diff test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps @ 6:9f5eed9a1c82 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps	Wed Dec 20 08:31:47 2017 -0500
@@ -0,0 +1,370 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%BoundingBox: 66 211 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+% 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343207.trna3_AlaAGC) show
+
+/sequence { (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) } def
+/len { sequence length } bind def
+
+72 216 translate
+72 6 mul len 1 add div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+drawseq
+0.5 dup translate
+% draw diagonal
+0.04 setlinewidth
+0 len moveto len 0 lineto stroke
+
+/min { 2 copy gt { exch } if pop } bind def
+
+/utri{ % i j prob utri
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.33
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/uHmotif{ % i j uHmotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/lHmotif{ % i j lHmotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/uImotif{ % i j k l uImotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup
+  5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll
+  moveto lineto lineto lineto closepath fill
+  grestore
+} bind def
+/lImotif{ % i j k l lImotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch
+  5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll
+  moveto lineto lineto lineto closepath fill
+  grestore
+} bind def
+
+%data starts here
+
+%start of quadruplex data
+
+%start of Hmotif data
+
+%start of Imotif data
+
+%draw the grid
+drawgrid
+
+%start of base pair probability data
+1 71 0.011137621 ubox
+1 72 0.998618513 ubox
+2 70 0.011249479 ubox
+2 71 0.999343269 ubox
+2 72 0.029380302 ubox
+3 69 0.016278852 ubox
+3 70 0.998657995 ubox
+3 71 0.029349731 ubox
+3 72 0.013044031 ubox
+4 68 0.015570075 ubox
+4 69 0.999660285 ubox
+4 70 0.006500567 ubox
+4 71 0.013063530 ubox
+5 67 0.017184802 ubox
+5 68 0.995393993 ubox
+5 70 0.012116272 ubox
+6 20 0.003683136 ubox
+6 47 0.007871866 ubox
+6 67 0.961997835 ubox
+6 68 0.010641824 ubox
+7 19 0.003963646 ubox
+7 22 0.016669769 ubox
+7 23 0.006395271 ubox
+7 26 0.010803708 ubox
+7 45 0.003325342 ubox
+7 46 0.008388346 ubox
+7 66 0.889354167 ubox
+8 18 0.004993356 ubox
+8 21 0.043576199 ubox
+8 22 0.009051039 ubox
+8 23 0.003412982 ubox
+8 26 0.053349931 ubox
+8 44 0.006391561 ubox
+8 45 0.009575801 ubox
+8 46 0.006511628 ubox
+8 48 0.044296110 ubox
+8 66 0.051228716 ubox
+9 17 0.005076838 ubox
+9 20 0.044973880 ubox
+9 47 0.045851242 ubox
+9 67 0.006907131 ubox
+10 20 0.031947572 ubox
+10 25 0.993218795 ubox
+10 47 0.003684611 ubox
+10 61 0.005362683 ubox
+11 18 0.045881626 ubox
+11 19 0.032788757 ubox
+11 22 0.010762380 ubox
+11 24 0.996351171 ubox
+11 43 0.031784396 ubox
+11 45 0.044997253 ubox
+11 46 0.003273388 ubox
+11 60 0.005393685 ubox
+12 18 0.028759750 ubox
+12 19 0.007591504 ubox
+12 21 0.010602364 ubox
+12 23 0.996289342 ubox
+12 42 0.031993047 ubox
+12 44 0.044989514 ubox
+12 58 0.005409282 ubox
+13 18 0.016589428 ubox
+13 19 0.009128152 ubox
+13 22 0.996158882 ubox
+13 41 0.032010508 ubox
+13 43 0.044839517 ubox
+13 57 0.005483356 ubox
+14 20 0.079642667 ubox
+14 56 0.005446527 ubox
+15 20 0.129735024 ubox
+15 55 0.005085787 ubox
+16 20 0.018529841 ubox
+16 38 0.051862141 ubox
+17 21 0.010497970 ubox
+17 26 0.003797728 ubox
+17 37 0.052295806 ubox
+17 39 0.003520191 ubox
+17 42 0.004660118 ubox
+17 52 0.004889289 ubox
+18 25 0.005375323 ubox
+18 36 0.051745231 ubox
+18 38 0.003387544 ubox
+19 25 0.004215070 ubox
+19 36 0.018363451 ubox
+19 40 0.005479857 ubox
+19 50 0.005352275 ubox
+20 24 0.003956630 ubox
+20 34 0.049426221 ubox
+20 35 0.019676299 ubox
+20 39 0.005488315 ubox
+20 49 0.005308891 ubox
+21 33 0.037607150 ubox
+21 38 0.005407841 ubox
+22 32 0.023047831 ubox
+22 33 0.039236028 ubox
+23 32 0.049874318 ubox
+23 47 0.036867639 ubox
+24 31 0.055184372 ubox
+24 47 0.041474959 ubox
+25 30 0.055108050 ubox
+25 41 0.003625640 ubox
+25 45 0.072422399 ubox
+25 46 0.047506335 ubox
+26 36 0.020612775 ubox
+26 40 0.011634581 ubox
+26 47 0.044476135 ubox
+27 35 0.020631543 ubox
+27 39 0.011645626 ubox
+27 43 0.992061337 ubox
+27 45 0.025461226 ubox
+27 46 0.039850990 ubox
+28 34 0.019643833 ubox
+28 42 0.996960401 ubox
+28 44 0.021374269 ubox
+28 45 0.024434496 ubox
+29 41 0.997917003 ubox
+29 43 0.018395309 ubox
+29 45 0.003166236 ubox
+30 36 0.012434123 ubox
+30 40 0.998065717 ubox
+30 47 0.007404570 ubox
+31 35 0.012393915 ubox
+31 39 0.997764981 ubox
+31 41 0.005414838 ubox
+31 43 0.003645699 ubox
+31 46 0.007622516 ubox
+32 37 0.068093187 ubox
+32 39 0.013599795 ubox
+32 42 0.003678913 ubox
+32 45 0.007610493 ubox
+33 37 0.102337630 ubox
+33 39 0.003720007 ubox
+33 41 0.003538594 ubox
+33 44 0.007538047 ubox
+34 38 0.013851913 ubox
+36 41 0.007501659 ubox
+38 48 0.018700348 ubox
+39 47 0.020533473 ubox
+40 46 0.020625702 ubox
+44 68 0.005576608 ubox
+44 70 0.006111196 ubox
+45 50 0.003800521 ubox
+45 62 0.010043051 ubox
+45 65 0.003484260 ubox
+45 67 0.009783316 ubox
+45 68 0.032579696 ubox
+45 69 0.007408521 ubox
+46 61 0.010086460 ubox
+46 65 0.005780351 ubox
+46 67 0.077112938 ubox
+46 68 0.006873266 ubox
+47 60 0.010092967 ubox
+47 64 0.003785455 ubox
+47 66 0.084736602 ubox
+48 59 0.008724857 ubox
+48 67 0.019275395 ubox
+49 65 0.998806957 ubox
+50 57 0.009062054 ubox
+50 64 0.999848265 ubox
+51 56 0.007052370 ubox
+51 62 0.010700667 ubox
+51 63 0.999834583 ubox
+52 61 0.014860342 ubox
+52 62 0.999778783 ubox
+52 63 0.005533111 ubox
+53 61 0.998254922 ubox
+53 62 0.007658167 ubox
+54 59 0.156536412 ubox
+55 60 0.324268739 ubox
+56 60 0.024269416 ubox
+1 72 0.9500000 lbox
+2 71 0.9500000 lbox
+3 70 0.9500000 lbox
+4 69 0.9500000 lbox
+5 68 0.9500000 lbox
+6 67 0.9500000 lbox
+7 66 0.9500000 lbox
+10 25 0.9500000 lbox
+11 24 0.9500000 lbox
+12 23 0.9500000 lbox
+13 22 0.9500000 lbox
+27 43 0.9500000 lbox
+28 42 0.9500000 lbox
+29 41 0.9500000 lbox
+30 40 0.9500000 lbox
+31 39 0.9500000 lbox
+49 65 0.9500000 lbox
+50 64 0.9500000 lbox
+51 63 0.9500000 lbox
+52 62 0.9500000 lbox
+53 61 0.9500000 lbox
+showpage
+end
+%%EOF