diff tools/genome_diversity/extract_primers.xml @ 0:9071e359b9a3

Uploaded

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/genome_diversity/extract_primers.xml	Fri Mar 09 19:37:19 2012 -0500
@@ -0,0 +1,90 @@
+<tool id="gd_extract_primers" name="Extract primers" version="1.0.0">
+  <description>for selected SNPs</description>
+
+  <command interpreter="python2.5">
+    extract_primers.py "--input=$input" "--output=$output" "--primers_loc=${GALAXY_DATA_INDEX_DIR}/gd.primers.loc"
+    #if $override_metadata.choice == "0":
+      "--scaffold_col=${input.metadata.scaffold}" "--pos_col=${input.metadata.pos}" "--species=${input.metadata.species}"
+    #else
+      "--scaffold_col=$scaf_col" "--pos_col=$pos_col" "--species=$species"
+    #end if
+  </command>
+
+  <inputs>
+    <param format="tabular" name="input" type="data" label="Selected SNPS dataset"/>
+    <conditional name="override_metadata">
+      <param name="choice" type="select" format="integer" label="choose columns">
+        <option value="0" selected="true">No, get columns from metadata</option>
+        <option value="1" >Yes, choose columns</option>
+      </param>
+      <when value="0">
+        <!-- no options -->
+      </when>
+      <when value="1">
+        <param name="scaf_col" type="data_column" data_ref="input" numerical="false" label="Column with scaffold"/>
+        <param name="pos_col" type="data_column" data_ref="input" numerical="true" label="Column with position"/>
+        <param name="species" type="select" label="Choose species">
+          <options from_file="gd.species.txt">
+            <column name="name" index="1"/>
+            <column name="value" index="0"/>
+          </options>
+        </param>
+      </when>
+    </conditional>
+  </inputs>
+
+  <outputs>
+    <data format="txt" name="output"/>
+  </outputs>
+
+  <tests>
+    <test>
+      <param name="input" value="gd.sample.wsf" ftype="wsf"/>
+      <param name="choice" value="0"/>
+      <output name="output" file="gd.extract_primers.txt"/>
+    </test>
+  </tests>
+
+
+  <help>
+**What it does**
+
+  This tool extracts primers for SNPs in the dataset using the Primer3 program.
+  The first line of output for a given SNP reports the name of the assembled
+  contig, the SNP's position in the contig, the two variant nucleotides, and
+  Primer3's "pair penalty".  The next line, if not blank, names restriction
+  enzymes (from the user-adjustable list) that differentially cut at that
+  site, but do not cut at any other position between and including the
+  primer positions.  The next lines show the SNP's flanking regions, with
+  the SNP position indicated by "n", including the primer positions and an
+  additional 3 nucleotides.
+
+-----
+
+**Example**
+
+- input file::
+
+    chr5_30800874_30802049    734   G  A  chr5   30801606   A  24  0  99   4  11  97   Y  496  0.502  0.033  0.215  6
+    chr8_55117827_55119487    994   A  G  chr8   55118815   G  25  0  102  4  11  96   Y  22   0.502  0.025  2.365  1
+    chr9_100484836_100485311  355   C  T  chr9   100485200  T  27  0  108  6  17  100  Y  190  0.512  0.880  2.733  4
+    chr12_3635530_3637738     2101  T  C  chr12  3637630    T  25  0  102  4  13  93   Y  169  0.554  0.024  0.366  4
+
+- output file::
+
+    chr5_30800874_30802049 734 G A 0.352964
+     BglII,MboI,Sau3AI,Tru9I,XhoII
+      1 CTGAAGGTGAGCAGGATTCAGGAGACAGAAAACAAAGCCCAGGCCTGCCCAAGGTGGAAA
+           >>>>>>>>>>>>>>>>>>>>
+     
+     61 AGTCTAACAACTCGCCCTCTGCTTAnATCTGAGACTCACAGGGATAATAACACACTTGGT
+     
+     
+     21 CAAGGAATAAACTAGATATTATTCACTCCTCTAGAAGGCTGCCAGGAAAATTGCCTGACT
+                                                             &lt;&lt;&lt;&lt;&lt;&lt;&lt;
+     
+    181 TGAACCTTGGCTCTGA
+        &lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;
+    etc.
+  </help>
+</tool>