Mercurial > repos > yhoogstrate > segmentation_fold
view segmentation-fold.xml @ 6:4d16cf9414cf draft default tip
planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/galaxytools-emc/tree/master/tools/segmentation_fold commit 3a3c1d069e0a079d8ea7c0b4ac856ef24141b1aa
author | erasmus-medical-center |
---|---|
date | Fri, 24 Feb 2017 04:18:22 -0500 |
parents | 63df1e23f4ff |
children |
line wrap: on
line source
<tool id="segmentation_fold" name="segmentation-fold" version="@VERSION@-1"> <description>RNA-Folding including predefined segments including K-turns</description> <macros> <import>macros.xml</import> </macros> <expand macro="requirements" /> <expand macro="version_command" /> <command detect_errors="aggressive"><![CDATA[ segmentation-fold #if $input.method == "fasta" -f '${input.input_fasta}' #else -s '${input.input_sequence}' #end if -p $predict_segments -H $min_hairpin_size #if $parameters.settings == "custom" -x '${parameters.input_xml}' #end if -t \${GALAXY_SLOTS:-4} > '${output_dbn}' ]]></command> <inputs> <conditional name="input"> <param name="method" type="select" label="Energy parameters"> <option value="fasta" selected="true">As FASTA-file</option> <option value="text">As text</option> </param> <when value="fasta"> <param name="input_fasta" type="data" format="fasta" label="Fasta file with RNA-sequece" argument="-f" /> </when> <when value="text"> <param name="input_sequence" type="text" label="RNA-sequence" argument="-s" /> </when> </conditional> <param name="predict_segments" type="boolean" truevalue="1" falsevalue="0" checked="true" label="Enable segment prediction functionality" argument="-p" /> <param name="min_hairpin_size" type="integer" min="1" value="3" label="Minimum hairpin size" argument="-h" /> <conditional name="parameters"> <param name="settings" type="select" label="Energy parameters"> <option value="default" selected="true">Default</option> <option value="custom">Custom</option> </param> <when value="default" /> <when value="custom"> <param name="input_xml" type="data" format="xml" multiple="false" label="Use custom 'segments.xml'-syntaxed file" argument="-x" /> </when> </conditional> </inputs> <outputs> <data format="dbn" name="output_dbn" label="segmentation-fold" /> <!--<data format="dot-bracket" name="output_dbn" label="${tool.name} on ${str(input.input_fasta.hid) + ': ' + input.input_fasta.name if $input.method == 'fasta' else $input.input_sequence.upper() }" />--> </outputs> <tests> <test> <param name="input_fasta" value="test_01.fa" ftype="fasta" /> <output name="output_dbn" file="test_01.dbn" /> </test> <test> <param name="input_fasta" value="test_02.fa" ftype="fasta" /> <output name="output_dbn" file="test_02.dbn" /> </test> <test> <param name="input_fasta" value="test_03.fa" ftype="fasta" /> <output name="output_dbn" file="test_03.dbn" /> </test> <test> <param name="input_fasta" value="test_04.fa" ftype="fasta" /> <output name="output_dbn" file="test_04.dbn" /> </test> <test> <param name="input_fasta" value="test_05.fa" ftype="fasta" /> <output name="output_dbn" file="test_05.dbn" /> </test> <test> <param name="input_fasta" value="test_06.fa" ftype="fasta" /> <output name="output_dbn" file="test_06.dbn" /> </test> <test> <param name="input_fasta" value="test_07.fa" ftype="fasta" /> <output name="output_dbn" file="test_07.dbn" /> </test> <test> <param name="input_fasta" value="test_08.fa" ftype="fasta" /> <output name="output_dbn" file="test_08.dbn" /> </test> <test> <param name="input_fasta" value="test_09.fa" ftype="fasta" /> <output name="output_dbn" file="test_09.dbn" /> </test> <test> <param name="input_fasta" value="test_10.fa" ftype="fasta" /> <output name="output_dbn" file="test_10.dbn" /> </test> <test> <param name="input_fasta" value="test_11.fa" ftype="fasta" /> <output name="output_dbn" file="test_11.dbn" /> </test> <test> <param name="input_fasta" value="test_12.fa" ftype="fasta" /> <output name="output_dbn" file="test_12.dbn" /> </test> <test> <param name="input_fasta" value="test_13.fa" ftype="fasta" /> <output name="output_dbn" file="test_13.dbn" /> </test> <test> <param name="input_fasta" value="test_14.fa" ftype="fasta" /> <output name="output_dbn" file="test_14.dbn" /> </test> <test> <param name="input_fasta" value="test_15.fa" ftype="fasta" /> <output name="output_dbn" file="test_15.dbn" /> </test> <test> <param name="input_fasta" value="test_16.fa" ftype="fasta" /> <output name="output_dbn" file="test_16.dbn" /> </test> <test> <param name="input_fasta" value="test_17.fa" ftype="fasta" /> <output name="output_dbn" file="test_17.dbn" /> </test> <test> <param name="input_fasta" value="test_18.fa" ftype="fasta" /> <output name="output_dbn" file="test_18.dbn" /> </test> <test> <param name="input_fasta" value="test_19.fa" ftype="fasta" /> <output name="output_dbn" file="test_19.dbn" /> </test> <test> <param name="input_fasta" value="test_20.fa" ftype="fasta" /> <output name="output_dbn" file="test_20.dbn" /> </test> <test> <param name="input_fasta" value="test_21.fa" ftype="fasta" /> <output name="output_dbn" file="test_21.dbn" /> </test> <test> <param name="input_fasta" value="test_22.fa" ftype="fasta" /> <output name="output_dbn" file="test_22.dbn" /> </test> <test> <param name="input_fasta" value="test_23.fa" ftype="fasta" /> <output name="output_dbn" file="test_23.dbn" /> </test> <test> <param name="input_fasta" value="test_24.fa" ftype="fasta" /> <output name="output_dbn" file="test_24.dbn" /> </test> <test> <param name="input_fasta" value="test_25.fa" ftype="fasta" /> <output name="output_dbn" file="test_25.dbn" /> </test> <test> <param name="input_fasta" value="test_26.fa" ftype="fasta" /> <output name="output_dbn" file="test_26.dbn" /> </test> <test> <param name="input_fasta" value="test_27.fa" ftype="fasta" /> <output name="output_dbn" file="test_27.dbn" /> </test> <test> <param name="input_fasta" value="test_28.fa" ftype="fasta" /> <output name="output_dbn" file="test_28.dbn" /> </test> </tests> <help><![CDATA[ **What it does**: Segmentation-fold is a application in the field of bioinformatics that predicts RNA 2D-structures. The model has an extension with respect to the classical Zuker algorithm, to allow new "structure elements" named segments and segmentloops. This makes it capable of folding a pre-defined substructure with multiple canonical or non-canonical base pairs, like K-turns and loop-E-motifs. Some of such sturcture elements are present in the corresponding energy table, although custom tables can be provided as well. **Running segmentation-fold** Segmentation-fold has to be provided with a sequence of which it has to predict the 2D structure. This can be done using a plain text sequence (allowed charset: ACTUG) or a FASTA file. A FASTA file has the following syntax: >Sequence name and other details AGUGUAGCUGUGUCGAUCGUAAGUCAG As the database of free energy parameters will most likely be updated over time we have added the possiblity to include this XML file as additional parameter. The most up to date version of this file can be found at the following url: https://github.com/yhoogstrate/segmentation-fold/blob/master/share/segmentation-fold/segments.xml If you would like to compare the results with a prediction as if the segment and segmentloop extension were disabled, you can disable it with the given parameter. **Output** The output is in DotBracket format (dbn) and can be visualized with e.g. DrawRNAjs or VaRNA. DrawRNAjs can be installed in galaxy by following the instructions at the following link: https://github.com/bgruening/galaxytools/tree/master/visualisations/drawrnajs Details on the dbn-format can be found here: https://wiki.galaxyproject.org/Learn/Datatypes#Dbn **Authors** Youri Hoogstrate (GitHub: @yhoogstrate) ]]></help> <expand macro="citations" /> </tool>