Mercurial > repos > nml > bio_hansel
diff bio_hansel.xml @ 0:9407a9eaad22 draft
planemo upload for repository https://github.com/phac-nml/bio_hansel commit c35a4502f95471e22dea2d77f36b92c47424cecc
| author | nml |
|---|---|
| date | Wed, 27 Sep 2017 11:50:41 -0400 |
| parents | |
| children | ba271365095e |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bio_hansel.xml Wed Sep 27 11:50:41 2017 -0400 @@ -0,0 +1,252 @@ +<tool id="bio_hansel" name="Hansel - Salmonella Subtyping" version="0.1.0"> + <requirements> + <requirement type="package" version="0.1.0">bio_hansel</requirement> + <requirement type="package" version="17.2.0">attrs</requirement> + </requirements> + <command detect_errors="exit_code"><![CDATA[ + ## Variables to be set. + #set outputResultsName = 'results.tab' + #set outputMatchResultsName = 'match_results.tab' + #set verboseDebuggingLevel = '-vvv' + + ## Preparing file input. + #if $single_or_paired.type == "paired": + + ln -s '$single_or_paired.fastq_input1' fast_q_paired_1.fastq && + ln -s '$single_or_paired.fastq_input2' fast_q_paired_2.fastq && + + #elif $single_or_paired.type == "collection": + + ln -s '$single_or_paired.fastq_input1.forward' fast_q_paired_1.fastq && + ln -s '$single_or_paired.fastq_input1.reverse' fast_q_paired_2.fastq && + + #elif $single_or_paired.type == "single": + + #if $single_or_paired.fastq_input1.is_of_type('fastqsanger') or $single_or_paired.fastq_input1.is_of_type('fastq'): + ln -s '$single_or_paired.fastq_input1' fast_q_single.fastq && + #end if + + #if $single_or_paired.fastq_input1.is_of_type('fasta'): + ln -s '$single_or_paired.fastq_input1' fast_a_single.fasta && + #end if + + #end if + + + ## Checking for custom scheme. + #if $type_of_scheme.scheme_type == "custom": + #if $type_of_scheme.scheme_input.is_of_type('fasta'): + ln -s '$type_of_scheme.scheme_input' custom_scheme.fasta && + #end if + #end if + + + ## Start the actual command here + hansel + + + ## Select the scheme + -s + + #if $type_of_scheme.scheme_type == "heidelberg": + heidelberg + #elif $type_of_scheme.scheme_type == "enteritidis": + enteritidis + #elif $type_of_scheme.scheme_type == "custom": + custom_scheme.fasta + #end if + + + #if $kmer_min + --min-kmer-freq $kmer_min + #end if + + #if $kmer_max + --max-kmer-freq $kmer_max + #end if + + ## Adding more parameters to the command. + $verboseDebuggingLevel -t "\${GALAXY_SLOTS:-1}" -o $outputResultsName -O $outputMatchResultsName + + + ## Entering the file inputs. + #if $single_or_paired.type == "single": + + #if $single_or_paired.fastq_input1.is_of_type('fastqsanger') or $single_or_paired.fastq_input1.is_of_type('fastq'): + fast_q_single.fastq + #end if + + #if $single_or_paired.fastq_input1.is_of_type('fasta'): + fast_a_single.fasta + #end if + + #else + + ##use -p to declare using two files. + -p fast_q_paired_1.fastq fast_q_paired_2.fastq + + #end if + ]]></command> + <inputs> + <conditional name="single_or_paired"> + <param name="type" type="select" label="Specify the read type."> + <option value="single">Single-end Data</option> + <option value="paired">Paired-end Data</option> + <option value="collection">Collection Paired-end Data</option> + </param> + <when value="single"> + <param name="fastq_input1" type="data" format="fastqsanger, fastq, fasta" label="Single end read file(s)"/> + </when> + <when value="paired"> + <param name="fastq_input1" type="data" format="fastqsanger, fastq" label="Forward paired-end read file"/> + <param name="fastq_input2" type="data" format="fastqsanger, fastq" label="Reverse paired-end read file"/> + </when> + <when value="collection"> + <param name="fastq_input1" type="data_collection" label="Paired-end reads collection" optional="false" format="fastqsanger, fastq" collection_type="paired" /> + </when> + </conditional> + <conditional name="type_of_scheme"> + <param name="scheme_type" type="select" label="Specify scheme to use. (Heidelberg is default)"> + <option value="heidelberg">Heidelberg scheme</option> + <option value="enteritidis">Enteritidis scheme</option> + <option value="custom">Specify your own custom scheme</option> + </param> + <when value="heidelberg"/> + <when value="enteritidis"/> + <when value="custom"> + <param name="scheme_input" type="data" format="fasta" label="Scheme Input"/> + </when> + </conditional> + <param name="kmer_min" argument="--min-kmer-freq" optional="True" type="integer" min="0" label="Min k-mer freq/coverage" value="10" help="default = 10"/> + <param name="kmer_max" argument="--max-kmer-freq" optional="True" type="integer" min="1" label="Max k-mer freq/coverage" value="200" help="default = 200"/> + </inputs> + <outputs> + <data format="tabular" name="results.tab" from_work_dir="results.tab" label="results.tab"/> + <data format="tabular" name="match_results.tab" from_work_dir="match_results.tab" label="match_results.tab"/> + </outputs> + <tests> + <test> + <param name="single_or_paired" value="single"/> + <param name="type_of_scheme" value="heidelberg"/> + <param name="fastq_input1" value="SRR1002850_SMALL.fasta"/> + <output name="results.tab"> + <assert_contents> + <!-- Verifying that the columns are as expected. --> + <has_text_matching expression="sample\s+scheme\s+subtype\s+all_subtypes\s+tiles_matching_subtype\s+are_subtypes_consistent\s+inconsistent_subtypes\s+n_tiles_matching_all\s+n_tiles_matching_all_total\s+n_tiles_matching_positive\s+n_tiles_matching_positive_total\s+n_tiles_matching_subtype\s+n_tiles_matching_subtype_total\s+file_path"/> + <!-- Verifying that the output of running the test file is expected. This is done via REGEX because the name and path of the file outputted to results.tab changes each test. --> + <has_text_matching expression="(heidelberg)\s+(2.2.2.2.1.4)\s+(2;)\s+(2.2;)\s+(2.2.2;)\s+(2.2.2.2;)\s+(2.2.2.2.1;)\s+(2.2.2.2.1.4)\s+(1037658-2.2.2.2.1.4;)\s+(2154958-2.2.2.2.1.4;)\s+(3785187-2.2.2.2.1.4)\s+(True)\s+(202)\s+(202)\s+(17)\s+(17)\s+(3)\s+(3)"/> + </assert_contents> + </output> + <output name="match_results.tab"> + <assert_contents> + <!-- This is the last line in the file, this assertion is to make sure that we have the correct number of items. --> + <has_text_matching expression="negative4738855-1.1"/> + </assert_contents> + </output> + </test> + </tests> + <help><![CDATA[ +*********************************************************** + bio_hansel - Heidelberg And eNteritidis Snp ELucidation +*********************************************************** + +Subtype *Salmonella enterica* subsp. enterica serovar Heidelberg and Enteritidis genomes using *in-silico* 33 bp k-mer SNP subtyping schemes developed by Genevieve Labbe et al. +Subtype *Salmonella* genome assemblies (FASTA files) and/or whole-genome sequencing reads (FASTQ files)! + +Github +======== +https://github.com/phac-nml/bio_hansel + +Citation +======== + +If you find this tool useful, please cite as: + + .. epigraph:: + + A robust genotyping scheme for *Salmonella enterica* serovar Heidelberg clones circulating in North America. + Geneviève Labbé, James Robertson, Peter Kruczkiewicz, Chad R. Laing, Kim Ziebell, Aleisha R. Reimer, Lorelee Tschetter, Gary Van Domselaar, Sadjia Bekal, Kimberley A. MacDonald, Linda Hoang, Linda Chui, Danielle Daignault, Durda Slavic, Frank Pollari, E. Jane Parmley, Philip Mabon, Elissa Giang, Lok Kan Lee, Jonathan Moffat, Marisa Rankin, Joanne MacKinnon, Roger Johnson, John H.E. Nash. + [Manuscript in preparation] + +Usage +===== +Enter your FASTQ/FASTA read files, select which scheme you would like to use (e.g. heidelberg, enteritidis, etc...) or specify your own. Finally, click execute. + + +Example Usage +============= + +Analysis of a single FASTA file +------------------------------- + + +Contents of ``results.tab``: + + sample scheme subtype all_subtypes tiles_matching_subtype are_subtypes_consistent inconsistent_subtypes n_tiles_matching_all n_tiles_matching_all_total n_tiles_matching_positive n_tiles_matching_positive_total n_tiles_matching_subtype n_tiles_matching_subtype_total file_path + + SRR1002850 heidelberg 2.2.2.2.1.4 2; 2.2; 2.2.2; 2.2.2.2; 2.2.2.2.1; 2.2.2.2.1.4 1037658-2.2.2.2.1.4; 2154958-2.2.2.2.1.4; 3785187-2.2.2.2.1.4 True 202 202 17 17 3 3 SRR1002850.fasta + + +Contents of ``match_results.tab``: + + tilename stitle pident length mismatch gapopen qstart qend sstart send evalue bitscore qlen slen seq coverage is_trunc refposition subtype is_pos_tile sample file_path scheme + + 775920-2.2.2.2 NODE_2_length_512016_cov_46.4737_ID_3 100.0 33 0 0 1 33 474875 474907 2.0000000000000002e-11 62.1 33 512016 GTTCAGGTGCTACCGAGGATCGTTTTTGGTGCG 1.0 False 775920 2.2.2.2 + + True SRR1002850 SRR1002850.fasta heidelberg + + negative3305400-2.1.1.1 NODE_3_length_427905_cov_48.1477_ID_5 100.0 33 0 0 1 33 276235 276267 2.0000000000000002e-11 62.1 33 427905 CATCGTGAAGCAGAACAGACGCGCATTCTTGCT 1.0 False + + negative3305400 2.1.1.1 False SRR1002850 SRR1002850.fasta heidelberg + + negative3200083-2.1 NODE_3_length_427905_cov_48.1477_ID_5 100.0 33 0 0 1 33 170918 170950 2.0000000000000002e-11 62.1 33 427905 ACCCGGTCTACCGCAAAATGGAAAGCGATATGC 1.0 False + + negative3200083 2.1 False SRR1002850 SRR1002850.fasta heidelberg + + negative3204925-2.2.3.1.5 NODE_3_length_427905_cov_48.1477_ID_5 100.0 33 0 0 1 33 175760 175792 2.0000000000000002e-11 62.1 33 427905 CTCGCTGGCAAGCAGTGCGGGTACTATCGGCGG 1.0 False + + negative3204925 2.2.3.1.5 False SRR1002850 SRR1002850.fasta heidelberg + + negative3230678-2.2.2.1.1.1 NODE_3_length_427905_cov_48.1477_ID_5 100.0 33 0 0 1 33 201513 201545 2.0000000000000002e-11 62.1 33 427905 AGCGGTGCGCCAAACCACCCGGAATGATGAGTG 1.0 False + + negative3230678 2.2.2.1.1.1 False SRR1002850 SRR1002850.fasta heidelberg + + negative3233869-2.1.1.1.1 NODE_3_length_427905_cov_48.1477_ID_5 100.0 33 0 0 1 33 204704 204736 2.0000000000000002e-11 62.1 33 427905 CAGCGCTGGTATGTGGCTGCACCATCGTCATTA 1.0 False + + [Next 196 lines omitted.] + + +Analysis of a single FASTQ readset +---------------------------------- + +Contents of ``results.tab``: + + sample scheme subtype all_subtypes tiles_matching_subtype are_subtypes_consistent inconsistent_subtypes n_tiles_matching_all n_tiles_matching_all_total n_tiles_matching_positive n_tiles_matching_positive_total n_tiles_matching_subtype n_tiles_matching_subtype_total file_path + + SRR5646583 heidelberg 2.2.1.1.1.1 2; 2.2; 2.2.1; 2.2.1.1; 2.2.1.1.1; 2.2.1.1.1.1 1983064-2.2.1.1.1.1; 4211912-2.2.1.1.1.1 True 202 202 20 20 2 2 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger + + +Contents of ``match_results.tab``: + + seq freq sample file_path tilename is_pos_tile subtype refposition is_kmer_freq_okay scheme + + ACGGTAAAAGAGGACTTGACTGGCGCGATTTGC 68 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 21097-2.2.1.1.1 True 2.2.1.1.1 21097 True heidelberg + + AACCGGCGGTATTGGCTGCGGTAAAAGTACCGT 77 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 157792-2.2.1.1.1 True 2.2.1.1.1 157792 True heidelberg + + CCGCTGCTTTCTGAAATCGCGCGTCGTTTCAAC 67 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 293728-2.2.1.1 True 2.2.1.1 293728 True heidelberg + + GAATAACAGCAAAGTGATCATGATGCCGCTGGA 91 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 607438-2.2.1 True 2.2.1 607438 True heidelberg + + CAGTTTTACATCCTGCGAAATGCGCAGCGTCAA 87 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 691203-2.2.1.1 True 2.2.1.1 691203 True heidelberg + + CAGGAGAAAGGATGCCAGGGTCAACACGTAAAC 33 SRR5646583 SRR5646583_forward.fastqsanger; SRR5646583_reverse.fastqsanger 944885-2.2.1.1.1 True 2.2.1.1.1 944885 True heidelberg + + [Next 200 lines omitted.] + + +Wrapper written by Matthew Gopez at the Public Health Agency of Canada, National Microbiology Laboratory. + ]]></help> + <citations> + </citations> +</tool> \ No newline at end of file