| Previous changeset 15:32f1f56bd970 (2023-03-02) Next changeset 17:b9aaed85cbd1 (2024-01-24) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/packages/trimmomatic commit ab36e4731731f12cce0e7d7cc3b50ba6a0bab1ef |
|
modified:
README.rst trimmomatic.xml trimmomatic_macros.xml |
|
added:
test-data/trimmomatic_se_out1.err.re_match test-data/trimmomatic_se_out2.err.re_match |
| b |
| diff -r 32f1f56bd970 -r 9a38087e3bfd README.rst --- a/README.rst Thu Mar 02 15:24:24 2023 +0000 +++ b/README.rst Sun Jan 14 11:00:33 2024 +0000 |
| b |
| b'@@ -12,13 +12,6 @@\n - Bolger, A.M., Lohse, M., & Usadel, B. (2014). Trimmomatic: A flexible trimmer\n for Illumina Sequence Data. Bioinformatics, btu170.\n \n-Automated installation\n-======================\n-\n-Installation via the Galaxy Tool Shed will take care of installing the tool wrapper\n-and the trimmomatic program and data, and setting the appropriate environment\n-variables.\n-\n Controlling the available memory\n ================================\n \n@@ -32,107 +25,83 @@\n \n This will set the environment variable ``_JAVA_OPTIONS`` to ``-Xmx6G``.\n \n-Manual Installation\n-===================\n-\n-There are two files to install:\n-\n-- ``trimmomatic.xml`` (the Galaxy tool definition)\n-- ``trimmomatic.sh`` (the shell script wrapper)\n-\n-The suggested location is in a ``tools/trimmomatic/`` folder. You will then\n-need to modify the ``tools_conf.xml`` file to tell Galaxy to offer the tool\n-by adding the line:\n-\n- <tool file="trimmomatic/trimmomatic.xml" />\n-\n-You will also need to install trimmomatic 0.38:\n-\n-- http://www.usadellab.org/cms/uploads/supplementary/Trimmomatic/Trimmomatic-0.38.zip\n-\n-The tool wrapper uses the following environment variables in order to find the\n-appropriate files:\n-\n-- ``TRIMMOMATIC_DIR`` should point to the directory holding the\n- ``trimmomatic-0.36.jar`` file\n-- ``TRIMMOMATIC_ADAPTERS_DIR`` should point to the directory holding the adapter\n- sequence files (used by the ``ILLUMINACLIP`` option).\n-\n-If you want to run the functional tests, copy the sample test files under\n-sample test files under Galaxy\'s ``test-data/`` directory. Then:\n-\n- ./run_tests.sh -id trimmomatic\n-\n-You will need to have set the environment variables above.\n-\n History\n =======\n \n-========== ======================================================================\n-Version Changes\n----------- ----------------------------------------------------------------------\n-0.39 - Update to Trimmomatic 0.39.\n-0.38.1 - Bug fix: add dependency on ``coreutils`` so that ``readlink -e`` is\n- supported across both Linux and MacOS platforms.\n-0.38.0 - Update to Trimmomatic 0.38.\n-0.36.6 - Added trimlog and log outputs; add support for ``fastqillumina``\n- and ``fastqsolexa`` input types\n-0.36.5 - Remove tool_dependencies.xml and always use conda to resolve tool\n- dependencies\n-0.36.4 - Add option to provide custom adapter sequences for ILLUMINACLIP\n- - Add options ``minAdapterLength`` and ``keepBothReads`` for ILLUMINACLIP\n- in palindrome mode\n-0.36.3 - Fix naming of output collections. Instead of all outputs being called\n- "Trimmomatic on collection NN" these will now be called "Trimmomatic\n- on collection NN: paired" or "Trimmomatic on collection NN: unpaired".\n-0.36.2 - Support fastqsanger.gz datatype. If fastqsanger.gz is used as input\n- the output will also be fastqsanger.gz.\n- - Use $_JAVA_OPTIONS to customize memory requirements.\n-0.36.1 - Reimplement to work with bioconda Trimmomatic 0.36 (toolshed version\n- is still supported for now).\n-0.36.0 - Update to Trimmomatic 0.36.\n-0.32.4 - Add support for ``AVGQUAL`` and ``MAXINFO`` operations.\n-0.32.3 - Add support for FASTQ R1/R2 pairs using dataset collections (input\n- can be dataset collection, in which case tool also outputs dataset\n-\t collections) and improve order and naming of output files.\n-0.32.2 - Use ``GALAXY_SLOTS`` to set the appropriate number of threads to use\n- at runtime (default is 6).\n-0.32.1 - Remove ``trimmomatic_adapters.loc.sample`` and hard-code adapter files\n- into the XML wrapper.\n-0.32.0 - Add tool_dependencies.xml to install Trimmomatic 0.32 automatically and\n- set the environment.\n- - Update tool versioning to use Trimmomatic version number (i.e. ``0.32``)\n- with tool iteration appended (i.e. ``.1``).\n-0.0.4 - Sp'..b'g outputs; add support for\n+ ``fastqillumina`` and ``fastqsolexa`` input types\n+0.36.5 - Remove tool_dependencies.xml and always use conda to resolve\n+ tool dependencies\n+0.36.4 - Add option to provide custom adapter sequences for\n+ ILLUMINACLIP\n+ - Add options ``minAdapterLength`` and ``keepBothReads`` for\n+ ILLUMINACLIP in palindrome mode\n+0.36.3 - Fix naming of output collections. Instead of all outputs being\n+ called "Trimmomatic on collection NN" these will now be called\n+ "Trimmomatic on collection NN: paired" or "Trimmomatic on\n+ collection NN: unpaired".\n+0.36.2 - Support fastqsanger.gz datatype. If fastqsanger.gz is used as\n+ input the output will also be fastqsanger.gz.\n+ - Use $_JAVA_OPTIONS to customize memory requirements.\n+0.36.1 - Reimplement to work with bioconda Trimmomatic 0.36 (toolshed\n+ version is still supported for now).\n+0.36.0 - Update to Trimmomatic 0.36.\n+0.32.4 - Add support for ``AVGQUAL`` and ``MAXINFO`` operations.\n+0.32.3 - Add support for FASTQ R1/R2 pairs using dataset collections\n+ (input can be dataset collection, in which case tool also\n+ outputs dataset collections) and improve order and naming of\n+ output files.\n+0.32.2 - Use ``GALAXY_SLOTS`` to set the appropriate number of threads\n+ to use at runtime (default is 6).\n+0.32.1 - Remove ``trimmomatic_adapters.loc.sample`` and hard-code\n+ adapter files into the XML wrapper.\n+0.32.0 - Add tool_dependencies.xml to install Trimmomatic 0.32\n+ automatically and set the environment.\n+ - Update tool versioning to use Trimmomatic version number (i.e.\n+ ``0.32``) with tool iteration appended (i.e. ``.1``).\n+0.0.4 - Specify \'-threads 6\' in <command> section.\n+0.0.3 - Added MINLEN, LEADING, TRAILING, CROP and HEADCROP options of\n+ trimmomatic.\n+0.0.2 - Updated ILLUMINACLIP option to use standard adapter sequences\n+ (requires the trimmomatic_adapters.loc file; sample version is\n+ supplied) plus cosmetic updates to wording and help text for\n+ some options.\n+0.0.1 - Initial version\n+============== ================================================================\n \n \n Credits\n =======\n \n-This wrapper has been developed and is maintained by Peter Briggs (@pjbriggs).\n+This wrapper was originally developed and maintained by Peter Briggs\n+(@pjbriggs).\n Peter van Heusden (@pvanheus) and Marius van den Beek (@mvdbeek) contributed \n support for gz compressed FastQ files. Charles Girardot (@cgirardot) and\n-Jelle Scholtalbers (@scholtalbers) contributed additional options to ILLUMINACLIP.\n+Jelle Scholtalbers (@scholtalbers) contributed additional options to\n+ILLUMINACLIP.\n Matthias Bernt (@bernt-matthias) added log and trimlog output.\n Nicola Soranzo (@nsoranzo) suggested using coreutils to enable cross-platform\n support across Linux and MacOS.\n Crist\xc3\xb3bal Gallardo (@gallardoalba) updated Trimmomatic up to version 0.39.\n+Peter Briggs wishes to acknowledge the help from Matthia Bernt\n+(@bernt-matthias) with relocating the tool in the IUC tool repository,\n+and the IUC for taking on responsibility for the tool.\n \n Developers\n ==========\n \n-This tool is developed on the following GitHub repository:\n-https://github.com/fls-bioinformatics-core/galaxy-tools/tree/master/trimmomatic\n-\n-For making the "Galaxy Tool Shed" http://toolshed.g2.bx.psu.edu/ tarball I use\n-the ``package_trimmomatic.sh`` script.\n-\n+The Trimmomatic tool is now maintained as part of the ``tools-iuc`` repository\n+on GitHub:\n+https://github.com/galaxyproject/tools-iuc/tools/tree/main/trimmomatic\n \n Licence (MIT)\n =============\n' |
| b |
| diff -r 32f1f56bd970 -r 9a38087e3bfd test-data/trimmomatic_se_out1.err.re_match --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/trimmomatic_se_out1.err.re_match Sun Jan 14 11:00:33 2024 +0000 |
| [ |
| @@ -0,0 +1,5 @@ +TrimmomaticSE: Started with arguments: + -threads [0-9]+ fastq_in\.fastqsanger fastq_out\.fastqsanger SLIDINGWINDOW:4:20 -trimlog trimlog +Quality encoding detected as phred33 +Input Reads: 10 Surviving: 8 \(80\.00%\) Dropped: 2 \(20\.00%\) +TrimmomaticSE: Completed successfully |
| b |
| diff -r 32f1f56bd970 -r 9a38087e3bfd test-data/trimmomatic_se_out2.err.re_match --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/trimmomatic_se_out2.err.re_match Sun Jan 14 11:00:33 2024 +0000 |
| [ |
| @@ -0,0 +1,4 @@ +TrimmomaticSE: Started with arguments: + -threads [0-9]+ fastq_in\.fastqsanger fastq_out\.fastqsanger SLIDINGWINDOW:4:20 -trimlog trimlog -phred33 +Input Reads: 10 Surviving: 8 \(80\.00%\) Dropped: 2 \(20\.00%\) +TrimmomaticSE: Completed successfully |
| b |
| diff -r 32f1f56bd970 -r 9a38087e3bfd trimmomatic.xml --- a/trimmomatic.xml Thu Mar 02 15:24:24 2023 +0000 +++ b/trimmomatic.xml Sun Jan 14 11:00:33 2024 +0000 |
| [ |
| b'@@ -10,7 +10,7 @@\n \tSee similar fix for snpSift\n \thttps://github.com/galaxyproject/tools-iuc/commit/b5e2080a7afdea9fa476895693b6115824c6fbb9\n -->\n- <requirement type="package" version="8.25">coreutils</requirement>\n+ <requirement type="package" version="9.4">coreutils</requirement>\n </requirements>\n <command detect_errors="aggressive"><![CDATA[\n @CONDA_TRIMMOMATIC_JAR_PATH@ &&\n@@ -38,7 +38,7 @@\n SE -threads \\${GALAXY_SLOTS:-6} fastq_in.\'$fastq_in.extension\' fastq_out.\'$fastq_in.extension\'\n #end if\n ## ILLUMINACLIP option\n- #if $illuminaclip.do_illuminaclip\n+ #if $illuminaclip.do_illuminaclip == "yes"\n #if $illuminaclip.adapter_type.standard_or_custom == "custom"\n #if $readtype.single_or_paired in ["pair_of_files","collection"]\n ILLUMINACLIP:$adapter_file_from_text:$illuminaclip.seed_mismatches:$illuminaclip.palindrome_clip_threshold:$illuminaclip.simple_clip_threshold:$illuminaclip.min_adapter_len:$illuminaclip.keep_both_reads\n@@ -134,7 +134,10 @@\n </when>\n </conditional>\n <conditional name="illuminaclip">\n- <param name="do_illuminaclip" type="boolean" label="Perform initial ILLUMINACLIP step?" help="Cut adapter and other illumina-specific sequences from the read" truevalue="yes" falsevalue="no" checked="False" />\n+ <param name="do_illuminaclip" type="select" label="Perform initial ILLUMINACLIP step?" help="Cut adapter and other illumina-specific sequences from the read">\n+\t<option value="no" selected="true">no</option>\n+\t<option value="yes">yes</option>\n+ </param>\n <when value="yes">\n <conditional name="adapter_type">\n <param name="standard_or_custom" type="select" label="Select standard adapter sequences or provide custom?">\n@@ -252,7 +255,7 @@\n </data>\n </outputs>\n <tests>\n- <test>\n+ <test expect_num_outputs="3">\n <!-- Single-end example -->\n <conditional name="readtype">\n <param name="single_or_paired" value="se" />\n@@ -263,16 +266,16 @@\n <param name="output_err" value="yes" />\n <output name="fastq_out" file="trimmomatic_se_out1.fastq" />\n <output name="log_file" file="trimmomatic_se_out1.log" />\n- <output name="err_file" file="trimmomatic_se_out1.err" />\n+ <output name="err_file" compare="re_match" file="trimmomatic_se_out1.err.re_match" />\n </test>\n- <test>\n+ <test expect_num_outputs="1">\n <!-- Single-end example - gzipped -->\n <param name="single_or_paired" value="se" />\n <param name="fastq_in" value="Illumina_SG_R1.fastq.gz" ftype="fastqsanger.gz" />\n <param name="operations_0|operation|name" value="SLIDINGWINDOW" />\n <output name="fastq_out" file="trimmomatic_se_out1.fastq.gz" />\n </test>\n- <test>\n+ <test expect_num_outputs="4">\n <!-- Paired-end example - gzipped -->\n <param name="single_or_paired" value="pair_of_files" />\n <param name="fastq_r1_in" value="Illumina_SG_R1.fastq.gz" ftype="fastqsanger.gz" />\n@@ -283,7 +286,7 @@\n <output name="fastq_out_r2_paired" file="trimmomatic_pe_r2_paired_out1.fastq.gz" />\n <output name="fastq_out_r2_unpaired" file="trimmomatic_pe_r2_unpaired_out1.fastq.gz" />\n </test>\n- <test>\n+ <test expect_num_outputs="4">\n <!-- Paired-end example -->\n <param name="single_or_paired" value="pair_of_files" />\n <param name="fastq_r1_in" value="Illumina_SG_R1.fastq" ftype="fastqsanger" />\n@@ -294,7 +297,7 @@\n <output name="fastq_out_r2_paired" file="trimmomatic_pe_r2_paired_out1.fastq" />\n <output name="fastq_out_r2_unpaired" file="trimmomatic_pe_r2_unpaired_out1.fastq" />\n </test>\n- <test>\n+ <test expect_num_outputs="4">\n <!-- Paired-end Illumina 1.3-1.7 quality encoding -->\n <param name="single_or_paired" value="pair_of_files" />\n <param name="fastq_r1_in" value="Illumina_SG_R1.fastqillumina" ftype="fastqillumina" />\n@@ -305,7 +308,7 @@\n <output name="fastq_out_r2_paired" file="trimmomatic'..b'tputs="1">\n <!-- Single-end using MAXINFO -->\n <param name="single_or_paired" value="se" />\n <param name="fastq_in" value="Illumina_SG_R1.fastq" ftype="fastqsanger" />\n@@ -379,12 +382,12 @@\n <param name="operations_0|operation|strictness" value="0.8" />\n <output name="fastq_out" file="trimmomatic_maxinfo.fastq" />\n </test>\n- <test>\n+ <test expect_num_outputs="4">\n <!-- Paired-end ILLUMINACLIP - this does not check valid clipping -->\n <param name="single_or_paired" value="pair_of_files" />\n <param name="fastq_r1_in" value="Illumina_SG_R1.fastq" ftype="fastqsanger" />\n <param name="fastq_r2_in" value="Illumina_SG_R2.fastq" ftype="fastqsanger" />\n- <param name="do_illuminaclip" value="true"/>\n+ <param name="do_illuminaclip" value="yes"/>\n <param name="adapter_fasta" value="TruSeq2-PE.fa"/>\n <param name="operations_0|operation|name" value="SLIDINGWINDOW" />\n <output name="fastq_out_r1_paired" file="trimmomatic_pe_r1_paired_out1_clip.fastq" />\n@@ -392,12 +395,12 @@\n <output name="fastq_out_r2_paired" file="trimmomatic_pe_r2_paired_out1.fastq" />\n <output name="fastq_out_r2_unpaired" file="trimmomatic_pe_r2_unpaired_out1_clip.fastq" />\n </test>\n- <test>\n+ <test expect_num_outputs="4">\n <!-- Paired-end ILLUMINACLIP providing \'custom\' adapters - this does not check valid clipping -->\n <param name="single_or_paired" value="pair_of_files" />\n <param name="fastq_r1_in" value="Illumina_SG_R1.fastq" ftype="fastqsanger" />\n <param name="fastq_r2_in" value="Illumina_SG_R2.fastq" ftype="fastqsanger" />\n- <param name="do_illuminaclip" value="true"/>\n+ <param name="do_illuminaclip" value="yes"/>\n <param name="standard_or_custom" value="custom"/>\n <param name="adapter_text"\n value=">PrefixPE/1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT >PrefixPE/2 CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT >PCR_Primer1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT >PCR_Primer1_rc AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT >PCR_Primer2 CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT >PCR_Primer2_rc AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG >FlowCell1 TTTTTTTTTTAATGATACGGCGACCACCGAGATCTACAC >FlowCell2 TTTTTTTTTTCAAGCAGAAGACGGCATACGA "/>\n@@ -408,7 +411,7 @@\n <output name="fastq_out_r2_paired" file="trimmomatic_pe_r2_paired_out1.fastq" />\n <output name="fastq_out_r2_unpaired" file="trimmomatic_pe_r2_unpaired_out1_clip.fastq" />\n </test>\n- <test>\n+ <test expect_num_outputs="3">\n <!-- Quality score test -->\n <conditional name="readtype">\n <param name="single_or_paired" value="se" />\n@@ -420,7 +423,7 @@\n <param name="quality_score" value="-phred33"/>\n <output name="fastq_out" file="trimmomatic_se_out1.fastq" />\n <output name="log_file" file="trimmomatic_se_out1.log" />\n- <output name="err_file" file="trimmomatic_se_out2.err" />\n+ <output name="err_file" compare="re_match" file="trimmomatic_se_out2.err.re_match" />\n </test>\n </tests>\n <help><![CDATA[\n@@ -499,9 +502,11 @@\n \n **Credits**\n \n-This Galaxy tool has been developed within the Bioinformatics Core Facility at the\n-University of Manchester, with contributions from Peter van Heusden, Marius\n-van den Beek, Jelle Scholtalbers, Charles Girardot, Matthias Bernt and Crist\xc3\xb3bal Gallardo.\n+This Galaxy tool was originally developed within the Bioinformatics Core\n+Facility at the University of Manchester, with contributions from Peter van\n+Heusden, Marius van den Beek, Jelle Scholtalbers, Charles Girardot, Matthias\n+Bernt and Crist\xc3\xb3bal Gallardo. It is now maintained as part of the IUC tool\n+collection.\n \n It runs the Trimmomatic program which has been developed\n within Bjorn Usadel\'s group at RWTH Aachen university.\n' |
| b |
| diff -r 32f1f56bd970 -r 9a38087e3bfd trimmomatic_macros.xml --- a/trimmomatic_macros.xml Thu Mar 02 15:24:24 2023 +0000 +++ b/trimmomatic_macros.xml Sun Jan 14 11:00:33 2024 +0000 |
| [ |
| @@ -6,5 +6,5 @@ <token name="@CONDA_TRIMMOMATIC_JAR_PATH@">if [ -z "\$TRIMMOMATIC_JAR_PATH" ]; then export TRIMMOMATIC_JAR_PATH=\$(dirname \$(readlink -e \$(which trimmomatic))); fi</token> <token name="@CONDA_TRIMMOMATIC_ADAPTERS_PATH@">if [ -z "\$TRIMMOMATIC_ADAPTERS_PATH" ]; then export TRIMMOMATIC_ADAPTERS_PATH=\$(dirname \$(readlink -e \$(which trimmomatic)))/adapters; fi</token> <token name="@TOOL_VERSION@">0.39</token> - <token name="@VERSION_SUFFIX@">0</token> + <token name="@VERSION_SUFFIX@">1</token> </macros> |