AFDFEFFGGG.DFGF
+@64231/2
+GTTTTTGCGCCTCCCCACCTCCTTTCTGCCGCAGGAAGATCGGGGCATGTTCACTACGTCTATCCAGCTACCGAGCGGTTCTACGCAACAGCAGACCCTGAAAGTCGTTGAAAAGGTTGAAAACTATTACTTCACCCATGAGAAAGACAA
++
+BABCCCCFCCCCFGGGGGGGGGHHHHHHHGGGGGGC2FAHFDGGGGGHHHHFHHHFHGHHHHHHHHGHHFHHGGGGGGGGGHFHGGGGGHHHHHHHGHHHHEFGHHGGGHFGHFHGHHHHEHHHHHHHHHHHHFBGHGHHHHHHHGBFFG
+@790716/2
+CGCATTGAGTGGGAGCACGTTGTCCCCGCCTGGCAATTCGGTCATCAGCGCCAGTGCTGGCAGGACGGCGGGCGAAAAAACTGCGCTAAAGACCCGGTCTACCGCAAAATGGAAAGCGATATGCATAACCTGCAACCCGCGATTGGCGAAG
++
+BBBBBCFFFFFCGGGGGGGGGGGHGGHGGGGHHGHHHHGDHGGGGHHHHGGGGG3GEGHHGBGGEHFGGGEGGGGGGGFGGHGHGGGGGFGFHHHGGGGGHHBDGGGGFHHEFHHHHGGHDCGGFGGGGGGEFGGGGGGGGAAFFFFFFF-
+@435849/2
+ATGCTAAAGCGACCTTCGTCAGCCGCCGTTTTACTGTTGCTTGCATTCAGACTCTCCTTTTTCTCAAAATTCAGCGGCTGGCTGGTCAGCCACAACGCTGACGCTATTTCTGACTATACGTAACGCGTATGCCGTAACCCTGAACGCCAT
++
+>A1AA3@DFBA1EE1GGAGCGGHF0EAEEA0F2AD2D2FAG1A/A2F2F22BFCGH0AEGGHHBGGHBD1EG1FE//>/>E/0?/0120BFG0F///>///</??ECF2>22FGF1>2B01B0C<CB@/<FG1/CA<.G.FGCG1<.-<C
+@1357272/1
+CCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTGCGGTGAAAATCCGCGAACTGGCAGAAATATTTCATCATAACACCACCATGTTGATGGCTGGCTGGGGA
++
+CDDDCCCCBBCCGGGGGGGGGGGGHHGGHHHGGGGGEGGGGGGGHHHHHHHGGGGGHHHHGGGGGGGGHHHHHGGGGGGGHHHHGGGGGHHHHHHGEFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFE
+@1365117/2
+GTGTTATGATGAAATATTTCTGCCAGTTCGCGGATTTTCACCGCAGAAACGCCGCAAATTTCCGCCGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGTCATAACCCGTTGTGCAGCGGGCAA
++
+BABBCFFFFFFFGGGGGGGGGGHHHHHHHGGGGGGGHHHHHHGGGGGHHHGGGGGGGGHHHHGGGGGGGGGHHHHHGGGGHHHHGHHGEGGGGGGGGGGDHHHHHHHHCHGHHHHHGGGGGD@CGG.CDHHHHHHGEFGGCHGGFGGGGDG
+@696481/1
+GACTACCGCAGTGACCACCCAAAGCCCTTTGATGATTGGCTCTGGCCCCATTTTTTCGTCTTTTACAATGATATTGGCCGCCTTCGGCGCCAGTTCAAACCAGGTTTTGGTGTGCAGCAGCGCGGCCGCCAGGGTGATCAGGTTTAAGAT
++
+BAABBFFDBBBAFGGGGGFGFFAFHHHHHHHHFHHHCFFHFHHFBGHHGGHHHGHGHGHGHGHHHHHHHGFHHHHH3?EEEGGGHHEGGGGGGHHHHHHHFHEGFHHGHCCFFDHHGHHHHGF?FCCDGFGCEDFFHHHHFFCGH:0C0C
+@1388806/1
+GTTGGGGATCGCCCATACGCTGGTGGAAAACGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTG
++
+A>AAADBBAABBGEGGGGGGGGGFGGGHHHHGGGGGGHHGGGHHHHHHGGGGHHHHHHGGGEGGHHHHGEGGFFHHHGHHGGGGGGGGGGGGGHHHHHHHGGHHGGHHHGGGGGGHGGGGGGHHGHGHHGGCFGGHHHGGGGFFFFFFFF
+@1389355/2
+TGGTGGTGTTATGATGAAATATTTCTGCCAGTTCGCGGATTTTCACCGCAGAAACGCCGCAAATTTCCGCCGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGTCATAACCCGTTGTGCAGCG
++
+BBBBBBB@BBFFGGGGGGFGGGHHHHHHHHHHHHGGGGGGGHHHHGHGGGGGHHHGGGGGGGGHHHHGGGGGGGGGHHHGHGGGGHHHHGHHGGGGFDFDGG@EGHHHGHHGFHGGHHHHGGFGGGGGGGG?DGHHHCGHDDGGEDFFGGC
+@1396509/1
+GTGTTATGATGAAATATTTCTGCCAGTTCGCGGATTTTCACCGCAGAAACGCCGCAAATTTCCGCCGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGTCATAACCCGTTGTGCAGCGGGCAA
++
+ABBAAFFFFFFFGGGGGGGGGGHGGHHGHFGGGGGGFFGHHHGGGGEFHFFGGGCEGGGGHEHGGGGGGGGHEHHHGGGGHFHHGHFEGGGGGGGGGGGGHHHHGHHHHHGGHHFHGFDGGGCCCGACEFHHFFHGGHGGGHFGGGCGGA.
+@839282/1
+AAAAACGTGCTGACGCTCCTGCAACAGGGGCAGCTTTCCATTCCGCAGCCGCAGCAACGTCCGGCAACGGATCGGCCATTATTGCCTGCTGAACATAATACGTTGAATCAGTTGGTGACGAAGCTGGCGGCCGCGACCGGCGAGTCAAACA
++
+CCCCCCCFCCCFGGEGGGGGGGHHHHHH2EFGGGFHHHHHHHHGHGGGGHGGGGGHHHGHGGGGGGGHGGGGGEGGGGHHHGHBGGGHHHHHGHHHHHHHHHGHHEFHHHHHGFHDFHHGGG?CHFHGGGGGCDGGGGGGGGGAFGGGGGG
+@1064015/2
+GCAAACGCCGCTCTGGCGCAAGCTGTGGCTCAACGTGATGCCGCAGGATACTGCGGATCTGCCTTTACCAGACCAGTGTGATGCGACCGTTTTCCCGTGGCTTGCCGCGACGCGGACCAGCGAGCAGGCGAATGCCGTTACCACGCCGGAG
++
+CCCBBFCBBCCCGGGGGGGGGGHHHHHHHHFHHHGHHHHHHHGGGGGGHHHHHHGGGGGHHHHHHHHHHHHHGHGHHHHHHHHHGGGGGGGHGHHHGHGGGGHGGHGGGGGGGGGCCCEHHGGGGGGGG?B??FFGGDFFGGGGDDFAFBC
+@614803/2
+GTAAAGAGGAAACTTCTTTTGCCAGCGTAGCCGCATCGGTAATCGTGATAAGTCCGCTCGCCTGATCCAGACGGGCGCAAATATCTTTAAAGTTAAAGGTATGCGGACCCATCAGTACCGGAATCGCATGAGCGGCGGCCTCCAGCGGGTT
++
+ABBBADDFAFFFGGGGGGGGGGHHHGGGGGGHGGGGGGGFHGHHGGHFGHHHHHHGGGGCEGGHHHHHHHHGGGGGGGGGGHHHHHHHHHFHHHHHFHHGHHHHGGGGGGHGGHHHHHHGGGCGHHGGGGGGHCCGGGGG.CEFFGGGGGG
+@1514182/1
+ACATGGTGGTGTTATGATGAAATATTTCTGCCAGTTCGCGGATTTTCACCGCAGAAACGCCGCAAATTTCCGCCGCCCATTCCGCTGTTTTGGCCGTACCGTCGGTCTTGCCCAAAAGATAGTCGGCGAAGCGGTCATAACCCGTTGTGC
++
+BCBCCFFFCBCCGGGGGGGGGGGHHHHHHHGHFHHHHGGGGGGGHHHHHHGGGGGHHHGGGGGGGGHHHHHGGGGGGGGHHHHHGGGGHHHHGHGGGGGGGGGGGGGGHHHHHGGHHHGHHHHHGGGGGGGGGGADGHHHHHHGGGGEDG
+@1514182/2
+GCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGGCCAAAACAGCGGAATGGGCGGCGGAAATTTGCGGCGTTTCTGCGGTGAAAATCCGCGAACTGGCAGAAATATTTCATCATAACACCACCATGT
++
+EEEEEFEDEDDCGGGGGGGGGGGGGGGGGGGHHHHHHHGGHHGGHHHGGGGGGHGGGGGGHFHHHHHGGGGGHHHHGGGGGGGGGHHHHGGGGGGGHHHHGGCDGGGGGGGGGGGGFFFFFFFEFFFFFFFFFFFFFFFFFFFFFFFFFF
+@188790/2
+ATATAACATAGCAAAGGCTATATTCGATGATTAATTAACCACATTGTTGCGAGGGATACTATGACGAATCTACATCGTCTGAAAACACTCCTGCTTGCCGGTATTGTCGCGATACTCGCGCTATCGCCAGCCTATGCAAAAGAGAAATTTA
++
+CCBCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHGHHHHHHHHGGGGGGHHHHHHHGGCGGHGHHHFHHFHHHGHGFHHGHHHHHHHHHHHHGGGGGHHHHGGGGGGGHGGGGGGGGHGGGGGGGHHHHHHHHHHGHHHHHHHH
+@1269745/1
+ATCCTCTCCCGTGAACGTCAGGCTCAGAACGCCGGTATCTTTGCCGGTTTCCGTTACGGTGAGGTTATTTTGCAGGTTATTAATCATGCCAAGCGTTGAGAATTTACTCACCGTAAATTCTGTATCAGGACGGGCGTCAATTGCCTCTAC
++
+ABBBAFFF4BAAGEEGGGGGGGCGHFFHHHGGG?EECFHHHHFFHFFFGGHHGHHGGFGGEFFHCFGHFGHGHGHHFGHHHHHFHHHFDHFHEGEEGGHHHHHHHHHHHG3GFGGDGHGHHHGHHHHHHHHGGGGGGGDGHHFHFFGHHH
+@1394708/1
+TCTCCATCTTATTCCATCAGGTATTCTTCGCGAGAATGTAACCAGCATCATCGGTAACGGTGTTGTGCTGTCTCCGGCCGCGCTGATGAAAGAGATGAAAGAACTGGAAGACCGTGGCATCCCCGTTCGTGAGCGTCTGCTGCTGTCTGAA
++
+BBBBBBFFFFFFGGGGGGGGGGFFFHHHHHGGCECDFHHHHHHHHHHHHHHGGGFHGHGFAAEEHHGHHHFHGHGFCFEG??EGGGHHHDGHHF2E3BGBHH0GGDEGFHHEHGEA/BGHHHHG?GFHGDF0DGGGGGGFHHHHHHHB0DG
+@844461/1
+CCCCGCATATGGGCACCGATGTGGCGTTAATGTTGGGGATCGCCCATACGCTGGTGGAAAACGGTTGGCAGGATGAAGCGTTCCTTGCCCGCTGCACAACGGGTTATGACCGCTTCGCCGACTATCTTTTGGGCAAGACCGACGGTACGG
++
+BBBBBBDBBFFFFFCEGAFGGGHHHGFGGFHHHHHGGGGGGGGGGGHHFFGGGGHHGFFGHHGGGGGGHHDGEFFHHHHGGGGGHHFHFFEGGEGFHHHGFBDGFHHFGHHGGGGGGGGGCCGGFGGHHGFCAGGFGGHHGGGGGDADGG
+@82896/2
+ATACACACATCAAAACCCTGCGCGCTAAGCTACGCGCGATCAACCCGGATCTCTCGCCAATTAACACGCATCGTGGAATGGGATACAGCCTGAGGAGCGTCTGATGCGCATCGGAATGCGTTTGCTACTGGGCTACTTTCTTATTGTCGC
++
+BBBBBFFBBFFFGBFFGGGGGGGGGGGGGCHHHGGGGGFGGGHHHGGGGGGHHHHCFGGGHHFHHHHGGGFGGHHGGDGFGHFGHHHHHHHGHHGGDHGGGGGFFFHGGGGGGGGGGHHGEGGGGGHHHFHHHFAHHGHHHHBGHGCGCH
+@822123/2
+TTACAGGATTATGCGATGTCTTCTATGTTACCGTCAATCAGCCCGGAACTGGCCCGTATCGCTCCCGGCTTTCGTGCATTAAGTATTAATGTTATTGCCGCTCCGATTCGCGATGCGCAGGTCGGAGAAATCGCGCTAAAAGAGGC
++
+BBBBBFFFFFFFGGGGGGGGGGHHHHHHHHHHGGGGGHHGBGHFEGGGGHHGHHHGGGHHGGHHGGCCGGGFHGGGGHHHGHG4BGGFHGHHHHHGFHHGGGGGGFGEFEDGF?C?FD@?DCGCCFGFHHHHGGGGGGGHFHEBAD
+@1502311/2
+ATATCTACCTGCTATCTGAACTGGAAAACAGCCAGGAGCTGGATGCGTTTGTTGATATTACGCCAGATAATCTTTTGCATCGGATTCAGGCGGACATCCTTGAACTGGAAAGCCATGCGGTGGCGGGCGTAAATCTTGAGGAGTATTCGCG
++
+1A1A1DF1@DFCFGG1FG33GF1111B00AFFGAFEHGH0FGGFFH/EEGFH002G2DF2FAEC??GFFEHHFHEH1FGGFEE?EGFGH10/////F1BB2FB1GDGBBF1000FGC1//?//FC//---<<.D00D0DGFFCF/GFF/?-
+@118152/1
+GCCATGGATAATGCAATTTTAGAGACGATTTTACAGCGCGTTCGCCCCCTCATTGGCCAGGGCAAAGTCGCTGACTATATTCCGGCATTAGCGTCCGTCGAGGGTTCAAAGCTGGGAATAGCGATTTGTACCGTGGACGGGCAGCATTAT
++
+AAAAAFFB13BDFFGEFFFFGCA111AAFFFHHGFE1AEEEEFGGCGCE/EGHH2AFGBAG?EFFAF1@?>EF?GHH1GFDFGF/EEEF1FGEAEEC/BE<@@C<BGFG2FGHC<?CCCGDBC?GAFGHGHHGCG??G@CCCG<CHFGDD
+@1368561/1
+GGTCATGTATCAGCCTGGCATCATATTTCTCTTTTCCGGCCATAAAATTGGCTATATTAACAAGCGCAAGTTTCGTTATGACGCTAATGAATATCTCTTACTGACCGTGCCGCTCCCTTTTGAATGCGAGACCTGGGCGAAGCCGGAGGTA
++
+BABBBFFFFFFFGGGGGGGGFFHHGHHFHFHFHHHGHGGGGGHHHHHHHHHHHGHHHGGHHHHHGGGGGGGGHHGHHHHHHHGGGGGGHHHGHHHFFGHHFHGFGHGGEEGGGFGGGHHHHHGGHHHGGCGGGHGCFHGGGCGHGGCGGCG
+@487094/2
+CGTATAAACTTATTCTGATATTCAGGAACAATTTAAATGTCTATCACTAAAGATCAAATCATTGAAGCAGTATCCGCTATGTCCGTAATGGACGTTGTAGAACTGATTTCTGCAATGGAAGAAAAATTCGGTGTTTCCGCTGCTGCTG
++
+A11>113@D31BDGBBG3F3F33B311F0G01AF331F3A3AB2FE2FHB11B1BFFD2AGBFHGB1110AFE2DA////1A22B/0A/2111>/?F/B22B1@GHFFHHF21FEDFF1E0>FGCF0@F/0?EE/>F2/E?EE11111
+@1425233/2
+CACTATGAGCAAGCAACAGGTTAGAGTGTCTATGTTTCGTAAAGTTCCGTTACGCATTTGTTTTTGTTTGTCATGTTGTAGACAGGTCTTATCTTCCATTATAAGTCTACAGATGCTGAACAACGAACTATCTGTACAGAAATGCCCATTT
++
+A>>A?DFFFFF11AAGF1BFBBGFDEDB3D3F3DFE3FEA0F0ABGBDEFHE/BE?EEBH2FGGGGFCFFCGFGFFHFFHE@FF>/BB1FFBDGHHHGFG22BEGDEFG1GG1BGF1FBFFF0>>/?>F1211>B2BF2GB1E1D1B1FDF
+@1045727/2
+AGCCGGGAGACGGAGCCAAAAAAGGGGTTTTCCGCAGGATTGTCGGCATGAGTGAAAATCGCGGCAATCTCATATCCTGCATCCAGTACGGCCTGCACGCCCTGACATCCCATATCGTGATAGGCAAAAATAACGGCTTTCATTGGTGA
++
+1AAA@DDDDAAAG0?EEGFG0FAE?/AA/E/GFEFG/EGCGGEFE?EGEHFHFGHHHFGHFFC/EC?1F11GHBHHHFGHHHHHGHFHHFGCCA<GHGCC/BCFHHBFHHCHFHFFA0?00FBGHHCFGGHHHHGCGCGHFDGFH0=CG
+@162070/2
+CCCATTGGTAAAATGCGGCGATTTTTCTCGATCACGCCCGGTTCTTTGGTCAACTGACCGTTATCGTCGAAACCGCCGTCCACCGGCAGTTCGCGGCCCGCCAGACGGTTAACTTCTAACATCCCGTAGGAGAACATCGACATCGACATAT
++
+BCBCCFFFFFFFGGGGGGGGGGHGHHFHHGHHHGHGHGGGGEGGHGGHHHHHHHHHGHHGGGGHHHHHGGGGGHGGGGGGGGHHGGGGGHHHGGGGGGGFGGGGHFCC?EGHGHHHHHGHHHHHHGCFGGGHHHHHHHGGGGDF?:?DGGB
+@1482518/2
+ATCATGTCCAGCACAATCGACAGACCAGATCCTTTCCAGTAACCCATTGGTAAAATGCGGCGATTTTTCTCGATCACGCCCGGTTCTTTGGTCAACTGACCGTTATCGTCGAAACCGCCGTCCACCGGCAGTTCGCGGCCCGCCAGACGGT
++
+CCC@BFFFFFFFGGGGGGGGGGGHHHHGHHFHHHHHHHHHHHHGGGHHHEFGFHHHHHGGGGGGGGFFHHHGHGHGHGEEEEGEGGHHGHHGFHHGHEFHEFEGGHHHHHGGGGGGGGGGA@FGHHGCGGG0FDEFGGGGG?????FE?..
+@960492/1
+GTTCGCTGACCGCGCCATGCTGCGCCAGAGTCTCTTCACGCACGCCAATCATCTGCGCTTTGGCTTCATTACTATAGGTGACAAAGCCGCGTTCAAACCAGGCGGAACTTCCGGCGATGTCGGTAATGGCTTTCGCCAGCCAGCCGCCGGT
++
+BBCC?DBABFFCGGGGGGGGGGHGGGGGHHHHHHHHHHHHHGGGGFGGHHGHHHHGGGGGGEHHHHHHHHHHHHHHHHHHHHHHHHGHGGGGGGHHHHGHHGHGGGGGFHHHGGGFGGGHHHGCEGHHGHHHHHGGGGGGGHHGGGGGGG-
+@127404/1
+GTTCAGAATGTAAGACTCAAGCATGGTATCGAAGGCGATACCGCGCAGCTCAATACCGTAATTTTGCAAGACGCCGCGATCGTACTTGAGGTTTTGCCCCACTTTGCGCACTTTTTCATCTTCCAGCAGCGGCTTCAGCAGTTCCAGAGCA
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHGHHGGHGGGGGHGGGGGGGHHHHHHHHGGHGGHHHHHHHHHHGGGGGGGGGGHHHHHHHHHHHHGHHHHGGGHHHHHGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHHF
+@103791/1
+ATGTTGCTCTATGGCATTGCCGATCTCGCCTTTGTTGGTGGTTCGCTGGTTGAACGCGGCGGTCATAACCCGCTGGAGGCCGCCGCTCATGCGATTCCGGTACTGATGGGGCCGCATACCTTTAACTTTAAAGATATTTGCGCCCGTCTGG
++
+AA?1ABD1FFB3BFAG1ABDG1EE0F3EF000BDGFGHAFEEAH?EFFC0BEFHFHG//?EC//?2BF1B///E@?AG/<CB/<BC?C/F1D/AG/B10<--.1>1111...<C--:C0CGGFCCCC0GC00:09000BBB-:AA-;.CEB
+@408024/2
+TCCCCAGATCCTGCGCCATCGGCGTCAACAGACTAACGGGCAAAAACTCAACGGTAATCAGGCAGGCGACACAAAACGCCACGGCAAAAACGGCTGACCAGTTAGGCCTGGCAACCCCATCAGCGCGGAATTTTTCTGCGATATTTTCATT
++
+AAABBFB@FFFFGG?EGGGGFGGGFGFGHHHGHHHGGGFDGFGHGFGHHHHHGGGHGHHHHGHHGGGGGGGGHGHHHGGGGGFGGGGFHHGGGFGCHHFHG?GHH0FGFEHHGHHGGGGEHFHHGGGGCGGGGHFHHGHGGGCFGGGFGGG
+@1092315/1
+ACTTAACACCAGCGAGTAATCGCGGTTGAGCGCGCCATTAACGAAAAGCTGCCCAATGCCCGGTAAGCCATAAATAGTTTCAATCACCATTGAGCCGGTAATAATGCCGACAAAGGCTGGCCCCATATAGGATAAAACCGGCAGCAGCGCA
++
+BBBBBFFFFBBFFGGEEGGGGGGGGEEFHHGGGGGGGGGHHHGDFGFHHHHFHHHHHGGFFEG>EGGHHGHGEBFHHBEGGHGHHEHHHHHHHHG3<>ECGHHBGFHFGGGGGHHHHHHGGHHGGGHGHHHHHEHHHHGGGGGG?GHHGGG
+@1398298/1
+AAATAATATGGTCAGCGCCCCGACTAAAATGGTCAAAATTAACACCAGCGAGTAATCGCGGTTGAGCGCGCCATTAACGAAAAGCTGCCCAATGCCCGGTAAGCCATAAATAGTTTCAATCACCATTGAGCCGGTAATAATGCCGACAAAG
++
+ABA?AFDDF5BFF54GEEGC22AEE23AAFAGFFGFF3BAFB5GB1GHGGEGGHHFDE1E010>33G/>E@EDGHHHHFE/EEBFBGCFGHEFGHH3<C</?DFGFHHHEGHD2FD2>GFFFGCFHHHFHFFCC@<FD1>GF1G-ACCDHB
+@150357/2
+CCCATCGCCTGTGCGATGCGAGCAAAACGCGCGACGGCGTTCGGACGGTTAAAGTTCTCGACAATTGGCAGCAGGATAGCGTTGCAGACGCCGTGCGGCAGATTGAGGGTTGCGCCCGGCTGGTGCGCCAGCGCGTGAACCAGCCCCAAA
++
+>>11A11>AAAFCGGCGEFGAAEAFGHGG?EE/A?EE@EGGGGGEEC?EFGHFGHEBFEFFGG/GFFFB1EEHHHGC1<>BGF/CHFEACCC@ACFG@C-@EEHH00G.<CCFGCE@-:-??BBFF9;AB?A-;;--;-F-----;-ABF
+@42776/1
+GATATCAACATGCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCG
++
+?ABBBFDDFFFFFGG4C4E2EEEGGHGHHHHGGADGBGHFHHHHHHHHGFE5GHFHHCEEEGGHBFHGFGGH?BECHHHBFGFEFFG33GDFH??/@@E/@@?C/@CGGBDFFFGDGCHGHF10/?<EGHGGCACA.<>CGC@AG.EAD?
+@1372312/1
+GAGACATAAAGAACACGCTCTTGATGTTCAGGTTCATGACGTCATCCCAGTCTTTTTCCGTGAAATCAATCGCATCTTCACGACGGATCAAACCCGCGTTATTCACCAGAATATCAATATGACCGTATTCCGCCACCGCCCGTTCCAGTAG
++
+BCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHGGGGHHHHHHHHHHHHHHHGHGGGHHHHGHHGGGGGHHHHHGGGGGEGGHHHHGGGGGGGGHHGHHHHHGHHHHHHHHHHHHHHGGHHHHHHFGGGHGGGGGGHHHHGHHF
+@60420/2
+ATTCACGCCTGGACATCTGCCCGGCTCAACTTCCTGGCGCGTAACGCTCCGCAACGGCAAGACGCTAATTTACGCAGATAGTCTCGCCACGCCCGACTATCTGCTGATTAACAACAAAAATTACCCTGACCTGGTTACTAATATTCAGAG
++
+@BCCCFCFCFBCGGGGGGGGGGGGGGGGHHHHFHHHHHGGGGGGFGGGGGGGGFGGGGGGGHHGGGGGHHHHHGGFGGGFHHHHGHGGGGEGGGGGGGGHHGHHHHEHHHHHHHGHHHHGHHHHHHHGHHGHHHGHHHHHHHHHHFDGEB
+@69433/2
+CGCCTGGACATCTGCCCGGCTCAACTTCCTGGCGCGTAACGCTCCGCAACGGCAAGACGCTAATTTACGCAGATAGTCTCGCCACGCCCGACTATCTGCTGATTAACAACAAAAATTACCCTGACCTGGTTACTAATATTCAGAGCAGCTT
++
+?ABBAAAFFFFFGGGGACGE2AB4FGHHHDHHHGGEEGE11E1EE11AEC0>EEGGHHEGG1EHHFB4FGFEEGEGHHFGHGGGGEGE@E//BCHGFFB1FDGGFFFDDFHE0GGHGFHHGHEHHFF0<>>11<FGHHHHHBFD0CHBGHG
+@610880/2
+CCGCGTAGCCTACCCAACTATACGCATCACCCATCCGCTCGATCGTTGCCATCATCGAAGCATAGGTATCGGAAATCGCGCCGTTGATGCCGTAAACCTCAGACATTTTCGCCACCACCGGTTTAAAGGTGCTGGTCAGAATGCCGGACC
++
+BBBBBBBBBFFFGGGGGGGGGGHHGGGGHHHHGHHHFGAFGGHHGFHHGHHHHHHHHHFGGHHHHHGGHHDEEEGHHGGCGEGEFGHGHHHGEGEGHHGHHGGHHHHHGHGGGGGHHHGGG@EGGHHHH1FHHGGHHGHEHHHHHGCGGG
+@135228/1
+CAGAAGCACGAATCCTCTCTCGCTAACGGCCATTCATTAATTCAGACAATGAATATCCGTGTCGAGAATCCGAACCTCAATAATATGGCTATCCAGGATGTGCCGATCCTGAACAGCGATAAAATCATTTGCTCACGCCTGAAACGCAATG
++
+BBBBBFFFFBBBGGGGGGFE4EAFGDHFGFGGCHFFHHHHHCHHHHHHHHHHGHHGHHGFGHFDGEHDFFFGGGG@2GGHHFHGGHHFHFFHEGHHGEFHHHGHGGGEFHHHHHGBFEGGGEFDDBF?GHFHHGH2A0CGH2FFGEGGGDF
+@785356/2
+AGCAACGCTTTCGTAACGTTTGGCCGGGCAATACACCGCCCGGCTCCGATTTTTGCCTGATAATTATCCAATTACACATTATTTCATTTCCCGCTAGTGGCGCACGAATTGAATTGGTTTACACTGCGGTCTCTACGCATGTTGCAGGGAA
++
+B@BAAFDBBBBFGFGAEEGGGGGHHGEGGGGGHHHHHGGGGGCGGGGGF?EGHGGHHHHHHHGHHHHHHHHHHHHHHGHHHHHHHHHGHHBGEGECGHHGGGGCCCGAGHHFFGHGFFFHHHHHHGHGGGGGGHHHGGGGGHHEHFHHGGG
+@93492/2
+GCTGTCGTTTCTCCAGTAGCCCGAAGCGGTCACCTTTGTTGGCAATAAAGATATCAACATGCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGG
++
+BBCCCFCCCCFFGGGGGGGGGGGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGHHHHHGHFHHHHHGHHHHHHHHHHHHHHGHHHHHGGGGGACC
+@104990/2
+CAGATAGTCTCGCCACGCCCGACTATCTGCTGATTAACAACAAAAATTACCCTGACATGGTTACTAATATTCAGAGCAGCTTTAAGACACTGGCTGCCCAGCATGTTGATATCTTTATTGCCAAAAAAGGTGACCGCTTCGGGCTACTGGA
++
+AA11A1F3@DFF1AFGGC0AEEA0AAGHGH1111DG11FF/A/A0/0F1G10FGHB12F0BDGGGGFFG22D2DFFFGF0FFGBD1D1FGHFFE0??BC1/0>11B22@22B1BDGH2EB1F1>0//>//1B11FCCGAC/EEG@00?F10
+@667480/2
+TCGCGGATCTGGTCGCGATCCTCTCCCGTGAACGTCAGGCTCAGAACGCCGGTATCTTTGCCGGTTTCCGTTACGGTGAGGTTATTTTGCAGGTTATTAAT
++
+BBBCCCBCCFFFGGGGGGGGGGHHHHHGHGGGHHHHGGGHHGHHHHHGGGGGEGGHHHHHHHGGGGGHHGHHGGGG?GFHHHHHHHHHHGHHHGHHHHHGH
+@175163/1
+GATGAAAAGCAACACGCCGCTCAACGTGCTGGCGCTCAACCAGCCGGAAACGGTACGTAGCTTCCCTAATATCTGCTATTTCGCGCTCTCTCCAGAAGATGAAGCCCGTGATGCGGCGCATCATATTTATGACCAGGGCAAGCAGTCGCCG
++
+BABBBFFFFFFFGGGECFGGEGGHHGHHHGHHGGGGGGHHHGHHGGGGGGHGGGHGGHGHGHHHHHHGHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHGHHFGHHFHGDGGHHHGGGGGGGGHHHHGHHHHHHHHGG?.EGGHHGHHGGGC
+@152824/2
+ATTCACGCCTGGACATCTGCCCGGCTCAACTTCCTGGCGCGTAACGCTCCGCAACGGCAAGACGCTAATTTACGCAGATAGTCTCGCCACGCCCGACTATCTGCTGATTAACAACAAAAATTACCCTGACCTGGTTACTAATATTCAGAG
++
+BBBBCFCFBFCCGGGGGGGGGGGGGGGHHHHGGHHHHHGGGGGGGGGGGGGGGGGGGGGGGHHGGGGGHHHHHGGGGGHHHHHHHHGGGGGGGGGGGGGHHHHHHHHHHGGHFHHHHHHHHHHHHGHHGHFHGHHHEHHHHHHHHHHHHH
+@1404989/1
+ATCTGAAAGGGTTTCGGTTCCGGACTTTCTCCGGCAAAAACAGCGGGTATCGGCGGCGCCGTCTCAAACCGTAGAGCGTTGCTCACAAACGTGCCTGCCTGGCCACGTCGCTCCAGCCAGCCCTGCGCCACCAGCTCGCCATAGGCATTTT
++
+BBBCCFFFFFCFGGGGGGGGFGCFGGHHHHHHGGGFEHHHGHHHGGGGGHHGGGGGGGCEGGGHHGFHBFGAHGGHGG/</CGHHHBDHEDGHFGFGFHB<GFGFFGGH?@AEECCBC:CEGGGFH--C..CAAAFF??B.A00CFBBFGG
+@434303/2
+CGCCAGTGCGTTCACACATCAACAGGGAACGTCGCTGGCGCTACGGCTATTGCCCGAGCGTTGTCCTGATCTGGCGGAAATCCAGACGCCGCCGATAGTACCCGCACTGCTTGCCAGCGAGAACGGACTGATTCTGGTCACTGGCGCCA
++
+CDDDCDFFFCCCGGGGGGGGGGHHHHGGHGGGHGGGGGGGGGGGGGGGGHHHHHHGGGGGGGGGHHHHGHHHHHHGGGGGHHHHHHGGGGGGGGGGGGHHHHHGGGGGHHHHHHHHGGGGGGGHGGGGGHGHHHHHHHHHGGGGGGGGG
+@217316/2
+GTCTCGCCACGCCCGACTATCTGCTGATTAACAACAAAAATTACCCTGACCTGGTTACTAATATTCAGAGCAGCTTTAAGACACTGGCCGCCCAGCATGTTGATATCTTTATTGCCAACAAAGGTGACCGCTTCGGGCTACTGGAGAAACG
++
+BABABFADAADBGGFGCGGGGGHHHHFHFFHHGGHHGFCHAEHFFHGECCGHFHGFGHHHHGHHHHHGHHGHHHHHHHHHHGFHFFHFFFCCEGGHFHGHGHHHGGFHHGHHFHHHFHGEEGFFGFHF3CFG/CDGGGGHHHHGFFHHHGG
+@1230247/1
+TCCTTTCCAGTAACCCATTGGTAAAATGCGGCGATTTTTCTCGATCACGCCCGGTTCTTTGGTCAACTGACCGTTATCGTCGAAACCGCCGTCCACCGGCAGTTCGCGGCCCGCCCGACGGTTAACTTCTAACATCCCGTAGGAGAACAT
++
+BBBBAFFFFBFFGGFGGGGGFFF5FGHDGFEECGGHGHHHFHGFEGGHFHEGGCEEFFHGFBGGFHHGHHHHGFGGEGHGHEEGGGHEGECEEEDHHBCBD?FGHGCC@C-CGGG-<-ACCDGGHHHHHGFFGGGGGG?FBD?FFGFGGF
+@256885/2
+CTCCAGTAGCCCGAAGCGGTCACCTTTGTTGGCAATAAAGATATCAACATGCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCGGATAGTCGGGCGTGGCGAGACTAT
++
+BBBBBFFBFFFFGGEEGGGGAEHCGFHFHHHHGHHHHHHGFHHGFHHHFFFHFFGGHEEFFGEBFHGFHHEFFG@GHGFHHGHH4FGFGHHHHEHHFGHHHFHGHFHHHGGGHHHFGHFHFGFH/>CDDFGHEFGGC@DGGFGGGCFGH
+@862769/2
+ATCTACATCGACGCTCACTTCGCGCTTGGCCGTATCACTGTACTCTTTTGCCGTTTTCATCTTCACTACCTCACGGGTTCCTGACAGCCTAAGTATAGACCGTTGAGAAAACCAGCAAACACGCCGGCAAGGCGCTGTCAGACGCAGAAAA
++
+AABCAFFFFCFCGGGGGGGGGGGGGGGGGGHGGGHGHGHHHHHHHHHHHHEGGEGHGHHHHHHHHHHHHHHHHHHGGFFHHHGFHHHHHHHHHHHHHGHHHGGGGHHGHGHHGGGHHHHHHHGGGGGF?@FGGGGGGEFDGHHGGGGGHHH
+@305222/1
+GCGTTATATCGTCACAGACAGCGCCTCAGGGCGCTGTTTTCGATCGGACATGTCGCTTTCGCAGGAGGGGACGTTATTCGGCGACCAGCCACATATCAGCCTCTTCAAACATCTCTTCCAGCATACGGTGCAGCCGTTCTTTCTCGGTTTT
++
+DDDDCCCFFFDFGGGGGGGGGGGGGGGHHHHGGGGGGHHHHGGHHGGGGGHHHHHHGHGHGGGGGGGGGGGGGGGHHHHHHGGGGGGHHGHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHGHHGHHHECGGHGHHHHHGGDGGG
+@359617/2
+AAATTACCCTGACCTGGTTACTAATATTCAGAGCAGCTTTAAGACACTGGCCGCCCAGCATGTTGATATCTTTATTGCCAACAAAGGTGACCGCTTCGGGCTACTGGAGAAACGACAGCAACTTCGCAACGGCGATACACAGGCATTCTTT
++
+3AAAAFFFFFFBBFGGGBFGCGBGBEGFHHGHHHHFHHCFDEDGHHHHFEHHEECEGHHHGHHHBGHEHDHFHFHHHHFHFFCFEF2BGFG@>EEEEG?ECCGGGFHFACCGFG<EE</0FFFG2?ADG///B@CGDGFHFGAACGFFHFD
+@359733/2
+TCAACATGCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAGG
++
+CBCCCFFFFFFFGGGGGGGGGGHHHHHHGHHHHGHHHHHHHHHHGHHHHHHHHGFHHHHHCGHGHHHHGHHHHHGHHHHGHHGHGHHHHCFCGGGGGGGGGGGHHGHHHHFGGGHHHHFHGGGGGHGHGGGGGGG-CCFGFGGGGGGGDFH
+@415286/1
+GTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAGGAAGTTGAGCCGGGCAGATGT
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHGHHHHHHFGHHHHHHGHHHHHHHHHHHHHHHHHHHHCGGGGFGGGGGGGGHHHHHHHGGGGHHHHHHGGGGGHHHGGGGGGDFGGGGGGGGGGGGGGHGGHHHHHHHHGGGGGGGHHH
+@372771/1
+GGTAAAGTGACTATCGCCGATGTAGCCCAACTTGCCGGTGTAGGCACGATGACCGTATCACGAGCCTTACGCACGCCGGAACAGGTCTCTGATAAACTCCGGGAAAAAATCGAAGCGGCAGTGCATGAGCTGGGCTATATGCCTAATCTCG
++
+A?AAAF33B33DDGFCACE?EAAA3BAEE0EFHDBAA/AEAFFGHHGCEC/EFHAE/BAGFEF@/>B1FH/?EEE/?>E?>E0F/1CG1BGDD2BD1GE1BCGGCEHHGAF?0FF?A/>-A<F1GFGGBGF/<..CGHHF00<DCFBGHH.
+@973668/1
+ACTAAGGAGGCATTCAGTGCGGATTCATATTCTCTTTGACCTCAATTTCCCTGGTCAGTTTCCCCATTCGTCCAGAAATGCTCCCTGCGCTCCGCCATGCGCACTAATTGTTCACAAGGCGCGTAACGAGGACCGTAAAGTGCGGCCAGG
++
+AABAABFDABBAGGFGGGFFEGEE2GGHFHHHHHFFGHHCHHHFHDGGHFGHHHFHHFHHGGEHFHHFHHHGGGHHHFHHHHEGGHGHCG?>EEGGGFFHEFFGGHHFHHGHFHHHGGHHGGFDGDGDEGCGHHGFHGEFHFGGGGGGHH
+@455190/1
+GAATCAAAGAATGCCTGTGTATCGCCGTTGCGAAGTTGCTGTCGTTTCTCCAGTAGCCCGAAGCGGTCACCTTTGTTGGCAATAAAGATATCAACATGCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGT
++
+AAAABFFD5CCFGFGGGDGGGFFGEAEEE?FEEEGFDBHFHFG2FEFFHHHFHFHH5FH?EC000EEE>GHEHHHHHFABB3F3FGFHHEHFHHFFHFHFHBEHGGGGCFHGGHDGHGHHBHHHBGHF11?FGHBDFFFDGFHGFCFG0G<
+@456389/2
+ACGCTAATTTACGCAGATAGTCTCGCCACGCCCGACTATCTGCTGATTAACAACAAAAATTACCCTGACCTGGTTACTAATATTCAGAGCAGCTTTAAGACACTGGCCGCCCAGCATGTTGATATCTTTATTGCCAACAAAGGTGACCG
++
+3AAAAAADFFFFA22E2AB5GGFFA2AE222AE22AAAAGFGGFC5BAA5F5FGCEFA1BEFHHBFHG3?@GA3FDFBFEG44GHH4@GFH3CF3GFE3FGFHEF1FFG?EE?GFB3BF4GFHHGHHFHB2BDDGG1FF/F00@FFHH/
+@1451600/2
+GTGTATCAACACGCCAGTTGGTATAACGAGCGCCGAGAATCAGATGCAGCGGGTCGGCCAGCGAAATGCGCGTAGCGGCATACAGCGATTTCATATGCGTGGTATCGTCCTGCGCCAGATTTTGTGGCGCCCAGTGGGATTGGGGGAAATT
++
+1>A1AFFFFFFAGGFEEGGGFGGFHHBAC?EECEGGGGGGHGHGGBGFGCE?E>EECEEGHGCGECFGEGGGEEEEECCGGHHFHFGGHFGB<FGGFHG//A?BGGC<GCCBFCCGCCFDGHFB//CGGA-AC.:<BE.;BFFE-??AEFG
+@456952/2
+ATTCACGCCTGGACATCTGCCCGGCTCAACTTCCTGGCGCGTAACGCTCCGCAACGGCAAGACGCTAATTTACGCAGATAGTCTCGCCACGCCCGACTATCTGCTGATTAACAACAAAAATTACCCTGACCTGGTTACTAATATTCAGAG
++
+AABBBFBFBFBBGGFGGGGBEGEGGGGFFHHHHFHHHCGGGGGDFGGGGGGFGEGGGGGGGHGEEFGDGGHHHFFGGEHGHHHHHFGGGGGCFGCCG?CHHGGHGGFHFHHGHHHHHHHHHHHHGGHGHHHHFHHHFFFHHHGHHEHGHG
+@58334/2
+ACGCCAGGCTATTCGCGTGGAGGGCGATACATTACCGTCCTCGAAAGGAGTGCTGTGATGAACGTCGTCATCCTTGACACCGGCTGCGCCAATTTAAGCTCGGTAAAATCCGCCGTGGCGCGCCACGGTTACACCCCGGTGGTCAGCCGCG
++
+AABBBBCCCFFFGGGGGGGGGGGGDGEAEGFHHHHHGGGGGHGGGGEGFHHHHHHHHFHHHHFHHEGFFHHGHHHHHHHHGGGEGGG@FFGGHHHHHHHHHGGFAFHHHHHGGGGGGGFGGGGDGGGGGFGHHHHGGGGCCGDFGGGGGGC
+@1317701/1
+GTTTCATTCAGCGTAGCGCCGCAATACTGCTTGACCAGCCAGAACAGGGAATCGGTCACGATCGTGCAGCCAATGGCGCCGGAACCAATGGCAATCGCAATGATCTCCGGGCTGACGTCAGGATAGAGCGGCAGCATGGGCGCAACAATCG
++
+BBBBBFFD5BF5EFGGGGGGGGGGGHHHGGHHHGHHHFHGHHHHHFHHGGGHHGFEGGHGFHHGHHGHEHHHHGGEFGGGCGGGCFFHGHHGHHHHGGGDDHHHHHHHGGCCCFHFDGAGGHGFHCGFGGCGGCFFFHECCDCG?DHHBFC
+@246013/2
+GTATAGAGGGGATCAGGCGAATTTTTGGCGTCCAGTCCTCGCCTTGTAGTCCGTTACCCCGGCTGATAGCCCTGGCCAGTTTACCGTTTTGATAAACCAGTGTTACCGCTACGCCATCCACTTTTGGTTGTACCCAAAGCTCGCTGCGCC
++
+BBABAFFFFADBGGGG442EEEHHHFGGHCGCGGGHHHGHGGGGGHHHHHFFEGHGEFGEGGGGGHHGHHGGHFHHHHHHHGHHGGF?EFHEGF4FF3FCFHFDGHFGGGGGDDGGGHHHHHEHHF?GC/DGGHFHHGFHBBDFGGDGGD
+@103354/1
+ATATGGAGGAGATCCTGCCGCCATACTCACAGCCAATGTACACCGTCGCCAGCAGAATTAGCGCCGACTCCGCAGGCAGATGCAACGCAAAGGCCAGCGGCAGTAAGATTGCCACGCCGTTGATCGGTCCCAGGCCCGGCAGCAGACCGA
++
+BBBBBFFFB@AAGGGGGGGGGGGGHFHGFHHGCFHHHHHHGHHHCHGGGGGGGHHHHGHHHEGGGGGGGGHGGGGGGHGGGHHHHHGGGGGHFHHAGGGGGGG<FGHFGHHHFFHD?FGDGFHHHFGGDCHHHGHGGGGGGGGHHF9ECF
+@124355/1
+CCCTAATTAGGGGCGTAGTTCAATTGGTAGAGCACCGGTCTCCAAAACCGGGTGTTGGGAGTTCGAGTCTCTCCGCCCCTGCCAGAAATAATCCTTAGCATCTGCTAAGGATTTTTTTTTGCCTAAAATTACCTGATTATCTGATCAGGTA
++
+CCCBCFFFFFFFFGGEEEFGFGHHGHHFGFCHHGHHGGGGGHHHHHFHGGGGFEGGGHGHGGHFGGFHGHHGHHGGGGCEFFHHHHHHFFBFHHHHHEHFGHHHHFFGHHDGHGFH?DFGGHHHFFH1GHFFHHG0DGBGFHGHGGFHH0=
+@671511/2
+AGCCAGGTCTGGATGCCGACCTGACCCTCTTTACGCTTAAACGCCAGCCCACCGTGTTGGTAGACGCGGAAAACGACAGCTTACAGGCTGAAGAATTGCTGACGCCGCTTGCCGCGATACGCGCAGGCAAGGGCTATATGACCGAACAAGG
++
+BABBBFBFFFFFGGGGGGCEGGHFHGHHGHHHHGGFGGGGGHGGGGGGEEHGEEGGHGHHEHHHHGGCECFCCGECEFGE?3FHGF3FGH0BFBGHHGHHEFHDDGDCD/<?F<CCF@?D.E@CCCFDAAEECEGFHCGFGGGGGGC-/CE
+@1309949/1
+ATCAATGTCTGATGGCGCTGCGCTTATCAGGCCTACCAGCCGAGTGCTTATGTAGGCCTGATAAGGTAAAGCCGCCATCCGGCATTTATGCTGTGGAGGGTAAGAAAGTAGTATCCCCGGCAACCTTAAACATCGCCCTCCAGCTCCGCGT
++
+CCCCCFFFFFFFFGGGGGGGGGGGGGHHHHHHGHHHHHHHGGGGGHHHHHHHHHHHHHHGHHHHHHHHHHHHHGGGGGHHGGGGGHHHHHHHHHHHHHGGEHHHHHHHHHHFHHHHHGGGGGGHGHHHHHHHHHGGGGGHGHHHHHHGGG<
+@841285/2
+TCATATGCGTGGTATCGTCCTGCGCCAGATTTTGTGGCGCCCAGTGGGTTTGGGGGAAATTACCGTTAAAGGCGCTGAAGTTGCCAATGTCGTCCGGAAAGACGTTCGCCCAGGCGCTAAAATAGCGGTTATTCTGTTTACTATAACTGC
++
+1A>A1BFBAAA1EDGGGEAFFGHGG?E?0FHGFFHCGAE?EGFHFFCG?EFGAFGGGFHHEHHBEGGC/D1EG/EEC/1FGHGHFBBCGFGGFF/ECC?CCGFCFEGGGC/EGFEGGC?AFFFHHFCCFGGFGGGHD0DFHBFHHHHFHE
+@631069/2
+GCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAGGAAGTTGAGCCGGGCAGATGTCCAGGCGTGAAT
++
+BBCCBFFFFFFFGGGGGGGGGGHHHHHHFGHHHHHHGHHHHHHHHHHGEFHHHHHHHGGGGGEGGGGGGGGHHHFHGGGGGGHHHHHGGGGGGHHHGGEGGGGECGGDDGGGGGGGGGHGGHGGHHHBHGGGGGG.GHBGGFHFHGGGDE0
+@107156/1
+ATGCAATGGCGCGCATTATGGCCTGCCGGCCCATCGTCTCCCTCAACCGCCAGGAAGCCATCATCGCTGCGGAACGCGCCGGGCTTGCGACCGATACGCGCACTTTCGGCGAAGCATGGGTAAAACGCTTTTCCGCGCCGCTGGTGGTGCG
++
+BBBBBFFFFFBAEGGGGGGGGGHHFGHGGGGEGHGGHHGHHHHHHHHHGGFGGGHHHHHHHHHHHHGHGGGGGGGGGCGGGGGGFFGHG?CCGCGGGGGGGGGCGHHGGGGGGGGGGGGGFBFGGFGGGGGGFFDFFFFFFFFFFFFFFFA
+@124165/2
+CTCTTGCGGATCGGCCTGGAAGTTCGACCAGATATCGTGATGGAACGGGATCACCACTTTGGTATTCAGCGATTCCGCCATGCGTAAAATATCCGCGCTGGTCATTTTGTCCGTAATACCGCGCGGGTTTTCACCGTAAGAACCGAGCGCG
++
+BBBAAFFBB@BBGGGGFGGGFFHFHFHFGGHHHHFHGFHFHHCFFH?EG1EC1GFHGHHHHGFDGHGHGHGEEHGHGGGGGEHGFGGFFHHHHBAFFGGGGCFHFFHHBGGHDFGGGHHGGGG//<C<FAEFFGGGGC..DFHHGGGGGDB
+@689524/1
+GATATCAACATGCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCG
++
+BBBBBFFB4@>CGG5EEGECG?EGFFGHHHHHHHHGHHFHHFFFHHHGFHEFHHHHHGCEBG2G?EHEHHHHGHFHHHHHHHHGHGFFHHGFGFC?EGEEGEGEGGFHHHHHHHGCDDHGHHFHCGGGGHGHGGGGCCCGCGGGGDGEGG
+@1173400/1
+GCCTTCATCGCTGGCGATCAGGAATCCGCCGGGAGCGGGGCTATTCAGCGACTGGGCGGCACGCGCGGTCTCGCGAGAAATAAACGGCGCCGTTGAGGTCGTGACCAGATTTTCCAGCGACTCTGCGCTTACGGGGCGTAGCAGCACGTTG
++
+??ABBBF5FF3F?EA2FEAEEGHHHFF?F?EG?AEE?E?ECEF@GHHFH?E?/?GHG??ECDCCGCCCFDGGHGGCGCGHHHGHDFGGGGGGCDDGGGC/:?DBEGBAFFGGGGGG0FB=@BDFFFB-BDDFFF;B?B;B?EFBBAF-AFA
+@371519/2
+GCCCGAGCGTTGTCCTGATCTGGCGGAAATCCAGACGCCGCCGATAGTACCCGCACTGCTTGCCAGCGAGAACGGACTGATTCTGGTCACTGGCGCCACTGGCTGCGGGAAATCCACTACGCTGGCGGCGATGGTGGGACATCTTAATCAA
++
+BBBBBDBBBABAGGGFFBGGGGGHCCAEGHHHHHFFCEGGGGGGFGGDGHHHGGGGGHHHFGHGHHGGEGFGHGGFGGGHEHFHGGHGHHHDGEGGFFFGHFHHGGGGGGGEHHHHHHHFGGGGGGGGGFABDDBFGAEFEFFFFFFFFFF
+@333663/2
+GTCAGAACATGAGTACGGGTTTCGTCGCGATAAATTTCGATGTCGTCACCCACACGGTTCGCCGGGAACAGGCCCACCACGCCACGCGGATTCAACAGTTTCTCGGCGCTCAGTTTATCCAGCATATCATTGGCGTCTTTAAACAGACG
++
+A3AAA5FCCFFBFGGG2EEEFGHGFEAGGCGDFBGHHGFDHHHFEGGHGHHGDGGFGFFFG?FGGG/EAGHGFAEGGGEGGAFCGGGCGCGFHHFHHFFGFHGHGGGG?@DDFDBGBDGFBDGHHGGHE0=GFHFACDG0:GGGGF/.-
+@746143/1
+GCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAGGAAGTTGAGCCGGGCAGATGTCCAGGCGTGAAT
++
+BBCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHGHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGGGGHHHHHGHGGGGHHHHGHGGGGGHHHGGGGGGGGGGGGGGGGGGGGGGGGHHGGHHHHHGFGGGGGHGHFHGHFHGGGGGG
+@375889/1
+GCGTCGTGAATGGTGCGGTTGGACAATGTTACCGATAACAGTTACCCGTAACAAATTTTGCAACTTGTAGAGTGGGGGCCCGCTTTGAGCACGACTAATCATGATCACCACGTTTACGTTCTGATGGGCGTATCAGGCAGCGGTAAATCCG
++
+BBBBBBBBFBFFGGGGGGGGGGHGHHHHHHHHHGGGGGHHHHHGHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHGHGGGGGGGGGGHHGHHHGGGGGHHHHHGHHHHHHHHGHHHGHGHHHGHHHHHGHGDGGHHHGHHGGGFFCGHHGHD
+@8003/1
+GTCCGTAATACCGCGCGGGTTTTCACCGTAAGAACCGAGCGCGACATCAATTTGATGTTCGTTGCCGTGTTTCGCGTAGTAGTTGGAATAGTGAGAATCGCCGCTGTGATAGAGATTGCCGCCCGGCGTTTTAAACAGATAGTTAACCGCG
++
+ABCCCCFDCFFFGGGGGGGEGGGHHHHGHHGHHHHHGGGGGGGGGGGHHHHHHHHHHHHHGGHHGHGGGHHHHGGGGGGGHHGGHHHHHHHHHHHHHHHFGGGGGGGHHHHHHHHHHHHHGGGGGGGGGGGGHHHHHHFFGGGGGGGGGGG
+@843394/1
+CCTTTGTTGGCAATAAAGATATCAACATGCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGT
++
+AAAAAFFFFA1DBBG1AF1E1ABGHHHHCFFGHEHCCEGEHHGHEDFE21BFAFF1FDDAFGEEHFG@2@GF1GG1F@EGG0BGHHHGFE>FFGGGFDBDBCGAE1FGGGE@EE?B?@CC/C//@GF>FFDC/?AAGF??FGA?.<11><A
+@719345/1
+AAGTAATAGTTTTCAACCTTTTCAACGACTTTCAGGGTCTGCTGTTGCGTAGAACCGCTCGGTAGCTGGATAGACGTAGTGAACATGCCCCGATCTTCCTGCGGCAGAAAGGAGGTGGGGAGGCGCAAAAACAGGAACACCATGCCGCCAA
++
+BCCABFFFFFFFGGGGGGGGGGHHHHGGGGGHHHHHHHHHHHHHHHHHGGGGGHHHGGGGGGGHGHHHHHHHGHHGGHHGHHHHHGHHHHGGGGGHHHHHHHGGGGGGHHHHHHGDHGGGGGGGGGGGGHGGHGGHHHHHGHHHHHGGGGG
+@693958/2
+GGCATGGTATTGCTGGTATAAGCAGGTAACATGGCTGTTATAAGTTGATAACAAACTCTTGCGCCGCGTCGTGATAGTTTGCAGACCTTCAAAGTTTGTGTTGCGCAGTACGGTGATAATGTGCGGCGCACCAGGCCGCGTCACTTTTTGA
++
+A@A3AFFFFFFFGGGGFFDFFFFFHEFFGHCDHEEGFAGEEGGG5GHFHFEGHHFE3FGGFFEG?A0EE@E>FF3GHDGDG3FHGHEHFHHHHHEGGHGGGHAF?E?EEE?E?FG?BGG43B33?/@DCGGC0G/F<DGGCFDGHHHHGGG
+@1071672/1
+GCAAAATAACCTCACCGTAACGGAAACCGGCAAAGATACCGGCGTTCTGAGCCTGACGTTCACGGGAGAGGATCGCGACCAGATCCGCGACATTCTCAACAGTATTACCCGTAACTATCAGCAACAGGACATTGCGCGGAAATCTGCAGAG
++
+AA1AAF@DDDCFCB1CECGFGGGGCAGHGGGCCH00GGHFC/EAEEAE12110B>FGCFFFEGA?EE/??/0B0/E@/>//0<11B0///BCCHF22F2<1FGDDF1?1?C?@AAF11FD11F0C00.<.<DBDGG@C?-:CHBF00;/B.
+@1239318/1
+TTACTAAAGGCGCTCGTGCTGCTATCGAAGCTGCTGGCGGTAAAATCGAGGAATAAGTAGCAGATGGCTAAACAACCGGGATTAGATTTTCAAAGTGCCAAAGGTGGCTTAGGTGAGCTGAAACGCAGACTGCTGTTTGTTATCGGCGCG
++
+CCCCCFFFFFCCGCGGGGGGGGGHHHGHHGGHHHHHGGGG?1FHHFGGCEECHHHHHFHGEF3GDGHHHHGHHGHHGGGG>EFHGFEGHHFHHHFBGDGBGH3B3?EGHHFFHHHGEEHHFHHFCB/C@FCFFHHDGH0?GG11FCCGGF
+@891586/2
+TGACAGCACTATTCACGCCTGGACATCTGCCCGGCTCAACTTCCTGGCGCGTAACGCTCCGCAACGGCAAGACGCTAATTTACGCAGATAGTCTCGCCACGCCCGACTATCTGCTGATTAACAACAAAAATTACCCTGACCTGGTTACTAA
++
+BBCCBFCFFFFFGGGGGGGGGGBFHHHHHHHHGGGGGHHHHHHHHHHGGEGEFGFEGEGGGGGGGGEGGGGHHGGGGGHHHHHGGGGCHFEFHHHHGGGGGGGGGGGGGHHHHGHHHHGHHHHHHHHGHHHFHHHHHHHHFHFHHHHHHHH
+@212595/1
+GCCTGGTGCGCCGCACATTATCACCGTACTGCGCAACACAAACTTTGAAGGTCTGCAAACTATCACGACGCGGCGCAAGAGTTTGTTATCAACTTATAACAGCCATGTTACCTGCTTATACCAGCAATACCATGCCTGTCTGCTATGCTTT
++
+AA?1>AB1FDDAE000AEGEBGD2BEFGGHHBEEGGCAFCFGAGBGHBF1FEDFH1FGFHHEBFGFGA?EEGG/EGEEGGHHHHHHGHHDDBBDBHHGGBHBFGHHFHFHGHHHFFGHHHF1FG/0<FHFHHGHHGHHHBGGFHHGHF0DG
+@975017/2
+GTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAGGAAGTTGAGCCGGGCAGATGT
++
+AAAAABFFFFF4F4DGGGG5BGEGHHHHHHF424BBGFG2GHFHHGF?B2GHHHHHHFFFHCGHFDFG?0EGGGCGGGCCEEHG4GFFH/EEAEGFFGHGEEDFEFEGEEAEBD?C?C?A//F?@DCGGHHB<1FGH1GCDC?@C..:GH
+@1029285/2
+GTATGTACCTGTCGCGCATGATTATCTGGACGCTCCGGATCAAATCTCCCGCCAGCGTGCTCTGGAACTGCTGAAGCCGCTGCTGGAAGATGAAAAAGTGCGCAAAGTGGGGCAAAACCTCAAGTACGATCGCGGCGTCTTGCAAAATTA
++
+1>AAAB3DFFBFGGGGGCAEFGGGFH32FFFCEFG?EGE?AGHH21FGHGGCGGGGGG/E>FHHHGHGBDHHHFHHHHGGGG/BFEHGH0FG1BBGGGBDD@EECGHGFGHGGGGHHHGEHHHHHGHFEC/@CCCCCCCGEFHHFHHHHF
+@285622/1
+ACGCCAAGCTGATATTGCGCTTTCGCAAAATCCTGTTTTGCTGCTTTTCGATACCATGCGATAGCCTGTCTGTCGCTTTGCGCGACGCCGCGACCAAATGCAGACATGATGCCCAGATGCGTTTGCGCAGCAGGCAGCCCCTGGCGAGCGG
++
+BBBBBBBBBFFFGGGGGGGGGGGHGGGGGGHFGHHGHHFHHHHFHHHHHGGHHCHHHHHGGHGGGHHGFHHHHHGFGHGHHGGGGGGGGGGGGGFGHHHHHHHHHHHHHHHHHHHFHHFHGDGGGB?@CGGHAAAGDFEFGHGGHGGCGGG
+@679992/1
+GTTGTACAGATACCGCGCCACGCTGCGACAGCGAACGGGAACGCACGTGACGTTTAGAGACGGAGTCCAGCTCAGCTTCCCGCTGTTTGACGACCGACTGCGCGGCGCGCATTTCACTCTGGCGTTGCTCCAGCAAGGCACGGGCGGCGG
++
+AAAAAFFFFFFFGBEEAEEEGE0EEFGGGGAGECEGECE?E/AEE>EHGEEEFFHHEGHHHG?EE?01B10FFHHFGHG1BE/>E?FGHFFCCC/CCC?AG////<C-<CCGGGGFCC:CGHFGGGGGFFB9B/;FB.EF;.;A-9=@;?
+@997155/1
+ATTCACGCCTGGACATCTGCCCGGCTCAACTTCCTGGCGCGTAACGCTCCGCAACGGCAAGACGCTAATTTACGCAGATAGTCTCGCCACGCCCGACTATCTGCTGATTAACAACAAAAATTACCCTGACCTGGTTACTAATATTCAGAG
++
+AAABADA@A?AAG4BG4F55F4E?EEEGHHGHHFFHHGECFEGG?EAEAECFGEGGGGGGGGFFCGCEHHHHHGGGGGHDGDGHE3//EEE//CC/B/BHFHHEHH1FGHFHHFHEHHFHHHHHGHHFBHEBGHGH1CHGGGHBGBGGHF
+@128249/2
+CGTTCACACATCAACAGGGAACGTCGCTGGCGCTACGGCTATTGCCCGAGCGTTGTCCTGATCTGGCGGAAATCCAGACGCCGCCGATAGTACCCGCACTGCTTGCCAGCGAGAACGGACTGATTCTGGTCACTGGCGCCACTGGCTGCGG
++
+BBCBBFFFFBFFGGGGGGGGGGGHHCGGEGGGGGGGGGGFGHFFGHHGGGGCEEGFHHHHGFHHHHHGGGGCFFHHHHGGGGGGGGGGGGFGHHHGGGGGHHGHCEHGHGGGGFDEGGGGCGHHHHHHFHHGHHFHHGGGGFBFFE/AEGG
+@1520351/1
+GGTGGTGGCTGACCGTCAGAACATGAGTACGGGTTTCGTCGCGATAAATTTCGATGTCGTCACCCACACGGTTCGCCGGGAACAGGCCCACCACGCCACGCGGATTCAACAGTTTCTCGGCGCTCAGTTTATCCAGCATATCATTGGCGT
++
+A?ABB>A3?FA4BBAEGGABGEHHHCF5BEFGGEDDG222A2AAEAFBHHHHHCDDBFECFH?DGFEEFGCFEGGEFCGCEEGEHHE/EGFDHH/DFDA?DCG?/CGFGGBBFFFDDD<.F--<<A/GHCGHHGB0CHHFFGGHF0:/:C
+@1052790/2
+GTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAGGAAGTTGAGCCGGGCAGATGT
++
+AABCCFFFFFFFGGGGGFFFGGHHHHHHGHHDGFHFHHHGHHHGHHHGHHHHHGFHHHHHHGHHHHHHGGGGGEGGGGGGGGHFHHHHHCEEEHHHHGHGGGGGHEHGGGCGCGGGCDDDGGADGGGGGHHHG1FDGHHGGGGGGGGHFH
+@22607/1
+GGATAATATGGTCTTGCGCGATGGTACGAATCGTCGTGTCTTTACTGGCGAGATATTTTTTAACCGTCGTCTTATCCAGCGTGATTTTCCAGCCCTTACAACAGTGGTCGCGACAGGCCGAGCCAGAACAGGAAAAGCGGGTGACAAAGG
++
+>?AAAFFFFFFFGGGGGGGCFGG?BGHFEFCGHGDCEFGHHHHHHFHHHGGGEFHHHGHHGGHHFGGGGCGFGHGHHHHHGECEHHHGFFGFGFGGHGFFHHHFHHFGGFCG?CGGGGGGC@?CHFHHF0<FFFHHFFD@FA@GFHFHGH
+@1099414/1
+GTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAGGAAGTTGAGCCGGGCAGATGT
++
+A?ABBFFFFFFBGGGGGGGGFGHHHHHHHGFHGGHHFHHFGHHGHHHGHHGHHHHHFHHGHHHHHHHHGGGGGEGGGGGGGGHHHHHHHGGGGHFHHGHCGGGGGHHGGGGGGGFGGCGGGGGGGGGGGHEFHCFHHHHHGG?CDDEHHH
+@223330/1
+ACCACGCGGTTAGCGTCACGCTGACATTCCAGCGCCTGCAGATAGTGGGCGACCGCAATCAGGTTGACCTCCGGCGGTAACTGCATTGCCGGGTGCCCCCAGTAGCCATTGGCGAAAATACCTAGCTGACCGCTGGCGACAAGATCCTTGA
++
+BBCCCBB?DBBBGGGGGGGGGGGGHHHHGHHHHGGGGHHHGHHHHHHHHGGGGGGGGGGGEHHDGHHHHHHHGGGGGFGGHHGHHHHHHHGGGDGGHHGCCGHGFFHGHGFGHGGGGGHHHHGHHGHHGHHGGGGGGGGGGGGGFFGGGGF
+@1104874/1
+CTATTCACGCCTGGACATCTGCCCGGCTCAACTTCCTGGCGCGTAACGCTCCGCAACGGCAAGACGCTAATTTACGCAGATAGTCTCGCCACGCCCGACTATCTGCTGATTAACAACAAAAATTACCCTGACCTGGTTACTAATATTCAGA
++
+ABBBBFFFBFBFGGGGGFGGGFHCEGGGGHHHCHCGGEHFEEGGGGGGGGGGGGGGGGGGCGFFFEEEAEGHGHHGGGGGGHHH4DGHGCFGGGGGC/BCGHHHHFFCGGHGHHHHHHHHHGHGHHGHFGHGFHFFGHFFHFFHHHHHGHF
+@992511/2
+TTGTGGCATTACGACAACGCGCCATCATCGCGCCAGCCGCAGACGCTAACGTTCATTCCGTGGTTTAGCTGGGCCAACCGTGGCGAGGGCGAAATGCGGATTTGGGTTAACGAGCGGTAATACTGTGCCGGATGGCGGCTGCGCCTTATC
++
+BACBCBBFFFFFGGGGGGGGGGGGGHGHHHGGGGGGGGGGGGGHGGGGGHGHHGHHHHHHGGGHGFHHHHHHGHGDHGGGEGGGGCGGGGGGGGHHHGGGGGHHHGDFHHHGGGGGGDFGFGFHH;GHHGGG?BEFGGGDGGGGFBFFFF
+@815460/1
+TGTACAGATACCGCGCCACGCTGCGACAGCGAACGGGAACGCACGTGACGTTTAGAGACGGAGTCCAGCTCAGCTTCCCGCTGTTTGACGACCGACTGCGCGGCGCGCATTTCACTCTGGCGTTGCTCCAGCAAGGCACGGGCGGCGGCAA
++
+ABAABFFFFFFFGGGGGGGGGGGGGGGGGHGGGGGGGGGGFGGGGBGFGGGGHHBGHHHGEGDEGGHFHHGHHHHHHFHGFGGFHHHHHGGGGGGGGGHGGGCGGGGGFGGHHHHGGHHHHGGGGGFFFGGGGGGGGGFGCGGFFF=DDFF
+@1141975/2
+GCCTGTGTATCGCCGTTGCGAAGTTGCTGTCGTTTCTCCAGTAGCCCGAAGCGGTCACCTTTGTTGGCAATAAAGATATCAACATGCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGT
++
+BBBBBFFDFFFBGGGGGGGGGGAFDFHHHHGGGGGHHHHFFDDDFHHGCGGGCGEFDGHHFHGHHHHHHHHHGHGGHBFHHHFHFFBGFBGHGGGGGHBFBGDHHHFGHGFHFGHHGGHGGHH2FDGFHHEF1?CGFHGHGFFHGHGGHCC
+@1144014/1
+CCTGGACATCTGCCCGGCTCAACTTCCTGGCGCGTAACGCTCCGCAACGGCAAGACGCTAATTTACGCAGATAGTCTCGCCACGCCCGACTATCTGCTGATTAACAACAAAAATTACCCTGACCTGGTTACTAATATTCAGAGCAGCTTTA
++
+BBBBBFFFFFFFGGGGG?EGFGHHHHHHHHHG?E2AEFGFGGGGGGFEEGGGFGFGFEFEEHGHFHGEG?@BGHGHEFBA@FEEEGGGGGGGHGHHGHHHHHHHHHHHHHHHHHFHHBGHFHGFHHHCFHHHHHHHHHDGGFGBFHHGFHH
+@256599/2
+GTGATGTACAGCTTGAAGATCTGCTGAAAGATTACGATGCGGTATTCCTTGGCGTCGGCACCTATCAGTCGATGCGCGGCGGGCTGGAAAATGAAGATGCGGACGGGGTTTTCGACGCTTTGCCGTTCCTGATCGCCAATACGAAGCAGAT
++
+BABBBFFFFFFFGGGGGGGGGGHHHHHHHHFHHHHGGHGGGGGGGHHHHHHGHGFGGGGGGGHHHHHHHHGGGHGGGGGGGGGGGGGFHHHHHGHHHHHHGGCGGGGGDFGGHGGGGGGGGHFGGGGGGGGGFGGGGGGGGGGEGGGFFFF
+@1445482/1
+CCTCGACCCTATGCGTGATGCGCTGCTCGGCGCGCTGGATGCGGGCGCAGTATGCGTGAACGTCGATCTGGCCCATGCCGGACAGCAGGCGAAACTCGAACCGGATACGCCGTATGGCGATGCGCTTGGCGTTGGTGCCGGTCGTAACTGG
++
+AAAAA3ADDFC44GGAE2GFFEGEAFEGEGGGEGCGCE1BGAEC@@>/EE>B3FGEE/EGFFGHGE/0GDFFFHAFGH1CCCCCE/FFHGGGGGCDCD.GF--C<..CCEGC@.GFFAA?BGDGA9DA?BBG@BG;E/BBB?B-@AFF/BF
+@74759/2
+CTACCAGGGCGGTCACAACGCAGGCCATACTCTCGTAATCAACGGTGAAAAAACCGTTCTCCATCTTATTCCATCAGGTATTCTTCGCGAGAATGTAACCAGCATCATCGGTAACGGTGTTGTGCTGTCTCCGGCCGCGCTGATGAAAGAG
++
+BBBBAFFBBBBBEGGGGGGEFGGGGGHHHHHGHFEFGHFHHGHGGGHEHFHCGGGGEGHGHHEGHGGDGHHHHFHHHHFBGGHHHGHCGGCGEHFGFHHHHHGHHHFGHHGGAFHGGDHGGHBAGHFHHHFBA-CDFGGGGGACFF0CHHF
+@414736/2
+ACCTGGGGGAGGCAATCAGTGTTTACACAGGAGCTGCTCCAGTTCGCTTAATGACGCCACAGTCCAGGTTGGATGAATACCCGCGGGCTGCTCGCGATGATGCGCGTTAAGCCAGCAGGTCGACAGCCCGGCGTTAATGCCGCCAAGAATA
++
+BBBBBFB@BD@DGGGGGGGGGGHHHGHHHGHHFHHHHGHHHGHHHGGGGGFHHHHGGGGGHGHHGFHHHHHGHHHHHHHHHFGGGGGGGCFHHGGGGGCHHHGGDGGGDGFHHHEEHGHHHGGGGCCC??-DGGGBAFFFGGGGAFGFGGB
+@1251068/2
+GGTGTACTCCGTGATGTTGTGTTGTCGCGCTTATTGTTCGGTTTACAGATTGCTATCTGTGCGAATGAACCCACATTACAACAGGAAATTTATTGCGGAAATTGATATATTCACAACGTTATGTTGCGGTTTATGCAACGTCAAAAACCGG
++
+AA>AAFDFFFAAFFGABFGFEGHHHHGHGGGGGHHFHHHGGGGGHHHHGHGGBGFFFGHHHHGGEFHFHHGEFEGHHHGEFGGFHEHFFHFFHHHEDGGGGHHHHGFHHHHHHHHEFGEHHHGGFHHGGBCGHHHHHHHGHHGGHGHGGG?
+@1200992/2
+GAATCAAAGAATGCCTGTGTATCGCCGTTGCGAAGTTGCTGTCGTTTCTCCAGTAGCCCGAAGCGGTCACCTTTGTTGGCAATAAAGATATCAACATGCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGT
++
+CCCCCFFFFFFFGGGGGGGGGGHGGGGGGGGGGGGGHHHHHHHGGFGHHHHHHHFFGHHGGGGGGGGGGHHHHHHH2FHGHHHHHGHHHHHHGHHHHHHHHHGHGGGGGHHHHHHHHHHHEGFHHHHFHHHHHHHGHHHGHHHGHHHGGH>
+@45038/1
+CGTCAATGGCGTATAGCATCATCGTTTCACAGTACAAAAATTAAAAACCCAGCGCCAACCGCATTCCATTTTTTGCGAACCTCTATCCAGAATCATCATCCCCTCGTTTCACCACTTTCCATCCCCAACGAACCAGGTTACAAACTGTACA
++
+A3AAA3DDFBDA?EGG55AFBGHHHHG46FFGFDEHFFHHHC3GFFGEAEGHF0A0BFC?ECGGDHHHHGBGHGEHGG@@EGFHHHH3BFHEHHBFBGFHFHGHGEEGGBFHHEEHGHGBFGFG/CGGGGFACGFAEFFGGFFFHHHHHH1
+@210213/2
+GGGCGAGCGGAGCGAGTAAATGCTCACGTACTGCGTGTACGCTCCGCCTTCTGCGCGCACGCCGACGCCAAACTGGCTGCAACGGTCACGCCCTGGAATCAAGCTTCATCACATGTTGATTGCTTTTTTCCCAGAAATCAGTAAAATTTT
++
+BBBBBBBBBBBBGGFGGGGGGGHHHHHHHHHHHGGGGGHHHGGGGGFGGGHHGHGGGGGGFGGGGGGGGGGHHHHHGHGGHHHGGGGGHGHGGGHHGHHHEGGHHHHGFHHGGHH0GGGHFHHHHFG0DHGHHHGH/GFHGHHFFFGHHH
+@1251034/1
+GTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAGGAAGTTGAGCCGGGCAGATGT
++
+BABBBFFFFF4CGGFGGCGGGGHHHHGHHHHHCGGHHHFGFHHHHHHGHHHHHHHHHHHHHHHHHHHHGGGGGGGFGFEGGGHHHHGHHGGGGHHGHFFEGGGG?FHGGGEGGGGGGGGGGEGGGGGGGHHFFGFHHHHHGGGGGGEFHF
+@1534407/2
+GGTTGAAGAAGCCGGCGCGGATATGATTGAGTGTAACTTCTCTTGCCCGCAGATGACCTCGCACGCCATGGGAAGCGATGTAGGGCAAAGCCCGTAGCTGGTTGAAAAATACTGCCGCGCCGTAAAACGCGGTTCATCTTTGCCAATG
++
+@AAABFBFFBBFGFGCAAEFEG?GFHHHF3B5FAAFGHHGHHFFFHBGGGGCEFF5GHFHFG/EEEGEGHFHHHAFGGHGHHFFGGGGFGEHGG/CFGHFHFFGGHHHHHGFHH2CCD?@DC@EDEHFGFC?:?E0CFCC00G0CFHH
+@1212330/2
+GTTGAATAACGTGTTATGCGCCTGGTTGACCCGCATTCTTTGATAAGCGAGCGGGGTGGCCTGCGGATCGTTACTGAGGATCAGTCGGATAGCTTCTTGATCGGCTTCCAGCGCATCATGGGCGTTTTTACGTAATAGCCCGCTTTGCCAT
++
+AAABCFFFFFCFGGGGGGGEGGGHHHHGGHHHGGGGGHHHHHFFHGHHGGGGGGGGGGCGGHGHGGGGGGHHHGHHHHGGHHHGHHGGFGGHHHHGHHHHGHGGGGCFHHHHGGGGGGHHHHAFAGGGFHHGGGHGHGHGHGGGGGHGGGF
+@988287/2
+GTAGTTGGCAAAACCGACTTTCTCGGTCTGCTGGCGCAGGTGGTGGCTGACCGTCAGAACATGAGTACGGGTTTCGTCGCGATAAATTTCGATGTCGTCACCCACACGGTTCGCCGGGAACAGGCCCACCACGCCACGCGGATTCAACAGT
++
+A3AABFFFFBFFGGGGGGGGGGHHGGGGGFHHHGGGGGFGFFEGGGHHGHHFGGGFGFHHGECGFGFFEGGFEFFG1AEGFEGDGFHHHGGFHHHFHGFHGHFGDFGGFGGGFCBDGF-CGHFGFGG?E?AEDDFGGGGFCA?AFG0FFGG
+@1262953/1
+TTGCCCCACTTTGCGCACTTTTTCATCTTCCAGCAGCGGCTTCAGCAGTTCCAGAGCACGCTGGCGGGAGATTTGATCCGGAGCGTCCAGATAATCATGCGCGACAGGTACATACGCGGCAACGCCAGGTTCGATGGCAAACGAGAGGCC
++
+BBBBAFABAFFFGGGGGGFGGGHHHHHHHHGHHHHFGGGGGGHFHHHHGHHHHHGGHHHGEGFFGGGG>EFFHHBGFGHGFEE/E?AFGHHDFGHHEHHGGDCCCCCG1F1FB<GGDGGCDGH@CFFFHHHGAEFFD/CFF.;.:EDDAF
+@403497/1
+GCAAAGGCTATATTCGATGATTAATTAACCACATTGTTGCGAGGGATACTATGACGAATCTACATCGTCTGAAAACACTCCTGCTTGCCGGTATTGTCGCGATACTCGCGCTATCGCCAGCCTATGCAAAAGAGAAATTTAAAGTCATCA
++
+AAB?3CBAFF4DGFBF6EGADFFHBDGHHF4AGHFF5FGFE2A2AAGHBDFFHFDAAEGFHH5GG5EA1F1GFFGGHA3GF3FBCGHAGGGG/F4FGHFGECGE/4BEG?E@DB?CDD///?GEFF1FGFGBFFHFGBFGFGHFH1FBGF
+@519556/2
+CGCCGGTGTTATACAGACAGTTCAGTTGCAACTGATGCAACTGGCTTTCCGTTTGCAGTTCGGCAAAACGCGCCTGGTAAACTTCCTGCTCCGCATTAAGCACGTCGAGCAGCGGGCGGGAACCGAGGTCAAGGTATTGCTGCTGATACAG
++
+AABBADB@AADFGGGGGGGGGGHHHFHGHHHHGGHB5FGHFCBFHHGHHHGHHGGHHHHHHGGGGGHHHGG?EGGGG@FHFHGHHHHHHHFHGGGGGFFBGHHFGHFGCFGGHCFCGGC?@FGEC@DC;GG0</00;:FBFFBB:;BFGGF
+@1343309/2
+GTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAGGAAGTTGAGCCGGGCAGATGT
++
+AAAAAFFFFFFFGGGFGBGGGFHHCEFGHCBCE4BFGHHA3GFHHHHGFHHFHHHHEFFHHHFHGFGHGCEAEEE0@0EEGGHHHHGG4EGGGHBBGHE>FFAEHBGFECCDCC/CC?<ADGGGFG/>DCFFGHHHHFFBDGC?-C.:F:
+@1379057/1
+GTCTTAAAGCTGCTCTGAATATTAGTAAACAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAGGAAGTTGAGCCGGGCAGATGT
++
+BBBBBFBDDBFFGGCGGBD56GFDFFGH5AAFGGHFHFG2F3FDFGHEGHFH2FFHHFHHFHHHHH5GF00EEGGEGFGG@A3FFGHD4EEEECGHFBFEFE?FHGHG/AF?@?C?@CADGECBF?//<FGFHGFBGGFB<-CGGGGHHC
+@1387077/1
+AAAGAATGCCTGTGTATCGCCGTTGCGAAGTTGCTGTCGTTTCTCCAGTAGCCCGAAGCGGTCACCTTTGTTGGCAATAAAGATATCAACATGCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTT
++
+BBBBBFFFFFBFGGGGGGG?EGEGGGGGGGFHHGHHGFFFEGHFHGHHHHHHHHGGGGGGGGCEHHHHHHHFHHHHHFHHHHHHHHHHHHHHFFHFFGHGCGGGFGHGHHHHHHHHGHHHHHHHDGBHFHHHHHHDFHGFHHFGHFFCFHH
+@472411/1
+CCTTGCCCGGCACGTTCGCCACCGCAACGGCGTGCATACCGTGCTGGCCGGGTTTGTTGAAGTCGGCGAAACCTTAGAACAGGCGGTCGCGCGAGAGGTAATGGAGGAGAGCGGGATTAAGGTGAAAAATCTGCGCTATGTGACTTCCCAG
++
+DDDCCFFFCCCDGGGGGGGGGGHGGGGGGGGGGGGHHHHHGGHGGHHGHGGGGGGGHHHHHHGHGGGGGGFGHHHHHHHHHHHGGGDGGCGCC-A-@D0<GFFHCGG?DCAC@GG-EFBFBF0CBFFGGGGGGFCDGGFFFFBFGFFFFF0
+@1463311/2
+GCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAGGAAGGTGA
++
+AAA111AD00AAGGGFBEFFFGCGFHBFHF112FFGHHH2FDEG1FFBCBA0G00BD2FGHG0BGFAGF2GB@EHHBGG1FBEE@EEEECEE?ECEHEGGBGHG/<A/>GB1GC/<CC<F</?A/ACG-A?<<CC<C.<-@.-CE/..;/0
+@451336/1
+TTTTTGTACCGTGGATGATAGGCGGCGCTATCCTGCTGCTGGCAGCCGGACTTTGGGGACTTTTTGCGCCGCCGTCGAAAAGTGCGCTGCGGGAAATTCACTGTCTGCGGGGAACGCCCCGCCGCTGGGGACTGTTTGGGGAGAATAATCA
++
+CCCCCCFFFFCAGGGGGFGGGGFGGGGGGGGHHHHHHHHHHHGHGGHGGEGGHGHHGGGGHHHHHGHGGGGGGGGGGGGGGHFGHGGGGGGGGGGHHHHHHHHHHHHHGGGGCGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFF
+@1515370/1
+ATCAACATGCTGGGCGGCCAGTGTCTTAAAGCTGCTCTGAATATTAGTAACCAGGTCAGGGTAATTTTTGTTGTTAATCAGCAGATAGTCGGGCGTGGCGAGACTATCTGCGTAAATTAGCGTCTTGCCGTTGCGGAGCGTTACGCGCCAG
++
+CCCDDFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHGGHHHGHHGHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGGGGHHHHHFFGFGGGHHHHHGGFGFDHHGGGGGGGGGGGGGGGGDGGGGG
+@1227757/2
+GTCGTAAGGCGGCTGCCAGCTCAGGGTAAACATACTTTTCTCCTTTATTTGACCTTTCAGCATAAACGCTAATCGCACGTAACGCCTTGCTTTCATATTCCAGTTGTCGCCGCGACGACATTTCGCTAAAGTCACGCCCCTTCTTCACTGG
++
+AAAAA4>BFFDDGGGGGCGGGGGFFFB3GBHHHHFHHHHFHHHGHHFHGHHHHGHHHHHGHHHHHHHGGGGGHHGGGGGFHHFGC@AEHGHHHGFHHHHHHGHHHGHGGHEGEBC@CCGGDHDFHGGGG1DDFGHGHCF?<CFHHGB0DFG
+@1292914/2
+GTCCAGGTTGGATGAATACCCGCGGGCTGCTCGCGATGATGCGCGTTAAGCCAGCAGGTCGACAGCCCGGCGTTAATGCCGCCAAGAATATCGGATTCCGCGGTATCGCCAACCATTAATACGCGCGAGCGGTCAGGATTCCCCGCCTG
++
+BBBBBFFFFFBFGGBEGGGGGGGGGGGGGGHHGGGEEEHHHHGGGGGGEHHGHGGFGHHHGCGGGHHGGCFGCGGGHGGHGGGGGHHHGHHFGC??DHHHGFDADEHGGGGGGDGHBGFHFHHGCCABGGGGGGGFF9FFFFFFFFFFF
+@57870/2
+GGAAAGAATAAACTGACACAGCGCCTTATGCGGCCAGTATGTTAGAGGCCAGGCGACCAGCGCGGTAATAAATAGCACGATTGCGCCTGCCGATCCCAACTGGATGGGAAGGAAAAGAGTGCCTGCGCCTACAGCCGTTCCGTATAATGCA
++
+AAAAACFFFFFFFFFBG1BF1AEEE00FFGHCEEEEAGFGHHDGDBFHF/A//AE/EEGF/E@E@FGEEGEG2GFFF@EFHHFE>@ECEFGEGG?/BGHGEFFC1CACCG/??F<0GG0GF11FFGCG...GCCF.-AAB/A<GCGDGF0<
+@321549/1
+CTGCAACACCAGATCGCAAGCTTTGGTTTTCACCTTTTCCGCCAGCGGCGTACTGCCGATATTATTGAGGTTCAACTGCTGGCCGTCCTTCGTCTTGAGCAACCCTTGCAGGCCGTTCAGGTAGTTAGTGTCCTGCTCCTGCTGTGTGGTA
++
+BCCCCFFFCCCFGGGGGGGGGGHHHHGHHGHHHHHHHHHHGGGGGGGGGGGGGHHHHGEEGGHHHHFHHHHHHHHHHHHHHHGHGGGGGHHHHGHGHHHHHHHHGHHHHHHHGGGGGHHHHGHHHHHHHHHHHHGHHHHHHHHGHHHHGHH
+@1034596/1
+CGACAGACCAGATCCTTTCCAGTAACCCATTGGTAAAATGCGGCGATTTTTCTCGATCACGCCCGGTTCTTTGGTCAACTGACCGTTATCGTCGAAACCGCCGTCCACCGGCAGTTCGCGGCCCGCCAGACGGTTAACTTCTAACATCCCG
++
+BBBBBBFFBFFFGGGGGGGCGGHHHHHGGHHGHFFHGHHHHGGGEGGHGGHFHHGHHHFHGHGGGGGGGHHEGHEHHHHHHHHHGGGGHFHHGGFEE@HGGGCDGGDHHG@CDCHHGGGGG@DFGGGCGHGGF?EDHFHFFGFFFGGGGGD
+@820599/1
+GTGGATGCGCGGGCGCAGCGAGCTTTGGGTACAACCAAAAGTGGATGGCGTAGCGGTAACACTGGTTTATCAAAACGGTAAACTGGCCAGGGCTATCAGCCGGGGTAACGGACTACAAGGCGAGGACTGGACGCCAAAAATTCGCCTGAT
++
+33AA?BCFBABD?EACEFGGC0EEHCFGGA5GGHHGFHFEFGHHH3FFFGEEEA@GEEEFHFFFFGFHBGB44GGCEEEFFGDGFFEGFHGFDFHBF2FGHC?/<<EHGDCGGGBGGHF.C--@@-CFCHFCDGFBCF?AFFFEDDDEF0
+@173849/1
+GTCATGCTGAAAGCGCTGTGCTTGTATAAAACGTGTTAATAACAAACAGACAAGGCCCCTAATGAACCCTTCCATGCTGAACGCGACCCTACTAACAACTGCGCCATCTCGCGCAGTGGTCGTCGTGCGTGTGGTGGTGGCCGTCGGCAAT
++
+BBCCBFFFFFFFGGGGGGEGGGHHHHHHHHHHGHHHHHHHHHHHHHHHHHHHGHGHHGGHGHHHHHHHGHHHHFHHHHHHHHGGGFGGGHHGHHHHHGHGHGGGGGGGHHGGGGGGDHHFGGBFGFGGG//<FGGGGDFF0>CFGGGGGGG
+@1270106/2
+GTTTCATTCAGCGTAGCGCCGCAATACTGCTTGACCAGCCAGAACAGGGAATCGGTCACGATCGTGCAGCCAATGGCGCCGGAACCAATGGCAATCGCAATGATCTCCGGGCTGACGTCAGGATAGAGCGGCAGCATGGGCGCAACAATCG
++
+A>AA1DFBF3DFGG?AAE?CCEGGGGGFHCGFHHFFHHHGC0G0GGHAAE0CGGGECFEEEHCE>GCHHGGHEGFFHEGGGGCGG/FFBGBEGFGGEFC/?GBG12F1/C<<@/0G?F/FEFHHGHGGDC?-A-A<G<GA.:CCCCHEC/.
+@732209/1
+CACTTCCAGGTGGCATACTAATAACCAAACGAAAGAGAAAGGAAGAACATTCATGCCTTTAAGCGCACAACAATTAGCCGCACAGAAAAATCTATCCTATGTTCTGGCTGAAAAGCTGGCGCAGCGGATATTAAAGGGTGACTACGCCCC
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHGGGGGHHHHHGHHHHHHHHHHHHHHHHHHHHHHHGGGGGHGHHHGHHHHGGGGGHHHHHHHHFHHHHHGHHHHHHHGHHGHHHHHHHHHGGGGGGGGGGGHHHHHHHGFFHHHHHGFGGG
+@1491034/2
+CCGTGATGTTGTGTTGTCGCGCTTATTGTTCGGTTTACAGATTGCTATCTGTGCGAATGAACCCACATTACAACAGGAAATTTATTGCGGAAATTGATATATTCACAACGTTATGTTGCGGTTTATGCAACGTCAAAAACCGGAGGT
++
+AABABBFFFFFFCGGGGGGGGGGGGHHHHHHGGGGGHHHHHHHHGHHHHHHHHHGFGGHHHHHGGGGHHHGHHHHGHHHHHHGHHHHGGGEFGHHHHHHHHHHHHHHHGGHHHHHHFHHGGGGGHHHBHHHGHHGGGHHGGGGGGCG
+@770570/2
+CCATAGAAGTGATTGAGAAATACTTCTGGAGTGAAGAAGAGCAGATGTGCCTGGAGTCCTGGGACGAAGCCTTTAGCAAAACCGAAGATTACCGTGGCGGTAACGCCAATATGCACGCCGTCGAAGCGTTCCTGATTGTTTATGACGTTA
++
+A3AAAFFFFFF5GGGGGGGGGGHFHFHFGHHHHBHHHHHBGHHHGHFGHEBGFHHHHFHHFHEHHGGGGGHFHHHHHHH3FCEE0EEEHHHHHGGGGEGE//FGGG/EECHHGHHHGGG?<BDGGEGGFFFHHHGFGHHHHDDBHHDFFB
+@916809/2
+GTTTATTGGTTAGCCCTTTCAGGCGAACAAATCGCGCGAAACAGCGCGCGCCATTGCCGCACTGCGAGACTTCACTGCCGTCGTCGTTGAAGATGCGGTAATGAAAGTCCAACTCAGGATCATAGGGCGCCTCAACCACCAGCAGCTGAT
++
+BBBA?B5DD5ABGBGC44BE5EGBEGECE2AE32C22AEA003AB0AE?>/EEE3GHG@/EE/33E@/>E?DGGHGEBFE//<//B//<<GD1?GHCC/DF1FG<1FF1FBG1FDD10GFCHD111</<--.;:0:C:EA.C.:CHFG00
+@1022616/1
+GATCTTGATAATAAAAAGGTTCTCCGTATGAATGACAACCAGGCGGATAGCGTCCCCGGAAGCAGAGCGGCGGCTTTTATTTCCTCGCAGATCGTTTTTCCTGTCATGATCGCCCAGCGCTCTCATAGCACAAAACGAGGTTTTCCATT
++
+ABBBAFFFFFFFFGGGGGGGGGHHHGHHHHFHHGHFHHH?GCGHEEFFGGHGGG0EGGGGGCGHHFHHCCGGF<EEHFHGG2BGHHD/BDC2CG2FAFFCFFFG1?GDFFBCDFDFHCCGEDCF00=GHFHHFGHF@.A@;/CAGH0C0
+@325444/2
+TCACACTGGTCTGGTAAAGGCAGATCCGCAGTATCCTGCGGCATCACGTTGAGCCACAGCTTGCGCCAGAGCGGCGTTTGCCGCTCGCCCTGATATTCCTGCAATTCAACCAGCGTGGTCAGTGGCCCGCCGCCGCGCAGCCCGGTACGAT
++
+BBBCCFFFFFFFGGGGGGGGGGGGHHHGGGGGHHHHHHHGGGGGHHGGHHGHHHHHHHHFFHHHGGGGGFHHGGGGGGGGHHGGGGGGGGGHGHHHHHHHHHHHHHHHGEFGGHGGGGHHHHHEHGHHGGGGGGGGGGGBGFGG?DGGGE.
+@22261/2
+ATTATGGGGTCCGCGTTGGCGGCGCTGCTGGTGGGATTTTTACAGCAGGGGCTACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTGTTGTTGTCGTTGGTCGTTCCGTCAGTTTGCATCGTCAC
++
+BCCCCFFFCBCCGGGGGGGGGGGGGGGGHHHHHGGHHHHHHHHHFHHHHGGGGHHHHHHHHHHGGGGGHHHGGGGGHHHGHHHHHHHGGGGGHHHHGGGGGGGGGGHHHHHHHHHHHGHHGGGFHGHGGGHHGHHGGHHHHHHGGGGGGG
+@316259/1
+GTGTGGGATGTGTGGCTCACGGCGCGGCGGCGGACTTACTGGCAGCGCGTTATGGCGCTCGCGGCATGTTGGCGACCGATCTTTTTACTACGCTGCGGCGTATTGTTAACCCTGATG
++
+BBBAAAB?FAFFGFGGGGGGGGGGGGGGGGGGGGGEHHHHFHHFGGGGGGCGHHGEGGGGGGGCFGGHFGHFFGGGGGCGGFGHHHEGGHGDGGGGGGGGFFFFFBFFFFFFFFFFF
+@71117/2
+GCGTGAGTACCATTCAAGGATTTGGTGACGATGCAAACTGACGGAACGACCAACGACAACAACAATGAGAAGCGCACCGGACAATGCGCTGGAAGTTTGATTCGGCACTCCGGCCATCTGTAGCCCCTGCTGTAAAAATCCCACCAGCAG
++
+BBCABCCFFFFFGGGGGGGGGGHHHHGHHGGGGGHHHHHHHHGGGGGGGGGGHGGGGGGHHHHHHHHHHHHHHGGGEGGGGGGHHHHGGGGGHHHGHHHHHHHGHGGGFHHGGGGGHHHHGGGHFHGHGHHHGHHGHHHHHHHGGHHHGH
+@237491/2
+CCGTCTCGCTGTCTGGCACGCGGCGCCTGCGCGCCAGTGCGTTCACACATCAACAGGGAACGTCGCTGGCGCTACGGCTATTGCCCGAGCGTTGTCCTGATCTGGCGGAAATCCAGACGCCGCCGATAGTACCCGCACTGCTTGCCAGCGA
++
+ABBAAFFBAABCGGGGGGGGGGGGGGGGGHGGGGGGGGHHGGGGGHHHGHHHGHGHGGGHGGHGGGGGGGGGGGGGGGGGHHGHHHGGGGGGGGGHHHHHHHHGGHGGGGGHHHFHHEGGGGGGGGAGGFGGGGGGGFFFFFFFEFFFFF9
+@104735/1
+GCGTGAGTACCATTCAAGGATTTGGTGACGATGCAAACTGACGGAACGACCAACGACAACAACAATGAGAAGCGCACCGGACAATGCGCTGGAAGTTTGATTCGGCACTCCGGCCATCTGTAGCCCCTGCTGTAAAAATCCCACCAGCAG
++
+ABBAABBFFFFFGGFDGGGGFFHHHGECGGGGFGHHHHHHHHEGGEEEGEGGGFGGGGGHHHHEGEGHG5GHHGGGGGCFGGGHFFFGGGGGHGHHHHHHGGHGGGG?HHHGGGGGHHHHHHGHFHGGFHHH=GFHHHHEHHFHEHGHHE
+@409854/2
+ATGTTGTACGCTACCAGGGCGGTCACAACGCAGGCCATACTCTCGTAATCAACGGTGAAAAAACCGTTCTCCATCTTATTCCATCAGGTATTCTTCGCGAGAATGTAACCAGCATCATCGGTAACGGTGTTGTGCTGTCTCCGGCCGCG
++
+AABBBFFFFBBBGGGGGGGGGGEGGHFGGGGGGGCGFHHHHHHHGGGHGHHHHGGEGGH4GFEGGGFGHGHHGHHHHHHHHHHHHGGHHHHHFGHHHGGGGGGFHFGHGBHHHHHHGHHGGGHGHGGGHGGHHGHHHHHHHDD?DCGGG
+@78894/1
+CGTCTGTACCGCCGCGAATTGGTTTCATCTCCGGCGTAATATGACAGTCACGCATGGCCTGCTGGGCGATATCGAGAATATGCGGATGCTCAACCACTTTTTCGCGCATATTGTAATAACTGTCTTCAATCACCAGTTCGATATAGCAGT
++
+BBBBBAFFFFADGFEGGCGCGGHHFHGHGHFHGFGGECEFHFHHHHGHHHHGHGGGF1GFFFFFFCEEEEFGHGHGA?G4GGHGGFFGHGHGHHFCFHHEGHGFGGCFGFHGHHHHGFHHHHHHHEHFHHHHFGFHGHGEHFHGHFHHDG
+@312501/1
+GGGCTATATGCCTAATCTCGCCGCCAGCGCGCTGGCGGCGAGATTAGGCATATAGCCCAGCTCATGCACTGCCGCTTCGATTTTTTCCCGGAGTTTATCAGAGACCTGTTCCGGCGTGCGTAAGGCTCGTGATACGGTCATCGTGCCTACA
++
+ABA?AFFFFBFFGGFGGGGGGGGEAEGAEGCGGGC?EGCEFG?FHDFHFHFHHHHGHFEAGFHGGHFGFHHGHG/EEEGCFFGHHGCFHDGGFGHGHHFFHFFG0CGHDFGHGGGGFGGGGDFFFHHHGGHHFFFEBGFDFGFEFGGGGGG
+@696103/1
+GGTGACAAAGCCGCGTTCAAACCAGGCGGAACTTCCGGCGATGTCGGTAATGGCTTTCGCCAGCCAGCCGCCGGTACAGGACTCTGCTGTCGTTACGGTCGCCCCGCGCGCTTTTAACGCCAGCCCGACCTGTTCGCTAAGCCGCATCAAT
++
+3AAAAFFFBFFFFGGGGGFFGGGHGGHGGCFFHHHFDCFFGGGGHHGCHFHFHGHHGHG?EG?FGHHGGGGG@GBCDHGHGHHEHHHHHFFGGGGGEDCDCGGGGGGCFGGGGCHHHHFCFFGGGGG-BCGGGGGGGGBFFFFFFB.;FFF
+@1462401/1
+GCCAGGCAATGAGTCTTGCCAGCGCGTTACAAATCCTTCGTCGGCAACAGCAGCTTAGCGAACGTACGCGCGAACTGTATCAGCAGCAATACCTTGACCTCGGTTCCCGCCCGCTGCTCGACGTGCTTAATGCGGAGCAGGAAGTTTACCA
++
+3AAAAAAAFF@DGFGGGGGGGGGGGGAEGGHGHHHHHHHGCEEEGGGFHGCGHHHHHFHCEGGGHAHGGGGGGGGHFEBFHHHHGGGHEGHHHHHGFFFFHGGGGGGHDGGGGGGGGEHGGGCGFHGHFGHHB?@-ACHHE.GFFFHHGG0
+@203406/1
+GTGCTGGGAGGCGCCAATATTTATGGCGGCTCCGGGTCGATTATGGGGTCCGCGTTGGCGGCGCTGCTGGGGGGATTTTTACAGCAGGGGCTACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTG
++
+BBCBBFFCFCCCGGGGGGGGGGHGHHHGGG0EF?EG10A0BF1FFHHG??F@CEEG?GBEE/ECCFDEFF/CDG-9CFGGECBFFBFGFFAB./BBBFFFEF=A-:.;BB>=DADFFFBFFBFBBF=9D?DFFFFDC=B-:@-99090BB0
+@580931/1
+CGTGTACTCGCGTCAGCAATTGATGGATATTGTCTGGTCTGATGCCCAGGAGACCTTCGATCGGACGGTCGATACACACATCAAAACCCTGCGCGCTAAGCTACGCGCGATCAACCCGGATCTCTCGCCAATTAACACGCATCGTGGAATG
++
+BAA?ACFFFBBBGGGGGFGGGCFHFHHFFHGGHHFFHFHHHBGBGHHHA2GFHGGHHHEHFHGEDFGGGE@EGGGHHBEGHHGHHHGEEA?GEFGGGGGHHHHFEF?CG?CFGCCFGFCCDGHHHHGGGGGH0DDHBHGFGGGGHHDEB9F
+@279358/1
+GTTGTGCTGGGAGGCGCCAATATTTATGGCGGCTCCGGGGCGATTATGGGGTCCGCGTTGGCGGCGCTGCTGGTGGGATTTTTACAGCAGGGGCCACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGGGCGCTTCTCA
++
+BBBBBAFFFFBFGG??EGGFGGHHHHHHHHGG00EFEEG00E/>?AGDGGGA1F//E///FFEC@DC///?1F0FDC.>CHHB<1111FGHGGC-..C.C;://:-:-B9FBF?--..0CF0;00C00/AA-.;9/9:AC---@--.AFF/
+@1194916/1
+AGATACAGCAGGAAGAGGCCGAGTCAGAGGAGATAATTTAATGGGCGATGTGTCAGCTGTCTGTTCATCCGGGAACATTTTACTGCCGCAGCAGGATGAGGTTGGCGGTTTATCAGAAGCATTAAAAAAAGCGGTGGAAAAACATAAGACA
++
+A3AAAFFFBFFBGGFGFGFGC?CCCFGBGGHGHHHGHBGGFHHHFHFG0A1BGHHEHHGFFGFFFHEBFFFECFCGHHGEFHBBGGBEGEGCFHHFFBFGGEGHEHGGCCGH3FFHHGEHHEHHFFDGCCDEGC<DG<F1CA.<DDDBDGB
+@1026821/2
+TCGGTAGGTTGGCCGACGAGGTGCAGCAGGTCGCCTGCCTGGATAATCGTCCCCGGCGACGGCACCATCAGCGTGTCATCGCGTTTCAGGCGTGAGCAAATGATTTTATCGCTGTTCAGGATCGGCACATCCTGGATAGCCATATTATTGA
++
+AAABBABCFFFBGGGGGGGGGFHHHHHHHHHHGGGGHHHHHHGHHGHHGEFDEHGGGGGGGGGFFGHHHHHHGEDEHFHHHGGGGGHHHHHGDCGGHHHHEHGHFFHHHHHGFEDHHHHHHHHGGGGGHHHHHHHCGFFFHHHHHHGHHH0
+@199330/2
+CTCAAACACGGCGCGGAATCCTGGATGGGATTCGTCGGCTTTTTACAAAACCCGGTGGTGGTGATCTTAAACCTGATCACCCTGGCGGCCGCGCTGCTGCACACCAAAACCTGGTTTGAACTGGCGCCGAAGGCGGCCAATATCATTGTAA
++
+CCCCCFFFFCDBGGGGEGGGGGHHGHHGHHHHHGHGGFGGGHHHHHHHHHHGGGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHGGGGG?FGGGGHHHGHGHGHHHHHGHHHGFHGHHHHHHHGGGGGGGGGGGGG?EGGFFFFFFFFF
+@906403/1
+CGTGTTAATAACAAACAGACAAGGCCCCTAATGAACCCTTCCATGCTGAACGCGACCCTACTAACAACTGCGCCATCTCGCGCAGTGGTCGTCGTGCGTGTGGTGGTGGTCGTCGGCAATGCGCCGTAGGGTCCGGAACACACACGATTC
++
+ABBAAFFFFFFFGGGGFBBGGFFGHAEFEFFGHCFGCEHFGHCHGBHHGHF2EEGCGGHFHHGFBGFGHCE?EGGGHHHEEFGGGGHHBGF@FG@EFECEGHGHGGGGGEHGCAC@/<AHHFGGACFAE?A/<CDCF--:/:E.DFFA.F
+@1010361/1
+ACCAGGAAGTGCTGGAAGAGTTTAACGAACATCGTAATGAGCCTGTTGATACTAACGACTTTATTGAGGCGATTGAGCGAAGTAAACGTCGCTTCCATGTTGTTGAAAATGAACAGGAGCTACTGCAAATGCTCAATGCGCCACTGGAAAA
++
+CCCCCBCFFFFFGGGGGGFGGGGHHHGGGGGHHGHHHGHHHHHHHHHHHHHHHHHHGGGGGHHHHHHHHGGFGHGHHHGGGGFHHHHGGHGGGHGHHHHHHHFHHHHHHHHHHHGFHHGHGHHHHGHHHHHHHHHHHHFGGGGGHHHHHHG
+@1539663/1
+ATATTATTGAGGTTCAACTGCTGGCCGTCCTTCGTCTTGAGCAACCCTTGCAGGCCGTTCAGGTAGTTAGTGTCCTGCTCCTGCTGTGTGGTATCCAACCCCAACTTGTTCAGAATCTGATTTTTAACGTTTTCCACGTTGGTAGCGGACG
++
+BBABBFFFFFFF4GGFGFGGGFHGGAFGGGGHHGGFHAFFHFHHHHGEHHHFHG1FAAEHGHHF5GHHHHHHHHHHHGGHGHGFFHHHGH?GGHGHHF@EFGGGGHHGHHHHFGDGFFGFDFHBGHHGGGGFFE3GBAHHHHDDGFGFGC/
+@754414/2
+GTTGTATTCATATTCCTTCGCCTTTTAATGCCATCCCGAAACGTATGAGCGCGTATATCAAAACGCGCCGAAAAGACTTACCCTGATATAGACTGCGGTTATTAGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTG
++
+CBBCCFFFFFFFGGGGGGGGGGGGHHHHHHHHHHGHHGCGGGGHHHHHHFGGGGGGHHHHHHHHGGGGGGGGGGHGHHHHHGHHHHHHHHHHHHHHGGEEGHHHHHHHHBHHHHHHHHGHHHHHHHGHHHHHHHHHGGGGGHHHHHHGHGF
+@811473/1
+TCGATACGCTGATTGGCTGTTTAATTGCCTTTGGCGGCATGGTCTGGCTGTGGCCGCAATGGCAAAGCGGGCTATTACGTAAAAACGCCCATGATGCGCTGGAAGCCGATCAAGAAGCTATCCGACTGATCCTCAGTAACGATCCGCAGG
++
+BBBBBBDBBBBAGGGGGGECGGHGGHHHHHGGGFFGGGGGHA5GGHFHFFHHHGGGGGGGHHGHHEHHGFGGGFFHHGGHFHHFGGGGGGGHHHHHHGGGFGGHHHGDGGGGHFGHHGHHHHHFGGFGGHHEGHGHDHGHDEEH?AFGGG
+@1390564/2
+CGTCGATCTGGCCCATGCCGGACAGCAGGCGAAACTCGAACCGGATACGCCGTATGGCGATGCGCTTGGCGTTGGTGCCGGTCGTAACTGGGCGCACGTCAACTCTATCGCTTATGACGCGAAAGACGACTCCATCATCCTTTCTTCCCG
++
+>A1AA>>?FFBFGEEGGFFGCCEEAGFHHFC?/EEFHG/EFEE/EE/BFEGCEEGBBGGGGGGGGC?FGHGEGE0EGFBEC<@CCHHCHHHGFCCCCG?AC.G1BFGFF??HAEHHHHGG?CCCGHH?C@EF/BFF0BBFGFF0CBBF/.
+@1246474/1
+GTTCGGTACCGTCATGTTGAAAGACTCGATCATTTTCATGTCGAAGCCGCGGAAGAAGCCGCTCAACACAAACAGCAAAACGATGGCGACCATCATCACTTTGGTGACATGGTTCCAGCCGCTCTCTTCTACGCCTTTACCGATCAAAATA
++
+ABBBADB@BDBBGCEABGDBGDG4BBGDHCHFHGGHFHFHBAEFEAA2AEECEAE1GFHG0EGCEGHHGGEFGEFGH1FHHGGFA/FEEGGEFHHHHHH1GHEHFAFHHHGEHFHHFHHE/DCGHBGHHHHHGGGHGHHHFDGGGCFHFGH
+@859791/2
+TCCCATGGCGTGCGAGGTCATCTGCGGGCAAGAGAAGTTACACTCAATCATATCCGCGCCGGCTTCTTCAACCAGACGCGCCAGTTCCTGCCACTGCTGCTCATTTTCCCCCATGATGGAAGCAATCAGCACCTTATCCGGATAATC
++
+BBBBBFFFFBABCE2EE2EFB5GHCCGCEGGG1EF3BAF5DFGDCBBHHHHFHHHEFGGCGCGGEHFHHHFHGGGHEGGCGGFCHHFFHHHHFHHHHGHEFGHBGHFDDGFG/FGF1DFGFHHHFHHFDHHGHCFFHFHDG?.AGHD
+@517097/1
+GGGCTACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTGTTGTTGTCGTTGGTCGTTCCGTCAGTTTGCATCGTCACCAAATCCTTGAATGGTACTCACGCCGTCGCAATGCGCATCAGGCATGAT
++
+BBBBBFFFFFFFGGGGGGGGGGHGGGGGHGHHHHHHHHHGGGGGHHHHGGCGGFGGGGHHHHHHHHHHHHHHGGGHHGHGGGHHGHHGGHHHHHHHHGHHHGHHEHHHHHHHHHHHHHHFHHHHEHGCCDGGGGGHHGGGGGHHHGHHHEF
+@524923/1
+ATTATGGGGTCCGCGTTGGCGGCGCTGCTGGTGGGATTTTTACAGCAGGGGCTACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTGTTGTTGTCGTTGGTCGTTCCGTCAGTTTGCATCGTCAC
++
+BBCCCFFFDCCCGGGEGGGGGGGGGGGGHHHFGFGHHHHHHHHHHHHHHGGGGHHHHHHHHHHGGGGGHHHGGGGGHGHHHHHHHHHGGGGGHHGHGGCGGGGGGGHHHHHHGHHHHHHHGGGHHGHGCFHHGHHGGHHHGGHGGGGGGG
+@708124/1
+CATTATCACCGTACTGCGCAACACAAACTTTGAAGGTCTGCAAACTATCACGACGCGGCGCAAGAGTTTGTTATCAACTTATAACAGCCATGTTACCTGCTTATACCAGCAATACCATGCCTGTCTGCTATGCTTTTTGGTTATGTAGTGT
++
+B@ABBFFFFFBFGGGGGGGGGGHGHGFHHHHFFGFGGHHHHGHHHHHHHHHGEEAGGGGGCEEGHHEGHHEHHGHFHHEHHHHHHHHGHHHHHHFHHHGHHHHHEHHHGHHFGFFGHHHHHHHHHGHHHHFHBGHHHHGFGEHHFGHHGG>
+@534234/2
+CTACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTGTTGTTGTCGTTGGTCGTTCCGTCAGTTTGCATCGTCACCAAATCCTTGAATGGTACTCACGCCGTCGCAATGCGCATCAGGCATGATTT
++
+CCCCCFFFFFFFGGGGCGGGGGGGGHHHHHHHHHHHGGGGGHHHHGGEGGGGGGGHHGGHHGHHHHHHHGGGGGGHGGGHHFGHGGHHHHHHHHGHHHGEGHHHHHHHHHCGHHHHGHHHFEHGGGGGGG?EHHGGGGCHHFHHHHHGHH
+@591674/2
+TTGCGACGGCGTGAGTACCATTCAAGGATTTGGTGACGATGCAAACTGACGGAACGACCAACGACAACAACAATGAGAAGCGCACCGGACAATGCGCTGGAAGTTTGATTCGGCACTCCGGCCATCTGTAGCCCCTGCTGTAAAAATCCCA
++
+CCCCDCCCCDDCGGGGGGGGGGHHHHHHHHHHHHGHHGGGGGHHHGHHHHGGGGGGGGGGHGGGGGGHHHHHHHHHHHHHHGGGGGGGGGGHHHHGGGGGFHHGHHHHGHGGEGGGHHHGGGGCHHHHHHFHHHGHGHHHHHHHHHHHHHE
+@1241134/2
+TCTTTACGCAATGAAAACCGACTTACGCTCATCTCGCTTTCGGCCAACCGGACAAACAGTGACGGCACCGCATCCCAGGACGTTTTCAGCGCTATTTCTCCCCCCTGCGCCGATGGCTGCCAGTGCAGCAAACGCAGGGGAGGCGCCTGGA
++
+BBCBAFFCBCCCGGGGGGGGFFGGHHGGGGGHHHGFGGHGHGCGEGHGGGGGGGHHGHHFFHHGGGEFFGGGGGHHHGEGHGGGHGHHHHFGGCFGHHHBGHGGGGGFACGC?@ADHHFEHHHBGEH0CAGGHGGCGCFG?DGGFGGD?E/
+@11260/1
+GTCATAAACAATCAGGAACGCTTCGACGGCGTGCATATTGGCGTTACCGCCACGGTAATCTTCGGTTTTGCTAAAGGCTTCGTCCCAGGACTCCAGGCACATCTGCTCTTCTTCACTCCAGAAGTATTTCTCAATCACTTCTATGGTGTAA
++
+AAABCFFFFFCFGGGGGGGGGGGGGHGGGGGGGGGHHHHHHGGGGGGHGGGGGGGGHGHHHHHHGGGGGHHHHHHHHHHHHGHGGGHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHGGHHHHHHHHHHHHHHHHHHHHHHHHH
+@603122/1
+GCGTGGCGTGGTGGGCCTGTTCCCGGCGAACCGTGTGGGTGACGACATCGAAATTTATCGCGACGAAACCCGTACTCATGTTCTGACGGTCAGCCACCACCTGCGCCAGCAGACCGAGAAAGTCGGTTTTGCCAACTACTGTCTGGCGGAT
++
+CCCCCCCBBBBAGGGGGGGGGGHHGGGGGGGGGGGCGGGEEDHGGGGGHGGGGHHHHHHHGGGGGGGGGHGGGGGGHGHHFGHHHGHGGGGGHHHHHHHHGHHHGGGGGGGHFGHGGCGGHHHHGGGGGGFHHGGGGGGGGGGGGGGGG?C
+@340862/1
+CTTTTAAGTTGTAGAAATGTAAATTTATTGTCAACGAACTACACTTTTCTCTTTGGCATCACCGGGAGGGTTGCCTGAAAATCCCGGGATGAGGTTTTCTTAGAAGGACAGTGACGTTATGTTCGCAGCAATCATTATCGGTATTTTTATT
++
+BBBBBFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHGGGGHHHHHHHHHGHHHHHHHHHHHHHHGGGGGGGDHGHHHHHGHHHHHHGGGGGGGHHHHHGHHHGHHGHHHHHGHHHHGGGHHHHHHGGFGGHHHHHHHHHHHGDHGHHHHHHH
+@339284/2
+TAATATATCCGGCCTGAATAAAAAAACCGCCGCTATTACAAGCGGCGGCTCTCAGTTTTTATTTTTTAGCAGCATCTGCGGCTTTAGCGTCAGCCGCATCGGCAGGTTTAGCATCCGCTTTCGGCGCTGGTTTGATATCCAGCAGCTCTA
++
+BBBBBFFFFFA@GGGGGGGGGGHHGGGGGGGGGGGGHHHHHHHGGGFF?EFGHHHHHHHGHHHHHHGHGHHGHEHHGHGGGGGGHHHHGFGGGHH?FGGGGGGGGGCGF/<0<0<C<<.;C0;-:---9-/9F?0FBB0CB0//9/9B0;
+@917927/1
+CTGGAAAAAGAGGTGATGACCCGCCGTCGCGAGATCTTCACCGGCATGGGTATTGAGTTCAAACTTAATACCGAAGTGGGTCGTGATGTACAGCTTGAAGATCTGCTGAAAGATTACGATGCGGTATTCCTTGGCGTCGGCACCTATCAGT
++
+BBBB?FFFFBBFGCGGGGGGGGCEGGEGGGFFGEFHG5GHHHGGGGGEFH?EGHHGFGGHHHGFGHHHHHGHGGFCGHHHEEEEFHHHHGGHHHEFGFHHHGHHHHHHHHHFFFFHHGGGGDFG<AFHHHHHGBGGGGGGCFCEHHHHGHG
+@646590/1
+GAGAAACAAAATCAGCTGGAACAACTGGCTGAGCAGTATGACGAGCTGAAACACGAGTTCGAGAAAAAACTTGAAGCGAAGCGCCGTAAAATCACCCAGGGCGACGATCTGGCGCCGGGCGTGCTGAAGATCGTGAAGGTCTATCTGGCCG
++
+AAAA1C1>>1FFGFGGG1B1F1BGGHHH0FA0F1BFGGHHB1?0EEEHH1FGHFAEEGGHF/GECG00/EGHGECFBEEEEECC?E>E>C>GHHG0<FCFC?/>CGC/GA1FBC//<--@?CC?EBHHHHGHHHAGAFB;:CGHHHFB0CC
+@674753/2
+ACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTGTTGTTGTCGTTGGTCGTTCCGTCAGTTTGCATCGTCACCAAATCCTTGAATGGTACTCACGCCGTCGCAATGCGCATCAGGCATGATTTC
++
+BBBBBFFFFFBBGGGGGGGG?F2FFHHHHHFHHHGGGFGHHHHGGEEGGCGFGHHHHGHHHHHGHGFFFGHHDGCEGHHGGHGGFGHHFFHHGHHGGHHEEFGHHGHFBGHGGHGHHGGEHGCGGGGGGGHB/ECDGFHHHHHGHHFHH
+@522696/1
+GCAGTGGCAGGAACTGGCGCGTCTGGTTGAAGAAGCCGGCGCGGATATGATTGAGTGTAACTTCTCTTGCCCGCAGATGACCTCGCACGCCATGGGAAGCGATGTAGGGCAAAGCCCGTAGCTGGTTGAAAAATACTGCCGCGCCGTAAAA
++
+BBBBBFFBFBB@GGGGGGGGFEEGGHFHGGHHFHGGHGGGGGGGCFGFHHHHHGHEGEGHFHHHFHFHGHHHGGGGGFGFHHGHGGGCCCFFEHHHCHDHGGHGHFFFGFFGHHFHHGDFDEGGHCFGCHHHFGFFGHBGG?@CGG-EEGG
+@680005/2
+CCAATATTTATGGCGGCTCCGGGTCGATTATGGGGTCCGCGTTGGCGGCGCTGCTGGTGGGATTTTTACAGCAGGGGCTACAGATGGCCGGAGGGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTGTTGTTGTCGTTGG
++
+AAAAAFFFFFFFGGGGG0EF0EE0A//FFEFA1CE//FEEAAE/G1>E?GEC//1FHFHGG/1BFFG/1F1B<FFC?<BCFDHD1DCFHCG//-><CCCCGCFGHF0GDGG;/:@-CE0CGHCG-A@-?-AG000CFGBFFBE.909;BBF
+@260823/1
+AAGTAATATTGGTAAACGACAGTAAAATGCCCCCCTTTCCTGACGAAACCACTCGCCAACGGCTTAGCGCCTGTACCGCCAGTCCGGCCTGATTCGCTTTTGCTACCTGCGCTTTATCATCACCTTCAACCTCAATAACCAATTGAATAC
++
+ABCCAFFFFFFFGGGGGGGGGGHHHHHHHHHHGGGGHHHHHHHHGGGGGHHGHHGGGGGGGGGGGHHHGGGGHHHHGGGGGGHHHGGGGGGHHHHGGGHGHHHGHHHHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHGCHHGHGHHH
+@892170/1
+GTATTCAATTGGTTATTGAGGTTGAAGGTGATGATAAAGCGCAGGTAGCAAAAGCGAATCAGGCCGGACTGGCGGTACAGGCGCTAAGCCGTTGGCGAGTGGTTTCGTCAGGAAAGGGGGGCATTTTACTGTCGTTTACCAATATTACTT
++
+AAABCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHGGGGGHHHHGGGGGGHHHGG>?144F?E/EGG33F/<EEG3</<<?F2?G3?0??AG2FGCHGGGG=9/FFFF0BFFFEEDE:0F0FBBBF09FF
+@594165/1
+TCGATACCCCGTAAACGGCGCAGTACCGGTAAAGTGACTATCGCCGATGTAGCCCAACTTGCCGGTGTAGGCACGATGACCGTATCACGAGCCTTACGCACGCCGGAACAGGTCTCTGATAAACTCCGGGAAAAAATCGAAGCGGCAGTG
++
+CCCCCCCFFCCCGGGGGGGFGGGGHHHGGEEGHHHHHHHHHHFGGGGGGGHHHHHGHGHHHHHGGGGGHHHGHHGGHGHHHGGHHHHHGFGGGHHFHGGGGGGGGGG?CBHHHHHGHHHHEHFHHHHGCGG?GFGGHGGFHGGGGGGGFG
+@387540/1
+TTCTTACCCTCCACAGCATAAATGCCGGATGGCGGCTTTACCTTATCAGGCCTACATAAGCACTCGGCTGGTAGGCCTGATAAGCGCAGCGCCATCAGACATTGATTGGCAATTAAGCCTGTTTAGCAGCTTCTGCTGCTTTCACGATCA
++
+BCCCCFFFFFCBGGGGGGGGGGHFHHEGGG?FHGGGGGHHHHHHHHHHG3GFHHHHHHHFHHHHHGGGEGGFFHGHHHGHHHHGHGGGGGGGGGGGHFHHHHFHHHFHHHHHHHHFDHHHHHGHHHGHHHHHHHGHHGHGHHHHHHGHHG
+@1390630/1
+AGCCTGATCAATAGGTTATTATACAAATGATACGCAAACTAATTAGTGGATCACACTAATTATGTTTGGTGTGCTGGAATGATGTACTGAGTACTGCGAAGAATGGGGGATAAACAAAACGCCCACATAAGCGGGCGTTGTTGTTGATAG
++
+CCCCCFFFFFFFGGGBGGGGGGHHHHHHHHGHHGGGGGHHHHHHHHFHGHHHHHGHHHHHHHHHGHHHGGGHEHHHHGHHHHHGHHHGHHHHHHHGHGGGGGHHHHHGGGEHHHHHHHHHGGGGGGGHHHHHGGGGGCGGGHGHHHHHHH
+@878893/1
+GGGCTACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTGTTGTTGTCGTTGGTCGTTCCGTCAGTTTGCATCGTCACCAAATCCTTGAATGGTACTCACGCCGTCGCAATGCGCATCAGGCATGAT
++
+ABAAAFFFFFFFGGGGCGGGGGHGGGGGHHHHHHHHHHGGGGGGHHHHGGGGGGGGGGHHHHHHHHHHGHHHGGGHHGGGGGHHGHHGGGGHFHHHHFHHHGHHHHHHHHHHHHHHHFGFHGHHHHGFFGCGGGGHHDGGGGHHHHHHHHH
+@1469643/2
+GTTCCACATACCGGTCTGAGGTATCAACAACAACATGTTCTGAGTGGTAGCGTTTGCGTTATATCGTCACAGACAGCGCCTCAGGGCGCTGTTTTCGATCGGACATGTCGCTTTCGCAGGAGGGGACGTTATTCGGCGACCAGCCACATAT
++
+A3ABBFFBFFFFEGGGGGGGGGHHGHHGHHHHGDHGFHHHHHHHGHGHHGGGGGGGHGGEGHGHHFGEHGHHHHHGHGGGGGHHGHGEGCFGEHHHGGEFFFG?CHHHHHHGGGHGGGGGFGFC/?/@<FFHHGFHFGGG-;C.C.GFHGG
+@591247/2
+CTCCTCCGGCAGTTCGCCGATGAAACGCGACGGGCGATGGTAGACCTCTTTACCATACAGACGGCGAGTTTCGGCATAGGTTAGCGTCAGTTTCTGCATGGCACGGGTAACGCCGACGTAGGCCAGACGACGCTCCTCTTCCAAACGCCCG
++
+CCCCCFFCBCCCFGGGGGGGGGHHHHGGGGGGGGGGGGGGHFHFHHGHGHHHHHHHHHHGHGGGGGGGGGHHGGGGCHHHHHFHHGGGGGHHHHHFHHHHFFHHGGGDGHHCGGGGGGGHHGFHHHHGGGGGGGGGGGGGGGGFGGFFFFA
+@606169/1
+CAACAAGAGATGCTGAATGCGGTTGGCGCCGAGTCGTTAAACGCGCTGACAGGTCAGATTGTGCCGAAAGACATTCAGCTCGCGACTCCGCCGCAGGTTGGCGAGGCGGCAACCGAATATGCCGCACTGGCGGAATCAAAAGCCATCGCCG
++
+BBBBABFFFFFFGGGBGGGGGFFGGFGCGGGGGGHGGGHGHHGGGGGGGGHHGHHHHHHHHGHFHGG?EEFHFHHHHHHHHGGGGGGGHGGGGGGGGHHHGGGGGGGGGGGGHGGGGGGBFFGGGGG@FFFGGFFFFFFFFEFFFFFDFF;
+@305249/1
+CTCTTCCCCGCGCGTCATCTTTATGTCACAAGATTTGTGCAAATTATGCACAGTGTTACATTGAACTTGTGGATAAAATCACTGTCTGATAAAAGAGTGGGTGATATTCTCGTTGCTCATCGGCTTTGGCACGGTTGTTGCTCGCTGACGG
++
+BBBBBFFFCADDGGGGEGGGGGHHHGHHFHHHHHHHHHGGFHFGHFHGHHHHHHHGHHHHHHFFBGHHHBGCGHHHGHHHGFHHHGHEHHGHFHGGHBEFGEEHFHHHHGGGGFBEHHHHHGEGFGHHGHHHGGGFGGEHFGHDCGGGGG?
+@1327395/1
+GTAAAGTGACTATCGCCGATGTAGCCCAACTTGCCGGTGTAGGCACGATGACCGTATCACGAGCCTTACGCACGCCGGAACAGGTCTCTGATAAACTCCGGGAAAAAATCGAAGCGGCAGTGCATGAGCTGGGCTATATGCCTAATCTCG
++
+BABB?DDF5DDFGFEGGGCCCFFFHHHGHGFHHGC?EEEEHHFHHHGEHFHHGEEHHGHHGGGGCHHHHGGGGGGFGGEECHGHHGBFHGHHGGHGHHHGGGCCHHGCHHGFHECGCCDG<FBGDFFHHHBHDEGHHFHF0GFHFHGBGH
+@926954/2
+CCTTTGGCACTTTGAAAATCTAATCCCGGTTGTTTAGCCATCTGCTACTTATTCCTCGATTTTACCGCCAGCAGCTTCGATAGCAGCACGAGCGCCTTTAGTAACACGCAGGCCACGAACAGTTACCGGAGTAGTGACTTCGCCAGCCAGG
++
+>A?ABBFFFFFFGFGG5FGGGDBG4FGFEEF2EEBHFFFHGHGBFHFGFFADHHHHHGGGBEFF331EECGFFHFHEH0?GG?GFHGFAEGGECEGGGHHHHGBGGBE?EEE/?FFGGD/?GGGGHEGCCC/0DFCGHFFBFGGGGAFHAF
+@1277442/2
+GAGATCGTCCACCAGCACGCCGAGATAAGCCTGAGAACGCGCAGGCGCCCAGCCCTCTTTGTCGGCGGAAAGACGCGCGGCATTCAGACCAGCGAGCAAGCCCTGCGCCGCAGCCTCATCATAGCCGTTAGTACCGTTGATTTGACTAGCA
++
+@AAABF?F@32BFGFCGGE?FEGCE2F53EBGAC2EHGAEGGA00A0E0EEGFFAGE2FHGDGEE////<EAGBEDCC?/CCCH1?1GFGF0GDG@C@/<ECHHFHCCGGCCC-ABF/0;090090C.99.9C0;..9;AFBFF/B/////
+@621975/2
+ATCGTACATAAAGTGTACAGTAAAAACAGGATCTGCTGCGAGGCCAGACGTCGCAATAATACTTTTTGCGCCACGCCATAGCTCACCCACACCATCGCCGCGCCTACGCCAAAAATAACGCCCCAGGTGTAGTCGGTCAGTCGGGTAAAAA
++
+AAAA1CAADFFFGGFFGGGGG3FFHFEGAGGFBGHCE1FGCGCCEGEFFEE/A/AEGFFGH1FFF1@>1/>EFFGGGGGHFHBE1GGFEEGEGE1FE////<</CAHFGGGGFCGHHH1//</<.C.<F<1<1><-<AA/=0.--::CBB0
+@332471/1
+ATACTAATGAAGAGAAAGTACGCGACCATCTGAAAGACAGCTTTGAGGAGGGTGATAACAACCTGTTCAAACTGGGTGCGGAGAATATCTTCCTGGGCCGTAAAGCCGCTAACAAAGAAGAGGCGATTCGCTTTGCCGGTGAACAACTGGT
++
+BABBAFFFFFFFGGGGGGGGGGDGGGGGHHGHHHHHHHHHGHHHHHGHHGGGEFHHHHHHHHGHGHHHHHHHHGHHHFCGGGGGHHHHGHGHHHHGGHFCFEGHHHHGGGGGHGHHHHGHHHGGGGGHHGGGHGHHHGGDFEHHHHHHHG<
+@1038562/1
+TGCCTGATGCGCATTGCGACGGCGTGAGTACCATTCCAGGATTTGGTGACGATGCAAACTGACGGAACGACCAACGACAACAACAATGAGAAGCGCACCGGACAATGCGCTGGAAGTTTGATTCGGCACTCCGGCCATCTGTAGCCCCTG
++
+1AAAAFB11B>AAEGGC?0E0EGGEE/A1DGHHFBB2AGBGGHBAGAEF1AA//?FBECFGGCCE>//F/EEEHGGGGCGFAAG/FGGFHBF0B@C@//<@/C@AGEGCECGCH1<F11=11>GA>-<-CCC.-:;-;G:GGFCGH/CCE
+@166012/1
+CGATTTCTCCGACCTGCGCATCGCGAATCGGAGCGGCAATAACATTAATACTTAATGCACGAAAGCCGGGAGCGATACGGGCCAGTTCCGGGCTGATTGACGGTAACATAGAAGACATCGCATAATCCTGTAATGACTATTTTCTTCTATG
++
+AABBBBFFFB32EAFGGEGGGEEGGCGCGHGGGCGGGGEHHHGHHHHHHHHHFHHHGHFHEDGCGHHEG@EEAEEEFGG??@CFHHHEHGGGGCGHHBFGGFG<GCFBGHH1FDFHFHHFGEGFHHHFFFHHHFBFGHHHGHHHHFCG0CC
+@644528/1
+GCCATATCCGTGTGATTACTGGTGGAAGTCAAACGGAAGGTAAAGGTTACTATTTCGCTCCGACGTTGCTGGCAGACGCAAAACAGGAAGATGCCATCGTGCAACGCGAGGTCTTCGGCCCGGTGGTCAGTATAACCGTCTTTGATGATGA
++
+ABBBBFFFFB?AGGBGGGGGGGBGFHHHFHHHHCGGGGGGFGHHHGGGHHHHHHHHHGGHGGGGGGGHGHHHGHGGFGGGFGHFHHHFHFFHHFHHHHGFGGHHHCEEEGGGHHHHHGGGGGG@CDFHHHGHHHFHHCCFGGFHHFHEHHF
+@1079465/2
+ATTCAAGGATTTGGTGACGATGCAAACTGACGGAACGACCAACGACAACAACAATGAGAAGCGCACCGGACAATGCGCTGGAAGTTTGATTCGGCACTCCGGCCATCTGTAGCCCCTGCTGTAAAAATCCCACCAGCAGCGCCGCCAACG
++
+CCCCCFFFFFFFGGGGGGGGGGGHHHHHHGHGGGGGGGGGGHGGGGGGHHHHHHHHHHHHHHGGGGGGGGGGHHHGGGGGGHHHHHHHHHHHGHGGGHHHGGGGGHHHHHHHGHHGHGHHHHHHHHHHHHHHHGHGHHHHGGGGGGGGGG
+@799043/1
+GATTGTACTGGCGCGCGAGCTTAATTTGAGTCAGATAGCGGCTATTCATCAGGCTACTGACGCCACGATTGAGTTCTTCATTCATGGCGCGCTGTGTGTCGCTTATTCTGGGCAGTGTTATATCTCTCATGCGCAAACCGGGCGCAGCGC
++
+BBBBBFFFFDB4EC?EE2ECGGHHHHGHHGHHGHHHHHHGGGGGHHGHHFFFFBHHHHGHHGGGF1?@HHGFHHHHGHGHHHGHH4EFGGEGGGEHHHHFGHGHCGHHHGEHEHG@FGFHHHFGHHGHHFFHGGCDDHECG?DDGGGGGG
+@158922/1
+TTGTCGAACTGTATCATACCGCCTGGTAATTTTGCCGGATGGCGCTGCGCTTATCCGCTCTACATTTCGTGCAGTTCTGTAG
++
+BBBBBBABFBFFGGFFGGGGGGGGHHHGHHHHHCFHGGCFGGHGGGGGGGGGGHHHGGGGHHHGHHHHHHGGGHHHHHHHHH
+@415633/2
+GGATACCACACAGCAGGAGCAGGACACTAACTACCTGAACGGCCTGCAAGGGTTGCTCAAGACGAAGGACGGCCAGCAGTTGAACCTCAATAATATCGGCAGTACGCCGCTGGCGGAAAAGGTGAAAACCAAAGCTTGCGATCTGGTGTTG
++
+ABCCCFFFFCCCGGGGGGGGGGHGHHHHHHHHHHHHHHHHHGGGGGHEHHGGGGGHHGHHHHHGGGGFHHGGGGGHGHHHHHHHGHHHHHHHGHHHHGGGGGHHHGFGGGGGGDGCFCGHHGHHFHGHFGEHHFEFFBED?GEHHH0CCEA
+@1473573/1
+TCCCATAGCATCCTCATCGGTTCAGAAGCTTTTGCGTGCGGTCGGTTCTGGTCACCAGACCGTTAAATTAGGTGAGTTCGCTTTTCTTACCGGTAATAAATTGGCGTCCGGAATGAACTCATGGAGTCATTTTCAAATAAAAAAGGCCTTT
++
+CCCCCFFFFFFFGGGGGGGGGGGHHHHHHHHHHHHGFGGGGGGGGEEGHHHHHHHHHHHGHGGGGGHHHHHHHHHHHHHGGGHGHHHHHHHGGGGGHHHHHHHHHGGGGGGGGGHHHHHHHHHHHHHHHHGHHHHHHHHHHHHGGGHHHHH
+@215170/1
+GTCTACCGGCGTGCCGTTTTCATCGTAAGGCATGTCTTCGATCGGGTTGATCTTAGAGATAACACCCTTGTTACCGTGGCGACCTGCCATCTTATCACCCGGCTGGATACGGCGTTTAACGGCCAGATAGACCTTCACGATCTTCAGCACG
++
+CBCCCFFCCCCCGGGGGGGGGGHHHHHHHHHHHGHHHHHHHHHGGGHGGFHFHHHHHHFHHHHHHGGHHHHHHGHGFEGGGFGGGHHHHHHHHHHHHHGHGGGGGGGHHHGCGGGGGHHHGGGGFHGHHGHHGHHGHGHGHHHGHHFHGHC
+@66044/1
+TTTGACCACGCATGTTGAATACGAAAAATGCGGCTATTTTACCCATCAACCTGGGGGAGGCAATCAGTGTTTACACAGGAGCTGCTCCAGTTCGCTTAATGACGCCACAGTCCAGGTTGGATGAATACCCGCGGGCTGCTCGCGATGATG
++
+BCCCCFFFCCCBGGGGGGGGGGHGHGGHHHHGGGGGHHHHHHHHHHHGHHHHGHGGGGGGGGHHHHHHHHHHHHHHHHHHGHHHGHHHHHHHHGGGHGGHHHHGGGGGGHHHHHHHHHHGHHHHHHHGFHGGGGGGGGGHHGGGGFGHHH
+@1124735/2
+GAGAAGCGCACCGGACAATGCGCTGGAAGTTTGATTCGGCACTCCGGCCATCTGTAGCCCCTGCTGTAAAAATCCCACCAGCAGCGCCGCCAACGCGGACCCCATAATCGACCCGGAGCCGCCATAAATATTGGCGCCTCCCAGCACAAC
++
+BBACBFFC@DBBEGFGGGGGGGEFGCGGHHHHHHHGHFHGGGHHHGGGFFHEGGHHHGHHGHGGFHHHHGGHHHHFFFGHGHHHHGGGGGCGGGGFGGGGGGGGHHGHHGHGFGCCGCGGG?FGGHHFHFHHEHHGGAGGGEFFFGGGGG
+@589532/2
+ATCCAGACGGGCGCAAATATCTTTAAAGTTAAAGGTATGCGGACCCATCAGTACCGGAATCGCATGAGCGGCGGCCTCCAGCGGGTTATGACCGCCGCGTTCAACCAGCGAACCACCAACAAAGGCGAGATCGGCAATGCCATAGAGCAA
++
+BBCCCFDADCCCGGGGGFGGGGHHHGHHFHHHHHHFFGHFEGGGGGHHHHHHHGHGGGFGHHGGGGFFHCGGGCGGGHHHGHGGGBFHHGHHHGGCGGG@FGHHHHGHHGGGGGFGGEGGEGGFGFCDDGEFFGGGFFFFFFBFFFFFFF
+@1333823/2
+ATGTAGATTCGTCATAGTATCCCTCGCAACAATGTGGTTAATTAATCATCGAATATAGCCTTTGCTATGTTATATAGCACAAGGCATGAATAAATGAAAATAATTCTTATTTGCGTAATGGCGACGATATGCAGTGATAGTGCTAAAGAGG
++
+BC@AAFFFFFCFGGGGGFGGGGHHGGGGGGGHHHHHHEFHHHHHGHGHHHHHGFGHHHHHHGHHGHHHHHGFFGHHHHHHHFHGHFHHHHHHHHGFHFFHHHHFHFHBFHHHGBFDFGGHHFFCGGGFFGHFGH3CDFFFBG3GHEGFFGE
+@861988/2
+ATATTTATCTACCCGGGAAGCCTGGCGGCATCATCCCCTTCATACTCCGCATCATCTTCGCCATCCCGCCCTTCTTCATCTTCTTCATCATGCGCTGCATGTCGTCGAACTGTTTCAGAAGGCGGTTAACGTCCTGCACCTGCATCCCACA
++
+CCCCCFFFFFFFGFEEGFCGGGHHGHGGGGGHHHHHGGGHHHHHHHHHGGGGEHHHHHHHGGFAGHEFGGGGHHHHHGDGHGHHHFGHHHHHHGGGGGGHHHHHFGGGFGHGHHHHHHHHHHHGCCGDHHGHH.>GHGHHHHHHFHFHHHD
+@407449/2
+AGCTGGATGCGTTTGTTGATATTACGCCAGATAATCTTTTGCATCGGATTCAGGCGGACATCCTTGAACTGGAAAGCCATGCGGTGGCGGGCGTAAATCTTGAGGAGTATTCGCGCAGCGACAATAAGCGTCTGCTCGATCCCGAGGATAA
++
+CCCCCFFFFBBBGGGGGGGGGGHGHGGGGGHHHHGHHHHHGHHHHGGEAEHHHHHGCEGGGHHHHHHHHGHFHGHHEFHHHHGGGGGHGGGGGGGCF2FHHGHHHHGFBGGHGD?CGGGFGGGGHFHHHG.AFGH0CDFHGGGGGGGGFFB
+@1187709/1
+ATTTTTACAGCAGGGGCTACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTGTTGTTGTCGTTGGTCGTTCCGTCAGTTTGCATCGTCACCAAATCCTTGAATGGTACTCACGCCGTCGCAATGCG
++
+CDDDDFDFFFFFGGGGGGGGGGHHHHHHGGGGGHHHGGGGGHHHHHHHHHHHGGGGGHHHHGGGGGGGGGGHHHHHHHHHHHHHGGGGHGGHGGGHHGHHGGHHHHHHHHGHHHGHGHHHHHHHHHHHHHHHHHHHHGHGGGGGGGGGHHD
+@1188962/1
+TTTCAAAAGGAAATCATGCCTGATGCGCATTGCGACGGCGTGAGTACCATTCAAGGATTTGGTGACGATGCAAACTGACGGAACGACCAACGACAACAACAATGAGAAGCGCACCGGACAATGCGCTGGAAGTTTGATTCGGCACTCCGG
++
+CCCCCFFFFCFFGGGFGGGGGGFFHHGGGGGHHGGGGFGGEGGGFGGFHGHHHHHHHHHHGGGEHHGGGGGHGHHHHGGGGGGGGGGGGHGGGGGGHHHHHGHHHGGHHHGGGGFGGCGGHHHGGGGGGFFHFFHHGHHFGHGCCHHGGC
+@1209242/1
+ACCAACGACAACAACAATGAGAAGCGCACCGGACAATGCGCTGGAAGTTTGATTCGGCACTCCGGCCATCTGTAGCCCCTGCTGTAAAAATCCCACCAGCAGCGCCGCCAACGCGGACCCCATAATCGACCCGGAGCCGCCATAAATATTG
++
+CCCCCCCCCBCCGGGGGGGGGGHHHGGGGGGGGGGHHHHGGGGGHHHGHHHHHHHGHGGGHHHGGGGGHHHHHHGHHHGHGHHHHHHHHHHHGHHHGHHHHHHGGGGGGGGGGGGGGGGGGGHHHHHEHGGFFGGGGGGGGGGGGGGGGGF
+@389136/2
+CGATACCATGGGCGAATTAATGTTGCTCTATGGCATTGCCGATCTCGCCTTTGTTGGTGGTTCGCTGGTTGAACGCGGCGGTCATAACCCGCTGGAGGCCGCCGCTCATGCGATTCCGGTACTGATGGGTCCGCATACCTTTAACTTTAAA
++
+A?AAADBCF5>4FECGGGGGGGFHHHHCFHFHHCFHFFHHCE?EGFCFGEEGDGHA1AF?EFFEGFGGHHGHBGHGE?GGCBCFFFGHEHCCCDGHE///<?D-@CGEHHGD..CGD/?-A.0000;F.//:;BFGGBBFGGEFBFFGFGG
+@1177857/1
+GCATTATACGGAACGGCTGTAGGCGCAGGCACTCTTTTCCTTCCCATCCAGTTGGGATCGGCAGGCGCAATCGTGCTATTTATTACCGCGCTGGTCGCCTGGCCTCTAACATACTGGCCGCATAAGGCGCTGTGTCAGTTTATTCTTTC
++
+BBBBBFFFFFBBGGCEGGGGGGHHGGGFCEAAGHHHGFHHHGGFHHFHHEHFFFH?EHGGGGGGFCEGGGGFGE?FCGHHHFHHFBGGGGGGGGGFCGGGHHEHHHHHBGHHGHGFBFHCFGGGHDDGDCGGDGHH0GGHFEFHHHFHD
+@1223039/1
+ACAATGAGAAGCGCACCGGACAATGCGCTGGAAGTTTGATTCGGCACTCCGGCCATCTGTAGCCCCTGCTGTAAAAATCCCACCAGCAGCGCCGCCAACGCGGACCCCATAATCGACCCGGAGCCGCCATAAATATTGGCGCCTCCCAGCA
++
+BB@AAFFFFFFFFEEFGGGGGGHHHGGGGGGAGG3GA5DGBHGG?ECCGHDEEGGHHHHFF5@F3FGAFHHDDFGHHHHHHHHGHHHGFFCC@EEGCGGD@DC@DFGGGHHHHF<GF@FCCF?CGGG@CGCFHGHHHHHGG?FGG.AF0CB
+@316425/1
+GTTGGGAGTTCGAGTCTCTCCGCCCCTGCCAGAAATAATCCTTAGCATCTGCTAAGGATTTTTTTTTGCCTAAAATTACCTGATTATCTGATCAGGTAATCGTAAGTTCCCTTCTTTTTCTCTTCATCATTTTCATTGTTCATCCAGCACA
++
+AAABBBBCBFFCGGGGGGGGGGGGGGHGHHHHHHHGHHHHHHGGHHHHFHHHHHHHHHHHHHHGGGGGHHHEHHHHHGHHHHFHHHHHHHHHHHHHGHGHHGHHHFHHHHHHHHHHHHHGHHHHHHHHGHHHHHHHHHHHHHHHHHHGHHF
+@1176776/1
+CTGCTTCAATGATTTGATCTTTAGTGATAGACATTTAAATTGTTCCTGAATATCAGAATAAGTTTATACGTAAGCAAATGCTTGATAAAGACAACTGCGATTACGCAGCTTCTTTTGCATCGCGTACAGCAGCCAGTGTGCGAACCAGTTT
++
+>AA?3DDF5F@FGGGGGGGGGCGGBFHBHH5AGHHCCFFHHFDFG5FGHHHFHHFEFGGFHBFFGHFHGFGAG1GBGGEGHGHHEFFHH5FCFFCBBA1EHAEFG?D@EG3GGHHHHGGHBDEEEG/E?FHFHGHH?BBEGGGGGGHHHEB
+@1335998/2
+GCCAGGTCTGATCAACCAGTTCGCTGCCTTCATCGCTGGCGATCAGGAATCCGCCGGGAGCGGGGCTATTCAGCGACTGGGCGGCACGCGCGGTCTCGCGAGAAATAAACGGCGCCGTTGAGGTCGTGACCAGATTTTCCAGCGACTCTG
++
+A??AAABBDFBFG5CGFFGGGFFFEEGEBFGHFHFFG?2EECECEFBG2FFFEEGGCEGGE/EGCECFHHHH4FE/ECEEEH@B@@?DCCGGCDGGFFGC--;A:CCFB;9.BAGGF9.CEBF/:@-:FFFFAF/BB//B/;BBBC-./9
+@1434731/2
+GAGCAGAAGGAGTGGGTGGCGCTGTGTCGCTTTTGCGGCGATTTGCACTGCAAAAAGCAGAGTGATTTTTTCGATATTATCGGTTTCAAGCAGTATTTGTTTGAACAAACCGAGATGAGCCATGGCACGGTGCGGGAATATGTCGTGCGTT
++
+AAABAFFFFF?AGGGGEEGGGGGFAGGHGHGHGHHHC2EGCFFAGFHHGGFHGHHEEHCGBG4FBGHHGGGFE1FFEF44FHGGGGEFHG?GHHHGHHHFHHHBFHDG0F/CCG//F2@GBFHBGG0GADGH?AC-@-/<GGHGACAECC?
+@1334415/2
+ATTATGGGGTCCGCGTTGGCGGCGCTGCTGGTGGGATTTTTACAGCAGGGGCTACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTGTTGTTGTCGTTGGTCGTTCCGTCAGTTTGCATCGTCAC
++
+?AAB@FB4>AABG?EGGGABGGGGGGCCHCHHFDEHCGHGGD35B3FFHGGG?GFFFFH3FGFCCEGGHGGCGEGGFFFHHHHHGHGDCGGGHBGHGGCGGCDGFGFFB1F<>FHGGAGFGEGGGGFDGGHFFGADDFGFGFHGFGEEGB
+@178294/1
+ATGTAGGGTTGCCAGTGGGCAGGGTAAATAAGGTCGATGATGCCCAGCGAAATATTGTTAATCTGCTCCTGATTATTCTCCCCAAACAGTCCCCAGCGGCGGGGCGTTCCCCGCAGACAGTGAATTTTCCCCAGCGCACTTTTCGACGGCG
++
+CCCCCFFCFFDFGGGGGGGGGGGGHHHHHHHHHHHGGGGHHGGGHHHHGGGGHHHHHHHHHHHHHHHHHHHBGFHGHHHHHGGHGFHHHHHGHHHFHGGGGGDC/<<A.CGH?C-<-.//:00<0:G00C0:C::-----CFGB?.A-;--
+@1293439/1
+AGCATGTAGTACCGAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAACATTCATTCATGATGCATCATGAACCTTAAAAAAGCCTGTAACTTCAATGAGTTGCAGGCTTTTTTGTTGCATGTGTGGTCATGAT
++
+BBB@AFFFFFFFGGGGGGGGGGHHHHHCHHHGGGGGGGGGGHHHHHHFHECGEEFHHHHHHHHHHHHGHHHHHHHHHHHGHHHHHHHGHHHHHHHHFFAGHHHHHHHGHDHHHHHH?FHFHHHGHHHHHGCHHHHFGHHHGHC0GFHGHE
+@1447742/1
+ATTATGGGGTCCGCGTTGGCGGCGCTGCTGGTGGGATTTTTACAGCAGGGGCTACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTGTTGTTGTCGTTGGTCGTTCCGTCAGTTTGCATCGTCAC
++
+CCCCCFFFAABBGGGFGGGGGGGGGGGGHHHGHGGHHHHHHHHHHHHHHGGGGHHHHGHHGHHGGGGGHHHGGGGGHHHGHHGHHHHGGGGGHHHHGGGGGGGGGGHHHHHHHHHHHHHHGGGEGDGGGGHHGHHGGHHHHHHGGGGGGG
+@1455713/2
+ATGCAAACTGACGGAACGACCAACGACAACAACAATGAGAAGCGCACCGGACAATGCGCTGGAAGTTTGATTCGGCACTCCGGCCATCTGTAGCCCCTGCTGTAAAAATCCCACCAGCAGCGCCGCCAACGCGGACCCCATAATCGACCCG
++
+BCBCDFFFFFFFGGGGGGGGGGHGGGGGGHHHHHHHHHHHHGHGGGGGGGGGGHHHHGGGGGHHHGHHHHHHHGHGGGHHHGGGGGGHHHGGHHHHGHGHHHHHHHHHGHHHHHGHHHHHHGGGGGGGGGGFGGGGGGGGGGFFGGGGGGC
+@713379/1
+GATTAGGCATATAGCCCAGCTCATGCACTGCCGCTTCGATTTTTTCCCGGAGTTTATCAGAGACCTGTTCCGGCGTGCGTAAGGCTCGTGATACGGTCATCGTGCCTACACCGGCAAGTTGGGCTACATCGGCGATAGTCACTTTACCGGT
++
+AAAAA11C1CF3GE3ECGGGGF1FFGHFBC1GEGAEGGHBHFFHGFHFEGGGGHHEHHBGHFHFGHGGDFHGCEEEE?@GEGFFHBGGEHG0>GFE</EFHHGGCGGFGFFCB@CBCGFFBGCHFHEFGFCGGCC?E?<=GHHHH0<<E-:
+@808387/1
+ATTGTGGCCTCCGTTATTTGCCGCTGAGCGAGTTGTGGATCAGTTCAAGCCAGTTCGGTACCGTCATGTTGAAAGACTCGATCATTTTCATGTCGAAGCCGCGGAAGAAGCCGCTCAACACAAACAGCAAAACGATGGCGACCATCATCA
++
+CCCCCFBBFFFBGGGGGGGGGGGGGGGHGGEGEGHEFGBBGHHHHHHHHHGHGFHHFGFHGHGGGGHHHHHGHHHGHHHGGHGGHHHHHHHHHGHHGGGHGGGEGGGHGHHGGGGGGFHGGHGGHHHGHHHHHGGHEDHGGGGFGHFHFH
+@1495918/2
+GGCTACAGATGGCCGGAGTGCCGAATCAAACTTCCAGCGCATTGTCCGGTGCGCTTCTCATTGTTGTTGTCGTTGGTCGTTCCGTCAGTTTGCATCGTCACCAAATCCTTGAATGGTACTCACGCCGTCGCAATGCGCATCAGGCATGCTT
++
+AABBAFFB55DFGFGCGCFFBBEFCGGHBGHGHDGHGHGGG?EFHHHGGAE?E0EEFFEHHFHDFGGHHH3EFEHGGHG?>FEFHEGEHFBEGFHGGA/FFHHGHFGFHHGHHBFHDHGHHGHEFGGGGGCC/<BGDGFFGHHGHHHH0DH
+@1270155/2
+AACGTCGACCGCTTCGCGGAAGGTAATGCGACGAATGAAGCATTTTTCACCATTGCCGGCAACGTTGGCGGTATCTGGCTCAAAGTGGCGTTTTCCATCATTGTGGCGTTTGTGTGCGCCGTCGGCAACATTATTACCGCGCAAACGGCGG
++
+BBBBBBBBBBBDEGGGGGGCEEGFGFFHCEEGGFFHHFHHHHHHHHHHGHHHHGHGHGGGEGEGEHHGGGGFGGGBFGGHHHHHHBFHGGGGGGHHHGGHHHHHFGHGGGGGHHFGFGGGCDCCGG@CHHHFHFHFHGGGGGGFGGGGAGF
+@1129781/1
+TCGCGTTTCAGGCGTGAGCAAATGATTTTATCGCTGTTCAGGATCGGCACATCCTGGATAGCCATATTATTGAGGTTCGGATTCTCGACACGGATATTCATTGTCTGAATTAATGAATGGCCGTTAGCGAGAGAGGATTCGTGCTTCTGCG
++
+CCCCCBCCFFFFGGGGGGGGGGHHHHHHHHHHHGHGGHHHHHHHHGGGGGHHHHHHHFHHHHHHHGHHGHHHHHHHHHGGGGGHHHGHGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHEFGHGGGGGHGGGGGGGGHHHHGHGGGHHHHHE
+@972353/1
+GGTAGCGGAATTACTCGATTCATCATGGTTTACGTCAATCACATCAGGGTTAACAATACGCCGCAGCGTAGTAAAAAGATCGGTCGCCAACATGCCGCGAGCGCCATAACGCGCTGCCAGTAAGTCCGCCGCCGCGCCGTGAGCCACACAT
++
+BBBCBFCCCCCFGGGGGGGGGGHHHHHHHHHHHGHHGGHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGGHHHHHGGHHHGGGGGGGGGGHHHHGGGGGGGGGGGHHHGGGGGGGHHGHHHGHHHGGFCFGGGGGGGFGGGGGGGGGGF
+@33636/1
+CCCGCTTATGTGGGCGTTTTGTTTATCCCCCATTCTTCGCAGTACTCAGTACATCATTCCAGCACACCAAACATAATTAGTGTGATCCACTAATTAGTTTGCGTATCATTTGTATAATAACCTATTGATCAGGCTAATAACCGCAGTCTAT
++
+CCCCCCCCFFFFGGGGGGGGGGHHHHHGHGGGHHHHHGHGGG