Mercurial > repos > rnateam > viennarna_rnainverse
view test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps @ 6:9f5eed9a1c82 draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29
author | rnateam |
---|---|
date | Wed, 20 Dec 2017 08:31:47 -0500 |
parents | |
children |
line wrap: on
line source
%!PS-Adobe-3.0 EPSF-3.0 %%Title: RNA Dot Plot %%Creator: ViennaRNA-2.2.10 %%CreationDate: Tue Dec 19 19:42:58 2017 %%BoundingBox: 66 211 518 662 %%DocumentFonts: Helvetica %%Pages: 1 %%EndComments %Options: % %This file contains the square roots of the base pair probabilities in the form % i j sqrt(p(i,j)) ubox %%BeginProlog /DPdict 100 dict def DPdict begin /logscale false def /lpmin 1e-05 log def /box { %size x y box - draws box centered on x,y 2 index 0.5 mul sub % x -= 0.5 exch 2 index 0.5 mul sub exch % y -= 0.5 3 -1 roll dup rectfill } bind def /ubox { logscale { log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if } if 3 1 roll exch len exch sub 1 add box } bind def /lbox { 3 1 roll len exch sub 1 add box } bind def /drawseq { % print sequence along all 4 sides [ [0.7 -0.3 0 ] [0.7 0.7 len add 0] [-0.3 len sub -0.4 -90] [-0.3 len sub 0.7 len add -90] ] { gsave aload pop rotate translate 0 1 len 1 sub { dup 0 moveto sequence exch 1 getinterval show } for grestore } forall } bind def /drawgrid{ 0.01 setlinewidth len log 0.9 sub cvi 10 exch exp % grid spacing dup 1 gt { dup dup 20 div dup 2 array astore exch 40 div setdash } { [0.3 0.7] 0.1 setdash } ifelse 0 exch len { dup dup 0 moveto len lineto dup len exch sub 0 exch moveto len exch len exch sub lineto stroke } for [] 0 setdash 0.04 setlinewidth currentdict /cutpoint known { cutpoint 1 sub dup dup -1 moveto len 1 add lineto len exch sub dup -1 exch moveto len 1 add exch lineto stroke } if 0.5 neg dup translate } bind def end %%EndProlog DPdict begin %delete next line to get rid of title 270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343207.trna3_AlaAGC) show /sequence { (\ GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\ ) } def /len { sequence length } bind def 72 216 translate 72 6 mul len 1 add div dup scale /Helvetica findfont 0.95 scalefont setfont drawseq 0.5 dup translate % draw diagonal 0.04 setlinewidth 0 len moveto len 0 lineto stroke /min { 2 copy gt { exch } if pop } bind def /utri{ % i j prob utri gsave 1 min 2 div 0.85 mul 0.15 add 0.95 0.33 3 1 roll % prepare hsb color sethsbcolor % now produce the coordinates for lines exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub moveto lineto lineto closepath fill grestore } bind def /uHmotif{ % i j uHmotif gsave 1 min 2 div 0.85 mul 0.15 add 0.95 0.99 3 1 roll % prepare hsb color sethsbcolor % now produce the coordinates for lines exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub moveto lineto lineto closepath fill grestore } bind def /lHmotif{ % i j lHmotif gsave 1 min 2 div 0.85 mul 0.15 add 0.95 0.99 3 1 roll % prepare hsb color sethsbcolor % now produce the coordinates for lines dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub moveto lineto lineto closepath fill grestore } bind def /uImotif{ % i j k l uImotif gsave 1 min 2 div 0.85 mul 0.15 add 0.95 0.99 3 1 roll % prepare hsb color sethsbcolor % now produce the coordinates for lines 1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup 5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll moveto lineto lineto lineto closepath fill grestore } bind def /lImotif{ % i j k l lImotif gsave 1 min 2 div 0.85 mul 0.15 add 0.95 0.99 3 1 roll % prepare hsb color sethsbcolor % now produce the coordinates for lines 4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch 5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll moveto lineto lineto lineto closepath fill grestore } bind def %data starts here %start of quadruplex data %start of Hmotif data %start of Imotif data %draw the grid drawgrid %start of base pair probability data 1 71 0.011137621 ubox 1 72 0.998618513 ubox 2 70 0.011249479 ubox 2 71 0.999343269 ubox 2 72 0.029380302 ubox 3 69 0.016278852 ubox 3 70 0.998657995 ubox 3 71 0.029349731 ubox 3 72 0.013044031 ubox 4 68 0.015570075 ubox 4 69 0.999660285 ubox 4 70 0.006500567 ubox 4 71 0.013063530 ubox 5 67 0.017184802 ubox 5 68 0.995393993 ubox 5 70 0.012116272 ubox 6 20 0.003683136 ubox 6 47 0.007871866 ubox 6 67 0.961997835 ubox 6 68 0.010641824 ubox 7 19 0.003963646 ubox 7 22 0.016669769 ubox 7 23 0.006395271 ubox 7 26 0.010803708 ubox 7 45 0.003325342 ubox 7 46 0.008388346 ubox 7 66 0.889354167 ubox 8 18 0.004993356 ubox 8 21 0.043576199 ubox 8 22 0.009051039 ubox 8 23 0.003412982 ubox 8 26 0.053349931 ubox 8 44 0.006391561 ubox 8 45 0.009575801 ubox 8 46 0.006511628 ubox 8 48 0.044296110 ubox 8 66 0.051228716 ubox 9 17 0.005076838 ubox 9 20 0.044973880 ubox 9 47 0.045851242 ubox 9 67 0.006907131 ubox 10 20 0.031947572 ubox 10 25 0.993218795 ubox 10 47 0.003684611 ubox 10 61 0.005362683 ubox 11 18 0.045881626 ubox 11 19 0.032788757 ubox 11 22 0.010762380 ubox 11 24 0.996351171 ubox 11 43 0.031784396 ubox 11 45 0.044997253 ubox 11 46 0.003273388 ubox 11 60 0.005393685 ubox 12 18 0.028759750 ubox 12 19 0.007591504 ubox 12 21 0.010602364 ubox 12 23 0.996289342 ubox 12 42 0.031993047 ubox 12 44 0.044989514 ubox 12 58 0.005409282 ubox 13 18 0.016589428 ubox 13 19 0.009128152 ubox 13 22 0.996158882 ubox 13 41 0.032010508 ubox 13 43 0.044839517 ubox 13 57 0.005483356 ubox 14 20 0.079642667 ubox 14 56 0.005446527 ubox 15 20 0.129735024 ubox 15 55 0.005085787 ubox 16 20 0.018529841 ubox 16 38 0.051862141 ubox 17 21 0.010497970 ubox 17 26 0.003797728 ubox 17 37 0.052295806 ubox 17 39 0.003520191 ubox 17 42 0.004660118 ubox 17 52 0.004889289 ubox 18 25 0.005375323 ubox 18 36 0.051745231 ubox 18 38 0.003387544 ubox 19 25 0.004215070 ubox 19 36 0.018363451 ubox 19 40 0.005479857 ubox 19 50 0.005352275 ubox 20 24 0.003956630 ubox 20 34 0.049426221 ubox 20 35 0.019676299 ubox 20 39 0.005488315 ubox 20 49 0.005308891 ubox 21 33 0.037607150 ubox 21 38 0.005407841 ubox 22 32 0.023047831 ubox 22 33 0.039236028 ubox 23 32 0.049874318 ubox 23 47 0.036867639 ubox 24 31 0.055184372 ubox 24 47 0.041474959 ubox 25 30 0.055108050 ubox 25 41 0.003625640 ubox 25 45 0.072422399 ubox 25 46 0.047506335 ubox 26 36 0.020612775 ubox 26 40 0.011634581 ubox 26 47 0.044476135 ubox 27 35 0.020631543 ubox 27 39 0.011645626 ubox 27 43 0.992061337 ubox 27 45 0.025461226 ubox 27 46 0.039850990 ubox 28 34 0.019643833 ubox 28 42 0.996960401 ubox 28 44 0.021374269 ubox 28 45 0.024434496 ubox 29 41 0.997917003 ubox 29 43 0.018395309 ubox 29 45 0.003166236 ubox 30 36 0.012434123 ubox 30 40 0.998065717 ubox 30 47 0.007404570 ubox 31 35 0.012393915 ubox 31 39 0.997764981 ubox 31 41 0.005414838 ubox 31 43 0.003645699 ubox 31 46 0.007622516 ubox 32 37 0.068093187 ubox 32 39 0.013599795 ubox 32 42 0.003678913 ubox 32 45 0.007610493 ubox 33 37 0.102337630 ubox 33 39 0.003720007 ubox 33 41 0.003538594 ubox 33 44 0.007538047 ubox 34 38 0.013851913 ubox 36 41 0.007501659 ubox 38 48 0.018700348 ubox 39 47 0.020533473 ubox 40 46 0.020625702 ubox 44 68 0.005576608 ubox 44 70 0.006111196 ubox 45 50 0.003800521 ubox 45 62 0.010043051 ubox 45 65 0.003484260 ubox 45 67 0.009783316 ubox 45 68 0.032579696 ubox 45 69 0.007408521 ubox 46 61 0.010086460 ubox 46 65 0.005780351 ubox 46 67 0.077112938 ubox 46 68 0.006873266 ubox 47 60 0.010092967 ubox 47 64 0.003785455 ubox 47 66 0.084736602 ubox 48 59 0.008724857 ubox 48 67 0.019275395 ubox 49 65 0.998806957 ubox 50 57 0.009062054 ubox 50 64 0.999848265 ubox 51 56 0.007052370 ubox 51 62 0.010700667 ubox 51 63 0.999834583 ubox 52 61 0.014860342 ubox 52 62 0.999778783 ubox 52 63 0.005533111 ubox 53 61 0.998254922 ubox 53 62 0.007658167 ubox 54 59 0.156536412 ubox 55 60 0.324268739 ubox 56 60 0.024269416 ubox 1 72 0.9500000 lbox 2 71 0.9500000 lbox 3 70 0.9500000 lbox 4 69 0.9500000 lbox 5 68 0.9500000 lbox 6 67 0.9500000 lbox 7 66 0.9500000 lbox 10 25 0.9500000 lbox 11 24 0.9500000 lbox 12 23 0.9500000 lbox 13 22 0.9500000 lbox 27 43 0.9500000 lbox 28 42 0.9500000 lbox 29 41 0.9500000 lbox 30 40 0.9500000 lbox 31 39 0.9500000 lbox 49 65 0.9500000 lbox 50 64 0.9500000 lbox 51 63 0.9500000 lbox 52 62 0.9500000 lbox 53 61 0.9500000 lbox showpage end %%EOF