Mercurial > repos > petr-novak > repeat_annotation_pipeline3

comparison format_repeat_library.xml @ 11:5366d5ea04bc draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload commit 9d1b19f98d8b7f0a0d1baf2da63a373d155626f8-dirty
author petr-novak
date Fri, 04 Aug 2023 12:35:32 +0000
parents ea6a3059a6af
children
comparison
equal deleted inserted replaced
10:276efc4cb17f 11:5366d5ea04bc
1 <tool id="annotate_contigs" name="Format Repeat Library" version="0.1.0" python_template_version="3.5"> 1 <tool id="annotate_contigs" name="Format Repeat Library" version="0.1.0" python_template_version="3.5">
2 <requirements> 2 <requirements>
3 <requirement type="package" version="2.60.0">bioconductor-biostrings</requirement> 3 <requirement type="package" version="2.60.0">bioconductor-biostrings</requirement>
4 </requirements> 4 </requirements>
5 <required_files>
6 <include type="literal" path="annotate_contigs.R"/>
7 </required_files>
5 <command detect_errors="exit_code"><![CDATA[ 8 <command detect_errors="exit_code"><![CDATA[
6 $__tool_directory__/annotate_contigs.R '$contigs' '$cluster_table' '$annotated_contigs' 9 Rscript $__tool_directory__/annotate_contigs.R '$contigs' '$cluster_table' '$annotated_contigs'
7 ]]></command> 10 ]]></command>
8 <inputs> 11 <inputs>
9 <param type="data" name="contigs" format="fasta" label="Contigs - Library of Repeats from TAREAN/RepeatExplorer pipeline" /> 12 <param type="data" name="contigs" format="fasta" label="Contigs - Library of Repeats from TAREAN/RepeatExplorer pipeline" />
10 <param type="data" name="cluster_table" format="txt" label="CLUSTER_TABLE from RepeatExplorer pipeline" help="CLUSTER_TABLE which contain annotation of clusters from RepeatExplorer pipeline"/> 13 <param type="data" name="cluster_table" format="txt" label="CLUSTER_TABLE from RepeatExplorer pipeline" help="CLUSTER_TABLE which contain annotation of clusters from RepeatExplorer pipeline"/>
11 </inputs> 14 </inputs>
58 61
59 Only Cluster, Automatic_annotation/Final_annnotation are mandatory" 62 Only Cluster, Automatic_annotation/Final_annnotation are mandatory"
60 63
61 Clusters with higher number than those in CLUSTER_TABLE are removed from Repeat library 64 Clusters with higher number than those in CLUSTER_TABLE are removed from Repeat library
62 65
63 Contigs are provided in followinf format:: 66 Contigs are provided in following format::
64 67
65 68
66 >CL25Contig1 69 >CL25Contig1
67 AGATCAAGATGGCGCCGGAGGACATGGAGAAAACGACGTTTATCACTCCCTGGGGAACATTTTGCTACAAGGTAATGCCT 70 AGATCAAGATGGCGCCGGAGGACATGGAGAAAACGACGTTTATCACTCCCTGGGGAACATTTTGCTACAAGGTAATGCCT
68 TTCGGTCTGAAGAACGCAGGGGCCACTTACCAACGAGCAATGGTAACTT 71 TTCGGTCTGAAGAACGCAGGGGCCACTTACCAACGAGCAATGGTAACTT