sbol3_diff: test-data/expanded_simple

annotate test-data/expanded_simple_library.nt @ 0:024def08af09 draft

planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty

author	tduigou
date	Mon, 19 Dec 2022 10:13:08 +0000
parents
children

rev	line source
0 024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1 <http://parts.igem.org/E0040> <http://sbols.org/v3#description> "Green FP (off patent)\nGFPmut3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2 <http://parts.igem.org/E0040> <http://sbols.org/v3#displayId> "E0040" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	3 <http://parts.igem.org/E0040> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	4 <http://parts.igem.org/E0040> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/E0040_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	5 <http://parts.igem.org/E0040> <http://sbols.org/v3#name> "GFPmut3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	6 <http://parts.igem.org/E0040> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	7 <http://parts.igem.org/E0040> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	8 <http://parts.igem.org/E0040> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	9 <http://parts.igem.org/E0040_sequence> <http://sbols.org/v3#displayId> "E0040_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	10 <http://parts.igem.org/E0040_sequence> <http://sbols.org/v3#elements> "ATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	11 <http://parts.igem.org/E0040_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	12 <http://parts.igem.org/E0040_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	13 <http://parts.igem.org/E0040_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	14 <http://parts.igem.org/E1010> <http://sbols.org/v3#description> "Red FP (off patent)\nmRFP1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	15 <http://parts.igem.org/E1010> <http://sbols.org/v3#displayId> "E1010" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	16 <http://parts.igem.org/E1010> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	17 <http://parts.igem.org/E1010> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/E1010_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	18 <http://parts.igem.org/E1010> <http://sbols.org/v3#name> "mRFP1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	19 <http://parts.igem.org/E1010> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	20 <http://parts.igem.org/E1010> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	21 <http://parts.igem.org/E1010> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	22 <http://parts.igem.org/E1010_sequence> <http://sbols.org/v3#displayId> "E1010_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	23 <http://parts.igem.org/E1010_sequence> <http://sbols.org/v3#elements> "ATGGCTTCCTCCGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGTTCCGTTAACGGTCACGAGTTCGAAATCGAAGGTGAAGGTGAAGGTCGTCCGTACGAAGGTACCCAGACCGCTAAACTGAAAGTTACCAAAGGTGGTCCGCTGCCGTTCGCTTGGGACATCCTGTCCCCGCAGTTCCAGTACGGTTCCAAAGCTTACGTTAAACACCCGGCTGACATCCCGGACTACCTGAAACTGTCCTTCCCGGAAGGTTTCAAATGGGAACGTGTTATGAACTTCGAAGACGGTGGTGTTGTTACCGTTACCCAGGACTCCTCCCTGCAAGACGGTGAGTTCATCTACAAAGTTAAACTGCGTGGTACCAACTTCCCGTCCGACGGTCCGGTTATGCAGAAAAAAACCATGGGTTGGGAAGCTTCCACCGAACGTATGTACCCGGAAGACGGTGCTCTGAAAGGTGAAATCAAAATGCGTCTGAAACTGAAAGACGGTGGTCACTACGACGCTGAAGTTAAAACCACCTACATGGCTAAAAAACCGGTTCAGCTGCCGGGTGCTTACAAAACCGACATCAAACTGGACATCACCTCCCACAACGAAGACTACACCATCGTTGAACAGTACGAACGTGCTGAAGGTCGTCACTCCACCGGTGCTTAATAACGCTGATAGTGCTAGTGTAGATCGC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	24 <http://parts.igem.org/E1010_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	25 <http://parts.igem.org/E1010_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	26 <http://parts.igem.org/E1010_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	27 <http://parts.igem.org/I20270> <http://sbols.org/v3#description> "positive control 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	28 <http://parts.igem.org/I20270> <http://sbols.org/v3#displayId> "I20270" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	29 <http://parts.igem.org/I20270> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	30 <http://parts.igem.org/I20270> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/I20270_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	31 <http://parts.igem.org/I20270> <http://sbols.org/v3#name> "I20270" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	32 <http://parts.igem.org/I20270> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	33 <http://parts.igem.org/I20270> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	34 <http://parts.igem.org/I20270> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	35 <http://parts.igem.org/I20270_sequence> <http://sbols.org/v3#displayId> "I20270_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	36 <http://parts.igem.org/I20270_sequence> <http://sbols.org/v3#elements> "TTGATGGCTAGCTCAGTCCTAGGTACAATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	37 <http://parts.igem.org/I20270_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	38 <http://parts.igem.org/I20270_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	39 <http://parts.igem.org/I20270_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	40 <http://parts.igem.org/J06504> <http://sbols.org/v3#description> "Red FP (off patent)\nmCherry" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	41 <http://parts.igem.org/J06504> <http://sbols.org/v3#displayId> "J06504" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	42 <http://parts.igem.org/J06504> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	43 <http://parts.igem.org/J06504> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J06504_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	44 <http://parts.igem.org/J06504> <http://sbols.org/v3#name> "J06504" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	45 <http://parts.igem.org/J06504> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	46 <http://parts.igem.org/J06504> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	47 <http://parts.igem.org/J06504> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	48 <http://parts.igem.org/J06504_sequence> <http://sbols.org/v3#displayId> "J06504_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	49 <http://parts.igem.org/J06504_sequence> <http://sbols.org/v3#elements> "ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCTTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	50 <http://parts.igem.org/J06504_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	51 <http://parts.igem.org/J06504_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	52 <http://parts.igem.org/J06504_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	53 <http://parts.igem.org/J23101> <http://sbols.org/v3#description> "5.5 SLM (high, but variable)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	54 <http://parts.igem.org/J23101> <http://sbols.org/v3#displayId> "J23101" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	55 <http://parts.igem.org/J23101> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	56 <http://parts.igem.org/J23101> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J23101_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	57 <http://parts.igem.org/J23101> <http://sbols.org/v3#name> "J23101" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	58 <http://parts.igem.org/J23101> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000167> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	59 <http://parts.igem.org/J23101> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	60 <http://parts.igem.org/J23101> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	61 <http://parts.igem.org/J23101_sequence> <http://sbols.org/v3#displayId> "J23101_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	62 <http://parts.igem.org/J23101_sequence> <http://sbols.org/v3#elements> "TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	63 <http://parts.igem.org/J23101_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	64 <http://parts.igem.org/J23101_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	65 <http://parts.igem.org/J23101_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	66 <http://parts.igem.org/J23105> <http://sbols.org/v3#description> "TBD SLM (expect 4.5)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	67 <http://parts.igem.org/J23105> <http://sbols.org/v3#displayId> "J23105" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	68 <http://parts.igem.org/J23105> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	69 <http://parts.igem.org/J23105> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J23105_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	70 <http://parts.igem.org/J23105> <http://sbols.org/v3#name> "J23105" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	71 <http://parts.igem.org/J23105> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000167> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	72 <http://parts.igem.org/J23105> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	73 <http://parts.igem.org/J23105> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	74 <http://parts.igem.org/J23105_sequence> <http://sbols.org/v3#displayId> "J23105_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	75 <http://parts.igem.org/J23105_sequence> <http://sbols.org/v3#elements> "TTGACAGCTAGCTCAGTCCTAGGGACTATGCTAGC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	76 <http://parts.igem.org/J23105_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	77 <http://parts.igem.org/J23105_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	78 <http://parts.igem.org/J23105_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	79 <http://parts.igem.org/J364001> <http://sbols.org/v3#description> "J23106 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	80 <http://parts.igem.org/J364001> <http://sbols.org/v3#displayId> "J364001" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	81 <http://parts.igem.org/J364001> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	82 <http://parts.igem.org/J364001> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J364001_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	83 <http://parts.igem.org/J364001> <http://sbols.org/v3#name> "J364001" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	84 <http://parts.igem.org/J364001> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	85 <http://parts.igem.org/J364001> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	86 <http://parts.igem.org/J364001> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	87 <http://parts.igem.org/J364001_sequence> <http://sbols.org/v3#displayId> "J364001_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	88 <http://parts.igem.org/J364001_sequence> <http://sbols.org/v3#elements> "TTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCTACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	89 <http://parts.igem.org/J364001_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	90 <http://parts.igem.org/J364001_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	91 <http://parts.igem.org/J364001_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	92 <http://parts.igem.org/J364002> <http://sbols.org/v3#description> "J23117 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	93 <http://parts.igem.org/J364002> <http://sbols.org/v3#displayId> "J364002" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	94 <http://parts.igem.org/J364002> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	95 <http://parts.igem.org/J364002> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J364002_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	96 <http://parts.igem.org/J364002> <http://sbols.org/v3#name> "J364002" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	97 <http://parts.igem.org/J364002> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	98 <http://parts.igem.org/J364002> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	99 <http://parts.igem.org/J364002> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	100 <http://parts.igem.org/J364002_sequence> <http://sbols.org/v3#displayId> "J364002_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	101 <http://parts.igem.org/J364002_sequence> <http://sbols.org/v3#elements> "TTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGCTACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	102 <http://parts.igem.org/J364002_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	103 <http://parts.igem.org/J364002_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	104 <http://parts.igem.org/J364002_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	105 <http://parts.igem.org/J364007> <http://sbols.org/v3#description> "J23100 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	106 <http://parts.igem.org/J364007> <http://sbols.org/v3#displayId> "J364007" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	107 <http://parts.igem.org/J364007> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	108 <http://parts.igem.org/J364007> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J364007_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	109 <http://parts.igem.org/J364007> <http://sbols.org/v3#name> "J364007" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	110 <http://parts.igem.org/J364007> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	111 <http://parts.igem.org/J364007> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	112 <http://parts.igem.org/J364007> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	113 <http://parts.igem.org/J364007_sequence> <http://sbols.org/v3#displayId> "J364007_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	114 <http://parts.igem.org/J364007_sequence> <http://sbols.org/v3#elements> "TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	115 <http://parts.igem.org/J364007_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	116 <http://parts.igem.org/J364007_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	117 <http://parts.igem.org/J364007_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	118 <http://parts.igem.org/J364009> <http://sbols.org/v3#description> "J23116 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	119 <http://parts.igem.org/J364009> <http://sbols.org/v3#displayId> "J364009" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	120 <http://parts.igem.org/J364009> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	121 <http://parts.igem.org/J364009> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J364009_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	122 <http://parts.igem.org/J364009> <http://sbols.org/v3#name> "J364009" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	123 <http://parts.igem.org/J364009> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	124 <http://parts.igem.org/J364009> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	125 <http://parts.igem.org/J364009> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	126 <http://parts.igem.org/J364009_sequence> <http://sbols.org/v3#displayId> "J364009_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	127 <http://parts.igem.org/J364009_sequence> <http://sbols.org/v3#elements> "TTGACAGCTAGCTCAGTCCTAGGGACTATGCTAGCTACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	128 <http://parts.igem.org/J364009_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	129 <http://parts.igem.org/J364009_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	130 <http://parts.igem.org/J364009_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	131 <http://parts.igem.org/K592100> <http://sbols.org/v3#description> "Blue FP\nTagBFP2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	132 <http://parts.igem.org/K592100> <http://sbols.org/v3#displayId> "K592100" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	133 <http://parts.igem.org/K592100> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	134 <http://parts.igem.org/K592100> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/K592100_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	135 <http://parts.igem.org/K592100> <http://sbols.org/v3#name> "K592100" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	136 <http://parts.igem.org/K592100> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	137 <http://parts.igem.org/K592100> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	138 <http://parts.igem.org/K592100> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	139 <http://parts.igem.org/K592100_sequence> <http://sbols.org/v3#displayId> "K592100_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	140 <http://parts.igem.org/K592100_sequence> <http://sbols.org/v3#elements> "ATGAGCGAACTGATCAAAGAGAACATGCACATGAAGCTGTACATGGAAGGCACCGTTGACAACCACCACTTTAAGTGCACGTCTGAGGGTGAGGGTAAGCCGTACGAAGGCACCCAAACCATGCGTATCAAAGTTGTGGAGGGCGGTCCACTGCCGTTCGCTTTTGACATTCTGGCGACCAGCTTCCTGTACGGTTCCAAAACGTTCATTAACCATACTCAGGGCATTCCGGATTTCTTCAAACAGAGCTTTCCGGAAGGTTTCACCTGGGAGCGTGTCACCACGTATGAAGATGGTGGTGTGTTGACCGCCACCCAAGATACCTCCCTGCAAGATGGCTGTCTGATCTATAACGTGAAAATTCGTGGCGTCAACTTTACGAGCAATGGTCCGGTGATGCAGAAGAAAACCCTGGGTTGGGAGGCGTTTACGGAAACCCTGTATCCGGCCGATGGTGGCCTGGAGGGCCGTAACGACATGGCACTGAAGCTGGTTGGTGGCAGCCATTTGATCGCAAATATCAAGACGACGTACCGCAGCAAGAAACCGGCGAAAAATCTGAAGATGCCGGGTGTTTACTATGTCGACTACCGTCTGGAACGCATTAAAGAAGCGAATAATGAGACTTACGTGGAGCAGCACGAGGTTGCAGTCGCGCGCTATTGCGACTTGCCTAGCAAGCTGGGTCATAAACTGAAT" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	141 <http://parts.igem.org/K592100_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	142 <http://parts.igem.org/K592100_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	143 <http://parts.igem.org/K592100_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	144 <http://parts.igem.org/R0040> <http://sbols.org/v3#description> "negative control 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	145 <http://parts.igem.org/R0040> <http://sbols.org/v3#displayId> "R0040" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	146 <http://parts.igem.org/R0040> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	147 <http://parts.igem.org/R0040> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/R0040_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	148 <http://parts.igem.org/R0040> <http://sbols.org/v3#name> "R0040" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	149 <http://parts.igem.org/R0040> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	150 <http://parts.igem.org/R0040> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	151 <http://parts.igem.org/R0040> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	152 <http://parts.igem.org/R0040_sequence> <http://sbols.org/v3#displayId> "R0040_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	153 <http://parts.igem.org/R0040_sequence> <http://sbols.org/v3#elements> "TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCAC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	154 <http://parts.igem.org/R0040_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	155 <http://parts.igem.org/R0040_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	156 <http://parts.igem.org/R0040_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	157 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#description> "" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	158 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#displayId> "B0015" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	159 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	160 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/B0015_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	161 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#name> "B0015" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	162 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000141> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	163 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	164 <http://sbolstandard.org/testfiles/B0015> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	165 <http://sbolstandard.org/testfiles/B0015_sequence> <http://sbols.org/v3#displayId> "B0015_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	166 <http://sbolstandard.org/testfiles/B0015_sequence> <http://sbols.org/v3#elements> "CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	167 <http://sbolstandard.org/testfiles/B0015_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	168 <http://sbolstandard.org/testfiles/B0015_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	169 <http://sbolstandard.org/testfiles/B0015_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	170 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#description> "Moderate (?)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	171 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#displayId> "B0032" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	172 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	173 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/B0032_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	174 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#name> "B0032" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	175 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000139> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	176 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	177 <http://sbolstandard.org/testfiles/B0032> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	178 <http://sbolstandard.org/testfiles/B0032_sequence> <http://sbols.org/v3#displayId> "B0032_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	179 <http://sbolstandard.org/testfiles/B0032_sequence> <http://sbols.org/v3#elements> "TCACACAGGAAAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	180 <http://sbolstandard.org/testfiles/B0032_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	181 <http://sbolstandard.org/testfiles/B0032_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	182 <http://sbolstandard.org/testfiles/B0032_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	183 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	184 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	185 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	186 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	187 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	188 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	189 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	190 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	191 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	192 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	193 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	194 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BioBricks_scar_long> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	195 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	196 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	197 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	198 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0032> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	199 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	200 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	201 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	202 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BioBricks_scar_short> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	203 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	204 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	205 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#description> "5' UTR including B0032 RBS and BB scars (long and short)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	206 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#displayId> "BB_B0032_BB" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	207 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	208 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	209 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	210 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	211 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	212 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	213 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#name> "BB-B0032-BB" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	214 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	215 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	216 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	217 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#description> "BioBricks scar including ag (not before CDS)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	218 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#displayId> "BioBricks_scar_long" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	219 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	220 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	221 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#name> "BioBricks_scar_long" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	222 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000627> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	223 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	224 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	225 <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> <http://sbols.org/v3#displayId> "BioBricks_scar_long_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	226 <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> <http://sbols.org/v3#elements> "TACTAGAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	227 <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	228 <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	229 <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	230 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#description> "BioBricks scar (short one, w/o ag, before CDS)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	231 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#displayId> "BioBricks_scar_short" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	232 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	233 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	234 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#name> "BioBricks_scar_short" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	235 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000627> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	236 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	237 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	238 <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> <http://sbols.org/v3#displayId> "BioBricks_scar_short_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	239 <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> <http://sbols.org/v3#elements> "TACTAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	240 <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	241 <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	242 <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	243 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#description> "Cyan FP; codon optimized using IDT tool <https://www.idtdna.com/CodonOpt>\nECFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	244 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#displayId> "ECFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	245 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	246 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/ECFP_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	247 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#name> "ECFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	248 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	249 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	250 <http://sbolstandard.org/testfiles/ECFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	251 <http://sbolstandard.org/testfiles/ECFP_sequence> <http://sbols.org/v3#displayId> "ECFP_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	252 <http://sbolstandard.org/testfiles/ECFP_sequence> <http://sbols.org/v3#elements> "ATGGTTAGTAAAGGGGAAGAGTTGTTTACGGGCGTTGTTCCAATCTTGGTGGAGTTGGACGGGGACGTTAATGGGCACAAATTTTCGGTCTCTGGGGAAGGCGAGGGGGACGCCACGTATGGTAAGCTGACCTTGAAGTTCATTTGCACTACTGGGAAATTGCCGGTTCCCTGGCCTACGCTTGTTACCACGTTGACCTGGGGCGTACAATGTTTCTCGCGCTATCCTGACCACATGAAACAACATGATTTCTTTAAGTCAGCTATGCCTGAGGGCTACGTGCAGGAGCGCACTATCTTCTTCAAGGATGACGGGAATTACAAAACCCGTGCGGAGGTAAAGTTCGAGGGTGACACGCTTGTCAACCGCATCGAGTTGAAGGGCATTGATTTTAAGGAGGATGGCAACATTTTAGGACATAAATTAGAGTATAACTATATTTCGCATAATGTCTACATTACTGCTGACAAACAAAAGAACGGCATCAAGGCTAATTTCAAAATTCGCCACAACATCGAGGATGGATCGGTTCAGTTAGCAGATCATTACCAGCAAAACACGCCCATCGGTGACGGACCAGTTCTGTTACCTGACAACCACTATCTTTCTACACAGAGTGCTCTTAGCAAGGACCCTAACGAAAAACGTGACCACATGGTCCTGCTGGAGTTTGTGACAGCCGCAGGTATTACATTGGGGATGGACGAATTGTATAAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	253 <http://sbolstandard.org/testfiles/ECFP_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	254 <http://sbolstandard.org/testfiles/ECFP_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	255 <http://sbolstandard.org/testfiles/ECFP_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	256 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	257 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	258 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	259 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	260 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	261 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	262 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	263 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	264 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	265 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	266 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	267 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	268 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	269 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	270 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	271 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	272 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23101_ATP07149_1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	273 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	274 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	275 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	276 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	277 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	278 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	279 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	280 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	281 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	282 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	283 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	284 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	285 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	286 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	287 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	288 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	289 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	290 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	291 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	292 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	293 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	294 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	295 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	296 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23101_E0040" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	297 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	298 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	299 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	300 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	301 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	302 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	303 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	304 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	305 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	306 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	307 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	308 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	309 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	310 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	311 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	312 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	313 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	314 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	315 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	316 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	317 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	318 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	319 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	320 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23101_E1010" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	321 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	322 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	323 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	324 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	325 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	326 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	327 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	328 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	329 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	330 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	331 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	332 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	333 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	334 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	335 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	336 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	337 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	338 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	339 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	340 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	341 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	342 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	343 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	344 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23101_ECFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	345 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	346 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	347 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	348 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	349 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	350 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	351 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	352 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	353 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	354 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	355 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	356 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	357 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	358 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	359 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	360 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	361 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	362 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	363 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	364 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	365 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	366 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	367 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	368 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23101_J06504" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	369 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	370 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	371 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	372 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	373 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	374 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	375 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	376 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	377 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	378 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	379 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	380 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	381 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	382 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	383 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	384 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	385 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	386 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	387 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	388 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	389 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	390 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	391 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	392 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23101_K592100" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	393 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	394 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	395 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	396 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	397 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	398 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	399 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	400 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	401 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	402 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	403 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	404 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	405 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	406 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	407 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	408 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	409 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	410 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	411 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	412 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	413 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	414 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	415 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	416 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23101_mTagBFP2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	417 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	418 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	419 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	420 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	421 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	422 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	423 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	424 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	425 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	426 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	427 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	428 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	429 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	430 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	431 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	432 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	433 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	434 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	435 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	436 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	437 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	438 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	439 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	440 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23101_meffCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	441 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	442 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	443 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	444 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	445 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	446 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	447 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	448 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	449 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	450 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	451 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	452 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	453 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	454 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	455 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	456 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	457 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	458 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	459 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	460 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	461 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	462 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	463 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	464 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23101_mmilCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	465 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	466 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	467 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	468 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	469 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	470 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	471 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	472 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	473 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	474 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	475 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	476 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	477 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	478 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	479 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	480 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	481 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	482 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	483 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	484 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	485 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	486 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	487 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	488 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23105_ATP07149_1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	489 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	490 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	491 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	492 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	493 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	494 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	495 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	496 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	497 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	498 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	499 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	500 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	501 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	502 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	503 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	504 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	505 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	506 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	507 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	508 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	509 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	510 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	511 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	512 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23105_E0040" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	513 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	514 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	515 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	516 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	517 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	518 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	519 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	520 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	521 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	522 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	523 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	524 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	525 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	526 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	527 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	528 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	529 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	530 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	531 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	532 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	533 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	534 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	535 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	536 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23105_E1010" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	537 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	538 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	539 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	540 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	541 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	542 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	543 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	544 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	545 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	546 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	547 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	548 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	549 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	550 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	551 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	552 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	553 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	554 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	555 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	556 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	557 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	558 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	559 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	560 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23105_ECFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	561 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	562 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	563 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	564 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	565 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	566 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	567 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	568 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	569 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	570 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	571 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	572 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	573 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	574 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	575 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	576 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	577 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	578 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	579 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	580 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	581 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	582 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	583 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	584 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23105_J06504" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	585 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	586 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	587 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	588 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	589 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	590 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	591 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	592 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	593 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	594 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	595 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	596 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	597 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	598 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	599 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	600 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	601 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	602 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	603 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	604 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	605 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	606 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	607 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	608 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23105_K592100" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	609 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	610 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	611 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	612 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	613 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	614 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	615 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	616 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	617 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	618 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	619 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	620 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	621 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	622 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	623 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	624 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	625 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	626 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	627 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	628 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	629 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	630 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	631 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	632 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23105_mTagBFP2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	633 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	634 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	635 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	636 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	637 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	638 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	639 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	640 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	641 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	642 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	643 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	644 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	645 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	646 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	647 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	648 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	649 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	650 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	651 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	652 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	653 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	654 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	655 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	656 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23105_meffCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	657 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	658 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	659 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	660 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	661 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	662 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	663 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	664 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	665 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	666 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	667 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	668 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	669 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	670 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	671 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	672 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	673 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	674 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	675 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	676 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	677 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	678 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	679 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	680 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#displayId> "FPs_small_FPs_small_ins_J23105_mmilCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	681 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	682 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	683 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	684 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	685 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	686 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	687 <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	688 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	689 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	690 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	691 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	692 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	693 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	694 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	695 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	696 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	697 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	698 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	699 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	700 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	701 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	702 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	703 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	704 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	705 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	706 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	707 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	708 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	709 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	710 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	711 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	712 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	713 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	714 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	715 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	716 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	717 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	718 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	719 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	720 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	721 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	722 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	723 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	724 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	725 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	726 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	727 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	728 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	729 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	730 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23101> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	731 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	732 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	733 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent6> <http://sbols.org/v3#instanceOf> <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	734 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	735 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#displayId> "FPs_small_ins_J23101_ATP07149_1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	736 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	737 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	738 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	739 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	740 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	741 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	742 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	743 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	744 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	745 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	746 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	747 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	748 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	749 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ATP07149_1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	750 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	751 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	752 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	753 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	754 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	755 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	756 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	757 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	758 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	759 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	760 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	761 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	762 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	763 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	764 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	765 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	766 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	767 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	768 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	769 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	770 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	771 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	772 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	773 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	774 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	775 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	776 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	777 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	778 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	779 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	780 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	781 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	782 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	783 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	784 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	785 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	786 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	787 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	788 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	789 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	790 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	791 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	792 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23101> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	793 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	794 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	795 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent6> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/E0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	796 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	797 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#displayId> "FPs_small_ins_J23101_E0040" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	798 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	799 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	800 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	801 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	802 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	803 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	804 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	805 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	806 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	807 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	808 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	809 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	810 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	811 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E0040> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	812 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	813 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	814 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	815 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	816 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	817 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	818 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	819 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	820 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	821 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	822 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	823 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	824 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	825 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	826 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	827 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	828 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	829 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	830 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	831 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	832 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	833 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	834 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	835 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	836 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	837 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	838 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	839 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	840 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	841 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	842 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	843 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	844 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	845 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	846 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	847 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	848 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	849 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	850 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	851 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	852 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	853 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	854 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23101> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	855 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	856 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	857 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent6> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/E1010> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	858 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	859 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#displayId> "FPs_small_ins_J23101_E1010" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	860 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	861 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	862 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	863 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	864 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	865 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	866 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	867 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	868 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	869 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	870 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	871 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	872 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	873 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_E1010> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	874 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	875 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	876 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	877 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	878 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	879 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	880 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	881 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	882 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	883 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	884 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	885 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	886 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	887 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	888 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	889 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	890 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	891 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	892 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	893 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	894 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	895 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	896 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	897 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	898 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	899 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	900 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	901 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	902 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	903 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	904 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	905 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	906 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	907 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	908 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	909 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	910 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	911 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	912 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	913 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	914 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	915 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	916 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23101> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	917 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	918 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	919 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent6> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/ECFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	920 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	921 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#displayId> "FPs_small_ins_J23101_ECFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	922 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	923 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	924 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	925 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	926 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	927 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	928 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	929 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	930 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	931 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	932 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	933 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	934 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	935 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_ECFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	936 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	937 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	938 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	939 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	940 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	941 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	942 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	943 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	944 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	945 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	946 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	947 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	948 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	949 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	950 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	951 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	952 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	953 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	954 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	955 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	956 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	957 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	958 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	959 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	960 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	961 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	962 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	963 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	964 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	965 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	966 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	967 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	968 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	969 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	970 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	971 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	972 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	973 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	974 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	975 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	976 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	977 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	978 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23101> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	979 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	980 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	981 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent6> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J06504> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	982 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	983 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#displayId> "FPs_small_ins_J23101_J06504" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	984 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	985 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	986 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	987 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	988 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	989 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	990 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	991 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	992 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	993 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	994 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	995 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	996 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	997 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_J06504> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	998 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	999 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1000 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1001 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1002 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1003 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1004 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1005 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1006 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1007 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1008 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1009 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1010 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1011 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1012 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1013 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1014 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1015 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1016 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1017 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1018 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1019 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1020 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1021 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1022 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1023 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1024 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1025 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1026 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1027 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1028 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1029 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1030 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1031 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1032 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1033 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1034 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1035 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1036 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1037 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1038 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1039 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1040 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23101> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1041 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1042 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1043 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent6> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/K592100> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1044 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1045 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#displayId> "FPs_small_ins_J23101_K592100" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1046 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1047 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1048 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1049 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1050 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1051 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1052 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1053 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1054 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1055 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1056 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1057 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1058 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1059 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_K592100> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1060 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1061 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1062 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1063 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1064 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1065 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1066 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1067 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1068 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1069 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1070 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1071 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1072 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1073 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1074 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1075 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1076 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1077 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1078 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1079 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1080 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1081 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1082 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1083 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1084 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1085 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1086 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1087 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1088 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1089 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1090 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1091 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1092 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1093 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1094 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1095 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1096 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1097 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1098 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1099 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1100 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1101 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1102 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23101> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1103 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1104 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1105 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent6> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/mTagBFP2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1106 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1107 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#displayId> "FPs_small_ins_J23101_mTagBFP2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1108 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1109 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1110 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1111 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1112 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1113 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1114 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1115 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1116 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1117 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1118 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1119 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1120 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1121 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mTagBFP2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1122 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1123 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1124 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1125 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1126 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1127 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1128 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1129 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1130 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1131 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1132 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1133 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1134 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1135 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1136 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1137 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1138 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1139 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1140 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1141 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1142 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1143 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1144 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1145 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1146 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1147 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1148 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1149 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1150 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1151 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1152 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1153 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1154 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1155 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1156 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1157 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1158 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1159 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1160 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1161 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1162 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1163 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1164 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23101> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1165 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1166 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1167 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent6> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/meffCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1168 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1169 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#displayId> "FPs_small_ins_J23101_meffCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1170 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1171 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1172 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1173 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1174 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1175 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1176 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1177 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1178 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1179 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1180 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1181 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1182 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1183 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_meffCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1184 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1185 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1186 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1187 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1188 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1189 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1190 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1191 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1192 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1193 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1194 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1195 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1196 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1197 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1198 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1199 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1200 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1201 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1202 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1203 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1204 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1205 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1206 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1207 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1208 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1209 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1210 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1211 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1212 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1213 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1214 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1215 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1216 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1217 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1218 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1219 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1220 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1221 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1222 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1223 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1224 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1225 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1226 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23101> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1227 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1228 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1229 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent6> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/mmilCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1230 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1231 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#displayId> "FPs_small_ins_J23101_mmilCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1232 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1233 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1234 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1235 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1236 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1237 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1238 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1239 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1240 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1241 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1242 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1243 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1244 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1245 <http://sbolstandard.org/testfiles/FPs_small_ins_J23101_mmilCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1246 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1247 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1248 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1249 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1250 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1251 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1252 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1253 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1254 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1255 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1256 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1257 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1258 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1259 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1260 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1261 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1262 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1263 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1264 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1265 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1266 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1267 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1268 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1269 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1270 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1271 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1272 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1273 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1274 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1275 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1276 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1277 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1278 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1279 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1280 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1281 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1282 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1283 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1284 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1285 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1286 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1287 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1288 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23105> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1289 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1290 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1291 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent6> <http://sbols.org/v3#instanceOf> <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1292 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1293 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#displayId> "FPs_small_ins_J23105_ATP07149_1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1294 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1295 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1296 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1297 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1298 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1299 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1300 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1301 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1302 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1303 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1304 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1305 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1306 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1307 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ATP07149_1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1308 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1309 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1310 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1311 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1312 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1313 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1314 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1315 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1316 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1317 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1318 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1319 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1320 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1321 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1322 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1323 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1324 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1325 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1326 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1327 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1328 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1329 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1330 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1331 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1332 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1333 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1334 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1335 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1336 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1337 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1338 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1339 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1340 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1341 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1342 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1343 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1344 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1345 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1346 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1347 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1348 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1349 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1350 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23105> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1351 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1352 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1353 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent6> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/E0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1354 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1355 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#displayId> "FPs_small_ins_J23105_E0040" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1356 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1357 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1358 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1359 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1360 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1361 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1362 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1363 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1364 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1365 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1366 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1367 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1368 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1369 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E0040> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1370 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1371 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1372 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1373 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1374 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1375 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1376 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1377 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1378 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1379 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1380 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1381 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1382 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1383 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1384 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1385 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1386 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1387 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1388 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1389 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1390 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1391 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1392 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1393 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1394 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1395 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1396 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1397 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1398 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1399 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1400 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1401 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1402 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1403 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1404 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1405 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1406 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1407 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1408 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1409 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1410 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1411 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1412 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23105> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1413 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1414 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1415 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent6> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/E1010> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1416 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1417 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#displayId> "FPs_small_ins_J23105_E1010" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1418 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1419 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1420 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1421 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1422 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1423 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1424 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1425 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1426 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1427 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1428 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1429 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1430 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1431 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_E1010> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1432 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1433 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1434 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1435 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1436 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1437 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1438 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1439 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1440 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1441 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1442 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1443 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1444 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1445 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1446 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1447 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1448 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1449 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1450 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1451 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1452 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1453 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1454 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1455 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1456 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1457 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1458 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1459 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1460 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1461 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1462 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1463 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1464 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1465 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1466 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1467 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1468 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1469 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1470 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1471 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1472 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1473 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1474 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23105> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1475 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1476 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1477 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent6> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/ECFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1478 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1479 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#displayId> "FPs_small_ins_J23105_ECFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1480 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1481 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1482 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1483 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1484 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1485 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1486 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1487 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1488 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1489 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1490 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1491 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1492 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1493 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_ECFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1494 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1495 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1496 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1497 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1498 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1499 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1500 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1501 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1502 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1503 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1504 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1505 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1506 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1507 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1508 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1509 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1510 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1511 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1512 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1513 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1514 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1515 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1516 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1517 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1518 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1519 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1520 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1521 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1522 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1523 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1524 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1525 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1526 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1527 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1528 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1529 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1530 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1531 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1532 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1533 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1534 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1535 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1536 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23105> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1537 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1538 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1539 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent6> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J06504> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1540 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1541 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#displayId> "FPs_small_ins_J23105_J06504" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1542 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1543 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1544 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1545 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1546 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1547 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1548 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1549 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1550 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1551 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1552 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1553 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1554 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1555 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_J06504> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1556 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1557 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1558 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1559 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1560 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1561 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1562 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1563 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1564 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1565 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1566 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1567 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1568 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1569 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1570 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1571 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1572 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1573 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1574 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1575 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1576 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1577 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1578 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1579 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1580 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1581 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1582 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1583 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1584 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1585 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1586 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1587 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1588 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1589 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1590 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1591 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1592 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1593 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1594 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1595 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1596 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1597 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1598 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23105> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1599 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1600 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1601 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent6> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/K592100> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1602 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1603 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#displayId> "FPs_small_ins_J23105_K592100" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1604 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1605 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1606 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1607 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1608 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1609 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1610 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1611 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1612 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1613 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1614 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1615 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1616 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1617 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_K592100> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1618 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1619 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1620 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1621 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1622 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1623 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1624 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1625 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1626 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1627 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1628 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1629 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1630 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1631 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1632 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1633 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1634 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1635 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1636 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1637 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1638 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1639 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1640 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1641 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1642 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1643 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1644 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1645 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1646 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1647 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1648 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1649 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1650 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1651 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1652 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1653 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1654 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1655 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1656 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1657 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1658 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1659 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1660 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23105> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1661 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1662 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1663 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent6> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/mTagBFP2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1664 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1665 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#displayId> "FPs_small_ins_J23105_mTagBFP2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1666 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1667 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1668 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1669 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1670 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1671 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1672 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1673 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1674 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1675 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1676 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1677 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1678 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1679 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mTagBFP2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1680 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1681 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1682 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1683 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1684 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1685 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1686 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1687 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1688 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1689 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1690 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1691 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1692 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1693 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1694 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1695 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1696 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1697 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1698 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1699 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1700 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1701 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1702 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1703 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1704 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1705 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1706 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1707 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1708 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1709 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1710 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1711 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1712 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1713 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1714 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1715 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1716 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1717 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1718 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1719 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1720 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1721 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1722 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23105> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1723 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1724 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1725 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent6> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/meffCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1726 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1727 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#displayId> "FPs_small_ins_J23105_meffCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1728 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1729 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1730 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1731 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1732 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1733 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1734 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1735 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1736 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1737 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1738 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1739 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1740 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1741 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_meffCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1742 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1743 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1744 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1745 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1746 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1747 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1748 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1749 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1750 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1751 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1752 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1753 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1754 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1755 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1756 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1757 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1758 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1759 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1760 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1761 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1762 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1763 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1764 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1765 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1766 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1767 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1768 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1769 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1770 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1771 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1772 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1773 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1774 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1775 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1776 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1777 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1778 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1779 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1780 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1781 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1782 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1783 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent5> <http://sbols.org/v3#displayId> "SubComponent5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1784 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent5> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J23105> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1785 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1786 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent6> <http://sbols.org/v3#displayId> "SubComponent6" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1787 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent6> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/mmilCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1788 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent6> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1789 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#displayId> "FPs_small_ins_J23105_mmilCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1790 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1791 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1792 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1793 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1794 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1795 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1796 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1797 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1798 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1799 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1800 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP/SubComponent6> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1801 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1802 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1803 <http://sbolstandard.org/testfiles/FPs_small_ins_J23105_mmilCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1804 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#displayId> "Round_1_order_collection" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1805 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1806 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ATP07149_1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1807 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1808 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_E1010> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1809 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_ECFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1810 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_J06504> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1811 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_K592100> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1812 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mTagBFP2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1813 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_meffCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1814 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23101_mmilCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1815 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ATP07149_1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1816 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1817 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_E1010> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1818 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_ECFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1819 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_J06504> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1820 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_K592100> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1821 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mTagBFP2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1822 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_meffCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1823 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_FPs_small_ins_J23105_mmilCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1824 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/_2018_Interlab_I20270> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1825 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/_2018_Interlab_J364001> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1826 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/_2018_Interlab_J364002> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1827 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/_2018_Interlab_J364007> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1828 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/_2018_Interlab_J364009> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1829 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/_2018_Interlab_R0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1830 <http://sbolstandard.org/testfiles/Round_1_order_collection> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Collection> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1831 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#description> "2 stop codons" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1832 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#displayId> "STOP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1833 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1834 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/STOP_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1835 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#name> "STOP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1836 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000319> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1837 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1838 <http://sbolstandard.org/testfiles/STOP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1839 <http://sbolstandard.org/testfiles/STOP_sequence> <http://sbols.org/v3#displayId> "STOP_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1840 <http://sbolstandard.org/testfiles/STOP_sequence> <http://sbols.org/v3#elements> "TAATAA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1841 <http://sbolstandard.org/testfiles/STOP_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1842 <http://sbolstandard.org/testfiles/STOP_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1843 <http://sbolstandard.org/testfiles/STOP_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1844 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#description> "" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1845 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#displayId> "UNSX" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1846 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1847 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/UNSX_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1848 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#name> "UNSX" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1849 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#role> <https://identifiers.org/SO:0001623> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1850 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1851 <http://sbolstandard.org/testfiles/UNSX> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1852 <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1853 <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1854 <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1855 <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1856 <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1857 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1858 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1859 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1860 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1861 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1862 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UP_element_consensus> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1863 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1864 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1865 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#description> "" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1866 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#displayId> "UNSX_UP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1867 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1868 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1869 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1870 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1871 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#name> "UNSX-UP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1872 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1873 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1874 <http://sbolstandard.org/testfiles/UNSX_UP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1875 <http://sbolstandard.org/testfiles/UNSX_sequence> <http://sbols.org/v3#displayId> "UNSX_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1876 <http://sbolstandard.org/testfiles/UNSX_sequence> <http://sbols.org/v3#elements> "CCAGGATACATAGATTACCACAACTCCGAGCCCTTCCACC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1877 <http://sbolstandard.org/testfiles/UNSX_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1878 <http://sbolstandard.org/testfiles/UNSX_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1879 <http://sbolstandard.org/testfiles/UNSX_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1880 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#description> "consensus without runs of As and Ts -59 to -36" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1881 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#displayId> "UP_element_consensus" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1882 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1883 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1884 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#name> "UP element consensus" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1885 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#role> <https://identifiers.org/SO:0001659> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1886 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1887 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1888 <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> <http://sbols.org/v3#displayId> "UP_element_consensus_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1889 <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> <http://sbols.org/v3#elements> "TGAAATATATTTTCGAAAAGCCGC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1890 <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1891 <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1892 <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1893 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1894 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1895 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1896 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1897 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1898 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1899 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1900 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1901 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1902 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1903 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1904 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1905 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1906 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1907 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent2> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/I20270> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1908 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1909 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270> <http://sbols.org/v3#displayId> "_2018_Interlab_I20270" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1910 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1911 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1912 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1913 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_I20270/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1914 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1915 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1916 <http://sbolstandard.org/testfiles/_2018_Interlab_I20270> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1917 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1918 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1919 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1920 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1921 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1922 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1923 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1924 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1925 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1926 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1927 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1928 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1929 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1930 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1931 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent2> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J364001> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1932 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1933 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001> <http://sbols.org/v3#displayId> "_2018_Interlab_J364001" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1934 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1935 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1936 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1937 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_J364001/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1938 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1939 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1940 <http://sbolstandard.org/testfiles/_2018_Interlab_J364001> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1941 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1942 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1943 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1944 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1945 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1946 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1947 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1948 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1949 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1950 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1951 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1952 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1953 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1954 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1955 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent2> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J364002> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1956 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1957 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002> <http://sbols.org/v3#displayId> "_2018_Interlab_J364002" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1958 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1959 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1960 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1961 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_J364002/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1962 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1963 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1964 <http://sbolstandard.org/testfiles/_2018_Interlab_J364002> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1965 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1966 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1967 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1968 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1969 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1970 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1971 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1972 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1973 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1974 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1975 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1976 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1977 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1978 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1979 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent2> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J364007> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1980 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1981 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007> <http://sbols.org/v3#displayId> "_2018_Interlab_J364007" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1982 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1983 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1984 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1985 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_J364007/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1986 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1987 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1988 <http://sbolstandard.org/testfiles/_2018_Interlab_J364007> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1989 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1990 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1991 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1992 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1993 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1994 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1995 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1996 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1997 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1998 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1999 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2000 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2001 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2002 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2003 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent2> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/J364009> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2004 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2005 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009> <http://sbols.org/v3#displayId> "_2018_Interlab_J364009" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2006 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2007 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2008 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2009 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_J364009/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2010 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2011 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2012 <http://sbolstandard.org/testfiles/_2018_Interlab_J364009> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2013 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2014 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2015 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2016 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2017 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2018 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2019 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2020 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2021 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2022 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2023 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2024 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2025 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2026 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2027 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent2> <http://sbols.org/v3#instanceOf> <http://parts.igem.org/R0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2028 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2029 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040> <http://sbols.org/v3#displayId> "_2018_Interlab_R0040" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2030 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2031 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2032 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2033 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_R0040/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2034 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2035 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2036 <http://sbolstandard.org/testfiles/_2018_Interlab_R0040> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2037 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#description> "Blue FP codon optimized" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2038 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#displayId> "mTagBFP2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2039 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2040 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/mTagBFP2_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2041 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#name> "mTagBFP2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2042 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2043 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2044 <http://sbolstandard.org/testfiles/mTagBFP2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2045 <http://sbolstandard.org/testfiles/mTagBFP2_sequence> <http://sbols.org/v3#displayId> "mTagBFP2_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2046 <http://sbolstandard.org/testfiles/mTagBFP2_sequence> <http://sbols.org/v3#elements> "ATGGTATCGAAGGGTGAAGAGTTGATTAAGGAAAACATGCACATGAAGTTATACATGGAAGGGACCGTGGATAATCACCATTTCAAATGCACATCTGAAGGAGAGGGAAAACCTTACGAAGGGACCCAGACAATGCGTATCAAAGTGGTCGAGGGTGGCCCTTTACCATTCGCGTTCGACATCCTGGCGACCTCCTTTTTATATGGGAGCAAAACATTCATTAACCACACCCAGGGAATCCCGGATTTCTTCAAGCAGTCTTTCCCTGAAGGGTTTACGTGGGAGCGTGTGACAACTTATGAGGATGGCGGGGTTTTGACGGCTACGCAGGATACTTCGTTACAAGACGGTTGCTTAATTTACAATGTAAAGATTCGTGGAGTAAATTTTACATCAAACGGTCCGGTCATGCAAAAGAAAACCCTTGGTTGGGAGGCGTTTACCGAGACATTGTATCCTGCCGACGGGGGATTAGAGGGTCGCAATGATATGGCACTGAAACTTGTGGGGGGGTCTCATTTAATTGCAAACGCTAAGACAACTTACCGCTCCAAGAAGCCCGCTAAGAACCTGAAAATGCCTGGGGTCTACTATGTTGACTATCGCCTTGAGCGTATCAAGGAGGCGAACAACGAGACTTACGTCGAGCAGCATGAGGTAGCGGTTGCCCGTTACTGTGACCTGCCATCTAAGTTAGGACATAAGTTGAAT" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2047 <http://sbolstandard.org/testfiles/mTagBFP2_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2048 <http://sbolstandard.org/testfiles/mTagBFP2_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2049 <http://sbolstandard.org/testfiles/mTagBFP2_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2050 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#description> "Cyan FP (free); codon optimized using IDT tool <https://www.idtdna.com/CodonOpt>\nmeffCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2051 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#displayId> "meffCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2052 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2053 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/meffCFP_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2054 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#name> "meffCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2055 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2056 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2057 <http://sbolstandard.org/testfiles/meffCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2058 <http://sbolstandard.org/testfiles/meffCFP_sequence> <http://sbols.org/v3#displayId> "meffCFP_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2059 <http://sbolstandard.org/testfiles/meffCFP_sequence> <http://sbols.org/v3#elements> "ATGGCGCTTTCAAAGCAGAGTTTACCGAGTGACATGAAGTTGATCTACCACATGGACGGGAACGTGAATGGTCACTCTTTCGTCATTAAGGGTGAAGGCGAGGGAAAACCCTATGAAGGAACACATACTATCAAGCTGCAAGTTGTTGAGGGCTCACCGTTACCTTTCAGCGCCGACATTCTGTCCACAGTTTTTCAATATGGGAACCGCTGTTTCACTAAGTATCCGCCTAATATCGTCGATTATTTTAAGAATAGCTGTTCTGGTGGGGGCTACAAGTTTGGACGCAGCTTTCTTTACGAAGACGGTGCGGTCTGTACGGCGTCAGGCGATATTACTCTGTCCGCAGACAAAAAGAGCTTTGAACACAAATCGAAATTCTTAGGCGTGAACTTCCCGGCTGACGGTCCGGTGATGAAGAAAGAGACCACCAACTGGGAACCATCGTGCGAAAAAATGACTCCGAATGGCATGACACTGATCGGTGACGTTACGGGTTTTTTGTTGAAGGAGGACGGAAAGCGTTACAAATGTCAATTTCATACCTTCCATGACGCTAAAGATAAGTCCAAAAAGATGCCGATGCCCGACTTCCACTTTGTCCAGCATAAAATTGAGCGCAAGGACCTTCCTGGAAGTATGCAAACATGGCGTCTTACCGAGCACGCGGCAGCATGTAAAACTTGTTTTACGGAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2060 <http://sbolstandard.org/testfiles/meffCFP_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2061 <http://sbolstandard.org/testfiles/meffCFP_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2062 <http://sbolstandard.org/testfiles/meffCFP_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2063 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#description> "Blue FP (free); codon optimized using IDT tool <https://www.idtdna.com/CodonOpt>\nmmilCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2064 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#displayId> "mmilCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2065 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2066 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/mmilCFP_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2067 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#name> "mmilCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2068 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2069 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2070 <http://sbolstandard.org/testfiles/mmilCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2071 <http://sbolstandard.org/testfiles/mmilCFP_sequence> <http://sbols.org/v3#displayId> "mmilCFP_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2072 <http://sbolstandard.org/testfiles/mmilCFP_sequence> <http://sbols.org/v3#elements> "ATGGCTCTGCCTAAACAAATGAAACTGACTTATCACATGGAGGGTACTGTGAACGGTCATTTTTTTATCATCAAGGGCGAAGGAGGGGGAGAGCCGTATGAGGGTACTCATACGATCAAGTTACAGGTGGTAGAGGGAAGCCCGTTGCCCTTTTCACCGGATATTCTTTCCACCGTCTTCCAATACGGCAACCGCTGCTTCACTAAATACCCTCCCAACATCGTTGATTACTTCAAAAACTCCTGCTCGGGCGGCGGTTATACTTTTGGACGTAGCTTCCTTTATGAGGACGGAGCTGTCTGTACTGCTTCCGGTGACATTACGCTGAGCAGCGACAAATCATCCTTTGAGCACAAATCTAAATTTCTGGGAGTAAACTTTCCTGCCGATGGCCCGGTGATGAAAAAAGAAACCACTAATTGGGAGCCTTCATGTGAGAAAATGACACCCAACGGGATGACCTTAATCGGTGATGTGACGGAGTTCCTGTTGAAGAAGGACGGTAAGCGTTACAAGTGCCAATTCCACACATTCCACGACGCGAAGGAGAAAAGCCGCAATATGCCGATGCCCGATTTCCATTTCGTTCAGCACGAGATTGAACGTAAAGATTTGCCAGGACCAATGCAAACATGGCAGTTGACCGAGCACGCAGCAGCCTGTAAGAACTGTTTCACAGAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2073 <http://sbolstandard.org/testfiles/mmilCFP_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2074 <http://sbolstandard.org/testfiles/mmilCFP_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2075 <http://sbolstandard.org/testfiles/mmilCFP_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2076 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#description> "pMB1 replicon, 100-300 copy" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2077 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#displayId> "pSB1C3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2078 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2079 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#name> "pSB1C3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2080 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000155> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2081 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2082 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#type> <https://identifiers.org/SO:0000988> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2083 <http://sbolstandard.org/testfiles/pSB1C3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2084 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#description> "Cyan FP; codon optimized using IDT tool <https://www.idtdna.com/CodonOpt>\nmCerulean3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2085 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#displayId> "ATP07149_1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2086 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#hasNamespace> <https://www.ncbi.nlm.nih.gov/nuccore> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2087 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#hasSequence> <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2088 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#name> "mCerulean3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2089 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2090 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2091 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2092 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> <http://sbols.org/v3#displayId> "ATP07149_1_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2093 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> <http://sbols.org/v3#elements> "ATGGTGTCGAAAGGTGAAGAACTTTTTACAGGTGTGGTCCCCATTTTAGTCGAATTAGATGGGGATGTGAATGGTCACAAATTCTCGGTGTCTGGGGAGGGTGAAGGTGACGCGACCTACGGGAAGTTGACTCTGAAATTCATTTGCACTACGGGGAAGTTACCAGTGCCCTGGCCCACTCTGGTTACAACACTGTCATGGGGCGTCCAATGTTTTGCTCGTTATCCTGACCACATGAAACAGCATGACTTCTTCAAGAGCGCAATGCCGGAAGGCTATGTCCAAGAGCGTACTATCTTTTTCAAAGACGATGGGAACTACAAAACACGCGCAGAAGTGAAGTTTGAGGGAGATACCCTGGTTAATCGCATTGAATTGAAAGGTATCGACTTCAAGGAGGATGGTAATATCCTGGGGCACAAATTGGAGTACAACGCTATCCACGGCAATGTTTACATTACGGCAGACAAACAGAAAAACGGAATTAAGGCCAATTTCGGACTTAACTGCAACATCGAAGATGGGTCGGTACAACTGGCAGACCACTATCAGCAAAATACGCCTATTGGTGACGGTCCTGTCCTGTTACCGGACAATCATTATCTTTCCACTCAGTCGAAACTGAGTAAAGATCCGAACGAGAAGCGCGATCACATGGTATTATTAGAGTTCGTCACAGCCGCAGGTATTACGTTAGGGATGGATGAGCTTTACAAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2094 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2095 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> <http://sbols.org/v3#hasNamespace> <https://www.ncbi.nlm.nih.gov/nuccore> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2096 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .

Mercurial > repos > tduigou > sbol3_diff

annotate test-data/expanded_simple_library.nt @ 0:024def08af09 draft