Mercurial > repos > rnateam > compalignp

changeset 0:7e55ac3bd458 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author rnateam
date Tue, 09 Jun 2015 05:36:03 -0400
parents
children f3a318881b1b
files compalignp.xml test-data/eukaryotic-trnas_2.1.clustal test-data/eukaryotic-trnas_2.1.out tool_dependencies.xml
diffstat 4 files changed, 83 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/compalignp.xml	Tue Jun 09 05:36:03 2015 -0400
@@ -0,0 +1,48 @@
+<tool id="compalignp" name="Compalignp" version="1.0">
+    <description>Fractional identities between alignments</description>
+    <requirements>
+        <requirement type="package" version="1.0">compalignp</requirement>
+    </requirements>
+    <stdio>
+        <exit_code range="1:" level="fatal" description="Error occurred. Please check Tool Standard Error" />
+        <exit_code range=":-1" level="fatal" description="Error occurred. Please check Tool Standard Error" />
+    </stdio>
+    <command>
+<![CDATA[
+    compalignp
+        -t $rna_alignment_target
+        -r $rna_alignment_reference
+    > $output
+]]>
+    </command>
+    <inputs>
+        <param format="clustalw,stockholm" name="rna_alignment_target" type="data" label="Target RNA Alignment" help="(-t)" />
+        <param format="clustalw,stockholm" name="rna_alignment_reference" type="data" label="Reference RNA Alignment" help="(-r)" />
+    </inputs>
+    <outputs>
+        <data name="output" format="txt" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="rna_alignment_target" value="eukaryotic-trnas_2.1.clustal"/>
+            <param name="rna_alignment_reference" value="eukaryotic-trnas_2.1.clustal"/>
+            <output name="output" file="eukaryotic-trnas_2.1.out"/>
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**compalignp**
+
+> Paranoia version of squids compalign. 
+
+Compute fractional "identity" between trusted alignment and test alignment
+Identity of the multiple sequence alignments is defined as
+the averaged identity over all N(N-1)/2 pairwise alignments.
+
+
+]]>
+    </help>
+<citations>
+  <citation type="doi">10.1186/1748-7188-1-19</citation>
+</citations>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/eukaryotic-trnas_2.1.clustal	Tue Jun 09 05:36:03 2015 -0400
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34      TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35      GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+                                     ************************************** ************** ******* ********* 
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/eukaryotic-trnas_2.1.out	Tue Jun 09 05:36:03 2015 -0400
@@ -0,0 +1,1 @@
+1.00
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Tue Jun 09 05:36:03 2015 -0400
@@ -0,0 +1,27 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="squid" version="1.9g">
+        <repository changeset_revision="a82a68a3374e" name="package_squid_1_9g" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" />
+    </package>
+    <package name="compalignp" version="1.0">
+        <install version="1.0">
+            <actions>
+                <action type="download_by_url">http://www.biophys.uni-duesseldorf.de/bralibase/compalignp.tgz</action>
+                <action type="set_environment_for_install">
+                    <repository changeset_revision="a82a68a3374e" name="package_squid_1_9g" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu">
+                        <package name="squid" version="1.9g" />
+                    </repository>
+                </action>
+                <action type="shell_command">make</action>
+                <action type="move_file">
+                    <source>compalignp</source>
+                    <destination>$INSTALL_DIR/bin</destination>
+                </action>
+                <action type="set_environment">
+                    <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR/bin</environment_variable>
+                    <environment_variable action="set_to" name="COMPALIGNP_ROOT_PATH">$INSTALL_DIR/bin</environment_variable>
+                </action>
+            </actions>
+        </install>
+    </package>
+</tool_dependency>