Mercurial > repos > nml > biohansel

changeset 8:4fa9d5e748d4 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/phac-nml/biohansel commit 759c65786566b73806fccaed05802fe01ec4226a
author nml
date Tue, 21 May 2019 15:05:40 -0400
parents 3360158bb0c5
children e305df0b1af7
files biohansel.xml test-data/SRR1002850_SMALL.fasta-match_results.tab test-data/SRR1002850_SMALL.fasta-results.tab test-data/SRR5646583_SMALL-match_results.tab test-data/SRR5646583_SMALL-results.tab test-data/SRR5646583_SMALL-tech_results.tab
diffstat 6 files changed, 34 insertions(+), 31 deletions(-) [+]
line wrap: on
line diff
--- a/biohansel.xml	Mon May 13 09:42:08 2019 -0400
+++ b/biohansel.xml	Tue May 21 15:05:40 2019 -0400
@@ -1,7 +1,7 @@
-<tool id="biohansel" name="biohansel" version="2.1.6">
+<tool id="biohansel" name="biohansel" version="2.2.0">
   <description>SNP subtyping of genome sequence reads or assemblies</description>
   <requirements>
-    <requirement type="package" version="2.1.1">bio_hansel</requirement>
+    <requirement type="package" version="2.2.0">bio_hansel</requirement>
   </requirements>
   <command detect_errors="exit_code">
 <![CDATA[
@@ -129,14 +129,14 @@
 #if $qc_vals.low_cov_depth_freq
   --low-cov-depth-freq $qc_vals.low_cov_depth_freq
 #end if
-#if $qc_vals.max_missing_tiles
-  --max-missing-tiles $qc_vals.max_missing_tiles
+#if $qc_vals.max_missing_kmers
+  --max-missing-kmers $qc_vals.max_missing_kmers
 #end if
-#if $qc_vals.min_ambiguous_tiles
-  --min-ambiguous-tiles $qc_vals.min_ambiguous_tiles
+#if $qc_vals.min_ambiguous_kmers
+  --min-ambiguous-kmers $qc_vals.min_ambiguous_kmers
 #end if
-#if $qc_vals.max_intermediate_tiles
-  --max-intermediate-tiles $qc_vals.max_intermediate_tiles
+#if $qc_vals.max_intermediate_kmers
+  --max-intermediate-kmers $qc_vals.max_intermediate_kmers
 #end if
 #if $qc_vals.low_coverage_warning
   --low-cov-warning $qc_vals.low_coverage_warning
@@ -200,6 +200,9 @@
           label="Included SNP Subtyping Scheme">
           <option value="heidelberg">Salmonella Heidelberg subtyping scheme</option>
           <option value="enteritidis">Salmonella Enteritidis subtyping scheme</option>
+          <option value="typhi">Salmonella Typhi subtyping scheme</option>
+          <option value="typhimurium">Salmonella Typhimurium subtyping scheme</option>
+          <option value="tb_speciation">Mycobacterium Tuberculosis subtyping scheme</option>
         </param>
       </when>
       <when value="custom">
@@ -237,28 +240,28 @@
         optional="true"
         label="QC: Frequency below this coverage are considered low coverage"
         help="default = 20"/>
-      <param name="min_ambiguous_tiles" type="integer"
-        argument="--min-ambiguous-tiles"
+      <param name="min_ambiguous_kmers" type="integer"
+        argument="--min-ambiguous-kmers"
         optional="true"
         value="3" min="0"
-        label="QC: Min number of tiles missing for Ambiguous Result"
+        label="QC: Min number of kmers missing for Ambiguous Result"
         help="default = 3"/>
-      <param name="max_missing_tiles" type="float"
-        argument="--max-missing-tiles"
+      <param name="max_missing_kmers" type="float"
+        argument="--max-missing-kmers"
         optional="true"
         value="0.05" min="0" max="1"
-        label="QC: Decimal Proportion of max allowed missing tiles" help="default = 0.05, valid values {0.0 - 1.0}"/>
-      <param name="max_intermediate_tiles" type="float"
-        argument="--max-intermediate-tiles"
+        label="QC: Decimal Proportion of max allowed missing kmers" help="default = 0.05, valid values {0.0 - 1.0}"/>
+      <param name="max_intermediate_kmers" type="float"
+        argument="--max-intermediate-kmers"
         optional="true"
         value="0.05" min="0" max="1"
-        label="QC: Decimal Proportion of max allowed missing tiles for an intermediate subtype"
+        label="QC: Decimal Proportion of max allowed missing kmers for an intermediate subtype"
         help="default = 0.05, valid values {0.0 - 1.0}"/> 
       <param name="low_coverage_warning" type="integer"
         argument="--low-cov-warning"
         optional="true"
         value="20"
-        label="QC: Overall tile coverage below this value will trigger a low coverage warning"
+        label="QC: Overall kmer coverage below this value will trigger a low coverage warning"
         help="default = 20"/> 
     </section>
     <section name="dev_args" title="Developer Options" expanded="False">
@@ -342,11 +345,11 @@
 **Usage**
 
 1) Select the sequence data you wish to subtype (FASTAs or FASTQs)
-2) Select subtyping scheme (e.g. *Salmonella enterica* serovar Heidelberg subtyping scheme, *Salmonella enterica* serovar Enteritidis subtyping scheme, or your own custom `biohansel` compatible subtyping scheme)
+2) Select subtyping scheme (e.g. *Salmonella enterica* serovar Heidelberg, Enteritidis, Typhimurium, or Typhi subtyping scheme, or your own custom `biohansel` compatible subtyping scheme)
 3) [Optional] Select your subtype metadata information table to include subtype metadata along with your subtype results
 4) Click ``Execute``
 
-For more information, visit `the biohansel project page <https://github.com/phac-nml/biohansel>`_.
+For more information, visit `the biohansel project page <https://github.com/phac-nml/biohansel>`_ or the `biohansel read the docs page <https://bio-hansel.readthedocs.io/en/readthedocs/>`_.
 
 
 **Example analysis results of a single FASTA file**
@@ -354,7 +357,7 @@
 Contents of ``results.tab``:
 
     +------------------+------------+----------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+-------------------------------+---------------------------+------------------------------------+--------------------------+-----------------------------------+------------------------+-----------+------------+
-    | sample           | scheme     | scheme_version | subtype     | all_subtypes                                   | tiles_matching_subtype                                        | are_subtypes_consistent | inconsistent_subtypes | n_tiles_matching_all | n_tiles_matching_all_expected | n_tiles_matching_positive | n_tiles_matching_positive_expected | n_tiles_matching_subtype | n_tiles_matching_subtype_expected | file_path              | qc_status | qc_message |
+    | sample           | scheme     | scheme_version | subtype     | all_subtypes                                   | kmers_matching_subtype                                        | are_subtypes_consistent | inconsistent_subtypes | n_kmers_matching_all | n_kmers_matching_all_expected | n_kmers_matching_positive | n_kmers_matching_positive_expected | n_kmers_matching_subtype | n_kmers_matching_subtype_expected | file_path              | qc_status | qc_message |
     +------------------+------------+----------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+-------------------------------+---------------------------+------------------------------------+--------------------------+-----------------------------------+------------------------+-----------+------------+
     | SRR1002850_SMALL | heidelberg | 0.5.0          | 2.2.2.2.1.4 | 2; 2.2; 2.2.2; 2.2.2.2; 2.2.2.2.1; 2.2.2.2.1.4 | 2154958-2.2.2.2.1.4; 1037658-2.2.2.2.1.4; 3785187-2.2.2.2.1.4 | True                    |                       | 202                  | 202                           | 17                        | 17                                 | 3                        | 3                                 | SRR1002850_SMALL.fasta | PASS      |            |
     +------------------+------------+----------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+-------------------------------+---------------------------+------------------------------------+--------------------------+-----------------------------------+------------------------+-----------+------------+
@@ -363,7 +366,7 @@
 Contents of ``match_results.tab``:
 
     +---------------------------+-----------------------------------+------------+---------------------------------------+-------------+-------------+-------------+-------------+------------------+------------------------+------------+----------------+-----------+------------+
-    | tilename                  | seq                               | is_revcomp | contig_id                             | match_index | refposition | subtype     | is_pos_tile | sample           | file_path              | scheme     | scheme_version | qc_status | qc_message |
+    | kmername                  | seq                               | is_revcomp | contig_id                             | match_index | refposition | subtype     | is_pos_kmer | sample           | file_path              | scheme     | scheme_version | qc_status | qc_message |
     +---------------------------+-----------------------------------+------------+---------------------------------------+-------------+-------------+-------------+-------------+------------------+------------------------+------------+----------------+-----------+------------+
     | 2154958-2.2.2.2.1.4       | GGCGCGCCACGGTTACTCCCCGGTGGTCAGCCG | True       | NODE_1_length_726282_cov_40.4705_ID_1 | 13732       | 2154958     | 2.2.2.2.1.4 | True        | SRR1002850_SMALL | SRR1002850_SMALL.fasta | heidelberg | 0.5.0          | PASS      |            |
     +---------------------------+-----------------------------------+------------+---------------------------------------+-------------+-------------+-------------+-------------+------------------+------------------------+------------+----------------+-----------+------------+
@@ -380,7 +383,7 @@
 Contents of ``results.tab``:
 
     +------------------+------------+----------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+-------------------------------+---------------------------+------------------------------------+--------------------------+-----------------------------------+----------------------------------------------------------+-------------------+-----------+------------+
-    | sample           | scheme     | scheme_version | subtype     | all_subtypes                                   | tiles_matching_subtype                   | are_subtypes_consistent | inconsistent_subtypes | n_tiles_matching_all | n_tiles_matching_all_expected | n_tiles_matching_positive | n_tiles_matching_positive_expected | n_tiles_matching_subtype | n_tiles_matching_subtype_expected | file_path                                                | avg_tile_coverage | qc_status | qc_message |
+    | sample           | scheme     | scheme_version | subtype     | all_subtypes                                   | kmers_matching_subtype                   | are_subtypes_consistent | inconsistent_subtypes | n_kmers_matching_all | n_kmers_matching_all_expected | n_kmers_matching_positive | n_kmers_matching_positive_expected | n_kmers_matching_subtype | n_kmers_matching_subtype_expected | file_path                                                | avg_kmer_coverage | qc_status | qc_message |
     +------------------+------------+----------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+-------------------------------+---------------------------+------------------------------------+--------------------------+-----------------------------------+----------------------------------------------------------+-------------------+-----------+------------+
     | SRR5646583_SMALL | heidelberg | 0.5.0          | 2.2.1.1.1.1 | 2; 2.2; 2.2.1; 2.2.1.1; 2.2.1.1.1; 2.2.1.1.1.1 | 1983064-2.2.1.1.1.1; 4211912-2.2.1.1.1.1 | True                    |                       | 202                  | 202                           | 20                        | 20                                 | 2                        | 2                                 | ['SRR5646583_SMALL_1.fastq', 'SRR5646583_SMALL_2.fastq'] | 42.631            | PASS      |            |
     +------------------+------------+----------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+-------------------------------+---------------------------+------------------------------------+--------------------------+-----------------------------------+----------------------------------------------------------+-------------------+-----------+------------+
@@ -388,7 +391,7 @@
 Contents of ``match_results.tab``:
 
     +---------------------+-----------------------------------+------+-------------+-----------+-------------+-------------------+------------------+------------+----------------+-----------+------------+
-    | tilename            | seq                               | freq | refposition | subtype   | is_pos_tile | is_kmer_freq_okay | sample           | scheme     | scheme_version | qc_status | qc_message |
+    | kmername            | seq                               | freq | refposition | subtype   | is_pos_kmer | is_kmer_freq_okay | sample           | scheme     | scheme_version | qc_status | qc_message |
     +---------------------+-----------------------------------+------+-------------+-----------+-------------+-------------------+------------------+------------+----------------+-----------+------------+
     | negative4642573-1.2 | TACCAGGAAGTGCTGGAAGAGTTTAACGAACAT | 62   | 4642573     | 1.2       | False       | True              | SRR5646583_SMALL | heidelberg | 0.5.0          | PASS      |            |
     +---------------------+-----------------------------------+------+-------------+-----------+-------------+-------------------+------------------+------------+----------------+-----------+------------+
@@ -424,8 +427,8 @@
   <citations>
     <citation type="bibtex">@ARTICLE{a1,
       title = {A robust genotyping scheme for Salmonella enterica serovar Heidelberg clones circulating in North America},
-      author = {Geneviève Labbé, James Robertson, Peter Kruczkiewicz, Marisa Rankin, Matthew Gopez, Chad R. Laing, Philip Mabon, Kim Ziebell, Aleisha R. Reimer, Lorelee Tschetter, Gary Van Domselaar, Sadjia Bekal, Kimberley A. MacDonald, Linda Hoang, Linda Chui, Danielle Daignault, Durda Slavic, Frank Pollari, E. Jane Parmley, Elissa Giang, Lok Kan Lee, Jonathan Moffat, Joanne MacKinnon, Roger Johnson, John H.E. Nash},
-      url = {https://github.com/phac-nml/bio_hansel}
+      author = {Geneviève Labbé, James Robertson, Peter Kruczkiewicz, Marisa Rankin, Matthew Gopez, Chad R. Laing, Philip Mabon, Kim Ziebell, Aleisha R. Reimer, Lorelee Tschetter, Gary Van Domselaar, Sadjia Bekal, Kimberley A. MacDonald, Linda Hoang, Linda Chui, Danielle Daignault, Durda Slavic, Frank Pollari, E. Jane Parmley, David Son, Darian Hole, Elissa Giang, Lok Kan Lee, Jonathan Moffat, Joanne MacKinnon, Roger Johnson, John H.E. Nash},
+      url = {https://github.com/phac-nml/biohansel}
       }
     }</citation>
   </citations>
--- a/test-data/SRR1002850_SMALL.fasta-match_results.tab	Mon May 13 09:42:08 2019 -0400
+++ b/test-data/SRR1002850_SMALL.fasta-match_results.tab	Tue May 21 15:05:40 2019 -0400
@@ -1,4 +1,4 @@
-tilename	seq	is_revcomp	contig_id	match_index	refposition	subtype	is_pos_tile	sample	file_path	scheme	scheme_version	qc_status	qc_message
+kmername	seq	is_revcomp	contig_id	match_index	refposition	subtype	is_pos_kmer	sample	file_path	scheme	scheme_version	qc_status	qc_message
 2154958-2.2.2.2.1.4	GGCGCGCCACGGTTACTCCCCGGTGGTCAGCCG	True	NODE_1_length_726282_cov_40.4705_ID_1	13732	2154958	2.2.2.2.1.4	True	SRR1002850_SMALL	SRR1002850_SMALL.fasta	heidelberg	0.5.0	PASS	
 negative2131791-2.2.3.1.3	GCTGGGCGAAATGATGCAGTTCACCACTTGCTC	True	NODE_1_length_726282_cov_40.4705_ID_1	36900	2131791	2.2.3.1.3	False	SRR1002850_SMALL	SRR1002850_SMALL.fasta	heidelberg	0.5.0	PASS	
 2069216-2.2.2	ATACTTAGGCTGTCAGTAACCCGTGAGGTAGTG	True	NODE_1_length_726282_cov_40.4705_ID_1	99475	2069216	2.2.2	True	SRR1002850_SMALL	SRR1002850_SMALL.fasta	heidelberg	0.5.0	PASS	
--- a/test-data/SRR1002850_SMALL.fasta-results.tab	Mon May 13 09:42:08 2019 -0400
+++ b/test-data/SRR1002850_SMALL.fasta-results.tab	Tue May 21 15:05:40 2019 -0400
@@ -1,2 +1,2 @@
-sample	scheme	scheme_version	subtype	all_subtypes	tiles_matching_subtype	are_subtypes_consistent	inconsistent_subtypes	n_tiles_matching_all	n_tiles_matching_all_expected	n_tiles_matching_positive	n_tiles_matching_positive_expected	n_tiles_matching_subtype	n_tiles_matching_subtype_expected	file_path	qc_status	qc_message
+sample	scheme	scheme_version	subtype	all_subtypes	kmers_matching_subtype	are_subtypes_consistent	inconsistent_subtypes	n_kmers_matching_all	n_kmers_matching_all_expected	n_kmers_matching_positive	n_kmers_matching_positive_expected	n_kmers_matching_subtype	n_kmers_matching_subtype_expected	file_path	qc_status	qc_message
 SRR1002850_SMALL	heidelberg	0.5.0	2.2.2.2.1.4	2; 2.2; 2.2.2; 2.2.2.2; 2.2.2.2.1; 2.2.2.2.1.4	2154958-2.2.2.2.1.4; 1037658-2.2.2.2.1.4; 3785187-2.2.2.2.1.4	True		202	202	17	17	3	3	SRR1002850_SMALL.fasta	PASS	
--- a/test-data/SRR5646583_SMALL-match_results.tab	Mon May 13 09:42:08 2019 -0400
+++ b/test-data/SRR5646583_SMALL-match_results.tab	Tue May 21 15:05:40 2019 -0400
@@ -1,4 +1,4 @@
-tilename	seq	freq	refposition	subtype	is_pos_tile	is_kmer_freq_okay	sample	scheme	scheme_version	qc_status	qc_message
+kmername	seq	freq	refposition	subtype	is_pos_kmer	is_kmer_freq_okay	sample	scheme	scheme_version	qc_status	qc_message
 negative4642573-1.2	TACCAGGAAGTGCTGGAAGAGTTTAACGAACAT	62	4642573	1.2	False	True	SRR5646583_SMALL	heidelberg	0.5.0	PASS	
 21097-2.2.1.1.1	GCAAATCGCGCCAGTCAAGTCCTCTTTTACCGT	42	21097	2.2.1.1.1	True	True	SRR5646583_SMALL	heidelberg	0.5.0	PASS	
 negative3647258-2.2.2.2.2.1	TACGGGTAACTGTTATCGGTAACATTGTCCAAC	64	3647258	2.2.2.2.2.1	False	True	SRR5646583_SMALL	heidelberg	0.5.0	PASS	
--- a/test-data/SRR5646583_SMALL-results.tab	Mon May 13 09:42:08 2019 -0400
+++ b/test-data/SRR5646583_SMALL-results.tab	Tue May 21 15:05:40 2019 -0400
@@ -1,2 +1,2 @@
-sample	scheme	scheme_version	subtype	all_subtypes	tiles_matching_subtype	are_subtypes_consistent	inconsistent_subtypes	n_tiles_matching_all	n_tiles_matching_all_expected	n_tiles_matching_positive	n_tiles_matching_positive_expected	n_tiles_matching_subtype	n_tiles_matching_subtype_expected	file_path	avg_tile_coverage	qc_status	qc_message
+sample	scheme	scheme_version	subtype	all_subtypes	kmers_matching_subtype	are_subtypes_consistent	inconsistent_subtypes	n_kmers_matching_all	n_kmers_matching_all_expected	n_kmers_matching_positive	n_kmers_matching_positive_expected	n_kmers_matching_subtype	n_kmers_matching_subtype_expected	file_path	avg_kmer_coverage	qc_status	qc_message
 SRR5646583_SMALL	heidelberg	0.5.0	2.2.1.1.1.1	2; 2.2; 2.2.1; 2.2.1.1; 2.2.1.1.1; 2.2.1.1.1.1	1983064-2.2.1.1.1.1; 4211912-2.2.1.1.1.1	True		202	202	20	20	2	2	['SRR5646583_SMALL_1.fastq', 'SRR5646583_SMALL_2.fastq']	42.631	PASS	
--- a/test-data/SRR5646583_SMALL-tech_results.tab	Mon May 13 09:42:08 2019 -0400
+++ b/test-data/SRR5646583_SMALL-tech_results.tab	Tue May 21 15:05:40 2019 -0400
@@ -1,2 +1,2 @@
-sample	subtype	avg_tile_coverage	qc_status	qc_message
+sample	subtype	avg_kmer_coverage	qc_status	qc_message
 SRR5646583_SMALL	2.2.1.1.1.1	42.631	PASS