Mercurial > repos > peterjc > count_roi_variants
view tools/count_roi_variants/count_roi_variants.py @ 0:95efbdb72961 draft
v0.0.4 - Previously only on Test Tool Shed
author | peterjc |
---|---|
date | Wed, 01 Feb 2017 07:10:26 -0500 |
parents | |
children | 3ee6f4d0ac80 |
line wrap: on
line source
#!/usr/bin/env python """Count sequence variants in region of interest in a BAM file. This script takes exactly four command line arguments: * Input BAM filename * Input BAI filename (via Galaxy metadata) * Output tabular filename * Region of interest (reference:start-end as used in samtools) This messes about with the filenames to make samtools happy, then runs "samtools view" and parses the reads mapped to the ROI, counts the observed variants spanning the ROI, and outputs this as a tabular file. """ import sys import os import subprocess import tempfile if "-v" in sys.argv or "--version" in sys.argv: # Galaxy seems to invert the order of the two lines print("BAM coverage statistics v0.0.4 (using samtools)") cmd = "samtools 2>&1 | grep -i ^Version" sys.exit(os.system(cmd)) # TODO - Proper command line API usage = """Requires 4 arguments: BAM, BAI, tabular filename, samtools-style region For ease of use, you can use a minus sign as the BAI filename which will use the BAM filename with the suffix .bai added to it. Example using one of the test-data files: $ count_roi_variants.py "SRR639755_mito_pairs_vs_NC_010642_clc.bam" "-" "counts.txt" "gi|187250362|ref|NC_010642.1|:1695-1725" Counted 3 variants from 16 reads spanning gi|187250362|ref|NC_010642.1|:1695-1725 $ cat counts.txt Variant Count Percentage AGCCCATGAGATGGGAAGCAATGGGCTACA 14 87.50 AGCCCATGAGATGGGAAGCAATGGGCTACG 1 6.25 AGCGCATGAGATGGGAAGCAATGGGCTACG 1 6.25 """ if len(sys.argv) == 5: bam_filename, bai_filename, tabular_filename, region = sys.argv[1:] else: sys.exit(usage) if not os.path.isfile(bam_filename): sys.exit("Input BAM file not found: %s" % bam_filename) if bai_filename == "-": # Make this optional for ease of use at the command line by hand: if os.path.isfile(bam_filename + ".bai"): bai_filename = bam_filename + ".bai" if not os.path.isfile(bai_filename): if bai_filename == "None": sys.exit("Error: Galaxy did not index your BAM file") sys.exit("Input BAI file not found: %s" % bai_filename) try: # Sanity check we have "ref:start-end" to give clear error message # Note can have semi-colon in the reference name # Note can have thousand separator commas in the start/end ref, start_end = region.rsplit(":", 1) start, end = start_end.split("-") start = int(start.replace(",", "")) end = int(end.replace(",", "")) except ValueError: sys.exit("Bad argument for region: %r" % region) # Assign sensible names with real extensions, and setup symlinks: tmp_dir = tempfile.mkdtemp() bam_file = os.path.join(tmp_dir, "temp.bam") bai_file = os.path.join(tmp_dir, "temp.bam.bai") os.symlink(os.path.abspath(bam_filename), bam_file) os.symlink(os.path.abspath(bai_filename), bai_file) assert os.path.isfile(bam_file), bam_file assert os.path.isfile(bai_file), bai_file assert os.path.isfile(bam_file + ".bai"), bam_file def clean_up(): os.remove(bam_file) os.remove(bai_file) os.rmdir(tmp_dir) def decode_cigar(cigar): """Returns a list of 2-tuples, integer count and operator char.""" count = "" answer = [] for letter in cigar: if letter.isdigit(): count += letter # string addition elif letter in "MIDNSHP=X": answer.append((int(count), letter)) count = "" else: raise ValueError("Invalid character %s in CIGAR %s" % (letter, cigar)) return answer assert decode_cigar("14S15M1P1D3P54M1D34M5S") == [(14, 'S'), (15, 'M'), (1, 'P'), (1, 'D'), (3, 'P'), (54, 'M'), (1, 'D'), (34, 'M'), (5, 'S')] def align_len(cigar_ops): """Sums the CIGAR M/=/X/D/N operators.""" return sum(count for count, op in cigar_ops if op in "M=XDN") def expand_cigar(seq, cigar_ops): """Yields (ref_offset, seq_base) pairs.""" ref_offset = 0 seq_offset = 0 for count, op in cigar_ops: if op in "MX=": for (i, base) in enumerate(seq[seq_offset:seq_offset + count]): yield ref_offset + i, base ref_offset += count seq_offset += count elif op == "I": # Give them all an in-between reference position # (Python lets us mix integers and floats, wouldn't work in C) for (i, base) in enumerate(seq[seq_offset:seq_offset + count]): yield ref_offset - 0.5, base # Does not change ref_offset seq_offset += count elif op in "DN": # Deletion/skip, # TODO: Option to return gap characters # for i in range(count): # yield ref_offset + i, "-" ref_offset += count elif op == "S": # Soft clipping, silently discard the bases (OK?) seq_offset += count elif op in "HP": # Hard trimming or pad, can ignore # TODO: Yield "-" if later offer to report deletions pass else: raise NotImplementedError("Unexpected CIGAR operator %s" % op) assert list(expand_cigar("ACGT", decode_cigar("4M"))) == [(0, "A"), (1, "C"), (2, "G"), (3, "T")] assert list(expand_cigar("ACGT", decode_cigar("2=1X1="))) == [(0, "A"), (1, "C"), (2, "G"), (3, "T")] assert list(expand_cigar("ACGT", decode_cigar("2M1D2M"))) == [(0, "A"), (1, "C"), (3, "G"), (4, "T")] assert list(expand_cigar("ACtGT", decode_cigar("2M1I2M"))) == [(0, "A"), (1, "C"), (1.5, "t"), (2, "G"), (3, "T")] assert list(expand_cigar("tACGT", decode_cigar("1I4M"))) == [(-0.5, 't'), (0, 'A'), (1, 'C'), (2, 'G'), (3, 'T')] assert list(expand_cigar("ACGTt", decode_cigar("4M1I"))) == [(0, 'A'), (1, 'C'), (2, 'G'), (3, 'T'), (3.5, 't')] assert list(expand_cigar("AAAAGGGGTTTT", decode_cigar("12M"))) == [(0, 'A'), (1, 'A'), (2, 'A'), (3, 'A'), (4, 'G'), (5, 'G'), (6, 'G'), (7, 'G'), (8, 'T'), (9, 'T'), (10, 'T'), (11, 'T')] assert list(expand_cigar("AAAAcGGGGTTTT", decode_cigar("4M1I8M"))) == [(0, 'A'), (1, 'A'), (2, 'A'), (3, 'A'), (3.5, 'c'), (4, 'G'), (5, 'G'), (6, 'G'), (7, 'G'), (8, 'T'), (9, 'T'), (10, 'T'), (11, 'T')] assert list(expand_cigar("AAAAGGGGcTTTT", decode_cigar("8M1I4M"))) == [(0, 'A'), (1, 'A'), (2, 'A'), (3, 'A'), (4, 'G'), (5, 'G'), (6, 'G'), (7, 'G'), (7.5, "c"), (8, 'T'), (9, 'T'), (10, 'T'), (11, 'T')] assert list(expand_cigar("AAAAcGGGGcTTTT", decode_cigar("4M1I4M1I4M"))) == [(0, 'A'), (1, 'A'), (2, 'A'), (3, 'A'), (3.5, 'c'), (4, 'G'), (5, 'G'), (6, 'G'), (7, 'G'), (7.5, 'c'), (8, 'T'), (9, 'T'), (10, 'T'), (11, 'T')] def get_roi(seq, cigar_ops, start, end): """Extract region of seq mapping to the ROI. Expect start and end to be zero based Python style end points. i.e. The ROI relative to the mapping start recorded in the POS field. Will return part of the SAM/BAM value SEQ based on interpretting the passed CIGAR operators. """ if len(cigar_ops) == 1 and cigar_ops[0][1] in "M=X": # Easy case, note start/end/pos all one-based assert cigar_ops[0][0] == len(seq) return seq[start:end] # Would use "start <= i < end" if they were all integers, but # want to exclude e.g. 3.5 and 7.5 when given start 4 and end 8. return "".join(base for i, base in expand_cigar(seq, cigar_ops) if start <= i <= end - 1) assert "GGGG" == get_roi("AAAAGGGGTTTT", decode_cigar("12M"), 4, 8) assert "GGGG" == get_roi("AAAAcGGGGTTTT", decode_cigar("4M1I8M"), 4, 8) assert "GGGG" == get_roi("AAAAGGGGcTTTT", decode_cigar("8M1I4M"), 4, 8) assert "GGGG" == get_roi("AAAAcGGGGcTTTT", decode_cigar("4M1I4M1I4M"), 4, 8) assert "GGaGG" == get_roi("AAAAGGaGGTTTT", decode_cigar("6M1I6M"), 4, 8) assert "GGGgA" == get_roi("AAAAGGGgATTTT", decode_cigar("7M1I5M"), 4, 8) def count_region(): # Could recreate the region string (with no commas in start/end)? # region = "%s:%i-%i" % (ref, start, end) tally = dict() # Call samtools view, don't need header so no -h added. # Only want mapped reads, thus flag filter -F 4. child = subprocess.Popen(["samtools", "view", "-F", "4", bam_file, region], stdout=subprocess.PIPE, stderr=subprocess.PIPE) for line in child.stdout: assert line[0] != "@", "Got unexpected SAM header line: %s" % line qname, flag, rname, pos, mapq, cigar, rnext, pnext, tlen, seq, rest = line.split("\t", 10) pos = int(pos) # one-based if start < pos: # Does not span the ROI continue cigar_ops = decode_cigar(cigar) if pos + align_len(cigar_ops) - 1 < end: # Does not span the ROI continue # All of start/end/pos are currently one-based, making offsets Python style.... roi_seq = get_roi(seq, cigar_ops, start - pos, end - pos + 1) assert roi_seq, "Error, empty ROI sequence for: %s" % line try: tally[roi_seq] += 1 except KeyError: tally[roi_seq] = 1 stderr = child.stderr.read() child.stdout.close() child.stderr.close() return_code = child.wait() if return_code: sys.exit("Got return code %i from samtools view" % return_code) elif "specifies an unknown reference name. Continue anyway." in stderr: sys.exit(stderr.strip() + "\n\nERROR: samtools did not recognise the region requested, can't count any variants.") return tally def record_counts(): tally = count_region() total = sum(tally.values()) # Using negative count to get sort with highest count first, # while tie-breaking by the ROI sequence alphabetically. table = sorted((-count, roi_seq) for (roi_seq, count) in tally.items()) del tally with open(tabular_filename, "w") as handle: handle.write("Variant\tCount\tPercentage\n") for count, roi_seq in table: handle.write("%s\t%i\t%0.2f\n" % (roi_seq, -count, -count * 100.0 / total)) print("Counted %i variants from %i reads spanning %s" % (len(table), total, region)) # Run it! record_counts() # Remove the temp symlinks and files: clean_up()