Mercurial > repos > peterjc > samtools_depad
changeset 0:2d303f2e09e0 draft
Uploaded v0.0.1, previously only on the Test Tool Shed
| author | peterjc |
|---|---|
| date | Fri, 21 Nov 2014 06:37:20 -0500 |
| parents | |
| children | 01f8967ce1e0 |
| files | test-data/sam_spec_padded.bam test-data/sam_spec_padded.depad.bam test-data/sam_spec_padded.fasta test-data/sam_spec_padded.sam tools/samtools_depad/README.rst tools/samtools_depad/samtools_depad.py tools/samtools_depad/samtools_depad.xml tools/samtools_depad/tool_dependencies.xml |
| diffstat | 8 files changed, 227 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_spec_padded.fasta Fri Nov 21 06:37:20 2014 -0500 @@ -0,0 +1,2 @@ +>ref +AGCATGTTAGATAA--GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_spec_padded.sam Fri Nov 21 06:37:20 2014 -0500 @@ -0,0 +1,10 @@ +@HD VN:1.5 SO:coordinate +@SQ SN:ref LN:47 +ref 516 ref 1 0 14M2D31M * 0 0 AGCATGTTAGATAAGATAGCTGTGCTAGTAGGCAGTCAGCGCCAT * +r001 99 ref 7 30 14M1D3M = 39 41 TTAGATAAAGGATACTG * +* 768 ref 8 30 1M * 0 0 * * CT:Z:.;Warning;Note=Ref wrong? +r002 0 ref 9 30 3S6M1D5M * 0 0 AAAAGATAAGGATA * PT:Z:1;4;+;homopolymer +r003 0 ref 9 30 5H6M * 0 0 AGCTAA * NM:i:1 +r004 0 ref 18 30 6M14D5M * 0 0 ATAGCTTCAGC * +r003 2064 ref 31 30 6H5M * 0 0 TAGGC * NM:i:0 +r001 147 ref 39 30 9M = 7 -41 CAGCGGCAT * NM:i:1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools_depad/README.rst Fri Nov 21 06:37:20 2014 -0500 @@ -0,0 +1,102 @@ +Galaxy wrapper for samtools depad +================================= + +This wrapper is copyright 2014 by Peter Cock, The James Hutton Institute +(formerly SCRI, Scottish Crop Research Institute), UK. All rights reserved. +See the licence text below. + +This is a wrapper for part of the command line samtools suite, v0.1.19 + +This wrapper is available from the Galaxy Tool Shed at: +http://toolshed.g2.bx.psu.edu/view/peterjc/samtools_idxstats + + +Automated Installation +====================== + +This should be straightforward, Galaxy should automatically download and install +samtools 0.1.19 if required. + + +Manual Installation +=================== + +This expects samtools to be on the $PATH, and was tested using v0.1.19. + +To install the wrapper copy or move the following files under the Galaxy tools +folder, e.g. in a ``tools/samtools_depad`` folder: + +* ``samtools_depad.xml`` (the Galaxy tool definition) +* ``samtools_depad.py`` (the Python wrapper script) +* ``README.rst`` (this file) + +You will also need to modify the ``tools_conf.xml`` file to tell Galaxy to offer +the tool. Just add the line, perhaps under the NGS tools section:: + + <tool file="samtools_depad/samtools_depad.xml" /> + +If you wish to run the unit tests, also add this to ``tools_conf.xml.sample`` +and move/copy the ``test-data`` files under Galaxy's ``test-data`` folder. Then:: + + $ ./run_functional_tests.sh -id samtools_depad + +That's it. + + +History +======= + +======= ====================================================================== +Version Changes +------- ---------------------------------------------------------------------- +v0.0.1 - Initial public release +======= ====================================================================== + + +Developers +========== + +Development is on this GitHub repository: +https://github.com/peterjc/pico_galaxy/tree/master/tools/samtools_depad + +For making the "Galaxy Tool Shed" http://toolshed.g2.bx.psu.edu/ tarball use +the following command from the Galaxy root folder:: + + $ tar -czf samtools_depad.tar.gz tools/samtools_depad/README.rst tools/samtools_depad/samtools_depad.xml tools/samtools_depad/samtools_depad.py tools/samtools_depad/tool_dependencies.xml test-data/sam_spec_padded.fasta test-data/sam_spec_padded.sam test-data/sam_spec_padded.bam test-data/sam_spec_padded.depad.bam + +Check this worked:: + + $ tar -tzf samtools_depad.tar.gz + tools/samtools_depad/README.rst + tools/samtools_depad/samtools_depad.xml + tools/samtools_depad/samtools_depad.py + tools/samtools_depad/tool_dependencies.xml + test-data/sam_spec_padded.fasta + test-data/sam_spec_padded.sam + test-data/sam_spec_padded.bam + test-data/sam_spec_padded.depad.bam + + +Licence (MIT) +============= + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in +all copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN +THE SOFTWARE. + +NOTE: This is the licence for the Galaxy Wrapper only. +samtools is available and licenced separately.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools_depad/samtools_depad.py Fri Nov 21 06:37:20 2014 -0500 @@ -0,0 +1,48 @@ +#!/usr/bin/env python +"""Wrapper for "samtools depad" for use in Galaxy. + +This script takes exactly four command line arguments: + * Input padded reference FASTA file + * Input SAM/BAM filename + * Input format ("sam" or "bam") + * Output BAM filename + +Runs "samtools depad" and captures the output to the desired BAM file. +""" +import sys +import os +import subprocess +import tempfile + +if "-v" in sys.argv or "--version" in sys.argv: + #Galaxy seems to invert the order of the two lines + print "(Galaxy wrapper v0.0.1)" + cmd = "samtools 2>&1 | grep -i ^Version" + sys.exit(os.system(cmd)) + +def stop_err(msg, error_level=1): + """Print error message to stdout and quit with given error level.""" + sys.stderr.write("%s\n" % msg) + sys.exit(error_level) + +if len(sys.argv) != 5: + stop_err("Require four arguments: padded FASTA, SAM/BAM file, format (SAM or BAM), output BAM filenames") + +padded_ref, bam_filename, input_format, output_filename = sys.argv[1:] + +if not os.path.isfile(padded_ref): + stop_err("Input padded reference FASTA file not found: %s" % padded_ref) +if not os.path.isfile(bam_filename): + stop_err("Input BAM file not found: %s" % bam_filename) +if input_format.lower() not in ["sam", "bam"]: + stop_err("Input format should be SAM or BAM, not %r" % input_format) + +#Run samtools depad: +if input_format.lower() == "sam": + cmd = "samtools depad -S -T %s %s > %s" % (padded_ref, bam_filename, output_filename) +else: + cmd = "samtools depad -T %s %s > %s" % (padded_ref, bam_filename, output_filename) +return_code = os.system(cmd) + +if return_code: + stop_err("Return code %i from command:\n%s" % (return_code, cmd))
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools_depad/samtools_depad.xml Fri Nov 21 06:37:20 2014 -0500 @@ -0,0 +1,59 @@ +<tool id="samtools_depad" name="Depad SAM/BAM file" version="0.0.1"> + <description>samtools depad</description> + <requirements> + <requirement type="binary">samtools</requirement> + <requirement type="package" version="0.1.19">samtools</requirement> + </requirements> + <version_command interpreter="python">samtools_depad.py --version</version_command> + <command interpreter="python">samtools_depad.py "$padded_ref" "$input_bam" "$input_bam.ext" "$output_bam"</command> + <inputs> + <param name="padded_ref" type="data" format="fasta" label="Padded FASTA file (with gap characters)" /> + <param name="input_bam" type="data" format="sam,bam" label="Input SAM or BAM file (mapped against the padded FASTA)" /> + </inputs> + <outputs> + <data name="output_bam" format="bam" label="$input_bam.name (depad)" /> + </outputs> + <stdio> + <!-- Assume anything other than zero is an error --> + <exit_code range="1:" /> + <exit_code range=":-1" /> + </stdio> + <tests> + <test> + <param name="padded_ref" value="sam_spec_padded.fasta" ftype="fasta" /> + <param name="input_bam" value="sam_spec_padded.bam" ftype="bam" /> + <output name="output_bam" file="sam_spec_padded.depad.bam" ftype="bam" /> + </test> + <test> + <param name="padded_ref" value="sam_spec_padded.fasta" ftype="fasta" /> + <param name="input_bam" value="sam_spec_padded.sam" ftype="sam" /> + <output name="output_bam" file="sam_spec_padded.depad.bam" ftype="bam" /> + </test> + </tests> + <help> +**What it does** + +This tool runs the ``samtools depad`` command in the SAMtools toolkit. + +Input is a *padded* FASTA file (with gaps represented by either ``*`` or ``-`` +characters) and a SAM or BAM file mapped against this *padded* FASTA file. + +The output is a new BAM file mapped against the *unpadded* FASTA file +created by removing all gap characters from the sequence. + +**Citation** + +If you use this Galaxy tool in work leading to a scientific publication please +cite: + +Heng Li et al (2009). The Sequence Alignment/Map format and SAMtools. +Bioinformatics 25(16), 2078-9. +http://dx.doi.org/10.1093/bioinformatics/btp352 + +Peter J.A. Cock (2014), Galaxy wrapper for the samtools depad command +http://toolshed.g2.bx.psu.edu/view/peterjc/samtools_depad + +This wrapper is available to install into other Galaxy Instances via the Galaxy +Tool Shed at http://toolshed.g2.bx.psu.edu/view/peterjc/samtools_depad + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools_depad/tool_dependencies.xml Fri Nov 21 06:37:20 2014 -0500 @@ -0,0 +1,6 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="samtools" version="0.1.19"> + <repository changeset_revision="923adc89c666" name="package_samtools_0_1_19" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>