Galaxy |

Changeset 3:c8e81e43bff1 (2018-04-07)

Previous changeset 2:ae4754e7c97a (2018-04-04) Next changeset 4:be0cc39776f9 (2018-06-11)

Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6

modified:
macros.xml
nhmmer.xml

added:
test-data/MADE1.nhmmscan_out
test-data/MADE1.nhmmscan_out.aliscoresout
test-data/MADE1.nhmmscan_out.dfamtblout
test-data/MADE1.nhmmscan_out.tblout
test-data/nhmmer.out.dfamtblout
test-data/nhmmer.out.tblout

diff -r ae4754e7c97a -r c8e81e43bff1 macros.xml
--- a/macros.xml Wed Apr 04 14:01:13 2018 -0400
+++ b/macros.xml Sat Apr 07 03:50:51 2018 -0400

[

b'@@ -2,11 +2,11 @@\n <macros>\n <xml name="requirements">\n <requirements>\n- <requirement type="package" version="3.1b2">hmmer</requirement>\n+ <requirement type="package" version="@TOOL_VERSION@">hmmer</requirement>\n <yield/>\n </requirements>\n </xml>\n- <token name="@WRAPPER_VERSION@">0.1</token>\n+ <token name="@TOOL_VERSION@">3.1b2</token>\n <xml name="stdio">\n <stdio>\n \n@@ -21,64 +21,64 @@\n -E $E\n --domE $domE\n \n-#if $T:\n--T $T\n+#if str($T):\n+ -T $T\n #end if\n \n-#if $domT:\n---domT $domT\n+#if str($domT):\n+ --domT $domT\n #end if\n \n-#if $incE:\n---incE $incE\n+#if str($incE):\n+ --incE $incE\n #end if\n \n-#if $incT:\n---incT $incT\n+#if str($incdomE):\n+ --incdomE $incdomE\n #end if\n \n-#if $incdomE:\n---incdomE $incdomE\n+#if str($incT):\n+ --incT $incT\n #end if\n \n-#if $incdomT:\n---incdomT $incdomT\n+#if str($incdomT):\n+ --incdomT $incdomT\n #end if\n </token>\n <xml name="thresholds_xml">\n \n- <param name="E" label="report sequences <= this E-Value threshold in output" help="(-E)" value="10.0" type="float" min="0"/>\n- <param name="domE" label="report domains <= this E-Value threshold in output" help="(--domE)" value="10.0" type="float" min="0"/>\n- <param name="T" label="report sequences >= this score threshold in output" help="(-T)" type="float" optional="True"/>\n- <param name="domT" label="report domains >= this score threshold in output" help="(--domT)" type="float" optional="True"/>\n+ <param argument="-E" type="float" min="0" value="10.0" label="report sequences <= this E-Value threshold in output" />\n+ <param argument="--domE" type="float" min="0" value="10.0" label="report domains <= this E-Value threshold in output" />\n+ <param argument="-T" type="float" optional="true" label="report sequences >= this score threshold in output" />\n+ <param argument="--domT" type="float" optional="true" label="report domains >= this score threshold in output" />\n \n- <param name="incE" label="consider sequences <= this E-Value threshold as significant" help="(--incE)" type="float" optional="True"/>\n- <param name="incdomE" label="consider domains <= this E-Value threshold as significant" help="(--incdomE)" type="float" optional="True"/>\n- <param name="incT" label="consider sequences >= this score threshold as significant" help="(--incT)" type="float" optional="True"/>\n- <param name="incdomT" label="consider domains >= this score threshold as significant" help="(--incdomT)" type="float" optional="True"/>\n+ <param argument="--incE" type="float" optional="true" label="consider sequences <= this E-Value threshold as significant" />\n+ <param argument="--incdomE" type="float" optional="true" label="consider domains <= this E-Value threshold as significant" />\n+ <param argument="--incT" type="float" optional="true" label="consider sequences >= this score threshold as significant" />\n+ <param argument="--incdomT" type="float" optional="true" label="consider domains >= this score threshold as significant" />\n </xml>\n <token name="@THRESHOLDS_NODOM@">\n -E $E\n \n-#if $T:\n--T $T\n+#if str($T):\n+ -T $T\n #end if\n \n-#if $incE:\n---incE $incE\n+#if str($incE):\n+ --incE $incE\n #end if\n \n-#if $incT:\n---incT $incT\n+#if str($incT):\n+ --incT $incT\n #end if\n </token>\n <xml name="thresholds_nodom">\n \n- <param name="E" label="report sequences <= this E-Value threshold in output" help="(-E)" value="10.0" type="float" min="0"/>\n- <param name="T" label="report sequences >= this score threshold in output" help="(-T)" type="float" optional="True"/>\n+ <param argument="-E" type="float" min="0" value="10.0" label="report sequences <= this E-Value threshold in output" />\n+ <param argument="'..b'abel="use profile\'s TC gathering cutoffs to set all thresholding" />\n </xml>\n <token name="@MCSS@">\n --$mcs.model_construction_strategy_select\n \n #if $mcs.model_construction_strategy_select == "fast":\n---symfrac $mcs.symfrac\n+ --symfrac $mcs.symfrac\n #end if\n-\n+#if str($fragthresh)\n+ --fragthresh $fragthresh\n+#end if\n </token>\n <xml name="mcss">\n \n@@ -353,12 +353,11 @@\n <option value="hand">Manual construction (requires reference annotation) (--hand)</option>\n </param>\n <when value="fast">\n- <param name="symfrac" value="0.5" type="float" label="Sets sym fraction controlling --fast construction"/>\n+ <param argument="--symfrac" value="0.5" type="float" label="Sets sym fraction controlling --fast construction"/>\n </when>\n <when value="hand"></when>\n </conditional>\n- <param name="fragthresh" label="Fraction of alignment length, under which sequences are excluded" help="HMMER infers fragments if the sequence length L is less than or equal to a fraction x times the alignment length in columns (--fragthresh)" value="0.5" optional="True" type="float" />\n-\n+ <param argument="--fragthresh" type="float" value="0.5" optional="true" label="Fraction of alignment length, under which sequences are excluded" help="HMMER infers fragments if the sequence length L is less than or equal to a fraction x times the alignment length in columns" />\n </xml>\n <token name="@PRIOR@">\n $aps_select\n@@ -376,32 +375,32 @@\n </citations>\n </xml>\n <token name="@LENGTHS@">\n-#if $w_beta:\n---w_beta $w_beta\n+#if str($w_beta):\n+ --w_beta $w_beta\n #end if\n \n-#if $w_length:\n---w_length $w_length\n+#if str($w_length):\n+ --w_length $w_length\n #end if\n-\n </token>\n <xml name="lengths">\n- <param name="w_beta" label="Tail mass at which window length is determined"\n- help="(--w_beta)" optional="True" type="float"/>\n- <param name="w_length" label="Window Length"\n- help="(--w_length)" optional="True" type="integer" />\n+ <param argument="--w_beta" type="float" optional="true" label="Tail mass at which window length is determined" />\n+ <param argument="--w_length" type="integer" optional="true" label="Window Length" />\n </xml>\n- <token name="@INPUTHMMCHOICE@">\n+ <token name="@INPUTHMMCHOICE@"><![CDATA[\n #if $input_hmm_conditional.input_hmm_source == "history":\n- \'$input_hmm_conditional.hmmfile\'\n+ #set $input_hmm_filename = "localref.hmm"\n+ ln -s \'${input_hmm_conditional.hmmfile}\' \'${input_hmm_filename}\' &&\n+ ## "Press" database\n+ hmmpress \'${input_hmm_filename}\' &&\n #else:\n- \'$input_hmm_conditional.index.fields.db_path\'\n+ #set $input_hmm_filename = str($input_hmm_conditional.index.fields.db_path)\n #end if\n- </token>\n+ ]]></token>\n <xml name="input_hmm_choice">\n <conditional name="input_hmm_conditional">\n <param name="input_hmm_source" type="select" label="Use a built-in HMM model database or own from your history" >\n- <option value="indexed" selected="True">Use a built-in HMM model database</option>\n+ <option value="indexed" selected="true">Use a built-in HMM model database</option>\n <option value="history">Use a HMM database from history</option>\n </param>\n <when value="indexed">\n@@ -413,12 +412,12 @@\n </param>\n </when>\n <when value="history">\n- <param name="hmmfile" type="data" label="HMM model" format="hmm2,hmm3"/>\n+ <param name="hmmfile" type="data" format="hmm2,hmm3" label="HMM model" />\n </when> \n </conditional> \n </xml>\n <xml name="input_hmm">\n- <param name="hmmfile" type="data" label="HMM model" format="hmm2,hmm3"/>\n+ <param name="hmmfile" type="data" format="hmm2,hmm3" label="HMM model" />\n </xml>\n <xml name="input_msa">\n <param name="msafile" type="data" label="Multiple Sequence Alignment" format="stockholm,clustal,fasta"\n'

diff -r ae4754e7c97a -r c8e81e43bff1 nhmmer.xml
--- a/nhmmer.xml Wed Apr 04 14:01:13 2018 -0400
+++ b/nhmmer.xml Sat Apr 07 03:50:51 2018 -0400

[

@@ -1,5 +1,5 @@
<?xml version="1.0"?>
-<tool id="hmmer_nhmmer" name="nhmmer" version="@WRAPPER_VERSION@.0">
+<tool id="hmmer_nhmmer" name="nhmmer" version="@TOOL_VERSION@">
   <description>search a DNA model or alignment against a DNA database (BLASTN-like)</description>
   <macros>
     <import>macros.xml</import>
@@ -20,10 +20,10 @@
@CPU@
@SEED@

-$hmmfile
-$seqfile
-> $output
-      ]]></command>
+'$hmmfile'
+'$seqfile'
+> '$output'
+  ]]></command>
   <inputs>
     <expand macro="input_hmm" />
     <param name="seqfile" type="data" format="fasta" label="Target sequence file"/>
@@ -57,7 +57,9 @@
       <param name="seqfile" value="dna_target.fa"/>
       <expand macro="oformat_test" />
       <expand macro="seed_test" />
-      <output name="output" file="nhmmer.out" lines_diff="32"/>
+      <output name="output" file="nhmmer.out" lines_diff="10" />
+      <output name="tblout" file="nhmmer.out.tblout" lines_diff="10" />
+      <output name="dfamtblout" file="nhmmer.out.dfamtblout" lines_diff="10" />
     </test>
   </tests>
   <help><![CDATA[
@@ -85,6 +87,6 @@
@SEED_HELP@

@ATTRIBUTION@
-]]></help>
+  ]]></help>
   <expand macro="citation"/>
</tool>

diff -r ae4754e7c97a -r c8e81e43bff1 test-data/MADE1.nhmmscan_out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.nhmmscan_out Sat Apr 07 03:50:51 2018 -0400

[

@@ -0,0 +1,109 @@
+# nhmmscan :: search DNA sequence(s) against a DNA profile database
+# HMMER 3.1b2 (February 2015); http://hmmer.org/
+# Copyright (C) 2015 Howard Hughes Medical Institute.
+# Freely distributed under the GNU General Public License (GPLv3).
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+# query sequence file:             /tmp/tmpc_c3amjg/files/000/dataset_2.dat
+# target HMM database:             /tmp/tmpc_c3amjg/files/000/dataset_1.dat
+# per-seq hits tabular output:     /tmp/tmpc_c3amjg/files/000/dataset_4.dat
+# hits output in Dfam format:      /tmp/tmpc_c3amjg/files/000/dataset_5.dat
+# max ASCII text line length:      unlimited
+# Vit filter P threshold:       <= 0.001
+# Fwd filter P threshold:       <= 1e-05
+# random number seed set to:       4
+# number of worker threads:        1
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+
+Query:       humanchr1/239220001-239550000  [L=330000]
+Scores for complete hit:
+    E-value  score  bias  Model     start    end  Description
+    ------- ------ -----  --------  -----  -----  -----------
+    1.2e-10   38.6   7.4  MADE1    302390 302466  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    7.8e-08   29.6   8.3  MADE1    174456 174498  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    1.2e-07   28.9   6.0  MADE1    302466 302390  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    7.2e-06   23.3   7.0  MADE1    174493 174456  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+  ------ inclusion threshold ------
+        1.4    6.3   7.0  MADE1    304073 304104  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+
+
+Annotation for each hit  (and alignments):
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   38.6   7.4   1.2e-10         4        80 .]    302390    302466 ..    302387    302466 ..        80    0.87
+
+  Alignment:
+  score: 38.6 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80
+                                       ggt ggtgcaaaa  aattg ggtttttgccatt cttttaat gc    a aaa  g a  t ctttt caccaa ctaa
+  humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466
+                                       899******************************************955533.443..334.4689***********99986 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   29.6   8.3   7.8e-08         1        43 [.    174456    174498 ..    174456    174518 ..        80    0.92
+
+  Alignment:
+  score: 29.6 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
+                                       ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
+  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
+                                       589************************************9975 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   28.9   6.0   1.2e-07         1        77 [.    302466    302390 ..    302466    302387 ..        80    0.74
+
+  Alignment:
+  score: 28.9 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77
+                                       ttag ttggtg aaaag                cattactttt                aatggcaaaaacc caatt  ttttgcacc acc
+  humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
+                                       68999999999999998................5666777776222222222222222268****************************9998 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   23.3   7.0   7.2e-06        43        80 .]    174493    174456 ..    174513    174456 ..        80    0.91
+
+  Alignment:
+  score: 23.3 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80
+                                       taatg caaaaacc caattacttttgcac aacctaa
+  humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
+                                       689********************************985 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ ?    6.3   7.0       1.4        41        72 ..    304073    304104 ..    304053    304109 ..        80    0.85
+
+  Alignment:
+  score: 6.3 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     41 tttaatggcaaaaaccgcaattacttttgcac 72
+                                       tt a tgg aaaaa   ca tta ttttgca
+  humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104
+                                       455779************************86 PP
+
+
+
+Internal pipeline statistics summary:
+-------------------------------------
+Query sequence(s):                         1  (660000 residues searched)
+Target model(s):                           1  (80 nodes)
+Residues passing SSV filter:             61794  (0.0936); expected (0.02)
+Residues passing bias filter:            46199  (0.07); expected (0.02)
+Residues passing Vit filter:              2752  (0.00417); expected (0.001)
+Residues passing Fwd filter:              2526  (0.00383); expected (1e-05)
+Total number of hits:                        5  (0.000405)
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
+# Mc/sec: 2640.00
+//
+[ok]

diff -r ae4754e7c97a -r c8e81e43bff1 test-data/MADE1.nhmmscan_out.aliscoresout
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.nhmmscan_out.aliscoresout Sat Apr 07 03:50:51 2018 -0400

[

@@ -0,0 +1,17 @@
+# target name        accession   query name                    accession  hmmfrom hmm to alifrom  ali to envfrom  env to  modlen strand   E-value  score  bias  description of target
+#-------------------  ----------          -------------------- ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- ---------------------
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -                4      80  302390  302466  302387  302466      80    +     1.2e-10   38.6   7.4  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -                1      43  174456  174498  174456  174518      80    +     7.8e-08   29.6   8.3  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -                1      77  302466  302390  302466  302387      80    -     1.2e-07   28.9   6.0  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -               43      80  174493  174456  174513  174456      80    -     7.2e-06   23.3   7.0  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -               41      72  304073  304104  304053  304109      80    +         1.4    6.3   7.0  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+#
+# Program:         hmmscan
+# Version:         3.1b2 (February 2015)
+# Pipeline mode:   SCAN
+# Query file:      /tmp/tmpc_c3amjg/files/000/dataset_2.dat
+# Target file:     /tmp/tmpc_c3amjg/files/000/dataset_1.dat
+# Option settings: nhmmscan --tblout /tmp/tmpc_c3amjg/files/000/dataset_4.dat --dfamtblout /tmp/tmpc_c3amjg/files/000/dataset_5.dat --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --B1 110 --B2 240 --B3 1000 --cpu 1 /tmp/tmpc_c3amjg/files/000/dataset_1.dat /tmp/tmpc_c3amjg/files/000/dataset_2.dat
+# Current dir:     /tmp/tmpc_c3amjg/job_working_directory/000/3/working
+# Date:            Wed Apr  4 16:58:45 2018
+# [ok]

diff -r ae4754e7c97a -r c8e81e43bff1 test-data/MADE1.nhmmscan_out.dfamtblout
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.nhmmscan_out.dfamtblout Sat Apr 07 03:50:51 2018 -0400

@@ -0,0 +1,10 @@
+# hit scores
+# ----------
+#
+# target name         acc                  query name                      bits   e-value  bias  hmm-st  hmm-en strand  ali-st  ali-en  env-st  env-en  modlen   description of target
+# ------------------- -------------------  -------------------           ------ --------- ----- ------- ------- ------ ------- ------- ------- ------- -------   ---------------------
+MADE1                 DF0000629.2          humanchr1/239220001-239550000   38.6   1.2e-10   7.4       4      80    +    302390  302466  302387  302466      80   MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                 DF0000629.2          humanchr1/239220001-239550000   29.6   7.8e-08   8.3       1      43    +    174456  174498  174456  174518      80   MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                 DF0000629.2          humanchr1/239220001-239550000   28.9   1.2e-07   6.0       1      77    -    302466  302390  302466  302387      80   MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                 DF0000629.2          humanchr1/239220001-239550000   23.3   7.2e-06   7.0      43      80    -    174493  174456  174513  174456      80   MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                 DF0000629.2          humanchr1/239220001-239550000    6.3       1.4   7.0      41      72    +    304073  304104  304053  304109      80   MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon

diff -r ae4754e7c97a -r c8e81e43bff1 test-data/MADE1.nhmmscan_out.tblout
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.nhmmscan_out.tblout Sat Apr 07 03:50:51 2018 -0400

[

diff -r ae4754e7c97a -r c8e81e43bff1 test-data/nhmmer.out.dfamtblout
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nhmmer.out.dfamtblout Sat Apr 07 03:50:51 2018 -0400

[

@@ -0,0 +1,17 @@
+# target name                 accession  query name           accession   hmmfrom hmm to alifrom  ali to envfrom  env to  sq len strand   E-value  score  bias  description of target
+#         ------------------- ---------- --------------------  ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- ---------------------
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2       4      80  302390  302466  302387  302466  330000    +     1.2e-10   38.6   7.4  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2       1      43  174456  174498  174456  174518  330000    +     7.8e-08   29.6   8.3  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2       1      77  302466  302390  302466  302387  330000    -     1.2e-07   28.9   6.0  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2      43      80  174493  174456  174513  174456  330000    -     7.2e-06   23.3   7.0  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2      41      72  304073  304104  304053  304109  330000    +         1.4    6.3   7.0  -
+#
+# Program:         nhmmer
+# Version:         3.1b2 (February 2015)
+# Pipeline mode:   SEARCH
+# Query file:      /tmp/tmpnpsbd_6p/files/000/dataset_1.dat
+# Target file:     /tmp/tmpnpsbd_6p/files/000/dataset_2.dat
+# Option settings: nhmmer --tblout /tmp/tmpnpsbd_6p/files/000/dataset_4.dat --dfamtblout None --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --dna --seed 4 --cpu 1 /tmp/tmpnpsbd_6p/files/000/dataset_1.dat /tmp/tmpnpsbd_6p/files/000/dataset_2.dat
+# Current dir:     /tmp/tmpnpsbd_6p/job_working_directory/000/3/working
+# Date:            Fri Apr  6 16:39:46 2018
+# [ok]

diff -r ae4754e7c97a -r c8e81e43bff1 test-data/nhmmer.out.tblout
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nhmmer.out.tblout Sat Apr 07 03:50:51 2018 -0400

[