Mercurial > repos > petr-novak > repeatexplorer2_testing
view repex_tarean.xml @ 5:397394c00bf7 draft
Uploaded
| author | petr-novak |
|---|---|
| date | Fri, 09 Apr 2021 08:09:53 +0000 |
| parents | 72c028e3e70e |
| children | 4b3af335dca8 |
line wrap: on
line source
<tool id="tarean" name="Tandem Repeat Analyzer" version="2.3.8" > <stdio> <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" /> <regex match="error" source="stderr" level="fatal" description="Unknown error" /> <regex match="warning" source="stderr" level="warning" description="Unknown warning" /> <exit_code range="1:" level="fatal" description="Error" /> </stdio> <description>Identification of genomic tandem repeats from NGS data</description> <requirements> <container type="singularity">shub://repeatexplorer/repex_tarean:0.3.8.dbaa07f</container> </requirements> <command detect_errors="exit_code"> export PYTHONHASHSEED=0; seqclust --paired --sample ${read_sampling.sample} --output_dir=tarean_output --logfile=${log} --cleanup --tarean_mode #if $advanced_options.advanced: --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -M $advanced_options.merging #if $advanced_options.custom_library.options_custom_library : -d $advanced_options.custom_library.library extra_database #end if #if $advanced_options.options.options: -opt $advanced_options.options.options #end if #else: -M 0.2 #end if ${FastaFile} >stdout.log 2> stderr.log ; echo "STDOUT CONTENT:" >> ${log} ; cat stdout.log >> ${log} ; echo "STDERR CONTENT:" >> ${log} ; cat stderr.log >> ${log} && /opt/repex_tarean/stderr_filter.py stderr.log && cd tarean_output && zip -r ${ReportArchive}.zip * && mv ${ReportArchive}.zip ${ReportArchive} && cp index.html ${ReportFile} && mkdir ${ReportFile.files_path} && cp -r --parents libdir ${ReportFile.files_path} && cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} && cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} && cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls && cp *.png ${ReportFile.files_path}/ && cp *.csv ${ReportFile.files_path}/ && cp *.html ${ReportFile.files_path}/ && cp *.css ${ReportFile.files_path}/ && cp *.fasta ${ReportFile.files_path}/ 2>>$log && rm -r ../tarean_output || : </command> <inputs> <param name="FastaFile" label="Paired-end Illumina reads" type="data" format="fasta" help="Input file must contain FASTA-formatted interlaced read pairs from paired-end sequencing. All pairs must be complete. Example of the input data format is provided in the help below."/> <conditional name="read_sampling"> <param name="do_sampling" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Read sampling" help="Use this option if you want to analyze only a part of the reads" /> <when value="false"> <!-- pass --> <param name="sample" label="Sample size" hidden="True" type="integer" value="0" help="Number of analyzed reads"/> </when> <when value="true"> <param name="sample" label="Sample size" type="integer" value="500000" min="10000" help="Number of analyzed reads"/> </when> </conditional> <conditional name="advanced_options"> <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" /> <when value="false"> <!-- pass --> </when> <when value="true"> <param name="merging" type="boolean" truevalue="0.2" falsevalue="0" checked="True" label="Perform cluster merging" help="By default, clusters connected through paired-end reads are merged"/> <conditional name="custom_library"> <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/> <when value="false"> <!-- do nothing here --> </when> <when value="true"> <param name="library" format="fasta" type="data" label="Use custom repeat database" help="Perform additional similarity search to user-provided repeat database. The database should contain FASTA-formatted DNA sequences with headers (sequence names) in the format: '>reapeatname#class/subclass'"/> </when> </conditional> <param name="size_threshold" label="Cluster size threshold for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; cluster with less than 20 reads are not considered."/> <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/> <param name="keep_names" label="Keep original read names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default, reads are renamed using integers. Use this option if you want to keep original names."/> <conditional name="options"> <param name="options" type="select" label="Similarity search options"> <option value="ILLUMINA" selected="true">Default </option> <option value="ILLUMINA_DUST_OFF" selected="false">Masking of low complexity repeats disabled </option> <!-- <option value="ILLUMINA_SENSITIVE_MGBLAST" selected="false">Illumina reads, sensitive search (search parameters: mgblast, min PID 80, -W8) slow, experimental feature!</option> --> <!-- <option value="ILLUMINA_SENSITIVE_BLASTPLUS" selected="false">Illumina reads, more sensitive search (search parameters: blastn, min PID 80, -W6) extremely slow, experimental feature!</option> --> <!-- <option value="OXFORD_NANOPORE" selected="false"> --> <!-- Pseudo short reads simulated from Oxford Nanopore data, experimental feature! --> <!-- </option> --> </param> </conditional> </when> </conditional> <conditional name="queue_definition"> <param name="queue_select" type="select" label="Select queue"> <option value="basic_fast_queue">basic (max runtime 2 days, 4 GB RAM)</option> <option value="long_slow_queue">long (max runtime 2 weeks, 64 GB RAM)</option> <option value="extra_long_slow_queue">extra long (max runtime 4 weeks, 64 GB RAM)</option> </param> <when value="basic_fast_queue"> <param name="queue_specification" type="text" label="Modify parameters (optional)" value="-l select=1:ncpus=10:mem=32gb:scratch_local=50gb -l walltime=48:00:00 -q elixirre@pbs.elixir-czech.cz -v TAREAN_MAX_MEM=4000000,TAREAN_CPU=4" /> </when> <when value="long_slow_queue"> <param name="queue_specification" type="text" label="Modify parameters (optional)" value="-l select=1:ncpus=16:mem=112gb:scratch_local=50gb -l walltime=336:00:00 -q elixirre@pbs.elixir-czech.cz -v TAREAN_MAX_MEM=64000000,TAREAN_CPU=15" /> </when> <when value="extra_long_slow_queue"> <param name="queue_specification" type="text" label="Modify parameters (optional)" value="-l select=1:ncpus=16:mem=112gb:scratch_local=50gb -l walltime=720:00:00 -q elixirre@pbs.elixir-czech.cz -v TAREAN_MAX_MEM=64000000,TAREAN_CPU=15" /> </when> </conditional> </inputs> <outputs> <data name="log" format="txt" label="TAREAN log file"/> <data name="ReportArchive" format="zip" label="TAREAN Archive with HTML report from data ${FastaFile.hid}"/> <data name="ReportFile" format="html" label="TAREAN HTML report from data ${FastaFile.hid}"/> </outputs> <help> **HELP** TAREAN - TAndem REpeat ANalyzer is a computational pipeline for **unsupervised identification of satellite repeats** from unassembled sequence reads. The pipeline uses low-pass paired-end whole genome sequence reads and performs graph-based clustering. The resulting clusters, representing all types of repeats present in the genome, are then examined to identify those containing circular structures indicative of tandem repeats. A poster summarizing TAREAN principles and implementation can be found `here.`__ .. __: http://w3lamc.umbr.cas.cz/lamc/?page_id=312 **Input data** The analysis requires **paired-end reads** generated by whole genome shotgun sequencing. The data should be provided as a single input file in fasta format with the reads interlaced (see example below). All the pairs must be complete, i.e. both "forward" and "reverse" sequence reads must be present. The reads should all be trimmed to the same length. The optimal size range is between 100 and 200 nucleotides. The number of reads to be analyzed should not exceed 1x coverage of the genome. Genome coverage between 0.01 and 0.5x is recommended. The reads should be filtered for quality. The recommended quality filtering is as follows: each read should have a quality score >=10 for 95% of the bases, i.e. if your reads are 100 base pairs long, then a read only passes this quality threshold if 95 bases have a quality of 10 or higher. Additionally, any reads containing indeterminate base pairs (indicated as N in the reads) should be removed. Finally, if either one of the reads in a pair fails to meet the aforementioned thresholds, **both** sequences should be removed. example of interlaced input format:: >0001_f CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG >0001_r GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT >0002_f ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG >0002_r TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC >0003_f TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT >0003_r TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT ... To perform the quality filtering on your fastQ formatted data as described above, and to interlace your paired-end sequence reads, please use the `Preprocessing of paired-reads`__ tool. .. __: tool_runner?tool_id=paired_fastq_filtering **Additional parameters** **Sample size** defines how many reads will be used during the computation. The default setting of 500,000 reads will enable detection of high copy number satellites within several hours. For higher sensitivity the sample size can be increased. Since the sample size affects memory usage, this parameter may be automatically adjusted to a lower value during the run. The maximum sample size which can be processed depends on the repetitiveness of the analyzed genome. This significantly limits the number of reads that can be analyzed with the TAREAN pipeline. **Perform cluster merging**. Families of repetitive elements are frequently split into multiple clusters rather than being represented as a single one. If you do not want to merge clusters based on the presence of broken read pairs, disable this option. **Use custom repeat database**. This option allows users to perform similarity comparison of identified repeats to their custom databases. The repeat class should be encoded in FASTA headers of database entries in order to allow correct parsing of similarity hits. **Similarity search options** By default sequence reads are compared using mgblast program. Default threshold is explicitly set to 90% sequence similarity spanning at least 55% of the read length (in the case of reads differing in length it applies to the longer one). Additionally, sequence overlap must be at least 55 nt. If you select option for shorter reads than 100 nt, minimum overlap 55 nt is not required. By default, mgblast search use DUST program to filter out low-complexity sequences. If you want to increase sensitivity of detection of satellites with shorter monomer use option with '*no masking of low complexity repeats*'. Note that omitting DUST filtering will significantly increase running times **Output** A list of clusters identified as putative satellite repeats, their genomic abundance and various cluster characteristics are provided. Length and consensus sequences of reconstructed monomers are also shown and accompanied by a detailed output from kmer-based reconstruction including sequences and sequence logos of alternative variants of monomer sequences. The output includes an **HTML summary** with a table listing all analyzed clusters. More detailed information about clusters is provided in additional files and directories. All results are also provided as a downloadable **zip archive**. Since read clustering results in thousands of clusters, the search for satellite repeats is limited to a subset of the largest ones corresponding to the most abundant genomic repeats. The default setting of the pipeline is to analyze all clusters containing at least 0.01% of the input reads. Besides the satellite repeats, three other groups of clusters are reported in the output (1) LTR-retrotransposons, (2) 45S and 5S rDNA and (3) all remaining clusters passing the size threshold. As (1) and (2) contain sequences with circular graphs, their consensus is calculated in the same way as for satellite repeats. Additionally a **log file** reporting the progress of the computational pipeline is provided. </help> </tool>