| Previous changeset 6:b6d7308c3728 (2018-03-02) Next changeset 8:e7f19d6a9af8 (2018-05-18) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/lastz commit 13e9724b44888b0de9535ac7b561ad9686038413 |
|
modified:
lastz.xml lastz_d.xml lastz_macros.xml |
|
added:
test-data/chrM_human.fa.gz test-data/chrM_mouse.fa.gz test-data/chrM_mouse.fq test-data/chrM_mouse.fq.bz2 test-data/chrM_mouse.fq.gz test-data/test4.out test-data/test5.out |
| b |
| diff -r b6d7308c3728 -r 10aca14c2332 lastz.xml --- a/lastz.xml Fri Mar 02 12:07:00 2018 -0500 +++ b/lastz.xml Thu May 17 04:29:13 2018 -0400 |
| [ |
| @@ -1,4 +1,4 @@ -<tool id="lastz_wrapper_2" name="LASTZ" version="1.3"> +<tool id="lastz_wrapper_2" name="LASTZ" version="1.3.1"> <description>: align long sequences</description> <macros> <import>lastz_macros.xml</import> @@ -7,6 +7,7 @@ <requirement type="package" version="@LASTZ_CONDA_VERSION@">lastz</requirement> <requirement type="package" version="1.7">samtools</requirement> <requirement type="package" version="3.4.2">r-base</requirement> + <requirement type="package" version="1.0.6">bzip2</requirement> </requirements> <command detect_errors="exit_code"><![CDATA[ lastz @@ -18,7 +19,7 @@ '${where_to_look.nomirror}' #end if #else: - '${query}' + @query_input@ #end if ## WHERE TO LOOK -------------------------------- @@ -279,7 +280,7 @@ </configfiles> <inputs> <expand macro="target_input"/> - <param name="query" format="fasta,fastq" type="data" label="Select QUERY sequence(s)" help="These are the sequences that you are aligning against TARGET"/> + <param name="query" format="fasta,fastq,fasta.gz,fastq.gz,fastq.bz2" type="data" label="Select QUERY sequence(s)" help="These are the sequences that you are aligning against TARGET"/> <section name="where_to_look" expanded="False" title="Where to look"> <param name="strand" type="select" display="radio" label="which strand to search" argument="--strand" help="Search both strands or choose plus or minus"> @@ -596,6 +597,38 @@ <param name="format" value="general_def" /> <output name="output" value="test3.out" /> </test> + <test> + <param name="ref_source" value="history" /> + <param name="target" value="chrM_mouse.fa.gz" /> + <param name="query" value="chrM_human.fa.gz" /> + <param name="strand" value="--strand=both" /> + <param name="format" value="blastn" /> + <output name="output" value="test4.out" /> + </test> + <test> + <param name="ref_source" value="history" /> + <param name="target" ftype="fasta.gz" value="chrM_human.fa.gz" /> + <param name="query" ftype="fastq.bz2" value="chrM_mouse.fq.bz2" /> + <param name="strand" value="--strand=both" /> + <param name="format" value="blastn" /> + <output name="output" value="test5.out" /> + </test> + <test> + <param name="ref_source" value="history" /> + <param name="target" ftype="fasta.gz" value="chrM_human.fa.gz" /> + <param name="query" ftype="fastq.gz" value="chrM_mouse.fq.gz" /> + <param name="strand" value="--strand=both" /> + <param name="format" value="blastn" /> + <output name="output" value="test5.out" /> + </test> + <test> + <param name="ref_source" value="history" /> + <param name="target" ftype="fasta.gz" value="chrM_human.fa.gz" /> + <param name="query" ftype="fastq" value="chrM_mouse.fq" /> + <param name="strand" value="--strand=both" /> + <param name="format" value="blastn" /> + <output name="output" value="test5.out" /> + </test> </tests> <help><![CDATA[ |
| b |
| diff -r b6d7308c3728 -r 10aca14c2332 lastz_d.xml --- a/lastz_d.xml Fri Mar 02 12:07:00 2018 -0500 +++ b/lastz_d.xml Thu May 17 04:29:13 2018 -0400 |
| [ |
| @@ -1,15 +1,16 @@ -<tool id="lastz_d_wrapper" name="LASTZ_D" version="1.3"> +<tool id="lastz_d_wrapper" name="LASTZ_D" version="1.3.1"> <description>: estimate substitution scores matrix</description> <macros> <import>lastz_macros.xml</import> </macros> <requirements> <requirement type="package" version="@LASTZ_CONDA_VERSION@">lastz</requirement> + <requirement type="package" version="1.0.6">bzip2</requirement> </requirements> <command detect_errors="exit_code"><![CDATA[ lastz_D @TARGET_INPUT_COMMAND_LINE@ - '${query}' + @query_input@ #if $score_file: '--inferonly=${score_file}' #else: |
| b |
| diff -r b6d7308c3728 -r 10aca14c2332 lastz_macros.xml --- a/lastz_macros.xml Fri Mar 02 12:07:00 2018 -0500 +++ b/lastz_macros.xml Thu May 17 04:29:13 2018 -0400 |
| [ |
| @@ -1,11 +1,26 @@ <macros> <token name="@LASTZ_CONDA_VERSION@">1.0.4</token> - <token name="@TARGET_INPUT_COMMAND_LINE@"> + <token name="@TARGET_INPUT_COMMAND_LINE@"><![CDATA[ #if $source.ref_source=="history": - '${source.target}' + #if $source.target.is_of_type('fasta.gz'): + <(gunzip -c '${source.target}') + #else: + '${source.target}' + #end if #else: '${source.target_2bit.fields.path}' #end if + ]]> + </token> + <token name="@query_input@"><![CDATA[ + #if $query.is_of_type('fasta.gz','fastq.gz'): + <(gunzip -c '${query}') + #elif $query.is_of_type('fastq.bz2'): + <(bunzip2 -c '${query}') + #else: + '${query}' + #end if + ]]> </token> <xml name="target_input"> <conditional name="source"> @@ -19,7 +34,7 @@ </param> </when> <when value="history"> - <param name="target" type="data" format="fasta" label="Select a reference dataset" /> + <param name="target" type="data" format="fasta,fasta.gz" label="Select a reference dataset" /> </when> </conditional> </xml> |
| b |
| diff -r b6d7308c3728 -r 10aca14c2332 test-data/chrM_human.fa.gz |
| b |
| Binary file test-data/chrM_human.fa.gz has changed |
| b |
| diff -r b6d7308c3728 -r 10aca14c2332 test-data/chrM_mouse.fa.gz |
| b |
| Binary file test-data/chrM_mouse.fa.gz has changed |
| b |
| diff -r b6d7308c3728 -r 10aca14c2332 test-data/chrM_mouse.fq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/chrM_mouse.fq Thu May 17 04:29:13 2018 -0400 |
| b |
| @@ -0,0 +1,8 @@ +@read1 +GTTAATGTAGCTTAATAACAAAGCAAAGCACTGAAAATGCTTAGATGGATAATTGTATCCCATAAACACAAAGGTTTGGTCCTGGCCTTATAATTAATTAGAGGTAAAATTACACATGCAAACCTCCATAGACCGGTGTAAAATCCCTTAAACATTTACTTAAAATTTAAGGAGAGGGTATCAAGCACATTAAAATAGCTTAAGACACCTTGCCTAGCCACACCCCCACGGGACTCAGCAGTGATAAATA ++ +HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH +@read2 +TTAAGCAATAAACGAAAGTTTGACTAAGTTATACCTCTTAGGGTTGGTAAATTTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAACTAATTATCTTCGGCGTAAAACGTGTCAACTATAAATAAATAAATAGAATTAAAATCCAACTTATATGTGAAAATTCATTGTTAGGACCTAAACTCAATAACGAAAGTAATTCTAGTCATTTATAATACACGACAGCTAAGACCCAAACTGGGATTAGATA ++ +HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH |
| b |
| diff -r b6d7308c3728 -r 10aca14c2332 test-data/chrM_mouse.fq.bz2 |
| b |
| Binary file test-data/chrM_mouse.fq.bz2 has changed |
| b |
| diff -r b6d7308c3728 -r 10aca14c2332 test-data/chrM_mouse.fq.gz |
| b |
| Binary file test-data/chrM_mouse.fq.gz has changed |
| b |
| diff -r b6d7308c3728 -r 10aca14c2332 test-data/test4.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test4.out Thu May 17 04:29:13 2018 -0400 |
| b |
| @@ -0,0 +1,1 @@ +chrM chrM 70.79 16186 4208 152 577 16569 1 15860 0 14129.5 |
| b |
| diff -r b6d7308c3728 -r 10aca14c2332 test-data/test5.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test5.out Thu May 17 04:29:13 2018 -0400 |
| b |
| @@ -0,0 +1,2 @@ +read1 chrM 68.50 254 71 5 1 248 577 827 5.2e-47 185.2 +read2 chrM 69.50 259 64 4 1 250 830 1082 1.7e-56 216.7 |