Mercurial > repos > xuebing > sharplabtool
diff tools/metag_tools/fastqsolexa_to_fasta_qual.xml @ 0:9071e359b9a3
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:37:19 -0500 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/metag_tools/fastqsolexa_to_fasta_qual.xml Fri Mar 09 19:37:19 2012 -0500 @@ -0,0 +1,91 @@ +<tool id="fastqsolexa_to_fasta_qual" name="FASTQSOLEXA-to-FASTA-QUAL" version="1.0.0"> + <description>extracts sequences and quality scores from FASTQSOLEXA data</description> + <command interpreter="python">fastqsolexa_to_fasta_qual.py $input1 $output1 $output2 $input1.extension</command> + <inputs> + <param name="input1" type="data" format="fastqsolexa" label="Fastqsolexa file"/> + </inputs> + <outputs> + <data name="output1" format="fasta"/> + <data name="output2" format="qualsolexa"/> + </outputs> + <tests> + <!-- NOTE: this tool generates 2 output files, but our functional tests currently only handle the last one generated --> + <test> + <param name="input1" value="1.fastqsolexa" ftype="fastqsolexa" /> + <output name="output1" file="fastqsolexa_to_fasta_qual_out4.fasta" /> + </test> + <test> + <param name="input1" value="2.fastqsolexa" ftype="fastqsolexa" /> + <output name="output1" file="fastqsolexa_to_fasta_qual_out2.fasta" /> + </test> + </tests> + <help> + +.. class:: warningmark + +IMPORTANT: This tool currently only supports data where the quality scores are integers or ASCII quality scores with base 64. + +----- + +**What it does** + +This tool extracts sequences and quality scores from FASTQ data ( Solexa variant ), producing a FASTA dataset and a QUAL dataset. + +----- + +**Example1** + +- Converting the following Solexa fastq data:: + + @seq1 + GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT + +seq1 + hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh + @seq2 + GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG + +seq2 + hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO + +- will extract the following sequences:: + + >seq1 + GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT + >seq2 + GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG + +- and quality scores:: + + >seq1 + 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 0 40 40 40 40 40 40 + >seq2 + 40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 33 40 40 40 40 23 40 1 40 6 40 19 9 10 7 3 40 15 + +**Example2** + +- Converting the following Solexa fastq data:: + + @HANNIBAL_1_FC302VTAAXX:2:1:228:167 + GAATTGATCAGGACATAGGACAACTGTAGGCACCAT + +HANNIBAL_1_FC302VTAAXX:2:1:228:167 + 40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4 + @HANNIBAL_1_FC302VTAAXX:2:1:156:340 + GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG + +HANNIBAL_1_FC302VTAAXX:2:1:156:340 + 40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9 + +- will extract the following sequences:: + + >HANNIBAL_1_FC302VTAAXX:2:1:228:167 + GAATTGATCAGGACATAGGACAACTGTAGGCACCAT + >HANNIBAL_1_FC302VTAAXX:2:1:156:340 + GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG + +- and quality scores:: + + >HANNIBAL_1_FC302VTAAXX:2:1:228:167 + 40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4 + >HANNIBAL_1_FC302VTAAXX:2:1:156:340 + 40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9 + + </help> +</tool>