comparison test-data/result.csv @ 0:eaac585f172a draft

Imported from capsule None
author rnateam
date Tue, 27 Jan 2015 09:06:24 -0500
parents
children 6a17e1229b9f
comparison
equal deleted inserted replaced
-1:000000000000 0:eaac585f172a
1 miRDeep2 score novel miRNAs reported by miRDeep2 novel miRNAs, estimated false positives novel miRNAs, estimated true positives known miRNAs in species known miRNAs in data known miRNAs detected by miRDeep2 estimated signal-to-noise excision gearing
2 10 1 0 +/- 0 1 +/- 0 (83 +/- 38%) 7 6 5 (83%) 6.7 1
3 9 1 0 +/- 0 1 +/- 0 (83 +/- 38%) 7 6 5 (83%) 6.7 1
4 8 1 0 +/- 0 1 +/- 0 (83 +/- 38%) 7 6 5 (83%) 6.7 1
5 7 1 0 +/- 0 1 +/- 0 (83 +/- 38%) 7 6 5 (83%) 6.7 1
6 6 1 0 +/- 0 1 +/- 0 (83 +/- 38%) 7 6 5 (83%) 6.7 1
7 5 1 0 +/- 0 1 +/- 0 (71 +/- 46%) 7 6 6 (100%) 4.5 1
8 4 1 0 +/- 0 1 +/- 0 (71 +/- 46%) 7 6 6 (100%) 4.5 1
9 3 1 0 +/- 0 1 +/- 0 (71 +/- 46%) 7 6 6 (100%) 4.5 1
10 2 1 0 +/- 0 1 +/- 0 (71 +/- 46%) 7 6 6 (100%) 4.5 1
11 1 1 0 +/- 0 1 +/- 0 (68 +/- 47%) 7 6 6 (100%) 4 1
12 0 1 1 +/- 1 1 +/- 1 (52 +/- 50%) 7 6 6 (100%) 2.2 1
13 -1 1 1 +/- 1 1 +/- 1 (52 +/- 50%) 7 6 6 (100%) 2.5 1
14 -2 1 1 +/- 1 0 +/- 0 (15 +/- 36%) 7 6 6 (100%) 1.9 1
15 -3 1 1 +/- 1 0 +/- 0 (15 +/- 36%) 7 6 6 (100%) 1.9 1
16 -4 1 1 +/- 1 0 +/- 0 (13 +/- 34%) 7 6 6 (100%) 1.8 1
17 -5 1 2 +/- 1 0 +/- 0 (6 +/- 24%) 7 6 6 (100%) 1.7 1
18 -6 1 3 +/- 1 0 +/- 0 (0 +/- 0%) 7 6 6 (100%) 1.5 1
19 -7 1 3 +/- 1 0 +/- 0 (0 +/- 0%) 7 6 6 (100%) 1.5 1
20 -8 1 3 +/- 1 0 +/- 0 (0 +/- 0%) 7 6 6 (100%) 1.5 1
21 -9 1 3 +/- 1 0 +/- 0 (0 +/- 0%) 7 6 6 (100%) 1.5 1
22 -10 1 3 +/- 1 0 +/- 0 (0 +/- 0%) 7 6 6 (100%) 1.5 1
23
24
25
26 novel miRNAs predicted by miRDeep2
27 provisional id miRDeep2 score estimated probability that the miRNA candidate is a true positive rfam alert total read count mature read count loop read count star read count significant randfold p-value miRBase miRNA example miRBase miRNA with the same seed UCSC browser NCBI blastn consensus mature sequence consensus star sequence consensus precursor sequence precursor coordinate
28 chrII:11534525-11540624_7 102170.8 83 +/- 38% - 200394 200381 0 13 yes - cbr-miR-35 - - ucaccggguggaaacuagcagu ugcugguuucuuccacaguggua ugcugguuucuuccacagugguacuuuccauuagaacuaucaccggguggaaacuagcagu chrII:11534525-11540624:3020..3081:+
29
30
31
32 mature miRBase miRNAs detected by miRDeep2
33 tag id miRDeep2 score estimated probability that the miRNA is a true positive rfam alert total read count mature read count loop read count star read count significant randfold p-value mature miRBase miRNA example miRBase miRNA with the same seed UCSC browser NCBI blastn consensus mature sequence consensus star sequence consensus precursor sequence precursor coordinate
34 chrII:11534525-11540624_11 61011.7 83 +/- 38% - 119663 119545 0 118 yes cel-miR-37 cbr-miR-35 - - ucaccgggugaacacuugcagu uguggguguccguugcggugcua uguggguguccguugcggugcuacauucucuaaucuguaucaccgggugaacacuugcagu chrII:11534525-11540624:3245..3306:+
35 chrII:11534525-11540624_17 17007.3 83 +/- 38% - 33350 33300 0 50 yes cel-miR-40 cbr-miR-35 - - ucaccggguguacaucagcuaa aguggauguaugccaugaugaua aguggauguaugccaugaugauaagauaucagaaauccuaucaccggguguacaucagcuaa chrII:11534525-11540624:3590..3652:+
36 chrII:11534525-11540624_9 7482.8 83 +/- 38% - 14668 14617 0 51 yes cel-miR-36 cbr-miR-35 - - ucaccgggugaaaauucgcaug cgccaauuuucgcuucagugcua cgccaauuuucgcuucagugcuagaccauccaaagugucuaucaccgggugaaaauucgcaug chrII:11534525-11540624:3123..3186:+
37 chrII:11534525-11540624_15 1978.6 83 +/- 38% - 3872 3014 1 857 yes cel-miR-39 cbr-miR-35 - - ucaccggguguaaaucagcuug agcugauuucgucuugguaaua agcugauuucgucuugguaauaagcucgucauugagauuaucaccggguguaaaucagcuug chrII:11534525-11540624:3494..3556:+
38 chrII:11534525-11540624_19 84.4 83 +/- 38% - 164 68 9 87 yes cel-miR-41 - - - ggugguuuuucucugcagugaua ucaccgggugaaaaaucaccua ggugguuuuucucugcagugauagauacuucuaacaacucgcuaucaccgggugaaaaaucaccua chrII:11534525-11540624:3715..3781:+
39 chrII:11534525-11540624_13 5.5 71 +/- 46% - 2140 2132 8 0 yes cel-miR-38 cbr-miR-35 - - ucaccgggagaaaaacuggagu uccgguuuuuuccguggugaua uccgguuuuuuccguggugauaacgcauccaaaagucucuaucaccgggagaaaaacuggagu chrII:11534525-11540624:3340..3403:+
40 chrII:11534525-11540624_12 -0.2 52 +/- 50% - 119546 119545 1 0 no cel-miR-37 cbr-miR-35 - - ucaccgggugaacacuugcagu uguuccgguuuuuuccguggugaua ucaccgggugaacacuugcagugguccucgugguuucucugugagccagguccuguuccgguuuuuuccguggugaua chrII:11534525-11540624:3284..3362:+
41
42 #miRBase miRNAs not detected by miRDeep2
43 miRBase precursor id total read count mature read count(s) star read count remaining reads UCSC browser NCBI blastn miRBase mature sequence(s) miRBase star sequence(s) miRBase precursor sequence
44 4000 4000 0 0 - - aaugacacugguuaucuuuuccaucg - cgccggcaaugacacugguuaucuuuuccaucguggaaugccccccauugauuuuuuccccuuuucggggggaaaaaauuggaaacgagaaagguaucgggugucauagccggcg