view glimmerhmm.xml @ 2:ae0b24f726c3 draft default tip

planemo upload for repository https://github.com/goeckslab/multi_fasta_glimmerhmm.git commit 33f2156452e82c882d7cc6a1a69c3c6884eab94a

<tool id="multi_fasta_glimmerhmm" name="Multi Fasta GlimmerHMM" version="4.0">
    <description>Predict ORFs in eukaryotic genomes for Multi Fasta file</description>
    <requirements>
        <requirement type="package" version="3.0.4">glimmerhmm</requirement>
    </requirements>
    <command detect_errors="aggressive"><![CDATA[
        python $__tool_directory__/multi_glimmer.py
        --multi_fasta $input
        --trained_dir $trained_specie.fields.path
        --output $output
	]]></command>
    <inputs>
        <param name="input" type="data" format="fasta" label="Genome Sequence"/>
        <param name="trained_specie" type="select" label="Select a specie">
            <options from_data_table="glimmer_hmm_trained_dir">
                <filter type="sort_by" column="2"/>
                <validator type="no_options" message="No indexes are available"/>
            </options>
        </param>
    </inputs>
    <outputs>
        <data format="gff3" name="output" />
    </outputs>
    <help>
        **What it does**

        GlimmerHMM is a new gene finder based on a Generalized Hidden Markov Model (GHMM).
        Although the gene finder conforms to the overall mathematical framework of a GHMM,
        additionally it incorporates splice site models adapted from the GeneSplicer program and a
        decision tree adapted from GlimmerM. It also utilizes Interpolated Markov Models for the
        coding and noncoding models . Currently, GlimmerHMM's GHMM structure includes introns of each phase,
        intergenic regions, and four types of exons (initial, internal, final, and single).
        A basic user manual can be consulted here.

        **Example**

        Suppose you have the following DNA formatted sequences::

            >SQ   Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
            cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
            ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
            cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
            cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
            ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg

        Running this tool will produce this::

            ##gff-version 3
            ##sequence-region ConsensusfromCH236920mapping 1 4148552
            ConsensusfromCH236920mapping  GlimmerHMM  mRNA  1       122     .   +   .   ID=ConsensusfromCH236920mapping.path1.gene1;Name=ConsensusfromCH236920mapping.path1.gene1
            ConsensusfromCH236920mapping  GlimmerHMM  CDS   1       122     .   +   0   ID=ConsensusfromCH236920mapping.cds1.1;
            ConsensusfromCH236920mapping  GlimmerHMM  mRNA  14066   15205   .   -   .   ID=ConsensusfromCH236920mapping.path1.gene2;Name=ConsensusfromCH236920mapping.path1.gene2
            ConsensusfromCH236920mapping  GlimmerHMM  CDS   14066   15034   .   -   0   ID=ConsensusfromCH236920mapping.cds2.1;
            ConsensusfromCH236920mapping  GlimmerHMM  CDS   15137   15205   .   -   0   ID=ConsensusfromCH236920mapping.cds2.2;
            ConsensusfromCH236920mapping  GlimmerHMM  mRNA  19910   24210   .   -   .   ID=ConsensusfromCH236920mapping.path1.gene3;Name=ConsensusfromCH236920mapping.path1.gene3
    </help>

</tool>