annotate hairpinTool.xml @ 18:11777fbeac32 default tip

Requirements temporarily removed

<tool id="shRNAseq" name="shRNAseq Tool" version="1.2.1">
  <description>
    Analyse differential representation for shRNAseq and sgRNA based procedures
    using edgeR package from Bioconductor.
  </description>
    
  <requirements>
    <!-- <requirement type="R-module" version="3.7.17">edgeR</requirement>
    <requirement type="R-module" version="3.21.16">limma</requirement>
    <requirement type="package" version="3.1.1">R_3_0_3</requirement> -->
    <!-- Requirements removed until dependencies properly implemented -->
  </requirements>
  
  <stdio>
    <exit_code range="1:" level="fatal" description="Tool exception" />
  </stdio>
  
  <command interpreter="Rscript">
  hairpinTool.R $inputOpt.inputType
                #if $inputOpt.inputType=="fastq":

                  #for $i, $fas in enumerate($inputOpt.fastq):
                    fastq::$fas.file
                  #end for
    
                  $inputOpt.hairpin
                  $inputOpt.samples

                  #if $inputOpt.positions.posOption=="yes":
                    $inputOpt.positions.barstart
                    $inputOpt.positions.barend
                    0
                    0
                    $inputOpt.positions.hpstart
                    $inputOpt.positions.hpend
                  #else:
                    1
                    5
                    0
                    0
                    37
                    57
                  #end if
                #elif $inputOpt.inputType=="pairedFastq":

                  #for $i, $fas in enumerate($inputOpt.fastq):
                    fastq::$fas.file
                  #end for

                  #for $i, $fas in enumerate($inputOpt.fastq):
                    fastqRev::$fas.fileRev
                  #end for
    
                  $inputOpt.hairpin
                  $inputOpt.samples
                    
                  #if $inputOpt.positions.posOption=="yes":
                    $inputOpt.positions.barstart
                    $inputOpt.positions.barend
                    $inputOpt.positions.barstartRev
                    $inputOpt.positions.barendRev
                    $inputOpt.positions.hpstart
                    $inputOpt.positions.hpend
                  #else:
                    1
                    5
                    0
                    0
                    37
                    57
                  #end if

                #elif $inputOpt.inputType=="counts":
                  $inputOpt.counts
                  $inputOpt.hairpin
                  $inputOpt.samples
                  0
                  0
                  0
                  0
                  0
                #end if
                
                #if $inputOpt.secondaryFactor.secFactorOpt=="yes":
                  "$inputOpt.secondaryFactor.secFactName"
                #else:
                  "none"
                #end if

                #if $filterCPM.filtOption=="yes":
                  $filterCPM.cpmReq
                  $filterCPM.sampleReq
                  $filterCPM.readReq
                #else:
                  -Inf
                  -Inf
                  -Inf
                #end if
          
                "$fdr"
                "$lfc"
                "$direction"
                "$workMode.mode"
                "$outFile"
                "$outFile.files_path"
          
                #if $workMode.mode=="classic":
                  "$workMode.pair1"
                  "$workMode.pair2"
                #elif $workMode.mode=="glm":
                  "$workMode.contrast"
                  "$workMode.roast.roastOption"

                  #if $workMode.roast.roastOption=="yes":
                    "$workMode.roast.hairpinReq"
                    "$workMode.roast.select.selOption"
                    "$workMode.roast.select.selection"
                  #else:
                    0
                    0
                    0
                  #end if

                #end if
  </command>
  
  <inputs>
    <conditional name="inputOpt">

      <param name="inputType" type="select" label="Input File Type">
        <option value="fastq">FastQ File</option>
        <option value="pairedFastq">Paired FastQ File</option>
        <option value="counts">Table of Counts</option>
      </param>

      <when value="fastq">
        <param name="hairpin" type="data" format="tabular" 
               label="Target Annotation"/>
        
        <param name="samples" type="data" format="tabular" 
               label="Sample Annotation"/>
               
        <repeat name="fastq" title="FastQ Files">       
          <param name="file" type="data" format="fastq"/>
        </repeat>
        
        <conditional name="secondaryFactor">
          
          <param name="secFactorOpt" type="select"
                 label="Include Secondary Factor">

            <option value="no" selected="True">No</option>

            <option value="yes">Yes</option>

          </param>

          <when value="yes">

            <param name="secFactName" type="text" label="Secondary Factor Name"
                   size="80"/>

          </when>

          <when value="no">
          </when>
        </conditional>
        
        <conditional name="positions">
          <param name="posOption" type="select" 
                 label="Specify Sample Index and Target Sequence Locations?"
                 help="Default Positions: Index: 1 to 5, Target: 37 to 57.">
            <option value="no" selected="True">No</option>
            <option value="yes">Yes</option>
          </param>
          
          <when value="yes">
            <param name="barstart" type="integer" value="1"
                   label="Index Starting Position"/>
            <param name="barend" type="integer" value="5"
                   label="Index Ending Position"/>
            
            <param name="hpstart" type="integer" value="37"
                   label="Target Starting Position"/>
               
            <param name="hpend" type="integer" value="57"
                   label="Target Ending Position"/>
          </when>
          
          <when value="no"/>
        </conditional>
      </when>

      <when value="pairedFastq">
        <param name="hairpin" type="data" format="tabular" 
               label="Target Sequence Annotation"/>
        
        <param name="samples" type="data" format="tabular" 
               label="Sample Annotation"/>
               
        <repeat name="fastq" title="FastQ Files">       
          <param name="file" type="data" format="fastq"/>
          <param name="fileRev" type="data" format="fastq"/>
        </repeat>
          
        <conditional name="secondaryFactor">

          <param name="secFactorOpt" type="select"
                 label="Include Secondary Factor">

            <option value="no" selected="True">No</option>

            <option value="yes">Yes</option>

          </param>

          <when value="yes">

            <param name="secFactName" type="text" label="Secondary Factor Name"
                   size="80"/>

          </when>

          <when value="no">
          </when>
        </conditional>

        <conditional name="positions">

          <param name="posOption" type="select" 
                 label="Specify Sample Index and Target Sequence Locations?"
                 help="Default Positions: Index: 1 to 5, Input required for 
                       reverse end, Target: 37 to 57.">

            <option value="no" selected="True">No</option>

            <option value="yes">Yes</option>

          </param>
          
          <when value="yes">
            <param name="barstart" type="integer" value="1"
                   label="Index Starting Position"/>

            <param name="barend" type="integer" value="5"
                   label="Index Ending Position"/>

            <param name="barstartRev" type="integer" value="0"
                   label="Reverse Index Starting Position"/>
                   
            <param name="barendRev" type="integer" value="0"
                   label="Reverse Index Ending Position"/>
           
            <param name="hpstart" type="integer" value="37"
                   label="Target Starting Position"/>
               
            <param name="hpend" type="integer" value="57"
                   label="Target Ending Position"/>
          </when>

          <when value="no">
          </when>

        </conditional>

      </when>

      <when value="counts">

        <param name="counts" type="data" format="tabular" label="Counts Table"/>

        <param name="hairpin" type="data" format="tabular" 
               label="Target Sequence Annotation"/>

        <param name="samples" type="data" format="tabular"
               label="Sample Annotation"/> 

        <conditional name="secondaryFactor">

          <param name="secFactorOpt" type="select"
                 label="Include Secondary Factor">

            <option value="no" selected="True">No</option>

            <option value="yes">Yes</option>

          </param>

          <when value="yes">

            <param name="secFactName" type="text" label="Secondary Factor Name"
                   size="80"/>

          </when>

          <when value="no">
          </when>

        </conditional>

      </when>

    </conditional>
    
    <conditional name="filterCPM">
      <param name="filtOption" type="select" label="Filter Low CPM?"
       help="Ignore target sequences with very low representation when 
             performing analysis.">
        <option value="yes">Yes</option>
        <option value="no">No</option>
      </param>
      
        <when value="yes">
          <param name="cpmReq" type="float" value="0.5" min="0"
                 label="Minimum CPM"/>
                 
          <param name="sampleReq" type="integer" value="1" min="0"
                 label="Minimum Samples" 
                 help="Filter out all the genes that do not meet the minimum 
                       CPM in at least this many samples."/>

          <param name="readReq" type="integer" value="1000" min="0"
                 label="Minimum Reads" 
                 help="Filter out all samples that do not have the minimum 
                       number of reads."/>

        </when>
        
        <when value="no"/>
        
    </conditional>
    
    <conditional name="workMode">
      <param name="mode" type="select" label="Analysis Type"
       help="Classic Exact Tests are useful for simple comparisons across
             two sampling groups. Generalised linear models allow for more 
             complex contrasts and gene level analysis to be made.">
        <option value="classic">Classic Exact Test</option>
        <option value="glm">Generalised Linear Model</option>
      </param>
      
      <when value="classic">
        <param name="pair1" type="text" label="Compare" size="40"/>
        <param name="pair2" type="text" label="To" size="40"
               help="The analysis will subtract values of this group from those
                     in the group above to establish the difference."/>
      </when>
      
      <when value="glm">
        <param name="contrast" type="text" size="60"
               label="Contrasts of interest"
               help="Specify equations defining contrasts to be made. Eg. 
                     KD-Control will result in positive fold change if KD has
                     greater expression and negative if Control has greater
                     expression."/>
               
        <conditional name="roast">
          <param name="roastOption" type="select" 
                 label="Perform Gene Level Analysis?"
                 help="Analyse LogFC tendencies for target sequences belonging
                       to the same gene. NOTE: this is a slow procedure that
                       scales badly with the number of genes analysed.">
            <option value="no">No</option>
            <option value="yes">Yes</option>
          </param>
          
          <when value="yes">
            <param name="hairpinReq" type="integer" value="2" min="2"
                   label="Minimum Targets Found"
                   help="Only genes with at least this many target sequences
                         found will be analysed."/>
                         
            <conditional name="select">
              <param name="selOption" type="select"
                     label="Gene Selection Method">
                <option value="rank">By p-value Rank</option>
                <option value="geneID">By Gene Identifier</option>
              </param>
              <when value="rank">
                <param name="selection" type="text" size="40" value="1:5"
                       label="Ranks of Top Genes to Plot"
                       help="Genes are ranked in ascending p-value for
                             differential representation, individual ranks can
                             be entered seperated by comma or a range seperated
                             by colon."/>
              </when>
              <when value="geneID">
                <param name="selection" type="text" size="80" value=""
                       label="Symbols of Genes to Plot"
                       help="Select genes based on their identifier in the
                             'Gene' column of the sample information file.
                             Please ensure exact match with the values in input
                             file and separate selections with commas."/>
              </when>
            </conditional>

            
          </when>
          
          <when value="no"/>
        </conditional>
      </when>
    </conditional>
    
    <param name="fdr" type="float" value="0.05" min="0" max="1"
           label="FDR Threshold"
           help="All observations below this threshold will be highlighted
                 in the smear plot."/>

    <param name="lfc" type="float" value="0" min="0" 
           label="Absolute LogFC Threshold"
           help="In additional to meeting the FDR requirement, the absolute 
                 value of the log-fold-change of the observation must be above
                 this threshold to be highlighted."/>

    <param name="direction" type="select" label="Highlight Option"
        help="Only hightlight positive or negative fold changes in smear plot?">
        <option value="all">Default</option>
        <option value="up">Positive Only</option>
        <option value="down">Negative Only</option>
    </param>
  </inputs>

  <outputs>
    <data format="html" name="outFile" label="TagSeq Analysis"/>
  </outputs>
  <help>
.. class:: infomark

**What it does**

Given tables containing information about the hairpins/sgRNA and their 
associated sample indices, information about the samples and fastq file 
containing the sequencing reads. This tool will generate plots and tables for 
the analysis of differential representation.

.. class:: infomark

A tutorial of how to use this tool is available at:
http://bioinf.wehi.edu.au/shRNAseq/galaxy.html

-----

.. class:: infomark

**INPUTS**

**Input File Type:**

This tool is able to either generate counts from a raw FastQ file given the
information regarding the samples and hairpins/sgRNA. Alternatively if a table 
of counts has already been generated it can also be used.

**Counts Table (Counts Input):**

A tab delimited text table of information regarding the counts of 
hairpins/sgRNA. Should have a column 'ID' to denote the hairpins/sgRNA that 
counts correspond to. Each additional column should have titles corresponding to 
the label for the sample.

Example::

  ID  Sample1 Sample2 Sample3
  Control1 49802 48014 40148
  Control2 12441 16352 14232
  Control3 9842  9148  9111
  Hairpin1 3300  3418  2914
  Hairpin2 91418 95812 93174
  Hairpin3 32985 31975 35104
  Hairpin4 12082 14081 14981
  Hairpin5 2491  2769  2691
  Hairpin6 1294  1486  1642
  Hairpin7 49501 49076 47611
  ...
  
**Target Sequence Annotation:**

A tab delimited text table of information regarding the targetted 
hairpins/sgRNA sequence. Should have columns 'ID', 'Sequences' and 'Gene' to 
uniquely identify the target, align it with the reads to produce counts and 
identify which gene the target acts on.

NOTE: the column names are case sensitive and should be input exactly as they
are shown here.

Example::

  ID  Sequences Gene
  Control1  TCTCGCTTGGGCGAGAGTAAG 2
  Control2  CCGCCTGAAGTCTCTGATTAA 2
  Control3  AGGAATTATAATGCTTATCTA 2
  Hairpin1  AAGGCAGAGACTGACCACCTA 4
  Hairpin2  GAGCGACCTGGTGTTACTCTA 4
  Hairpin3  ATGGTGTAAATAGAGCTGTTA 4
  Hairpin4  CAGCTCATCTTCTGTGAAGAA 4
  Hairpin5  CAGCTCTGTGGGTCAGAAGAA 4
  Hairpin6  CCAGGCACAGATCTCAAGATA 4
  Hairpin7  ATGACAAGAAAGACATCTCAA 7
  ...
  
**Sample Annotation (FastQ Input):**

A tab delimited text table of information regarding the samples. Should have
columns 'ID', 'Sequences' and 'group' to uniquely identify each sample, identify
the sample in the reads by its sample index sequence and correctly group 
replicates for analysis. Additional columns may inserted for annotation purposes 
and will not interfere with analysis as long as the necessary columns are 
present.

NOTE: With the exception of other_group, column names are case sensitive and
should be input exactly as they are shown here. The other_group column can be
named by the user and specified in the "Include Secondary Factor" option of the
tool.

Example::

  ID  Sequences group other_group Replicate
  3 GAAAG Day 2 male 1
  6 GAACC Day 10  female  1
  9 GAAGA Day 5 GFP neg male 1
  16  GAATT Day 5 GFP pos male 1
  18  GACAC Day 2 female 2
  21  GACCA Day 10  male  2
  28  GACGT Day 5 GFP neg male 2
  31  GACTG Day 5 GFP pos female 2
  33  GAGAA Day 2 male 3
  40  GAGCT Day 10  female  3
  ...
  
**Include Secondary Factor**
If there are two factors involved in the experiment (i.e. Age and Gender) then
then secondary factor should be included to improve the statistical analysis.
The secondary factor should be specified as a column in the sample annotation
file and the corresponding column name should be input exactly as it is into 
the provided field in the tool.

NOTE: Currently the secondary factor is used only to improve statistical
analysis, comparisons can only be made in the primary factor specified as 
"group" in the sample annotation.

**Specify Sample Index and Target Sequence Locations (FastQ Input):**

It is assumed that in the sequencing reads that the first 5 bases are the
sample index sequence and that bases 37-57 are the hairpins/sgRNA. If this is 
not the case then the values of the positions can be changed, however it still
requires the sample indices and hairpins/sgRNA to be in a consistent location an
in a continuous sequence.

NOTE: position values start at 1 for the first base.

**Filter Low CPM?:**

Often in a large screen there may members with very low counts which are of no
interest in the experiment, these may be filtered out to speed up computations.
Filtering will be based on counts per million in a required number of samples.

**Analysis Type:**

 * **Classic Exact Test:** This allows two experimental groups to be compared 
   and p-values for differential representation derivec for each target 
   sequence. Simple and fast for straightforward comparisons. In this option you
   will have the option of "*Compare* x *To* y" which implicitly subtracts the 
   data from y from that of x to produce the comparison.

 * **Generalised Linear Model:** This allow for complex contrasts to be specified 
   and also gene level analysis to be performed. If this option is chosen then 
   contrasts must be explicitly stated in equations and multiple contrasts can 
   be made. In addition there will be the option to analyse hairpins/sgRNA on a 
   per-gene basis to see if hairpins/sgRNA belonging to a particular gene have 
   any overall tendencies for the direction of their log-fold-change.

**FDR Threshold:**
The smear plot in the output will have hairpins/sgRNA highlighted to signify
significant differential representation. The significance is determined by
contorlling the false discovery rate, only those with a FDR lower than the
threshold will be highlighted in the plot.

-----

**Citations:**

.. class:: infomark

limma

Please cite the paper below for the limma software itself.  Please also try
to cite the appropriate methodology articles that describe the statistical
methods implemented in limma, depending on which limma functions you are
using.  The methodology articles are listed in Section 2.1 of the limma 
User's Guide.

  * Smyth, GK (2005). Limma: linear models for microarray data. In: 
    'Bioinformatics and Computational Biology Solutions using R and 
    Bioconductor'. R. Gentleman, V. Carey, S. Dudoit, R. Irizarry, 
    W. Huber (eds), Springer, New York, pages 397-420.

.. class:: infomark

edgeR

Please cite the first paper for the software itself and the other papers for
the various original statistical methods implemented in edgeR.  See 
Section 1.2 in the User's Guide for more detail.

  * Robinson MD, McCarthy DJ and Smyth GK (2010). edgeR: a Bioconductor 
    package for differential expression analysis of digital gene expression 
    data. Bioinformatics 26, 139-140
    
  * Robinson MD and Smyth GK (2007). Moderated statistical tests for assessing 
    differences in tag abundance. Bioinformatics 23, 2881-2887
    
  * Robinson MD and Smyth GK (2008). Small-sample estimation of negative 
    binomial dispersion, with applications to SAGE data.
    Biostatistics, 9, 321-332
    
  * McCarthy DJ, Chen Y and Smyth GK (2012). Differential expression analysis 
    of multifactor RNA-Seq experiments with respect to biological variation. 
    Nucleic Acids Research 40, 4288-4297
    
Report problems to: [e-mail]

.. _edgeR: http://www.bioconductor.org/packages/release/bioc/html/edgeR.html
.. _limma: http://www.bioconductor.org/packages/release/bioc/html/limma.html
  </help>
</tool>