Mercurial > repos > petr-novak > repeat_annotation_pipeline3
view format_repeat_library.xml @ 12:755a4d643184 draft default tip
planemo upload commit a61591d548f42ff417781e7fe7418dc2901ccc23
| author | petr-novak |
|---|---|
| date | Tue, 26 Sep 2023 07:28:04 +0000 |
| parents | 5366d5ea04bc |
| children |
line wrap: on
line source
<tool id="annotate_contigs" name="Format Repeat Library" version="0.1.0" python_template_version="3.5"> <requirements> <requirement type="package" version="2.60.0">bioconductor-biostrings</requirement> </requirements> <required_files> <include type="literal" path="annotate_contigs.R"/> </required_files> <command detect_errors="exit_code"><![CDATA[ Rscript $__tool_directory__/annotate_contigs.R '$contigs' '$cluster_table' '$annotated_contigs' ]]></command> <inputs> <param type="data" name="contigs" format="fasta" label="Contigs - Library of Repeats from TAREAN/RepeatExplorer pipeline" /> <param type="data" name="cluster_table" format="txt" label="CLUSTER_TABLE from RepeatExplorer pipeline" help="CLUSTER_TABLE which contain annotation of clusters from RepeatExplorer pipeline"/> </inputs> <outputs> <data name="annotated_contigs" format="fasta" label="Annotated Repeat Library based on ${contigs.hid} and ${cluster_table.hid}" /> </outputs> <help><![CDATA[ **What this tool does** Contigs from RepeatExplorer archive are annotated based on the classification of repeats from cluster_table. Preformated CLUSTER_TABLE can be extracted from RepeatExplorer archive and modified accordingly. By default, "Final_annotation" column is used to append annotation to contigs in repeat library (based on the cluster id). If "Final_annotation" column is incomplete, "Automatic_annotation" column is used instead. Example of tab delimited CLUSTER_TABLE:: "Number_of_reads_in_clusters" 3886 "Number_of_clusters" 822 "Number_of_superclusters" 821 "Number_of_singlets" 6114 "Number_of_analyzed_reads" 10000 "Cluster" "Supercluster" "Size" "Size_adjusted" "Automatic_annotation" "TAREAN_annotation" "Final_annotation" 1 1 260 260 "All/repeat/satellite" "Putative satellites (low confidence)" "" 2 2 157 157 "All/repeat/satellite" "Putative satellites (low confidence)" "" 3 4 100 100 "All" "Other" "" 4 5 83 83 "All" "Other" "" 5 3 77 77 "All" "Other" "" 6 3 65 65 "All" "Other" "" 7 6 61 61 "All" "Other" "" 8 7 58 58 "All" "Other" "" 9 8 53 53 "All" "Other" "" 10 9 53 53 "All" "Other" "" 11 10 51 51 "All" "Other" "" 12 11 45 45 "All" "Other" "" 13 12 44 44 "All" "Other" "" 14 13 44 44 "All" "Other" "" 15 14 39 39 "All" "Other" "" 16 15 37 37 "All" "Other" "" 17 16 30 30 "All/repeat/satellite" "Putative satellites (low confidence)" "" 18 17 28 28 "All/repeat/satellite" "Putative satellites (low confidence)" "" 19 18 26 26 "All/repeat/satellite" "Putative satellites (high confidence)" "" 20 19 23 23 "All/repeat/../CRM" "Other" "" 21 20 21 21 "All" "Other" "" 22 21 21 21 "All" "Other" "" 23 22 21 21 "All" "Other" "" 24 23 21 21 "All" "Other" "" 25 24 20 20 "All/repeat/../Ogre" "Other" "" Only Cluster, Automatic_annotation/Final_annnotation are mandatory" Clusters with higher number than those in CLUSTER_TABLE are removed from Repeat library Contigs are provided in following format:: >CL25Contig1 AGATCAAGATGGCGCCGGAGGACATGGAGAAAACGACGTTTATCACTCCCTGGGGAACATTTTGCTACAAGGTAATGCCT TTCGGTCTGAAGAACGCAGGGGCCACTTACCAACGAGCAATGGTAACTT >CL1Contig4#All/repeat/satellite ACCCGAAGGCCGGCTCAACCCGAAGTTGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGA A >CL1Contig5 TGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACCCGAAGT TGATAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACACGAAGT TGAGAGGAACATCTGACCTCGCCGTCAGGCATCTGTTAAA Resulting repeat library will have following format:: >CL25Contig1#All/repeat/mobile_element/Class_I/LTR/Ty3_gypsy/non-chromovirus/OTA/Tat/Ogre AGATCAAGATGGCGCCGGAGGACATGGAGAAAACGACGTTTATCACTCCCTGGGGAACATTTTGCTACAAGGTAATGCCT TTCGGTCTGAAGAACGCAGGGGCCACTTACCAACGAGCAATGGTAACTT >CL1Contig4#All/repeat/satellite ACCCGAAGGCCGGCTCAACCCGAAGTTGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGA A >CL1Contig5#All/repeat/satellite TGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACCCGAAGT TGATAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACACGAAGT TGAGAGGAACATCTGACCTCGCCGTCAGGCATCTGTTAAA ]]></help> </tool>