| Next changeset 1:34de9855c962 (2017-09-07) |
|
Commit message:
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/intarna commit bd39ebb8525db1e0f6a7e232bc05a5eea6badd25 |
|
added:
intarna.xml test-data/intarna_query.fa test-data/intarna_result.tabular test-data/intarna_target.fa |
| b |
| diff -r 000000000000 -r 33c0836ea386 intarna.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/intarna.xml Tue Feb 21 04:59:09 2017 -0500 |
| [ |
| b'@@ -0,0 +1,415 @@\n+<tool id="intarna" name="IntaRNA" version="2.0.0">\n+ <description>Efficient RNA-RNA interaction prediction incorporating accessibility and seeding of interaction sites.</description>\n+ <macros>\n+ <macro name="query_macro">\n+ <param name="_query" argument="--query" format="fasta" type="data" label="Query sequence(s)" help="Sequences have to use IUPAC nucleotide encoding. File must be in FASTA format" />\n+ <conditional name="qAcc_cond">\n+ <param argument="--qAcc" type="select" label="Accessibility computation" help="">\n+ <option value="N">No accessibility contributions (\'N\')</option>\n+ <option value="C" selected="true">Computation of accessibilities (\'C\')</option>\n+ <option value="P">Unpaired probabilities in RNAplfold format from --qAccFile</option>\n+ <option value="E">ED values in RNAplfold Pu-like format from --qAccFile</option>\n+ </param>\n+ <when value="N"/>\n+ <when value="C"/>\n+ <when value="P">\n+ <param argument="--qAccFile" format="text" type="data" label="Accessibility computation" help="" />\n+ </when>\n+ <when value="E">\n+ <param argument="--qAccFile" format="text" type="data" label="Accessibility computation" help="" />\n+ </when>\n+ </conditional>\n+ <param argument="--qAccW" type="integer" value="150" min="0" max="99999"\n+ label="Max. interaction length" help="... for query accessibility computation. Set to 0 to use full sequence length"/>\n+ <param argument="--qAccL" type="integer" value="100" min="0" max="99999"\n+ label="Max. loop length" help="... for query accessibility computation. 0 defaults to sliding window size \'qAccW\'"/>\n+ </macro>\n+ <macro name="target_macro">\n+ <param name="_target" argument="--target" format="fasta" type="data" label="Target sequence(s)" help="Sequences have to use IUPAC nucleotide encoding. File must be in FASTA format" />\n+ <conditional name="tAcc_cond">\n+ <param argument="--tAcc" type="select" label="Accessibility computation" help="">\n+ <option value="N">No accessibility contributions (\'N\')</option>\n+ <option value="C" selected="true">Computation of accessibilities (\'C\')</option>\n+ <option value="P">Unpaired probabilities in RNAplfold format from --qAccFile</option>\n+ <option value="E">ED values in RNAplfold Pu-like format from --qAccFile</option>\n+ </param>\n+ <when value="N"/>\n+ <when value="C"/>\n+ <when value="P">\n+ <param argument="--tAccFile" format="text" type="data" label="The file to be parsed" help="... for accessibility computation" />\n+ </when>\n+ <when value="E">\n+ <param argument="--tAccFile" format="text" type="data" label="Accessibility computation" help="" />\n+ </when>\n+ </conditional>\n+ <param argument="--tAccW" type="integer" value="150" min="0" max="99999"\n+ label="Max. interaction length" help="... for query accessibility computation. Set to 0 to use full sequence length"/>\n+ <param argument="--tAccL" type="integer" value="100" min="0" max="99999"\n+ label="Max. loop length" help="... for query accessibility computation. 0 defaults to sliding window size \'tAccW\'"/>\n+ </macro>\n+ <macro name="seed_macro">\n+ <param argument="--noSeed" truevalue="--noSeed" falsevalue="" checked="False" type="boolean"\n+ label="Disable seed constraint entirely for computation" help=""/>\n+ <param argument="--seedBP" type="integer" value="7" min="2" max="20" label="Min. num'..b'tput\'][\'add_output_cond\'][\'selector\'] == "add" and\n+ \'outQAccFile\' in advancedOptions[\'output\'][\'add_output_cond\'][\'add_output\']\n+ ))\n+ </filter>\n+ </data>\n+ <data name="outTAccFile" format="text" label="Target\'s ED values, on ${on_string}">\n+ <filter>\n+ ((\n+ advancedOptions[\'advancedSelector\'] == "advanced" and\n+ advancedOptions[\'output\'][\'add_output_cond\'][\'selector\'] == "add" and\n+ \'outTAccFile\' in advancedOptions[\'output\'][\'add_output_cond\'][\'add_output\']\n+ ))\n+ </filter>\n+ </data>\n+ <data name="outQPuFile" format="text" label="Query\'s unpaired probabilities used for ED values, on ${on_string}">\n+ <filter>\n+ ((\n+ advancedOptions[\'advancedSelector\'] == "advanced" and\n+ advancedOptions[\'output\'][\'add_output_cond\'][\'selector\'] == "add" and\n+ \'outQPuFile\' in advancedOptions[\'output\'][\'add_output_cond\'][\'add_output\']\n+ ))\n+ </filter>\n+ </data>\n+ <data name="outTPuFile" format="text" label="Target\'s unpaired probabilities used for ED values, on ${on_string}">\n+ <filter>\n+ ((\n+ advancedOptions[\'advancedSelector\'] == "advanced" and\n+ advancedOptions[\'output\'][\'add_output_cond\'][\'selector\'] == "add" and\n+ \'outTPuFile\' in advancedOptions[\'output\'][\'add_output_cond\'][\'add_output\']\n+ ))\n+ </filter>\n+ </data>\n+ </outputs>\n+ <tests>\n+ <test>\n+ <conditional name="advancedOptions">\n+ <param name="advancedSelector" value="basic"/>\n+ <section name="query">\n+ <param name="_query" value="intarna_query.fa" />\n+ </section>\n+ <section name="target">\n+ <param name="_target" value="intarna_target.fa"/>\n+ </section>\n+ </conditional>\n+ <output name="outfile" file="intarna_result.tabular"/>\n+ </test>\n+ </tests>\n+\n+ <help>\n+<![CDATA[\n+\n+**What it does**\n+\n+Efficient RNA-RNA interaction prediction incorporating accessibility and seeding of interaction sites\n+\n+During the last few years, several new small regulatory RNAs (sRNAs) have been discovered in bacteria. Most of them act as post-transcriptional regulators by base pairing to a target mRNA, causing translational repression or activation, or mRNA degradation. Numerous sRNAs have already been identified, but the number of experimentally verified targets is considerably lower. Consequently, computational target prediction is in great demand. Many existing target prediction programs neglect the accessibility of target sites and the existence of a seed, while other approaches are either specialized to certain types of RNAs or too slow for genome-wide searches.\n+\n+IntaRNA, developed by `Prof. Backofen\'s bioinformatics group at Freiburg University <http://www.bioinf.uni-freiburg.de/>`_, is a general and fast approach to the prediction of RNA-RNA interactions incorporating both the accessibility of interacting sites as well as the existence of a user-definable seed interaction. We successfully applied IntaRNA to the prediction of bacterial sRNA targets and determined the exact locations of the interactions with a higher accuracy than competing programs.\n+\n+.. class:: infomark\n+\n+Please refer to `IntaRNA github repository <https://github.com/BackofenLab/IntaRNA>`_ for use cases and additional information.\n+\n+\n+**Input**\n+\n+\n+\n+RNA sequences in *FASTA* format\n+\n+\n+**Output**\n+\n+RNA-RNA interaction information in CSV format and additional information/files on demand\n+\n+]]>\n+\n+ </help>\n+\n+ <citations>\n+ <citation type="doi">10.1093/nar/gku359</citation>\n+ <citation type="doi">10.1093/bioinformatics/btn544</citation>\n+ </citations>\n+\n+</tool>\n' |
| b |
| diff -r 000000000000 -r 33c0836ea386 test-data/intarna_query.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intarna_query.fa Tue Feb 21 04:59:09 2017 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>ncRNA1 +AGGAUGGGGGAAACCCCAUACUCCUCACACACCAAAUCGCCCGAUUUAUCGGGCUUUUUU +>ncRNA2 +ACUGAGGUACGAUCGUGGCAGGGCCUUUGACUGACUUUCGUACUU |
| b |
| diff -r 000000000000 -r 33c0836ea386 test-data/intarna_result.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intarna_result.tabular Tue Feb 21 04:59:09 2017 -0500 |
| b |
| @@ -0,0 +1,5 @@ +id1 start1 end1 id2 start2 end2 subseqDP hybridDP E +mRNA1 85 95 ncRNA1 21 32 GUGGUGAGGAG&CUCCUCACACAC (((((((((((&)))))))).))) -11.8782 +mRNA1 127 135 ncRNA2 18 25 GGCACCUGC&GCAGGGCC (((.(((((&)))))))) -6.95474 +mRNA2 86 97 ncRNA1 20 31 UGUGUGACGAGU&ACUCCUCACACA (((((((.((((&)))).))))))) -8.16661 +mRNA2 15 18 ncRNA2 22 25 GGCC&GGCC ((((&)))) -4.99627 |
| b |
| diff -r 000000000000 -r 33c0836ea386 test-data/intarna_target.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intarna_target.fa Tue Feb 21 04:59:09 2017 -0500 |
| b |
| @@ -0,0 +1,8 @@ +>mRNA1 +UUUAAAUUAAAAAAUCAUAGAAAAAGUAUCGUUUGAUACUUGUGAUUAUACUCAGUUAUA +CAGUAUCUUAAGGUGUUAUUAAUAGUGGUGAGGAGAAUUUAUGAAGCUUUUCAAAAGCUU +GCUUGUGGCACCUGCAACUCUUGGUCUUUUAGCACCAAUGACCGCUACUGCUAAU +>mRNA2 +UGCUUCUUAGUAAUGGCCAGCUCGGGGAUUUGGAACUGGUGGUUGUUAAUUCUAGGCAAA +UAGAUUAAAAUUAAAUUACUCAAAUUGUGUGACGAGUUUUAUGAAGCUUUUUAAAAGCUU +GUUGGUAGCUCCAGCAACGAUUGGGCUACUAGCUCCAUUUUCAACGUUUGCUGGC |