sbol3_diff: test-data/simple_library.nt annotate

annotate test-data/simple_library.nt @ 2:67fd1abac44b draft default tip

planemo upload for repository https://github.com/SynBioDex/SBOL-utilities commit 51525bc3c90f9bdd38e26e74e6a8761306b3a442

author	tduigou
date	Mon, 15 May 2023 07:38:18 +0000
parents	024def08af09
children

rev	line source
0 024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	1 <http://parts.igem.org/E0040> <http://sbols.org/v3#description> "Green FP (off patent)\nGFPmut3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	2 <http://parts.igem.org/E0040> <http://sbols.org/v3#displayId> "E0040" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	3 <http://parts.igem.org/E0040> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	4 <http://parts.igem.org/E0040> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/E0040_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	5 <http://parts.igem.org/E0040> <http://sbols.org/v3#name> "GFPmut3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	6 <http://parts.igem.org/E0040> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	7 <http://parts.igem.org/E0040> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	8 <http://parts.igem.org/E0040> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	9 <http://parts.igem.org/E0040_sequence> <http://sbols.org/v3#displayId> "E0040_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	10 <http://parts.igem.org/E0040_sequence> <http://sbols.org/v3#elements> "ATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	11 <http://parts.igem.org/E0040_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	12 <http://parts.igem.org/E0040_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	13 <http://parts.igem.org/E0040_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	14 <http://parts.igem.org/E1010> <http://sbols.org/v3#description> "Red FP (off patent)\nmRFP1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	15 <http://parts.igem.org/E1010> <http://sbols.org/v3#displayId> "E1010" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	16 <http://parts.igem.org/E1010> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	17 <http://parts.igem.org/E1010> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/E1010_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	18 <http://parts.igem.org/E1010> <http://sbols.org/v3#name> "mRFP1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	19 <http://parts.igem.org/E1010> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	20 <http://parts.igem.org/E1010> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	21 <http://parts.igem.org/E1010> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	22 <http://parts.igem.org/E1010_sequence> <http://sbols.org/v3#displayId> "E1010_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	23 <http://parts.igem.org/E1010_sequence> <http://sbols.org/v3#elements> "ATGGCTTCCTCCGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGTTCCGTTAACGGTCACGAGTTCGAAATCGAAGGTGAAGGTGAAGGTCGTCCGTACGAAGGTACCCAGACCGCTAAACTGAAAGTTACCAAAGGTGGTCCGCTGCCGTTCGCTTGGGACATCCTGTCCCCGCAGTTCCAGTACGGTTCCAAAGCTTACGTTAAACACCCGGCTGACATCCCGGACTACCTGAAACTGTCCTTCCCGGAAGGTTTCAAATGGGAACGTGTTATGAACTTCGAAGACGGTGGTGTTGTTACCGTTACCCAGGACTCCTCCCTGCAAGACGGTGAGTTCATCTACAAAGTTAAACTGCGTGGTACCAACTTCCCGTCCGACGGTCCGGTTATGCAGAAAAAAACCATGGGTTGGGAAGCTTCCACCGAACGTATGTACCCGGAAGACGGTGCTCTGAAAGGTGAAATCAAAATGCGTCTGAAACTGAAAGACGGTGGTCACTACGACGCTGAAGTTAAAACCACCTACATGGCTAAAAAACCGGTTCAGCTGCCGGGTGCTTACAAAACCGACATCAAACTGGACATCACCTCCCACAACGAAGACTACACCATCGTTGAACAGTACGAACGTGCTGAAGGTCGTCACTCCACCGGTGCTTAATAACGCTGATAGTGCTAGTGTAGATCGC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	24 <http://parts.igem.org/E1010_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	25 <http://parts.igem.org/E1010_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	26 <http://parts.igem.org/E1010_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	27 <http://parts.igem.org/I20270> <http://sbols.org/v3#description> "positive control 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	28 <http://parts.igem.org/I20270> <http://sbols.org/v3#displayId> "I20270" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	29 <http://parts.igem.org/I20270> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	30 <http://parts.igem.org/I20270> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/I20270_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	31 <http://parts.igem.org/I20270> <http://sbols.org/v3#name> "I20270" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	32 <http://parts.igem.org/I20270> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	33 <http://parts.igem.org/I20270> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	34 <http://parts.igem.org/I20270> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	35 <http://parts.igem.org/I20270_sequence> <http://sbols.org/v3#displayId> "I20270_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	36 <http://parts.igem.org/I20270_sequence> <http://sbols.org/v3#elements> "TTGATGGCTAGCTCAGTCCTAGGTACAATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	37 <http://parts.igem.org/I20270_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	38 <http://parts.igem.org/I20270_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	39 <http://parts.igem.org/I20270_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	40 <http://parts.igem.org/J06504> <http://sbols.org/v3#description> "Red FP (off patent)\nmCherry" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	41 <http://parts.igem.org/J06504> <http://sbols.org/v3#displayId> "J06504" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	42 <http://parts.igem.org/J06504> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	43 <http://parts.igem.org/J06504> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J06504_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	44 <http://parts.igem.org/J06504> <http://sbols.org/v3#name> "J06504" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	45 <http://parts.igem.org/J06504> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	46 <http://parts.igem.org/J06504> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	47 <http://parts.igem.org/J06504> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	48 <http://parts.igem.org/J06504_sequence> <http://sbols.org/v3#displayId> "J06504_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	49 <http://parts.igem.org/J06504_sequence> <http://sbols.org/v3#elements> "ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCTTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	50 <http://parts.igem.org/J06504_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	51 <http://parts.igem.org/J06504_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	52 <http://parts.igem.org/J06504_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	53 <http://parts.igem.org/J23101> <http://sbols.org/v3#description> "5.5 SLM (high, but variable)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	54 <http://parts.igem.org/J23101> <http://sbols.org/v3#displayId> "J23101" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	55 <http://parts.igem.org/J23101> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	56 <http://parts.igem.org/J23101> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J23101_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	57 <http://parts.igem.org/J23101> <http://sbols.org/v3#name> "J23101" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	58 <http://parts.igem.org/J23101> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000167> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	59 <http://parts.igem.org/J23101> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	60 <http://parts.igem.org/J23101> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	61 <http://parts.igem.org/J23101_sequence> <http://sbols.org/v3#displayId> "J23101_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	62 <http://parts.igem.org/J23101_sequence> <http://sbols.org/v3#elements> "TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	63 <http://parts.igem.org/J23101_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	64 <http://parts.igem.org/J23101_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	65 <http://parts.igem.org/J23101_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	66 <http://parts.igem.org/J23105> <http://sbols.org/v3#description> "TBD SLM (expect 4.5)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	67 <http://parts.igem.org/J23105> <http://sbols.org/v3#displayId> "J23105" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	68 <http://parts.igem.org/J23105> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	69 <http://parts.igem.org/J23105> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J23105_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	70 <http://parts.igem.org/J23105> <http://sbols.org/v3#name> "J23105" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	71 <http://parts.igem.org/J23105> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000167> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	72 <http://parts.igem.org/J23105> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	73 <http://parts.igem.org/J23105> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	74 <http://parts.igem.org/J23105_sequence> <http://sbols.org/v3#displayId> "J23105_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	75 <http://parts.igem.org/J23105_sequence> <http://sbols.org/v3#elements> "TTGACAGCTAGCTCAGTCCTAGGGACTATGCTAGC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	76 <http://parts.igem.org/J23105_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	77 <http://parts.igem.org/J23105_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	78 <http://parts.igem.org/J23105_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	79 <http://parts.igem.org/J364001> <http://sbols.org/v3#description> "J23106 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	80 <http://parts.igem.org/J364001> <http://sbols.org/v3#displayId> "J364001" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	81 <http://parts.igem.org/J364001> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	82 <http://parts.igem.org/J364001> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J364001_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	83 <http://parts.igem.org/J364001> <http://sbols.org/v3#name> "J364001" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	84 <http://parts.igem.org/J364001> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	85 <http://parts.igem.org/J364001> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	86 <http://parts.igem.org/J364001> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	87 <http://parts.igem.org/J364001_sequence> <http://sbols.org/v3#displayId> "J364001_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	88 <http://parts.igem.org/J364001_sequence> <http://sbols.org/v3#elements> "TTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCTACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	89 <http://parts.igem.org/J364001_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	90 <http://parts.igem.org/J364001_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	91 <http://parts.igem.org/J364001_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	92 <http://parts.igem.org/J364002> <http://sbols.org/v3#description> "J23117 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	93 <http://parts.igem.org/J364002> <http://sbols.org/v3#displayId> "J364002" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	94 <http://parts.igem.org/J364002> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	95 <http://parts.igem.org/J364002> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J364002_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	96 <http://parts.igem.org/J364002> <http://sbols.org/v3#name> "J364002" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	97 <http://parts.igem.org/J364002> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	98 <http://parts.igem.org/J364002> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	99 <http://parts.igem.org/J364002> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	100 <http://parts.igem.org/J364002_sequence> <http://sbols.org/v3#displayId> "J364002_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	101 <http://parts.igem.org/J364002_sequence> <http://sbols.org/v3#elements> "TTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGCTACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	102 <http://parts.igem.org/J364002_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	103 <http://parts.igem.org/J364002_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	104 <http://parts.igem.org/J364002_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	105 <http://parts.igem.org/J364007> <http://sbols.org/v3#description> "J23100 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	106 <http://parts.igem.org/J364007> <http://sbols.org/v3#displayId> "J364007" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	107 <http://parts.igem.org/J364007> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	108 <http://parts.igem.org/J364007> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J364007_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	109 <http://parts.igem.org/J364007> <http://sbols.org/v3#name> "J364007" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	110 <http://parts.igem.org/J364007> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	111 <http://parts.igem.org/J364007> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	112 <http://parts.igem.org/J364007> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	113 <http://parts.igem.org/J364007_sequence> <http://sbols.org/v3#displayId> "J364007_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	114 <http://parts.igem.org/J364007_sequence> <http://sbols.org/v3#elements> "TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	115 <http://parts.igem.org/J364007_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	116 <http://parts.igem.org/J364007_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	117 <http://parts.igem.org/J364007_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	118 <http://parts.igem.org/J364009> <http://sbols.org/v3#description> "J23116 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	119 <http://parts.igem.org/J364009> <http://sbols.org/v3#displayId> "J364009" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	120 <http://parts.igem.org/J364009> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	121 <http://parts.igem.org/J364009> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/J364009_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	122 <http://parts.igem.org/J364009> <http://sbols.org/v3#name> "J364009" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	123 <http://parts.igem.org/J364009> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	124 <http://parts.igem.org/J364009> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	125 <http://parts.igem.org/J364009> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	126 <http://parts.igem.org/J364009_sequence> <http://sbols.org/v3#displayId> "J364009_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	127 <http://parts.igem.org/J364009_sequence> <http://sbols.org/v3#elements> "TTGACAGCTAGCTCAGTCCTAGGGACTATGCTAGCTACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	128 <http://parts.igem.org/J364009_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	129 <http://parts.igem.org/J364009_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	130 <http://parts.igem.org/J364009_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	131 <http://parts.igem.org/K592100> <http://sbols.org/v3#description> "Blue FP\nTagBFP2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	132 <http://parts.igem.org/K592100> <http://sbols.org/v3#displayId> "K592100" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	133 <http://parts.igem.org/K592100> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	134 <http://parts.igem.org/K592100> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/K592100_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	135 <http://parts.igem.org/K592100> <http://sbols.org/v3#name> "K592100" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	136 <http://parts.igem.org/K592100> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	137 <http://parts.igem.org/K592100> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	138 <http://parts.igem.org/K592100> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	139 <http://parts.igem.org/K592100_sequence> <http://sbols.org/v3#displayId> "K592100_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	140 <http://parts.igem.org/K592100_sequence> <http://sbols.org/v3#elements> "ATGAGCGAACTGATCAAAGAGAACATGCACATGAAGCTGTACATGGAAGGCACCGTTGACAACCACCACTTTAAGTGCACGTCTGAGGGTGAGGGTAAGCCGTACGAAGGCACCCAAACCATGCGTATCAAAGTTGTGGAGGGCGGTCCACTGCCGTTCGCTTTTGACATTCTGGCGACCAGCTTCCTGTACGGTTCCAAAACGTTCATTAACCATACTCAGGGCATTCCGGATTTCTTCAAACAGAGCTTTCCGGAAGGTTTCACCTGGGAGCGTGTCACCACGTATGAAGATGGTGGTGTGTTGACCGCCACCCAAGATACCTCCCTGCAAGATGGCTGTCTGATCTATAACGTGAAAATTCGTGGCGTCAACTTTACGAGCAATGGTCCGGTGATGCAGAAGAAAACCCTGGGTTGGGAGGCGTTTACGGAAACCCTGTATCCGGCCGATGGTGGCCTGGAGGGCCGTAACGACATGGCACTGAAGCTGGTTGGTGGCAGCCATTTGATCGCAAATATCAAGACGACGTACCGCAGCAAGAAACCGGCGAAAAATCTGAAGATGCCGGGTGTTTACTATGTCGACTACCGTCTGGAACGCATTAAAGAAGCGAATAATGAGACTTACGTGGAGCAGCACGAGGTTGCAGTCGCGCGCTATTGCGACTTGCCTAGCAAGCTGGGTCATAAACTGAAT" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	141 <http://parts.igem.org/K592100_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	142 <http://parts.igem.org/K592100_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	143 <http://parts.igem.org/K592100_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	144 <http://parts.igem.org/R0040> <http://sbols.org/v3#description> "negative control 2018 interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	145 <http://parts.igem.org/R0040> <http://sbols.org/v3#displayId> "R0040" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	146 <http://parts.igem.org/R0040> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	147 <http://parts.igem.org/R0040> <http://sbols.org/v3#hasSequence> <http://parts.igem.org/R0040_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	148 <http://parts.igem.org/R0040> <http://sbols.org/v3#name> "R0040" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	149 <http://parts.igem.org/R0040> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	150 <http://parts.igem.org/R0040> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	151 <http://parts.igem.org/R0040> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	152 <http://parts.igem.org/R0040_sequence> <http://sbols.org/v3#displayId> "R0040_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	153 <http://parts.igem.org/R0040_sequence> <http://sbols.org/v3#elements> "TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCAC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	154 <http://parts.igem.org/R0040_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	155 <http://parts.igem.org/R0040_sequence> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	156 <http://parts.igem.org/R0040_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	157 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#cardinality> <http://sbols.org/v3#one> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	158 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#displayId> "VariableFeature1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	159 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#variable> <http://sbolstandard.org/testfiles/All_FPs_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	160 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/E0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	161 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/E1010> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	162 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/J06504> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	163 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/K592100> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	164 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#variant> <http://sbolstandard.org/testfiles/ECFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	165 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#variant> <http://sbolstandard.org/testfiles/mTagBFP2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	166 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#variant> <http://sbolstandard.org/testfiles/meffCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	167 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#variant> <http://sbolstandard.org/testfiles/mmilCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	168 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://sbols.org/v3#variant> <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	169 <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#VariableFeature> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	170 <http://sbolstandard.org/testfiles/All_FPs> <http://sbols.org/v3#description> "" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	171 <http://sbolstandard.org/testfiles/All_FPs> <http://sbols.org/v3#displayId> "All_FPs" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	172 <http://sbolstandard.org/testfiles/All_FPs> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	173 <http://sbolstandard.org/testfiles/All_FPs> <http://sbols.org/v3#hasVariableFeature> <http://sbolstandard.org/testfiles/All_FPs/VariableFeature1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	174 <http://sbolstandard.org/testfiles/All_FPs> <http://sbols.org/v3#name> "All FPs" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	175 <http://sbolstandard.org/testfiles/All_FPs> <http://sbols.org/v3#strategy> <http://sbols.org/v3#enumerate> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	176 <http://sbolstandard.org/testfiles/All_FPs> <http://sbols.org/v3#template> <http://sbolstandard.org/testfiles/All_FPs_template> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	177 <http://sbolstandard.org/testfiles/All_FPs> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#CombinatorialDerivation> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	178 <http://sbolstandard.org/testfiles/All_FPs_template/LocalSubComponent1> <http://sbols.org/v3#displayId> "LocalSubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	179 <http://sbolstandard.org/testfiles/All_FPs_template/LocalSubComponent1> <http://sbols.org/v3#name> "Part 1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	180 <http://sbolstandard.org/testfiles/All_FPs_template/LocalSubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	181 <http://sbolstandard.org/testfiles/All_FPs_template/LocalSubComponent1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	182 <http://sbolstandard.org/testfiles/All_FPs_template/LocalSubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#LocalSubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	183 <http://sbolstandard.org/testfiles/All_FPs_template> <http://sbols.org/v3#displayId> "All_FPs_template" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	184 <http://sbolstandard.org/testfiles/All_FPs_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/All_FPs_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	185 <http://sbolstandard.org/testfiles/All_FPs_template> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	186 <http://sbolstandard.org/testfiles/All_FPs_template> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	187 <http://sbolstandard.org/testfiles/All_FPs_template> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	188 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#description> "" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	189 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#displayId> "B0015" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	190 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	191 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/B0015_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	192 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#name> "B0015" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	193 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000141> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	194 <http://sbolstandard.org/testfiles/B0015> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	195 <http://sbolstandard.org/testfiles/B0015> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	196 <http://sbolstandard.org/testfiles/B0015_sequence> <http://sbols.org/v3#displayId> "B0015_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	197 <http://sbolstandard.org/testfiles/B0015_sequence> <http://sbols.org/v3#elements> "CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	198 <http://sbolstandard.org/testfiles/B0015_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	199 <http://sbolstandard.org/testfiles/B0015_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	200 <http://sbolstandard.org/testfiles/B0015_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	201 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#description> "Moderate (?)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	202 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#displayId> "B0032" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	203 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	204 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/B0032_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	205 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#name> "B0032" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	206 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000139> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	207 <http://sbolstandard.org/testfiles/B0032> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	208 <http://sbolstandard.org/testfiles/B0032> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	209 <http://sbolstandard.org/testfiles/B0032_sequence> <http://sbols.org/v3#displayId> "B0032_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	210 <http://sbolstandard.org/testfiles/B0032_sequence> <http://sbols.org/v3#elements> "TCACACAGGAAAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	211 <http://sbolstandard.org/testfiles/B0032_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	212 <http://sbolstandard.org/testfiles/B0032_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	213 <http://sbolstandard.org/testfiles/B0032_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	214 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	215 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	216 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	217 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	218 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	219 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	220 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	221 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	222 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	223 <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	224 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	225 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BioBricks_scar_long> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	226 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	227 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	228 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	229 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0032> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	230 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	231 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	232 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	233 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BioBricks_scar_short> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	234 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	235 <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	236 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#description> "5' UTR including B0032 RBS and BB scars (long and short)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	237 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#displayId> "BB_B0032_BB" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	238 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	239 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/BB_B0032_BB/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	240 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	241 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	242 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/BB_B0032_BB/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	243 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	244 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#name> "BB-B0032-BB" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	245 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	246 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	247 <http://sbolstandard.org/testfiles/BB_B0032_BB> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	248 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#description> "Designs for round 1 if iGEM 2021 calibration experimentation" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	249 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#displayId> "BasicParts" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	250 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	251 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/E0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	252 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/E1010> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	253 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/I20270> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	254 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/J06504> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	255 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/J23101> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	256 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/J23105> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	257 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/J364001> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	258 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/J364002> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	259 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/J364007> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	260 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/J364009> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	261 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/K592100> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	262 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://parts.igem.org/R0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	263 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	264 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/B0032> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	265 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/BioBricks_scar_long> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	266 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/BioBricks_scar_short> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	267 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/ECFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	268 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	269 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/UNSX> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	270 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/UP_element_consensus> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	271 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/mTagBFP2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	272 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/meffCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	273 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/mmilCFP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	274 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	275 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <https://synbiohub.programmingbiology.org/public/Eco1C1G1T1/LmrA> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	276 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#member> <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	277 <http://sbolstandard.org/testfiles/BasicParts> <http://sbols.org/v3#name> "Fluorescence calibration basic parts" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	278 <http://sbolstandard.org/testfiles/BasicParts> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Collection> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	279 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#description> "BioBricks scar including ag (not before CDS)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	280 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#displayId> "BioBricks_scar_long" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	281 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	282 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	283 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#name> "BioBricks_scar_long" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	284 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000627> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	285 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	286 <http://sbolstandard.org/testfiles/BioBricks_scar_long> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	287 <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> <http://sbols.org/v3#displayId> "BioBricks_scar_long_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	288 <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> <http://sbols.org/v3#elements> "TACTAGAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	289 <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	290 <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	291 <http://sbolstandard.org/testfiles/BioBricks_scar_long_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	292 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#description> "BioBricks scar (short one, w/o ag, before CDS)" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	293 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#displayId> "BioBricks_scar_short" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	294 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	295 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	296 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#name> "BioBricks_scar_short" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	297 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000627> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	298 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	299 <http://sbolstandard.org/testfiles/BioBricks_scar_short> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	300 <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> <http://sbols.org/v3#displayId> "BioBricks_scar_short_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	301 <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> <http://sbols.org/v3#elements> "TACTAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	302 <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	303 <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	304 <http://sbolstandard.org/testfiles/BioBricks_scar_short_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	305 <http://sbolstandard.org/testfiles/CompositeParts> <http://sbols.org/v3#description> "Designs for round 1 if iGEM 2021 calibration experimentation" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	306 <http://sbolstandard.org/testfiles/CompositeParts> <http://sbols.org/v3#displayId> "CompositeParts" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	307 <http://sbolstandard.org/testfiles/CompositeParts> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	308 <http://sbolstandard.org/testfiles/CompositeParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/All_FPs> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	309 <http://sbolstandard.org/testfiles/CompositeParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	310 <http://sbolstandard.org/testfiles/CompositeParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_ins> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	311 <http://sbolstandard.org/testfiles/CompositeParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/Round_1_order> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	312 <http://sbolstandard.org/testfiles/CompositeParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	313 <http://sbolstandard.org/testfiles/CompositeParts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/_2018_Interlab_ins> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	314 <http://sbolstandard.org/testfiles/CompositeParts> <http://sbols.org/v3#name> "Fluorescence calibration devices" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	315 <http://sbolstandard.org/testfiles/CompositeParts> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Collection> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	316 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#description> "Cyan FP; codon optimized using IDT tool <https://www.idtdna.com/CodonOpt>\nECFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	317 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#displayId> "ECFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	318 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	319 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/ECFP_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	320 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#name> "ECFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	321 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	322 <http://sbolstandard.org/testfiles/ECFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	323 <http://sbolstandard.org/testfiles/ECFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	324 <http://sbolstandard.org/testfiles/ECFP_sequence> <http://sbols.org/v3#displayId> "ECFP_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	325 <http://sbolstandard.org/testfiles/ECFP_sequence> <http://sbols.org/v3#elements> "ATGGTTAGTAAAGGGGAAGAGTTGTTTACGGGCGTTGTTCCAATCTTGGTGGAGTTGGACGGGGACGTTAATGGGCACAAATTTTCGGTCTCTGGGGAAGGCGAGGGGGACGCCACGTATGGTAAGCTGACCTTGAAGTTCATTTGCACTACTGGGAAATTGCCGGTTCCCTGGCCTACGCTTGTTACCACGTTGACCTGGGGCGTACAATGTTTCTCGCGCTATCCTGACCACATGAAACAACATGATTTCTTTAAGTCAGCTATGCCTGAGGGCTACGTGCAGGAGCGCACTATCTTCTTCAAGGATGACGGGAATTACAAAACCCGTGCGGAGGTAAAGTTCGAGGGTGACACGCTTGTCAACCGCATCGAGTTGAAGGGCATTGATTTTAAGGAGGATGGCAACATTTTAGGACATAAATTAGAGTATAACTATATTTCGCATAATGTCTACATTACTGCTGACAAACAAAAGAACGGCATCAAGGCTAATTTCAAAATTCGCCACAACATCGAGGATGGATCGGTTCAGTTAGCAGATCATTACCAGCAAAACACGCCCATCGGTGACGGACCAGTTCTGTTACCTGACAACCACTATCTTTCTACACAGAGTGCTCTTAGCAAGGACCCTAACGAAAAACGTGACCACATGGTCCTGCTGGAGTTTGTGACAGCCGCAGGTATTACATTGGGGATGGACGAATTGTATAAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	326 <http://sbolstandard.org/testfiles/ECFP_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	327 <http://sbolstandard.org/testfiles/ECFP_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	328 <http://sbolstandard.org/testfiles/ECFP_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	329 <http://sbolstandard.org/testfiles/FPs_small/VariableFeature1> <http://sbols.org/v3#cardinality> <http://sbols.org/v3#one> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	330 <http://sbolstandard.org/testfiles/FPs_small/VariableFeature1> <http://sbols.org/v3#displayId> "VariableFeature1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	331 <http://sbolstandard.org/testfiles/FPs_small/VariableFeature1> <http://sbols.org/v3#variable> <http://sbolstandard.org/testfiles/FPs_small_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	332 <http://sbolstandard.org/testfiles/FPs_small/VariableFeature1> <http://sbols.org/v3#variantDerivation> <http://sbolstandard.org/testfiles/FPs_small_ins> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	333 <http://sbolstandard.org/testfiles/FPs_small/VariableFeature1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#VariableFeature> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	334 <http://sbolstandard.org/testfiles/FPs_small> <http://sbols.org/v3#displayId> "FPs_small" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	335 <http://sbolstandard.org/testfiles/FPs_small> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	336 <http://sbolstandard.org/testfiles/FPs_small> <http://sbols.org/v3#hasVariableFeature> <http://sbolstandard.org/testfiles/FPs_small/VariableFeature1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	337 <http://sbolstandard.org/testfiles/FPs_small> <http://sbols.org/v3#name> "FPs small" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	338 <http://sbolstandard.org/testfiles/FPs_small> <http://sbols.org/v3#template> <http://sbolstandard.org/testfiles/FPs_small_template> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	339 <http://sbolstandard.org/testfiles/FPs_small> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#CombinatorialDerivation> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	340 <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature1> <http://sbols.org/v3#cardinality> <http://sbols.org/v3#one> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	341 <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature1> <http://sbols.org/v3#displayId> "VariableFeature1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	342 <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature1> <http://sbols.org/v3#variable> <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	343 <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/J23101> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	344 <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/J23105> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	345 <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#VariableFeature> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	346 <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature2> <http://sbols.org/v3#cardinality> <http://sbols.org/v3#one> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	347 <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature2> <http://sbols.org/v3#displayId> "VariableFeature2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	348 <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature2> <http://sbols.org/v3#variable> <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	349 <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature2> <http://sbols.org/v3#variantDerivation> <http://sbolstandard.org/testfiles/All_FPs> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	350 <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#VariableFeature> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	351 <http://sbolstandard.org/testfiles/FPs_small_ins> <http://sbols.org/v3#description> "" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	352 <http://sbolstandard.org/testfiles/FPs_small_ins> <http://sbols.org/v3#displayId> "FPs_small_ins" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	353 <http://sbolstandard.org/testfiles/FPs_small_ins> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	354 <http://sbolstandard.org/testfiles/FPs_small_ins> <http://sbols.org/v3#hasVariableFeature> <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	355 <http://sbolstandard.org/testfiles/FPs_small_ins> <http://sbols.org/v3#hasVariableFeature> <http://sbolstandard.org/testfiles/FPs_small_ins/VariableFeature2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	356 <http://sbolstandard.org/testfiles/FPs_small_ins> <http://sbols.org/v3#name> "FPs small insert" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	357 <http://sbolstandard.org/testfiles/FPs_small_ins> <http://sbols.org/v3#strategy> <http://sbols.org/v3#enumerate> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	358 <http://sbolstandard.org/testfiles/FPs_small_ins> <http://sbols.org/v3#template> <http://sbolstandard.org/testfiles/FPs_small_ins_template> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	359 <http://sbolstandard.org/testfiles/FPs_small_ins> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#CombinatorialDerivation> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	360 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	361 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	362 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	363 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	364 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	365 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	366 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	367 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	368 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	369 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	370 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint3> <http://sbols.org/v3#displayId> "Constraint3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	371 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint3> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	372 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint3> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	373 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint3> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	374 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	375 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint4> <http://sbols.org/v3#displayId> "Constraint4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	376 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint4> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	377 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint4> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	378 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint4> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	379 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	380 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint5> <http://sbols.org/v3#displayId> "Constraint5" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	381 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint5> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	382 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint5> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	383 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint5> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	384 <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint5> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	385 <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent1> <http://sbols.org/v3#displayId> "LocalSubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	386 <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent1> <http://sbols.org/v3#name> "Part 2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	387 <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	388 <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	389 <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#LocalSubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	390 <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent2> <http://sbols.org/v3#displayId> "LocalSubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	391 <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent2> <http://sbols.org/v3#name> "Part 4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	392 <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	393 <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent2> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	394 <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#LocalSubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	395 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	396 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX_UP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	397 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	398 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	399 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	400 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/BB_B0032_BB> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	401 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	402 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	403 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent3> <http://sbols.org/v3#displayId> "SubComponent3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	404 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent3> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/STOP> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	405 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent3> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	406 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	407 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent4> <http://sbols.org/v3#displayId> "SubComponent4" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	408 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent4> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/B0015> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	409 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent4> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	410 <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent4> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	411 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#displayId> "FPs_small_ins_template" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	412 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	413 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	414 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	415 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	416 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_ins_template/Constraint5> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	417 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	418 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_template/LocalSubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	419 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	420 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	421 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	422 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_ins_template/SubComponent4> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	423 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	424 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	425 <http://sbolstandard.org/testfiles/FPs_small_ins_template> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	426 <http://sbolstandard.org/testfiles/FPs_small_template/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	427 <http://sbolstandard.org/testfiles/FPs_small_template/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_template/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	428 <http://sbolstandard.org/testfiles/FPs_small_template/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	429 <http://sbolstandard.org/testfiles/FPs_small_template/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	430 <http://sbolstandard.org/testfiles/FPs_small_template/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	431 <http://sbolstandard.org/testfiles/FPs_small_template/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	432 <http://sbolstandard.org/testfiles/FPs_small_template/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/FPs_small_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	433 <http://sbolstandard.org/testfiles/FPs_small_template/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	434 <http://sbolstandard.org/testfiles/FPs_small_template/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/FPs_small_template/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	435 <http://sbolstandard.org/testfiles/FPs_small_template/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	436 <http://sbolstandard.org/testfiles/FPs_small_template/LocalSubComponent1> <http://sbols.org/v3#displayId> "LocalSubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	437 <http://sbolstandard.org/testfiles/FPs_small_template/LocalSubComponent1> <http://sbols.org/v3#name> "Inserted Construct" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	438 <http://sbolstandard.org/testfiles/FPs_small_template/LocalSubComponent1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	439 <http://sbolstandard.org/testfiles/FPs_small_template/LocalSubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#LocalSubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	440 <http://sbolstandard.org/testfiles/FPs_small_template/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	441 <http://sbolstandard.org/testfiles/FPs_small_template/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	442 <http://sbolstandard.org/testfiles/FPs_small_template/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	443 <http://sbolstandard.org/testfiles/FPs_small_template> <http://sbols.org/v3#displayId> "FPs_small_template" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	444 <http://sbolstandard.org/testfiles/FPs_small_template> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_template/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	445 <http://sbolstandard.org/testfiles/FPs_small_template> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/FPs_small_template/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	446 <http://sbolstandard.org/testfiles/FPs_small_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	447 <http://sbolstandard.org/testfiles/FPs_small_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/FPs_small_template/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	448 <http://sbolstandard.org/testfiles/FPs_small_template> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	449 <http://sbolstandard.org/testfiles/FPs_small_template> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	450 <http://sbolstandard.org/testfiles/FPs_small_template> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	451 <http://sbolstandard.org/testfiles/FinalProducts> <http://sbols.org/v3#description> "Final products desired for actual fabrication" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	452 <http://sbolstandard.org/testfiles/FinalProducts> <http://sbols.org/v3#displayId> "FinalProducts" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	453 <http://sbolstandard.org/testfiles/FinalProducts> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	454 <http://sbolstandard.org/testfiles/FinalProducts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	455 <http://sbolstandard.org/testfiles/FinalProducts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/_2018_Interlab> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	456 <http://sbolstandard.org/testfiles/FinalProducts> <http://sbols.org/v3#name> "Final Products" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	457 <http://sbolstandard.org/testfiles/FinalProducts> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Collection> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	458 <http://sbolstandard.org/testfiles/LinearDNAProducts> <http://sbols.org/v3#description> "Linear DNA constructs to be fabricated" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	459 <http://sbolstandard.org/testfiles/LinearDNAProducts> <http://sbols.org/v3#displayId> "LinearDNAProducts" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	460 <http://sbolstandard.org/testfiles/LinearDNAProducts> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	461 <http://sbolstandard.org/testfiles/LinearDNAProducts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/FPs_small_ins> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	462 <http://sbolstandard.org/testfiles/LinearDNAProducts> <http://sbols.org/v3#member> <http://sbolstandard.org/testfiles/_2018_Interlab_ins> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	463 <http://sbolstandard.org/testfiles/LinearDNAProducts> <http://sbols.org/v3#name> "Linear DNA Products" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	464 <http://sbolstandard.org/testfiles/LinearDNAProducts> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Collection> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	465 <http://sbolstandard.org/testfiles/Round_1_order/VariableFeature1> <http://sbols.org/v3#cardinality> <http://sbols.org/v3#one> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	466 <http://sbolstandard.org/testfiles/Round_1_order/VariableFeature1> <http://sbols.org/v3#displayId> "VariableFeature1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	467 <http://sbolstandard.org/testfiles/Round_1_order/VariableFeature1> <http://sbols.org/v3#variable> <http://sbolstandard.org/testfiles/Round_1_order_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	468 <http://sbolstandard.org/testfiles/Round_1_order/VariableFeature1> <http://sbols.org/v3#variantDerivation> <http://sbolstandard.org/testfiles/FPs_small> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	469 <http://sbolstandard.org/testfiles/Round_1_order/VariableFeature1> <http://sbols.org/v3#variantDerivation> <http://sbolstandard.org/testfiles/_2018_Interlab> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	470 <http://sbolstandard.org/testfiles/Round_1_order/VariableFeature1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#VariableFeature> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	471 <http://sbolstandard.org/testfiles/Round_1_order> <http://sbols.org/v3#description> "" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	472 <http://sbolstandard.org/testfiles/Round_1_order> <http://sbols.org/v3#displayId> "Round_1_order" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	473 <http://sbolstandard.org/testfiles/Round_1_order> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	474 <http://sbolstandard.org/testfiles/Round_1_order> <http://sbols.org/v3#hasVariableFeature> <http://sbolstandard.org/testfiles/Round_1_order/VariableFeature1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	475 <http://sbolstandard.org/testfiles/Round_1_order> <http://sbols.org/v3#name> "Round 1 order" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	476 <http://sbolstandard.org/testfiles/Round_1_order> <http://sbols.org/v3#strategy> <http://sbols.org/v3#enumerate> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	477 <http://sbolstandard.org/testfiles/Round_1_order> <http://sbols.org/v3#template> <http://sbolstandard.org/testfiles/Round_1_order_template> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	478 <http://sbolstandard.org/testfiles/Round_1_order> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#CombinatorialDerivation> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	479 <http://sbolstandard.org/testfiles/Round_1_order_template/LocalSubComponent1> <http://sbols.org/v3#displayId> "LocalSubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	480 <http://sbolstandard.org/testfiles/Round_1_order_template/LocalSubComponent1> <http://sbols.org/v3#name> "Part 1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	481 <http://sbolstandard.org/testfiles/Round_1_order_template/LocalSubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	482 <http://sbolstandard.org/testfiles/Round_1_order_template/LocalSubComponent1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	483 <http://sbolstandard.org/testfiles/Round_1_order_template/LocalSubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#LocalSubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	484 <http://sbolstandard.org/testfiles/Round_1_order_template> <http://sbols.org/v3#displayId> "Round_1_order_template" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	485 <http://sbolstandard.org/testfiles/Round_1_order_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/Round_1_order_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	486 <http://sbolstandard.org/testfiles/Round_1_order_template> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	487 <http://sbolstandard.org/testfiles/Round_1_order_template> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	488 <http://sbolstandard.org/testfiles/Round_1_order_template> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	489 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#description> "2 stop codons" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	490 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#displayId> "STOP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	491 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	492 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/STOP_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	493 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#name> "STOP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	494 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000319> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	495 <http://sbolstandard.org/testfiles/STOP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	496 <http://sbolstandard.org/testfiles/STOP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	497 <http://sbolstandard.org/testfiles/STOP_sequence> <http://sbols.org/v3#displayId> "STOP_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	498 <http://sbolstandard.org/testfiles/STOP_sequence> <http://sbols.org/v3#elements> "TAATAA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	499 <http://sbolstandard.org/testfiles/STOP_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	500 <http://sbolstandard.org/testfiles/STOP_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	501 <http://sbolstandard.org/testfiles/STOP_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	502 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#description> "" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	503 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#displayId> "UNSX" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	504 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	505 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/UNSX_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	506 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#name> "UNSX" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	507 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#role> <https://identifiers.org/SO:0001623> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	508 <http://sbolstandard.org/testfiles/UNSX> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	509 <http://sbolstandard.org/testfiles/UNSX> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	510 <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	511 <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	512 <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	513 <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	514 <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	515 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	516 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UNSX> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	517 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	518 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	519 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> <http://sbols.org/v3#displayId> "SubComponent2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	520 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/UP_element_consensus> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	521 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	522 <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	523 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#description> "" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	524 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#displayId> "UNSX_UP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	525 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/UNSX_UP/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	526 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	527 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/UNSX_UP/SubComponent2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	528 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	529 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#name> "UNSX-UP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	530 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000804> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	531 <http://sbolstandard.org/testfiles/UNSX_UP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	532 <http://sbolstandard.org/testfiles/UNSX_UP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	533 <http://sbolstandard.org/testfiles/UNSX_sequence> <http://sbols.org/v3#displayId> "UNSX_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	534 <http://sbolstandard.org/testfiles/UNSX_sequence> <http://sbols.org/v3#elements> "CCAGGATACATAGATTACCACAACTCCGAGCCCTTCCACC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	535 <http://sbolstandard.org/testfiles/UNSX_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	536 <http://sbolstandard.org/testfiles/UNSX_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	537 <http://sbolstandard.org/testfiles/UNSX_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	538 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#description> "consensus without runs of As and Ts -59 to -36" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	539 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#displayId> "UP_element_consensus" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	540 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	541 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	542 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#name> "UP element consensus" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	543 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#role> <https://identifiers.org/SO:0001659> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	544 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	545 <http://sbolstandard.org/testfiles/UP_element_consensus> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	546 <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> <http://sbols.org/v3#displayId> "UP_element_consensus_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	547 <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> <http://sbols.org/v3#elements> "TGAAATATATTTTCGAAAAGCCGC" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	548 <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	549 <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	550 <http://sbolstandard.org/testfiles/UP_element_consensus_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	551 <http://sbolstandard.org/testfiles/_2018_Interlab/VariableFeature1> <http://sbols.org/v3#cardinality> <http://sbols.org/v3#one> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	552 <http://sbolstandard.org/testfiles/_2018_Interlab/VariableFeature1> <http://sbols.org/v3#displayId> "VariableFeature1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	553 <http://sbolstandard.org/testfiles/_2018_Interlab/VariableFeature1> <http://sbols.org/v3#variable> <http://sbolstandard.org/testfiles/_2018_Interlab_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	554 <http://sbolstandard.org/testfiles/_2018_Interlab/VariableFeature1> <http://sbols.org/v3#variantDerivation> <http://sbolstandard.org/testfiles/_2018_Interlab_ins> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	555 <http://sbolstandard.org/testfiles/_2018_Interlab/VariableFeature1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#VariableFeature> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	556 <http://sbolstandard.org/testfiles/_2018_Interlab> <http://sbols.org/v3#displayId> "_2018_Interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	557 <http://sbolstandard.org/testfiles/_2018_Interlab> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	558 <http://sbolstandard.org/testfiles/_2018_Interlab> <http://sbols.org/v3#hasVariableFeature> <http://sbolstandard.org/testfiles/_2018_Interlab/VariableFeature1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	559 <http://sbolstandard.org/testfiles/_2018_Interlab> <http://sbols.org/v3#name> "2018 Interlab" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	560 <http://sbolstandard.org/testfiles/_2018_Interlab> <http://sbols.org/v3#template> <http://sbolstandard.org/testfiles/_2018_Interlab_template> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	561 <http://sbolstandard.org/testfiles/_2018_Interlab> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#CombinatorialDerivation> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	562 <http://sbolstandard.org/testfiles/_2018_Interlab_ins/VariableFeature1> <http://sbols.org/v3#cardinality> <http://sbols.org/v3#one> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	563 <http://sbolstandard.org/testfiles/_2018_Interlab_ins/VariableFeature1> <http://sbols.org/v3#displayId> "VariableFeature1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	564 <http://sbolstandard.org/testfiles/_2018_Interlab_ins/VariableFeature1> <http://sbols.org/v3#variable> <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	565 <http://sbolstandard.org/testfiles/_2018_Interlab_ins/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/I20270> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	566 <http://sbolstandard.org/testfiles/_2018_Interlab_ins/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/J364001> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	567 <http://sbolstandard.org/testfiles/_2018_Interlab_ins/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/J364002> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	568 <http://sbolstandard.org/testfiles/_2018_Interlab_ins/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/J364007> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	569 <http://sbolstandard.org/testfiles/_2018_Interlab_ins/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/J364009> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	570 <http://sbolstandard.org/testfiles/_2018_Interlab_ins/VariableFeature1> <http://sbols.org/v3#variant> <http://parts.igem.org/R0040> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	571 <http://sbolstandard.org/testfiles/_2018_Interlab_ins/VariableFeature1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#VariableFeature> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	572 <http://sbolstandard.org/testfiles/_2018_Interlab_ins> <http://sbols.org/v3#description> "Swapped R0040 for TwistNeg as the negative control, due to Twist minimum synthesis length" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	573 <http://sbolstandard.org/testfiles/_2018_Interlab_ins> <http://sbols.org/v3#displayId> "_2018_Interlab_ins" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	574 <http://sbolstandard.org/testfiles/_2018_Interlab_ins> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	575 <http://sbolstandard.org/testfiles/_2018_Interlab_ins> <http://sbols.org/v3#hasVariableFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_ins/VariableFeature1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	576 <http://sbolstandard.org/testfiles/_2018_Interlab_ins> <http://sbols.org/v3#name> "2018 Interlab insert" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	577 <http://sbolstandard.org/testfiles/_2018_Interlab_ins> <http://sbols.org/v3#strategy> <http://sbols.org/v3#enumerate> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	578 <http://sbolstandard.org/testfiles/_2018_Interlab_ins> <http://sbols.org/v3#template> <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	579 <http://sbolstandard.org/testfiles/_2018_Interlab_ins> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#CombinatorialDerivation> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	580 <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template/LocalSubComponent1> <http://sbols.org/v3#displayId> "LocalSubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	581 <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template/LocalSubComponent1> <http://sbols.org/v3#name> "Part 1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	582 <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template/LocalSubComponent1> <http://sbols.org/v3#orientation> <http://sbols.org/v3#inline> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	583 <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template/LocalSubComponent1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	584 <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template/LocalSubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#LocalSubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	585 <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template> <http://sbols.org/v3#displayId> "_2018_Interlab_ins_template" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	586 <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	587 <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	588 <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	589 <http://sbolstandard.org/testfiles/_2018_Interlab_ins_template> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	590 <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint1> <http://sbols.org/v3#displayId> "Constraint1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	591 <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint1> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_template/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	592 <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint1> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	593 <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint1> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	594 <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	595 <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint2> <http://sbols.org/v3#displayId> "Constraint2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	596 <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint2> <http://sbols.org/v3#object> <http://sbolstandard.org/testfiles/_2018_Interlab_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	597 <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint2> <http://sbols.org/v3#restriction> <http://sbols.org/v3#meets> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	598 <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint2> <http://sbols.org/v3#subject> <http://sbolstandard.org/testfiles/_2018_Interlab_template/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	599 <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Constraint> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	600 <http://sbolstandard.org/testfiles/_2018_Interlab_template/LocalSubComponent1> <http://sbols.org/v3#displayId> "LocalSubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	601 <http://sbolstandard.org/testfiles/_2018_Interlab_template/LocalSubComponent1> <http://sbols.org/v3#name> "Inserted Construct" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	602 <http://sbolstandard.org/testfiles/_2018_Interlab_template/LocalSubComponent1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	603 <http://sbolstandard.org/testfiles/_2018_Interlab_template/LocalSubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#LocalSubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	604 <http://sbolstandard.org/testfiles/_2018_Interlab_template/SubComponent1> <http://sbols.org/v3#displayId> "SubComponent1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	605 <http://sbolstandard.org/testfiles/_2018_Interlab_template/SubComponent1> <http://sbols.org/v3#instanceOf> <http://sbolstandard.org/testfiles/pSB1C3> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	606 <http://sbolstandard.org/testfiles/_2018_Interlab_template/SubComponent1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#SubComponent> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	607 <http://sbolstandard.org/testfiles/_2018_Interlab_template> <http://sbols.org/v3#displayId> "_2018_Interlab_template" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	608 <http://sbolstandard.org/testfiles/_2018_Interlab_template> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	609 <http://sbolstandard.org/testfiles/_2018_Interlab_template> <http://sbols.org/v3#hasConstraint> <http://sbolstandard.org/testfiles/_2018_Interlab_template/Constraint2> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	610 <http://sbolstandard.org/testfiles/_2018_Interlab_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_template/LocalSubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	611 <http://sbolstandard.org/testfiles/_2018_Interlab_template> <http://sbols.org/v3#hasFeature> <http://sbolstandard.org/testfiles/_2018_Interlab_template/SubComponent1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	612 <http://sbolstandard.org/testfiles/_2018_Interlab_template> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	613 <http://sbolstandard.org/testfiles/_2018_Interlab_template> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	614 <http://sbolstandard.org/testfiles/_2018_Interlab_template> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	615 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#description> "Blue FP codon optimized" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	616 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#displayId> "mTagBFP2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	617 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	618 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/mTagBFP2_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	619 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#name> "mTagBFP2" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	620 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	621 <http://sbolstandard.org/testfiles/mTagBFP2> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	622 <http://sbolstandard.org/testfiles/mTagBFP2> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	623 <http://sbolstandard.org/testfiles/mTagBFP2_sequence> <http://sbols.org/v3#displayId> "mTagBFP2_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	624 <http://sbolstandard.org/testfiles/mTagBFP2_sequence> <http://sbols.org/v3#elements> "ATGGTATCGAAGGGTGAAGAGTTGATTAAGGAAAACATGCACATGAAGTTATACATGGAAGGGACCGTGGATAATCACCATTTCAAATGCACATCTGAAGGAGAGGGAAAACCTTACGAAGGGACCCAGACAATGCGTATCAAAGTGGTCGAGGGTGGCCCTTTACCATTCGCGTTCGACATCCTGGCGACCTCCTTTTTATATGGGAGCAAAACATTCATTAACCACACCCAGGGAATCCCGGATTTCTTCAAGCAGTCTTTCCCTGAAGGGTTTACGTGGGAGCGTGTGACAACTTATGAGGATGGCGGGGTTTTGACGGCTACGCAGGATACTTCGTTACAAGACGGTTGCTTAATTTACAATGTAAAGATTCGTGGAGTAAATTTTACATCAAACGGTCCGGTCATGCAAAAGAAAACCCTTGGTTGGGAGGCGTTTACCGAGACATTGTATCCTGCCGACGGGGGATTAGAGGGTCGCAATGATATGGCACTGAAACTTGTGGGGGGGTCTCATTTAATTGCAAACGCTAAGACAACTTACCGCTCCAAGAAGCCCGCTAAGAACCTGAAAATGCCTGGGGTCTACTATGTTGACTATCGCCTTGAGCGTATCAAGGAGGCGAACAACGAGACTTACGTCGAGCAGCATGAGGTAGCGGTTGCCCGTTACTGTGACCTGCCATCTAAGTTAGGACATAAGTTGAAT" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	625 <http://sbolstandard.org/testfiles/mTagBFP2_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	626 <http://sbolstandard.org/testfiles/mTagBFP2_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	627 <http://sbolstandard.org/testfiles/mTagBFP2_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	628 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#description> "Cyan FP (free); codon optimized using IDT tool <https://www.idtdna.com/CodonOpt>\nmeffCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	629 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#displayId> "meffCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	630 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	631 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/meffCFP_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	632 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#name> "meffCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	633 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	634 <http://sbolstandard.org/testfiles/meffCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	635 <http://sbolstandard.org/testfiles/meffCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	636 <http://sbolstandard.org/testfiles/meffCFP_sequence> <http://sbols.org/v3#displayId> "meffCFP_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	637 <http://sbolstandard.org/testfiles/meffCFP_sequence> <http://sbols.org/v3#elements> "ATGGCGCTTTCAAAGCAGAGTTTACCGAGTGACATGAAGTTGATCTACCACATGGACGGGAACGTGAATGGTCACTCTTTCGTCATTAAGGGTGAAGGCGAGGGAAAACCCTATGAAGGAACACATACTATCAAGCTGCAAGTTGTTGAGGGCTCACCGTTACCTTTCAGCGCCGACATTCTGTCCACAGTTTTTCAATATGGGAACCGCTGTTTCACTAAGTATCCGCCTAATATCGTCGATTATTTTAAGAATAGCTGTTCTGGTGGGGGCTACAAGTTTGGACGCAGCTTTCTTTACGAAGACGGTGCGGTCTGTACGGCGTCAGGCGATATTACTCTGTCCGCAGACAAAAAGAGCTTTGAACACAAATCGAAATTCTTAGGCGTGAACTTCCCGGCTGACGGTCCGGTGATGAAGAAAGAGACCACCAACTGGGAACCATCGTGCGAAAAAATGACTCCGAATGGCATGACACTGATCGGTGACGTTACGGGTTTTTTGTTGAAGGAGGACGGAAAGCGTTACAAATGTCAATTTCATACCTTCCATGACGCTAAAGATAAGTCCAAAAAGATGCCGATGCCCGACTTCCACTTTGTCCAGCATAAAATTGAGCGCAAGGACCTTCCTGGAAGTATGCAAACATGGCGTCTTACCGAGCACGCGGCAGCATGTAAAACTTGTTTTACGGAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	638 <http://sbolstandard.org/testfiles/meffCFP_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	639 <http://sbolstandard.org/testfiles/meffCFP_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	640 <http://sbolstandard.org/testfiles/meffCFP_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	641 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#description> "Blue FP (free); codon optimized using IDT tool <https://www.idtdna.com/CodonOpt>\nmmilCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	642 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#displayId> "mmilCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	643 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	644 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#hasSequence> <http://sbolstandard.org/testfiles/mmilCFP_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	645 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#name> "mmilCFP" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	646 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	647 <http://sbolstandard.org/testfiles/mmilCFP> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	648 <http://sbolstandard.org/testfiles/mmilCFP> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	649 <http://sbolstandard.org/testfiles/mmilCFP_sequence> <http://sbols.org/v3#displayId> "mmilCFP_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	650 <http://sbolstandard.org/testfiles/mmilCFP_sequence> <http://sbols.org/v3#elements> "ATGGCTCTGCCTAAACAAATGAAACTGACTTATCACATGGAGGGTACTGTGAACGGTCATTTTTTTATCATCAAGGGCGAAGGAGGGGGAGAGCCGTATGAGGGTACTCATACGATCAAGTTACAGGTGGTAGAGGGAAGCCCGTTGCCCTTTTCACCGGATATTCTTTCCACCGTCTTCCAATACGGCAACCGCTGCTTCACTAAATACCCTCCCAACATCGTTGATTACTTCAAAAACTCCTGCTCGGGCGGCGGTTATACTTTTGGACGTAGCTTCCTTTATGAGGACGGAGCTGTCTGTACTGCTTCCGGTGACATTACGCTGAGCAGCGACAAATCATCCTTTGAGCACAAATCTAAATTTCTGGGAGTAAACTTTCCTGCCGATGGCCCGGTGATGAAAAAAGAAACCACTAATTGGGAGCCTTCATGTGAGAAAATGACACCCAACGGGATGACCTTAATCGGTGATGTGACGGAGTTCCTGTTGAAGAAGGACGGTAAGCGTTACAAGTGCCAATTCCACACATTCCACGACGCGAAGGAGAAAAGCCGCAATATGCCGATGCCCGATTTCCATTTCGTTCAGCACGAGATTGAACGTAAAGATTTGCCAGGACCAATGCAAACATGGCAGTTGACCGAGCACGCAGCAGCCTGTAAGAACTGTTTCACAGAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	651 <http://sbolstandard.org/testfiles/mmilCFP_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	652 <http://sbolstandard.org/testfiles/mmilCFP_sequence> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	653 <http://sbolstandard.org/testfiles/mmilCFP_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	654 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#description> "pMB1 replicon, 100-300 copy" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	655 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#displayId> "pSB1C3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	656 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#hasNamespace> <http://sbolstandard.org/testfiles> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	657 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#name> "pSB1C3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	658 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000155> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	659 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	660 <http://sbolstandard.org/testfiles/pSB1C3> <http://sbols.org/v3#type> <https://identifiers.org/SO:0000988> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	661 <http://sbolstandard.org/testfiles/pSB1C3> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	662 <https://synbiohub.programmingbiology.org/public/Eco1C1G1T1/LmrA> <http://sbols.org/v3#description> "" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	663 <https://synbiohub.programmingbiology.org/public/Eco1C1G1T1/LmrA> <http://sbols.org/v3#displayId> "LmrA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	664 <https://synbiohub.programmingbiology.org/public/Eco1C1G1T1/LmrA> <http://sbols.org/v3#hasNamespace> <https://synbiohub.programmingbiology.org/public/Eco1C1G1T1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	665 <https://synbiohub.programmingbiology.org/public/Eco1C1G1T1/LmrA> <http://sbols.org/v3#name> "LmrA" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	666 <https://synbiohub.programmingbiology.org/public/Eco1C1G1T1/LmrA> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	667 <https://synbiohub.programmingbiology.org/public/Eco1C1G1T1/LmrA> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	668 <https://synbiohub.programmingbiology.org/public/Eco1C1G1T1/LmrA> <http://www.w3.org/ns/prov#wasDerivedFrom> <https://synbiohub.programmingbiology.org/public/Eco1C1G1T1/LmrA/1> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	669 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#description> "Cyan FP; codon optimized using IDT tool <https://www.idtdna.com/CodonOpt>\nmCerulean3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	670 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#displayId> "ATP07149_1" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	671 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#hasNamespace> <https://www.ncbi.nlm.nih.gov/nuccore> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	672 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#hasSequence> <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	673 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#name> "mCerulean3" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	674 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#role> <https://identifiers.org/SO:0000316> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	675 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	676 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	677 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> <http://sbols.org/v3#displayId> "ATP07149_1_sequence" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	678 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> <http://sbols.org/v3#elements> "ATGGTGTCGAAAGGTGAAGAACTTTTTACAGGTGTGGTCCCCATTTTAGTCGAATTAGATGGGGATGTGAATGGTCACAAATTCTCGGTGTCTGGGGAGGGTGAAGGTGACGCGACCTACGGGAAGTTGACTCTGAAATTCATTTGCACTACGGGGAAGTTACCAGTGCCCTGGCCCACTCTGGTTACAACACTGTCATGGGGCGTCCAATGTTTTGCTCGTTATCCTGACCACATGAAACAGCATGACTTCTTCAAGAGCGCAATGCCGGAAGGCTATGTCCAAGAGCGTACTATCTTTTTCAAAGACGATGGGAACTACAAAACACGCGCAGAAGTGAAGTTTGAGGGAGATACCCTGGTTAATCGCATTGAATTGAAAGGTATCGACTTCAAGGAGGATGGTAATATCCTGGGGCACAAATTGGAGTACAACGCTATCCACGGCAATGTTTACATTACGGCAGACAAACAGAAAAACGGAATTAAGGCCAATTTCGGACTTAACTGCAACATCGAAGATGGGTCGGTACAACTGGCAGACCACTATCAGCAAAATACGCCTATTGGTGACGGTCCTGTCCTGTTACCGGACAATCATTATCTTTCCACTCAGTCGAAACTGAGTAAAGATCCGAACGAGAAGCGCGATCACATGGTATTATTAGAGTTCGTCACAGCCGCAGGTATTACGTTAGGGATGGATGAGCTTTACAAG" .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	679 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	680 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> <http://sbols.org/v3#hasNamespace> <https://www.ncbi.nlm.nih.gov/nuccore> .
024def08af09 planemo upload commit ce400589f51221295c59294ed462bb82220f4654-dirty tduigou parents: diff changeset	681 <https://www.ncbi.nlm.nih.gov/nuccore/ATP07149_1_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .

Mercurial > repos > tduigou > sbol3_diff

annotate test-data/simple_library.nt @ 2:67fd1abac44b draft default tip