| Next changeset 1:03627f24605f (2020-01-31) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/lofreq commit 9efcb813ab17041c7f5aad834dfff45bd7046c60" |
|
added:
lofreq_call.xml macros.xml test-data/alnqual-out1.bam test-data/alnqual-out2.bam test-data/alnqual-out3.bam test-data/alnqual-out4.bam test-data/alnqual-out5.bam test-data/call-out1.vcf test-data/call-out2.vcf test-data/indelqual-out1.bam test-data/indelqual-out2.bam test-data/indelqual-out3.bam test-data/lofreq-in1.bam test-data/pBR322.fa test-data/viterbi-out1.bam test-data/viterbi-out2.bam tool-data/fasta_indexes.loc.sample tool_data_table_conf.xml.sample |
| b |
| diff -r 000000000000 -r 31216d510164 lofreq_call.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lofreq_call.xml Tue Dec 17 17:27:17 2019 -0500 |
| [ |
| b'@@ -0,0 +1,365 @@\n+<tool id="lofreq_call" name="Call variants" version="@WRAPPER_VERSION@0">\n+ <description>with LoFreq</description>\n+ <macros>\n+ <import>macros.xml</import>\n+ </macros>\n+ <expand macro="requirements" />\n+ <command detect_errors="exit_code"><![CDATA[\n+ ## prepare reference genome and mapped reads input\n+ @PREPARE_REF@\n+ ln -s \'$reads\' reads.bam &&\n+ ln -s -f \'${reads.metadata.bam_index}\' reads.bam.bai &&\n+\n+ ## call variants with lofreq\n+\n+ ## make lofreq stick to tool contract by\n+ ## generating tmp output inside job working dir\n+ mkdir pp-tmp &&\n+ export TMPDIR=pp-tmp &&\n+\n+ lofreq call-parallel --pp-threads \\${GALAXY_SLOTS:-1} --verbose\n+\n+ --ref \'$reference_fasta_fn\' --out variants.vcf $variant_types\n+\n+ #if str($regions.restrict_to_region) == \'regions_from_file\':\n+ --bed \'$regions.bed\'\n+ #end if\n+\n+ #if str($call_control.set_call_options) == \'yes\':\n+ --min-cov $call_control.coverage.min_cov\n+ --max-depth $call_control.coverage.max_depth\n+ $call_control.pe.use_orphan\n+ --min-bq $call_control.bc_quals.min_bq\n+ --min-alt-bq $call_control.bc_quals.min_alt_bq\n+ --def-alt-bq $call_control.bc_quals.def_alt_bq\n+ ${call_control.align_quals.alnqual.use_alnqual}\n+ #if str($call_control.align_quals.alnqual.use_alnqual) != \'-A -B\':\n+ ${call_control.align_quals.alnqual.alnqual_choice.alnquals_to_use}\n+ ${call_control.align_quals.alnqual.alnqual_choice.extended_baq}\n+ #end if\n+ --min-mq $call_control.map_quals.min_mq\n+ --max-mq $call_control.map_quals.use_mq.max_mq\n+ $call_control.map_quals.use_mq.no_mq\n+ #if str($call_control.source_qual.use_src_qual.src_qual):\n+ $call_control.source_qual.use_src_qual.src_qual\n+ #set $ign_vcfs = \',\'.join([str($ign_vcf) for $ign_vcf in $call_control.source_qual.use_src_qual.ign_vcf if $ign_vcf])\n+ #if $ign_vcfs:\n+ --ign-vcf "$ign_vcfs"\n+ #end if\n+ --def-nm-q $call_control.source_qual.use_src_qual.def_nm_q\n+ #end if\n+ --min-jq $call_control.joint_qual.min_jq\n+ --min-alt-jq $call_control.joint_qual.min_alt_jq\n+ --def-alt-jq $call_control.joint_qual.def_alt_jq\n+ #end if\n+\n+ --sig $filter_control.sig\n+ #set $bonf_factor = $filter_control.bonf or \'dynamic\'\n+ --bonf $bonf_factor\n+ $filter_control.others\n+\n+ reads.bam 2>&1\n+\n+ ## in case of errors add the log files produced\n+ ## by the parallel workers to stderr\n+ || (tool_exit_code=\\$? && cat pp-tmp/lofreq2_call_parallel*/*.log 1>&2 && exit \\$tool_exit_code)\n+\n+ ## work around a bug in lofreq call-parallel\n+ ## https://github.com/CSB5/lofreq/issues/85\n+ ## that causes the output format to be vcf.gz with certain filter\n+ ## combinations.\n+ #if str($bonf_factor) != \'dynamic\':\n+ #if \'--no-default-filter\' in str($filter_control.others):\n+ && ln -s variants.vcf variants.vcf.gz\n+ && gzip -df variants.vcf.gz\n+ #end if\n+ #end if\n+ ]]></command>\n+ <inputs>\n+ <param type="data" name="reads" format="bam" label="Input reads in BAM format" />\n+ <expand macro="reference_interface" />\n+ <conditional name="regions">\n+ <param name="restrict_to_region" type="select"\n+ label="Call variants across">\n+ <option value="genome">Whole reference</option>\n+ <option value="regions_from_file">Regions specified in BED</option>\n+ </param>\n+ <when value="genome" />\n+ <when value="regions_from_file">\n+ <param argument="--bed" type="data" format="bed"\n+ '..b'data since no machine-\n+or sequencing-technology dependent thresholds are used. It automatically adapts\n+to changes in coverage and sequencing quality and can therefore be applied to a\n+variety of data-sets e.g. viral/quasispecies, bacterial, metagenomics or\n+somatic data.\n+\n+While the tool will often give reasonable results with default settings a\n+variety of options let you control its exact behavior. These advanced options\n+can be subdivided into those affecting variant calling and those affecting\n+posterior filtering of the results.\n+\n+**Variant calling paramters**\n+\n+At the heart of LoFreq\'s variant caller is a **joint quality score** that is\n+computed for every site in every read (that survives filtering) and that\n+combines some or all of the following read and base quality measures:\n+\n+- Base/indel quality\n+\n+ For any read, this is the Phred-scaled likelihood that the base mapped to a\n+ given site does not represent a sequencing error. For every base, this score\n+ got computed by the base caller of your sequencing platform and got\n+ incorporated into your input dataset during read alignment.\n+\n+ For insertions/deletions this is defined, analogously, as the Phred-scaled\n+ likelihood that any inserted/deleted base is real, however, you are\n+ responsible for adding indel qualitites, which are required for indel\n+ calling with lofreq, to your input.\n+\n+ For doing so, you can use ``lofreq indelqual`` or GATK\'s BQSR.\n+\n+- Base/indel alignment quality\n+\n+ For any read, this is the Phred-scaled likelihood that the read\'s base or\n+ indel mapped to a given reference genome position is mapped to this position\n+ correctly.\n+\n+ The tool can calculate these scores for you on the fly. Alternatively, you\n+ can precalculate them using ``lofreq alnqual``, which will incorporate them\n+ into your input dataset.\n+\n+- Mapping quality\n+\n+ The Phred-scaled likelihood that the read got mapped to the correct place\n+ in the reference genome. This score got incorporated into your input dataset\n+ by the aligner you used to map your reads.\n+ \n+- Source quality\n+\n+ This is the Phred-scaled likelihood that the given read comes from the\n+ reference genome. The tool can calculate this score for you.\n+\n+\n+**Variant filter parameters**\n+\n+After generating a list of called variants, the tool can filter this list\n+based on:\n+\n+- the statistical significance of the variant calls\n+- strand-bias of reads supporting the variant\n+- coverage of the variant site\n+\n+While posterior filtering can help reduce false-positive variant calls, please\n+note that the separate ``lofreq filter``, which can be run on the output of\n+``lofreq call`` has many more options for configuring filters.\n+\n+These are the different filter settings supported by the tool:\n+\n+*Preset filtering on QUAL score + coverage + strand bias*\n+\n+For variants to pass this filter, the following is required:\n+\n+- statistical signficance of the variant call with a pvalue < 0.01 based on the\n+ retransformed QUAL score of the variant and multiple-testing corrected using\n+ a dynamically determined Bonferroni factor (based on the number of overall\n+ variants considered during calling).\n+\n+- A strand-bias in supporting reads not significant under a FDR-corrected p\n+ value of 0.001 and 85% of supporting reads mapped to the same strand of the\n+ genome.\n+\n+- A coverage of the variant site of at least 10x.\n+\n+*Preset QUAL score-based filtering*\n+\n+Same QUAL-based significance filter as the default, but without the strand-bias\n+and coverage criteria\n+\n+*Strictly no filtering*\n+\n+Do not apply any filters, but produce the original list of all called variants.\n+You will almost always want to use ``lofreq filter`` to process the resulting\n+output.\n+ \n+*Custom filter settings/combinations*\n+\n+Lets you define your own QUAL-based significance filter and, optionally,\n+combine it with the default starnd-bias and coverage filters.\n+]]></help>\n+ <expand macro="citations" />\n+</tool>\n' |
| b |
| diff -r 000000000000 -r 31216d510164 macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Tue Dec 17 17:27:17 2019 -0500 |
| [ |
| @@ -0,0 +1,88 @@ +<macros> + <token name="@WRAPPER_VERSION@">@TOOL_VERSION@+galaxy</token> + <token name="@TOOL_VERSION@">2.1.3.1</token> + <xml name="requirements"> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">lofreq</requirement> + <yield/> + </requirements> + </xml> + <xml name="citations"> + <citations> + <citation type="doi">10.1093/nar/gks918</citation> + <yield /> + </citations> + </xml> + <token name="@PREPARE_REF@"><![CDATA[ + #if str($reference_source.ref_selector) == 'history': + #set $reference_fasta_fn = 'reference.fa' + ln -s '$reference_source.ref' $reference_fasta_fn && + lofreq faidx $reference_fasta_fn 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 && + #else + #set $reference_fasta_fn = str($reference_source.ref.fields.path) + #end if + ]]></token> + <xml name="reference_interface"> + <conditional name="reference_source"> + <param name="ref_selector" type="select" + label="Choose the source for the reference genome"> + <option value="cached">Locally cached</option> + <option value="history">History</option> + </param> + <when value="cached"> + <param argument="--ref" type="select" + label="Reference genome"> + <options from_data_table="fasta_indexes"> + <filter type="data_meta" column="dbkey" key="dbkey" ref="reads" /> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file" /> + </options> + </param> + </when> + <when value="history"> + <param argument="--ref" type="data" format="fasta" label="Reference" help="Reference sequence" /> + </when> + </conditional> + </xml> + <xml name="handle_existing_alnqual"> + <conditional name="alnqual_choice"> + <param name="alnquals_to_use" type="select" + label="Use the following alignment quality scores"> + <option value="">Base and indel alignment qualities (BAQ and IDAQ)</option> + <option value="-A">Only base alignment qualities (BAQ)</option> + <option value="-B">Only indel alignment qualities (IDAQ)</option> + </param> + <when value="-B"> + <param name="extended_baq" type="hidden" value="" /> + </when> + <when value=""> + <param argument="-e" name="extended_baq" type="boolean" checked="true" truevalue="" falsevalue="-e" + label="If BAQ needs to be computed, calculate extended BAQ?" /> + </when> + <when value="-A"> + <param argument="-e" name="extended_baq" type="boolean" checked="true" truevalue="" falsevalue="-e" + label="If BAQ needs to be computed, calculate extended BAQ?" /> + </when> + </conditional> + </xml> + <xml name="handle_alnqual" token_mode="Use"> + <conditional name="alnqual_choice"> + <param name="alnquals_to_use" type="select" + label="@MODE@ the following alignment quality scores"> + <option value="">Base and indel alignment qualities (BAQ and IDAQ)</option> + <option value="-A">Only base alignment qualities (BAQ)</option> + <option value="-B">Only indel alignment qualities (IDAQ)</option> + </param> + <when value="-B"> + <param name="extended_baq" type="hidden" value="" /> + </when> + <when value=""> + <param argument="-e" name="extended_baq" type="boolean" checked="true" truevalue="" falsevalue="-e" + label="Use extended BAQ?" /> + </when> + <when value="-A"> + <param argument="-e" name="extended_baq" type="boolean" checked="true" truevalue="" falsevalue="-e" + label="Use extended BAQ?" /> + </when> + </conditional> + </xml> +</macros> |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/alnqual-out1.bam |
| b |
| Binary file test-data/alnqual-out1.bam has changed |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/alnqual-out2.bam |
| b |
| Binary file test-data/alnqual-out2.bam has changed |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/alnqual-out3.bam |
| b |
| Binary file test-data/alnqual-out3.bam has changed |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/alnqual-out4.bam |
| b |
| Binary file test-data/alnqual-out4.bam has changed |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/alnqual-out5.bam |
| b |
| Binary file test-data/alnqual-out5.bam has changed |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/call-out1.vcf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/call-out1.vcf Tue Dec 17 17:27:17 2019 -0500 |
| b |
| @@ -0,0 +1,19 @@ +##fileformat=VCFv4.0 +##fileDate=20191125 +##source=lofreq call --verbose --ref reference.fa --sig 0.01 --bonf dynamic --no-default-filter -r pBR322:1-2180 -o /tmp/lofreq2_call_parallel3mrmthi_/0.vcf.gz alignments.bam +##reference=reference.fa +##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw Depth"> +##INFO=<ID=AF,Number=1,Type=Float,Description="Allele Frequency"> +##INFO=<ID=SB,Number=1,Type=Integer,Description="Phred-scaled strand bias at this position"> +##INFO=<ID=DP4,Number=4,Type=Integer,Description="Counts for ref-forward bases, ref-reverse, alt-forward and alt-reverse bases"> +##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL."> +##INFO=<ID=CONSVAR,Number=0,Type=Flag,Description="Indicates that the variant is a consensus variant (as opposed to a low frequency variant)."> +##INFO=<ID=HRUN,Number=1,Type=Integer,Description="Homopolymer length to the right of report indel position"> +##FILTER=<ID=min_snvqual_38,Description="Minimum SNV Quality (Phred) 38"> +##FILTER=<ID=min_indelqual_20,Description="Minimum Indel Quality (Phred) 20"> +##FILTER=<ID=min_dp_10,Description="Minimum Coverage 10"> +##FILTER=<ID=sb_fdr,Description="Strand-Bias Multiple Testing Correction: fdr corr. pvalue > 0.001000"> +##FILTER=<ID=min_snvqual_38,Description="Minimum SNV Quality (Phred) 38"> +##FILTER=<ID=min_indelqual_20,Description="Minimum Indel Quality (Phred) 20"> +#CHROM POS ID REF ALT QUAL FILTER INFO +pBR322 1134 . C T 49314 PASS DP=1767;AF=1.000000;SB=0;DP4=0,0,910,857 |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/call-out2.vcf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/call-out2.vcf Tue Dec 17 17:27:17 2019 -0500 |
| b |
| @@ -0,0 +1,27 @@ +##fileformat=VCFv4.0 +##fileDate=20191204 +##source=lofreq call --verbose --ref reference.fa --sig 1 --bonf 1 --no-default-filter --no-default-filter -r pBR322:1-2180 -o /tmp/tmpjsbggC/job_working_directory/000/8/working/pp-tmp/lofreq2_call_parallelj9yxuugx/0.vcf.gz reads.bam +##reference=reference.fa +##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw Depth"> +##INFO=<ID=AF,Number=1,Type=Float,Description="Allele Frequency"> +##INFO=<ID=SB,Number=1,Type=Integer,Description="Phred-scaled strand bias at this position"> +##INFO=<ID=DP4,Number=4,Type=Integer,Description="Counts for ref-forward bases, ref-reverse, alt-forward and alt-reverse bases"> +##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL."> +##INFO=<ID=CONSVAR,Number=0,Type=Flag,Description="Indicates that the variant is a consensus variant (as opposed to a low frequency variant)."> +##INFO=<ID=HRUN,Number=1,Type=Integer,Description="Homopolymer length to the right of report indel position"> +#CHROM POS ID REF ALT QUAL FILTER INFO +pBR322 815 . A G 0 . DP=665;AF=0.003008;SB=6;DP4=333,311,0,2 +pBR322 861 . A C 0 . DP=946;AF=0.002114;SB=3;DP4=447,497,0,2 +pBR322 1001 . A C 0 . DP=1797;AF=0.000556;SB=3;DP4=877,918,1,0 +pBR322 1013 . C G 0 . DP=1773;AF=0.000564;SB=0;DP4=875,897,0,1 +pBR322 1068 . T G 0 . DP=1774;AF=0.000564;SB=3;DP4=853,920,1,0 +pBR322 1084 . G T 0 . DP=1789;AF=0.000559;SB=3;DP4=875,913,1,0 +pBR322 1113 . T A 0 . DP=1784;AF=0.000561;SB=0;DP4=885,898,0,1 +pBR322 1134 . C T 49314 . DP=1767;AF=1.000000;SB=0;DP4=0,0,910,857 +pBR322 1193 . G A 0 . DP=1698;AF=0.000589;SB=3;DP4=865,832,0,1 +pBR322 1218 . A C 0 . DP=1708;AF=0.000585;SB=3;DP4=875,831,0,1 +pBR322 1230 . T C 0 . DP=1759;AF=0.000569;SB=3;DP4=907,850,0,1 +pBR322 1256 . A G 0 . DP=1746;AF=0.000573;SB=0;DP4=902,842,1,0 +pBR322 1498 . C G 0 . DP=1195;AF=0.000837;SB=3;DP4=588,606,1,0 +pBR322 1503 . T G 0 . DP=1156;AF=0.000865;SB=3;DP4=563,592,1,0 +pBR322 1505 . G A 0 . DP=1137;AF=0.000880;SB=0;DP4=560,576,0,1 |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/indelqual-out1.bam |
| b |
| Binary file test-data/indelqual-out1.bam has changed |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/indelqual-out2.bam |
| b |
| Binary file test-data/indelqual-out2.bam has changed |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/indelqual-out3.bam |
| b |
| Binary file test-data/indelqual-out3.bam has changed |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/lofreq-in1.bam |
| b |
| Binary file test-data/lofreq-in1.bam has changed |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/pBR322.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/pBR322.fa Tue Dec 17 17:27:17 2019 -0500 |
| b |
| @@ -0,0 +1,74 @@ +>pBR322 +TTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAA +TTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGG +CACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTT +GCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATA +TGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCG +CCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGAC +CACACCCGTCCTGTGGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCAC +AGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCA +CTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGG +ACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCT +CAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGACCGAT +GCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGT +CGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCT +CTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCT +TGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAA +ACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTACGT +CTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTC +CGGCGGCATCGGGATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCA +TCAGGGACAGCTTCAAGGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCACTGGACC +GCTGATCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGAT +TGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCG +GGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGA +ATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAAC +ATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGG +TCCTGGCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGG +GGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGC +TGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCG +TAAAGTCTGGAAACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCA +GGATGCTGCTGGCTACCCTGTGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGA +CCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAA +CGTTCCAGTAACCGGGCATGTTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGT +TTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTTACACGGAGGCATCAGTGACC +AAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTT +CTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCAC +GACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAAC +CTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGC +AGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACC +CAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTG +TACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACC +GCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGC +GGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATA +ACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCG +CGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCT +CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA +GCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTC +TCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGT +AGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCG +CCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGG +CAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCT +TGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGC +TGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCG +CTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTC +AAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTT +AAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAA +AATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAAT +GCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCT +GACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTG +CAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAG +CCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTA +ATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTG +CCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCG +GTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCT +CCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTA +TGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTG +GTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCC +CGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTG +GAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGA +TGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTG +GGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAAT +GTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTC +TCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCA +CATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCT +ATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAA \ No newline at end of file |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/viterbi-out1.bam |
| b |
| Binary file test-data/viterbi-out1.bam has changed |
| b |
| diff -r 000000000000 -r 31216d510164 test-data/viterbi-out2.bam |
| b |
| Binary file test-data/viterbi-out2.bam has changed |
| b |
| diff -r 000000000000 -r 31216d510164 tool-data/fasta_indexes.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/fasta_indexes.loc.sample Tue Dec 17 17:27:17 2019 -0500 |
| b |
| @@ -0,0 +1,29 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a fasta_indexes.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The fasta_indexes.loc +#file has this format (white space characters are TAB characters): +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg19 Canonical indexed stored in +# +# /depot/data2/galaxy/hg19/sam/, +# +#then the fasta_indexes.loc entry would look like this: +# +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +# +#and your /depot/data2/galaxy/hg19/sam/ directory +#would contain hg19canon.fa and hg19canon.fa.fai files. +# +#Your fasta_indexes.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#hg18canon hg18 Human (Homo sapiens): hg18 Canonical /depot/data2/galaxy/hg18/sam/hg18canon.fa +#hg18full hg18 Human (Homo sapiens): hg18 Full /depot/data2/galaxy/hg18/sam/hg18full.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /depot/data2/galaxy/hg19/sam/hg19full.fa |
| b |
| diff -r 000000000000 -r 31216d510164 tool_data_table_conf.xml.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Tue Dec 17 17:27:17 2019 -0500 |
| b |
| @@ -0,0 +1,7 @@ +<tables> + <!-- Location of SAMTools indexes for FASTA files --> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/fasta_indexes.loc" /> + </table> +</tables> |