Previous changeset 9:96ed25eb39f0 (2020-06-06) Next changeset 11:aee9afe5de77 (2020-06-17) |
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/chira commit 51f68a6d51d9e87f8e54021ce760b1506a3589b8" |
modified:
chira_quantify.xml macros.xml test-data/chimeras test-data/interactions |
removed:
test-data/singletons |
b |
diff -r 96ed25eb39f0 -r e0f08a05b24c chira_quantify.xml --- a/chira_quantify.xml Sat Jun 06 08:12:49 2020 -0400 +++ b/chira_quantify.xml Sun Jun 14 17:36:19 2020 -0400 |
b |
@@ -25,7 +25,7 @@ Always set this value relative to your sequencing depth. Setting this to lower leads CRLs of random multimappings Also consider setting the --crl_share option along with this"/> - <param name="em_threshold" type="float" value="1" label="EM threshold" + <param name="em_threshold" type="float" value="0.1" label="EM threshold" help="The maximum difference of transcripts expression between two consecutive iterations of EM algorithm to converge."/> <param name="crl" type="boolean" truevalue="-crl" falsevalue="" checked="true" label="Create CRLs" help="Create CRLs and qunatify them or use the loci further without creating the CRLs" /> @@ -37,6 +37,7 @@ <tests> <test expect_num_outputs="1"> <param name="segments" value="segments.bed"/> + <param name="em_threshold" value="1"/> <param name="merged" value="merged.bed"/> <param name="min_locus_size" value="5"/> <output name="loci" file="loci.counts"/> |
b |
diff -r 96ed25eb39f0 -r e0f08a05b24c macros.xml --- a/macros.xml Sat Jun 06 08:12:49 2020 -0400 +++ b/macros.xml Sun Jun 14 17:36:19 2020 -0400 |
b |
@@ -1,6 +1,6 @@ <macros> <token name="@WRAPPER_VERSION@">@TOOL_VERSION@+galaxy</token> - <token name="@TOOL_VERSION@">1.3.3</token> + <token name="@TOOL_VERSION@">1.3.4</token> <xml name="requirements"> <requirements> <requirement type="package" version="@TOOL_VERSION@">chira</requirement> |
b |
diff -r 96ed25eb39f0 -r e0f08a05b24c test-data/chimeras --- a/test-data/chimeras Sat Jun 06 08:12:49 2020 -0400 +++ b/test-data/chimeras Sun Jun 14 17:36:19 2020 -0400 |
b |
@@ -1,3 +1,3 @@ tagid txid1 txid2 geneid1 geneid2 symbol1 symbol2 region1 region2 tx_pos_start1 tx_pos_end1 tx_pos_strand1 length1 tx_pos_start2 tx_pos_end2 tx_pos_strand2 length2 read_info genomic_pos1 genomic_pos2 locus1 locus2 groupid1 groupid2 tpm1 tpm2 score1 score2 score sequences hybrid hybrid_pos mfe -3|2 mmu-miR-20a-5p ENSMUST00000136025 NA NA NA NA NA NA 0 23 + 23 132 142 + 188 6,28,35,44,55 mmu-miR-20a-5p:0:23:+ ENSMUST00000136025:132:142:+ mmu-miR-20a-5p:0:23:+ ENSMUST00000136025:132:142:+ 5 2 75660.00 165100.00 1.0 1.0 2.0 UAAAGUGCUUAUAGUGCAGGUAG&CUGCCUGCCU ((((((((((&)).)))))))) 1&13 -13.7 -4|1 mmu-miR-6979-3p ENSMUST00000136025 NA NA NA NA NA NA 2 12 + 21 32 46 + 188 30,39,2,15,54 mmu-miR-6979-3p:2:12:+ ENSMUST00000136025:32:46:+ mmu-miR-6979-3p:2:12:+ ENSMUST00000136025:32:46:+ 7 1 165100.00 121100.00 1.0 1.0 2.0 GUGUCUGUCU&CAGGACUCUUGGCU ((((.....((&))....)))) 3&1 -4 +3|2 mmu-miR-20a-5p ENSMUST00000136025 NA NA NA NA NA NA 0 23 + 23 132 142 + 188 6,28,35,44,55 mmu-miR-20a-5p:0:23:+ ENSMUST00000136025:132:142:+ mmu-miR-20a-5p:0:23:+ ENSMUST00000136025:132:142:+ 5 2 75660.00 165100.00 1.0 1.0 2.0 UAAAGUGCUUAUAGUGCAGGUAG&CUGCCUGCCU ............((.((((((((&)))))))))) 13&1 -13.7 +4|1 mmu-miR-6979-3p ENSMUST00000136025 NA NA NA NA NA NA 2 12 + 21 32 46 + 188 30,39,2,15,54 mmu-miR-6979-3p:2:12:+ ENSMUST00000136025:32:46:+ mmu-miR-6979-3p:2:12:+ ENSMUST00000136025:32:46:+ 7 1 165100.00 121100.00 1.0 1.0 2.0 GUGUCUGUCU&CAGGACUCUUGGCU NA NA NA |
b |
diff -r 96ed25eb39f0 -r e0f08a05b24c test-data/interactions --- a/test-data/interactions Sat Jun 06 08:12:49 2020 -0400 +++ b/test-data/interactions Sun Jun 14 17:36:19 2020 -0400 |
b |
@@ -1,2 +1,2 @@ -mmu-miR-20a-5p:0:23:+ ENSMUST00000136025:132:142:+ 1 UAAAGUGCUUAUAGUGCAGGUAG CUGCCUGCCU ((((((((((&)).)))))))) 1&13 -13.7 75660.00 165100.00 240760.0 1.0 1.0 2.0 NA NA mmu-miR-20a-5p ENSMUST00000136025 -mmu-miR-6979-3p:2:12:+ ENSMUST00000136025:32:46:+ 1 GUGUCUGUCU CAGGACUCUUGGCU ((((.....((&))....)))) 3&1 -4 165100.00 121100.00 286200.0 1.0 1.0 2.0 NA NA mmu-miR-6979-3p ENSMUST00000136025 +1 mmu-miR-20a-5p 0 23 + ENSMUST00000136025 132 142 + UAAAGUGCUUAUAGUGCAGGUAG CUGCCUGCCU ............((.((((((((&)))))))))) -13.7 AGUGCAGGUAG CUGCCUGCCU 13&1 mmu-miR-20a-5p 12 23 + ENSMUST00000136025 132 142 + 75660.00 165100.00 240760.0 1.0 1.0 2.0 NA NA mmu-miR-20a-5p ENSMUST00000136025 +1 mmu-miR-6979-3p 2 12 + ENSMUST00000136025 32 46 + GUGUCUGUCU CAGGACUCUUGGCU NA NA NA NA NA mmu-miR-6979-3p 2 12 + ENSMUST00000136025 32 46 + 165100.00 121100.00 286200.0 1.0 1.0 2.0 NA NA mmu-miR-6979-3p ENSMUST00000136025 |
b |
diff -r 96ed25eb39f0 -r e0f08a05b24c test-data/singletons --- a/test-data/singletons Sat Jun 06 08:12:49 2020 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
b |
@@ -1,4 +0,0 @@ -tagid txid geneid symbol region tx_pos_start tx_pos_end tx_pos_strand length read_info genomic_pos locus groupid tpm score -2|2 mmu-miR-6898-5p NA NA NA 11 21 + NA 1,10,49 mmu-miR-6898-5p:11:21:+ mmu-miR-6898-5p:11:21:+ 6 165100.00 1.00 -6|1 ENSMUST00000160533 NA NA NA 69 82 + NA 43,55,55 ENSMUST00000160533:69:82:+ ENSMUST00000160533:69:82:+ 4 129700.00 1.00 -7|9 ENSMUST00000182010 NA NA NA 24 74 + NA 6,55,55 ENSMUST00000182010:24:74:+ ENSMUST00000182010:19:74:+ 0 64850.00 1.00 |