comparison segmentation-fold.xml @ 2:22d7b6019372 draft

planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit 7e54643d9af0065268d5cde2f2fc9872d2de8fa9

1:27f670a42ba2

<tool id="segmentation_fold" name="segmentation-fold" version="1.1.0_1">
    <description>RNA-Folding including predefined segments including K-turns</description>
    
    <requirements>
        <requirement type="package" version="1.1.0">segmentation-fold</requirement>
    </requirements>
    
    <stdio></stdio>
    
    <version_command>segmentation-fold --version | head -n 2 | tail -n 1 | sed -e 's/^[[:space:]]*//' -e 's/[[:space:]]*$//'</version_command>

            </when>
        </conditional>
    </inputs>
    
    <outputs>
        <data format="dot-bracket" name="output_dbn" label="asdasdasd" />
        <!--<data format="dot-bracket" name="output_dbn" label="${tool.name} on ${str(input.input_fasta.hid) + ': ' + input.input_fasta.name if $input.method == 'fasta' else $input.input_sequence.upper() }" />-->
    </outputs>
    
    <tests>
        <test>

            <output name="output_dbn"   file="test_28.dbn" />
        </test>
    </tests>
    
    <help><![CDATA[
Segmentation-fold is a bioinformatics application that predicts RNA
2D-structure with an extended version of the Zuker algorithm. This
modification contains a new "structure element" named a segment and is
capable of folding a pre-defined substructures with multiple canonical
or non-canonical pairings.

This allows folding of more complex structures like K-turns, which are
also part of the implemented free energy table. These thermodynamic
parameters (free Gibbs energy) have been estimated using a in silico
approach and therefore lack high resolution.
    ]]></help>
    
    <citations>
        <citation type="bibtex">
           @mastersthesis{mastersthesis,

2:22d7b6019372

<tool id="segmentation_fold" name="segmentation-fold" version="1.6.3-0">
    <description>RNA-Folding including predefined segments including K-turns</description>
    
    <requirements>
        <requirement type="package" version="1.6.3">segmentation-fold</requirement>
    </requirements>
    
    <stdio></stdio>
    
    <version_command>segmentation-fold --version | head -n 2 | tail -n 1 | sed -e 's/^[[:space:]]*//' -e 's/[[:space:]]*$//'</version_command>

            </when>
        </conditional>
    </inputs>
    
    <outputs>
        <data format="dbn" name="output_dbn" label="segmentation-fold" />
        <!--<data format="dot-bracket" name="output_dbn" label="${tool.name} on ${str(input.input_fasta.hid) + ': ' + input.input_fasta.name if $input.method == 'fasta' else $input.input_sequence.upper() }" />-->
    </outputs>
    
    <tests>
        <test>

            <output name="output_dbn"   file="test_28.dbn" />
        </test>
    </tests>
    
    <help><![CDATA[
**What it does**:

Segmentation-fold is a application in the field of bioinformatics that
predicts RNA 2D-structures. The model has an extension with respect to
the classical Zuker algorithm, to allow new "structure elements" named
segments and segmentloops. This makes it capable of folding a
pre-defined substructure with multiple canonical or non-canonical base
pairs, like K-turns and loop-E-motifs. Some of such sturcture elements
are present in the corresponding energy table, although custom tables
can be provided as well.


**Running segmentation-fold**

Segmentation-fold has to be provided with a sequence of which it has to
predict the 2D structure. This can be done using a plain text sequence
(allowed charset: ACTUG) or a FASTA file. A FASTA file has the following
syntax:

    >Sequence name and other details
    
    AGUGUAGCUGUGUCGAUCGUAAGUCAG

As the database of free energy parameters will most likely be updated
over time we have added the possiblity to include this XML file as
additional parameter. The most up to date version of this file can be
found at the following url:

https://github.com/yhoogstrate/segmentation-fold/blob/master/share/segmentation-fold/segments.xml

If you would like to compare the results with a prediction as if the
segment and segmentloop extension were disabled, you can disable it with
the given parameter.

**Output**

The output is in DotBracket format (dbn) and can be visualized with e.g.
DrawRNAjs or VaRNA.

DrawRNAjs can be installed in galaxy by following the instructions at
the following link:

https://github.com/bgruening/galaxytools/tree/master/visualisations/drawrnajs

Details on the dbn-format can be found here:

https://wiki.galaxyproject.org/Learn/Datatypes#Dbn

**Authors**

Youri Hoogstrate (yhoogstrate @ github)
    ]]></help>
    
    <citations>
        <citation type="bibtex">
           @mastersthesis{mastersthesis,