| Previous changeset 6:9aab29e159a7 (2014-01-16) Next changeset 8:64698e16f4a6 (2015-04-09) |
|
Commit message:
Uploaded |
|
modified:
cufflinks_wrapper.py cufflinks_wrapper.xml test-data/cufflinks_out1.gtf test-data/cufflinks_out2.fpkm_tracking test-data/cufflinks_out3.fpkm_tracking test-data/cufflinks_out4.txt tool_dependencies.xml |
|
added:
cuff_macros.xml test-data/cufflinks_out4.gtf test-data/cufflinks_out5.gtf |
| b |
| diff -r 9aab29e159a7 -r 5346d5eea8b1 cuff_macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/cuff_macros.xml Fri Dec 19 11:58:22 2014 -0500 |
| [ |
| @@ -0,0 +1,91 @@ +<macros> + <token name="@VERSION@">2.2.1</token> + <xml name="requirements"> + <requirements> + <requirement type="package" version="2.2.1">cufflinks</requirement> + <yield /> + </requirements> + </xml> + <xml name="stdio"> + <stdio> + <exit_code range="1:" /> + <exit_code range=":-1" /> + <regex match="Error:" /> + <regex match="Exception:" /> + </stdio> + </xml> + <xml name="condition_inputs"> + <!-- DEFAULT : use BAM/SAM files --> + <conditional name="in_type"> + <param name="set_in_type" type="select" label="Input data type" + help="CuffNorm supports either CXB (from cuffquant) or SAM/BAM input files. Mixing is not supported. Default: SAM/BAM"> + <option value="BAM">SAM/BAM</option> + <option value="CXB">Cuffquant (CXB)</option> + <option value="CONDITION_LIST">List of single replicate conditions</option> + <option value="CONDITION_REPLICATE_LIST">List of multiple replicate conditions</option> + </param> + <when value="BAM"> + <repeat name="conditions" title="Condition" min="2"> + <param name="name" title="Condition name" type="text" label="Name"/> + <param name="samples" label="Replicates" type="data" format="sam,bam" multiple="true"/> + </repeat> + </when> + <when value="CXB"> + <repeat name="conditions" title="Condition" min="2"> + <param name="name" title="Condition name" type="text" label="Name"/> + <param name="samples" label="Replicates" type="data" format="cxb" multiple="true"/> + </repeat> + </when> + <when value="CONDITION_LIST"> + <param name="conditions" title="List of Conditions" type="data_collection" collection_type="list" /> + </when> + <when value="CONDITION_REPLICATE_LIST"> + <param name="conditions" title="List of Conditions" type="data_collection" collection_type="list:list" /> + </when> + </conditional> + </xml> + <token name="@CONDITION_SAMPLES@"> + #if $in_type.set_in_type in ['BAM', 'CXB'] + #for $condition in $in_type.conditions: + #set samples = ','.join( [ str( $sample ) for $sample in $condition.samples ] ) + $samples + #end for + #elif $in_type.set_in_type == 'CONDITION_LIST' + #for $sample in $in_type.conditions: + $sample + #end for + #elif $in_type.set_in_type == 'CONDITION_REPLICATE_LIST' + #for $condition_list in $in_type.conditions: + #set samples = ','.join( [ str( $sample ) for $sample in $condition_list ] ) + $samples + #end for + #end if + </token> + <token name="@CONDITION_LABELS@"> + #import re + #if $in_type.set_in_type in ['BAM', 'CXB'] + #set labels = '\'' + '\',\''.join( [ str( $condition.name ) for $condition in $in_type.conditions ] ) + '\'' + #elif $in_type.set_in_type in ['CONDITION_LIST', 'CONDITION_REPLICATE_LIST'] + #set labels = '\'' + '\',\''.join( map(lambda x: re.sub('[^\w\-_]', '_', x), $in_type.conditions.keys() ) ) + '\'' + #end if + --labels $labels + </token> + <xml name="cufflinks_gtf_inputs"> + <param format="gtf" name="inputs" type="data" label="GTF file(s) produced by Cufflinks" help="" multiple="true" /> + <repeat name="additional_inputs" title="Additional GTF Inputs (Lists)"> + <param format="gtf" name="additional_inputs" type="data_collection" label="GTF file(s) produced by Cufflinks" help="" /> + </repeat> + </xml> + <token name="@CUFFLINKS_GTF_INPUTS@"> + ## Inputs. + #for $input_file in $inputs: + "${input_file}" + #end for + #for $additional_input in $additional_inputs: + #for $input_file in $additional_input.additional_inputs: + "${input_file}" + #end for + #end for + </token> + <token name="@HAS_MULTIPLE_INPUTS@">getattr(inputs, "__len__", [].__len__)() >= 2</token> +</macros> \ No newline at end of file |
| b |
| diff -r 9aab29e159a7 -r 5346d5eea8b1 cufflinks_wrapper.py --- a/cufflinks_wrapper.py Thu Jan 16 13:14:05 2014 -0500 +++ b/cufflinks_wrapper.py Fri Dec 19 11:58:22 2014 -0500 |
| b |
| b'@@ -1,7 +1,5 @@\n #!/usr/bin/env python\n \n-# Supports Cufflinks versions 1.3 and newer.\n-\n import optparse, os, shutil, subprocess, sys, tempfile\n from galaxy import eggs\n from galaxy.datatypes.util.gff_util import parse_gff_attributes, gff_attributes_to_str\n@@ -14,35 +12,56 @@\n #Parse Command Line\n parser = optparse.OptionParser()\n parser.add_option( \'-1\', \'--input\', dest=\'input\', help=\' file of RNA-Seq read alignments in the SAM format. SAM is a standard short read alignment, that allows aligners to attach custom tags to individual alignments, and Cufflinks requires that the alignments you supply have some of these tags. Please see Input formats for more details.\' )\n- parser.add_option( \'-s\', \'--inner-dist-std-dev\', dest=\'inner_dist_std_dev\', help=\'The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp.\' )\n parser.add_option( \'-I\', \'--max-intron-length\', dest=\'max_intron_len\', help=\'The minimum intron length. Cufflinks will not report transcripts with introns longer than this, and will ignore SAM alignments with REF_SKIP CIGAR operations longer than this. The default is 300,000.\' )\n parser.add_option( \'-F\', \'--min-isoform-fraction\', dest=\'min_isoform_fraction\', help=\'After calculating isoform abundance for a gene, Cufflinks filters out transcripts that it believes are very low abundance, because isoforms expressed at extremely low levels often cannot reliably be assembled, and may even be artifacts of incompletely spliced precursors of processed transcripts. This parameter is also used to filter out introns that have far fewer spliced alignments supporting them. The default is 0.05, or 5% of the most abundant isoform (the major isoform) of the gene.\' )\n parser.add_option( \'-j\', \'--pre-mrna-fraction\', dest=\'pre_mrna_fraction\', help=\'Some RNA-Seq protocols produce a significant amount of reads that originate from incompletely spliced transcripts, and these reads can confound the assembly of fully spliced mRNAs. Cufflinks uses this parameter to filter out alignments that lie within the intronic intervals implied by the spliced alignments. The minimum depth of coverage in the intronic region covered by the alignment is divided by the number of spliced reads, and if the result is lower than this parameter value, the intronic alignments are ignored. The default is 5%.\' )\n parser.add_option( \'-p\', \'--num-threads\', dest=\'num_threads\', help=\'Use this many threads to align reads. The default is 1.\' )\n- parser.add_option( \'-m\', \'--inner-mean-dist\', dest=\'inner_mean_dist\', help=\'This is the expected (mean) inner distance between mate pairs. \\\n- For, example, for paired end runs with fragments selected at 300bp, \\\n- where each end is 50bp, you should set -r to be 200. The default is 45bp.\')\n parser.add_option( \'-G\', \'--GTF\', dest=\'GTF\', help=\'Tells Cufflinks to use the supplied reference annotation to estimate isoform expression. It will not assemble novel transcripts, and the program will ignore alignments not structurally compatible with any reference transcript.\' )\n+ parser.add_option ("--compatible-hits-norm",dest=\'compatible_hits_norm\',help=\'Count hits compatible with reference RNAs only\')\n parser.add_option( \'-g\', \'--GTF-guide\', dest=\'GTFguide\', help=\'use reference transcript annotation to guide assembly\' )\n+ parser.add_option("--3-overhang-tolerance",dest=\'three_overhang_tolerance\', help=\'The number of bp allowed to overhang the 3prime end of a reference transcript when determining if an assembled transcript should be merged with it (ie, the assembled transcript is not novel). The default is 600 bp.\')\n+ parser.add_option("--intron-overhang-tolerance",dest=\'intron_overhang_tolerance\',help=\'The number of bp allowed to enter the intron of a reference transcript when determining if '..b'ias_correction\', action="store_true", help=\'Providing Cufflinks with a multifasta file via this option instructs it to run our new bias detection and correction algorithm which can significantly improve accuracy of transcript abundance estimates.\')\n parser.add_option( \'\', \'--index\', dest=\'index\', help=\'The path of the reference genome\' )\n parser.add_option( \'\', \'--ref_file\', dest=\'ref_file\', help=\'The reference dataset from the history\' )\n \n- # Global model.\n+ # Global model (for trackster).\n parser.add_option( \'\', \'--global_model\', dest=\'global_model_file\', help=\'Global model used for computing on local data\' )\n \n (options, args) = parser.parse_args()\n@@ -84,8 +103,6 @@\n cmd = "cufflinks -q --no-update-check"\n \n # Add options.\n- if options.inner_dist_std_dev:\n- cmd += ( " -s %i" % int ( options.inner_dist_std_dev ) )\n if options.max_intron_len:\n cmd += ( " -I %i" % int ( options.max_intron_len ) )\n if options.min_isoform_fraction:\n@@ -94,31 +111,59 @@\n cmd += ( " -j %f" % float ( options.pre_mrna_fraction ) ) \n if options.num_threads:\n cmd += ( " -p %i" % int ( options.num_threads ) )\n- if options.inner_mean_dist:\n- cmd += ( " -m %i" % int ( options.inner_mean_dist ) )\n if options.GTF:\n cmd += ( " -G %s" % options.GTF )\n+ if options.compatible_hits_norm:\n+ cmd += ( " --compatible-hits-norm" )\n if options.GTFguide:\n cmd += ( " -g %s" % options.GTFguide )\n+ cmd += ( " --3-overhang-tolerance %i" % int ( options.three_overhang_tolerance ) )\n+ cmd += ( " --intron-overhang-tolerance %i" % int ( options.intron_overhang_tolerance ) )\n+ if options.no_faux_reads:\n+ cmd += ( " --no-faux-reads" )\n if options.multi_read_correct:\n cmd += ( " -u" )\n- if options.num_importance_samples:\n- cmd += ( " --num-importance-samples %i" % int ( options.num_importance_samples ) )\n+\n+ if options.library_type and options.library_type != \'auto\':\n+ cmd += ( " --library-type %s" % options.library_type)\n+ if options.mask_file:\n+ cmd += ( " --mask-file %s" % options.mask_file )\n+ if options.inner_mean_dist:\n+ cmd += ( " -m %i" % int ( options.inner_mean_dist ) )\n+ if options.inner_dist_std_dev:\n+ cmd += ( " -s %i" % int ( options.inner_dist_std_dev ) )\n if options.max_mle_iterations:\n cmd += ( " --max-mle-iterations %i" % int ( options.max_mle_iterations ) )\n- if options.do_normalization:\n- cmd += ( " -N" )\n+ if options.junc_alpha:\n+ cmd += ( " --junc-alpha %f" % float ( options.junc_alpha) ) \n+ if options.small_anchor_fraction:\n+ cmd += ( " --small-anchor-fraction %f" % float (options.small_anchor_fraction ) )\n+ if options.overhang_tolerance:\n+ cmd += ( " --overhang-tolerance %i" % int ( options.overhang_tolerance ) )\n+ if options.max_bundle_length:\n+ cmd += ( " --max-bundle-length %i" % int ( options.max_bundle_length ) ) \n+ if options.max_bundle_frags:\n+ cmd += ( " --max-bundle-frags %i" % int ( options.max_bundle_frags ) )\n+ if options.min_intron_length:\n+ cmd += ( " --min-intron-length %i" % int ( options.min_intron_length ) )\n+ if options.trim_three_avgcov_thresh:\n+ cmd += ( " --trim-3-avgcov-thresh %i" % int ( options.trim_three_avgcov_thresh ) ) \n+ if options.trim_three_dropoff_frac:\n+ cmd += ( " --trim-3-dropoff-frac %f" % float ( options.trim_three_dropoff_frac ) ) \n+\n if options.do_bias_correction:\n cmd += ( " -b %s" % seq_path )\n if options.no_effective_length_correction:\n cmd += ( " --no-effective-length-correction" )\n- \n- # Debugging.\n- print cmd\n+ if options.no_length_correction:\n+ cmd += ( " --no-length-correction" )\n \n # Add input files.\n cmd += " " + options.input\n- \n+ \n+ # Debugging.\n+ print cmd\n+ \n #\n # Run command and handle output.\n #\n' |
| b |
| diff -r 9aab29e159a7 -r 5346d5eea8b1 cufflinks_wrapper.xml --- a/cufflinks_wrapper.xml Thu Jan 16 13:14:05 2014 -0500 +++ b/cufflinks_wrapper.xml Fri Dec 19 11:58:22 2014 -0500 |
| b |
| b'@@ -1,9 +1,10 @@\n-<tool id="cufflinks" name="Cufflinks" version="0.0.7">\n- <!-- Wrapper supports Cufflinks versions v1.3.0 and newer -->\n+<tool id="cufflinks" name="Cufflinks" version="@VERSION@.0">\n <description>transcript assembly and FPKM (RPKM) estimates for RNA-Seq data</description>\n- <requirements>\n- <requirement type="package" version="2.1.1">cufflinks</requirement>\n- </requirements>\n+ <expand macro="requirements" />\n+ <expand macro="stdio" />\n+ <macros>\n+ <import>cuff_macros.xml</import>\n+ </macros>\n <version_command>cufflinks 2>&1 | head -n 1</version_command>\n <command interpreter="python">\n cufflinks_wrapper.py \n@@ -13,19 +14,18 @@\n -I $max_intron_len\n -F $min_isoform_fraction\n -j $pre_mrna_fraction\n- $effective_length_correction\n+ $length_correction\n \n ## Include reference annotation?\n #if $reference_annotation.use_ref == "Use reference annotation":\n -G $reference_annotation.reference_annotation_file\n+ $reference_annotation.compatible_hits_norm\n #end if\n #if $reference_annotation.use_ref == "Use reference annotation guide":\n-\t\t -g $reference_annotation.reference_annotation_guide_file\n- #end if\n-\n- ## Normalization?\n- #if str($do_normalization) == "Yes":\n- -N\n+ -g $reference_annotation.reference_annotation_guide_file\n+ --3-overhang-tolerance=$reference_annotation.three_overhang_tolerance\n+ --intron-overhang-tolerance=$reference_annotation.intron_overhang_tolerance\n+ $reference_annotation.no_faux_reads\n #end if\n \n ## Bias correction?\n@@ -47,16 +47,32 @@\n #if $global_model:\n --global_model=$global_model\n #end if\n+\n+ ## advanced settings\n+ #if $advanced_settings.use_advanced_settings == "Yes":\n+ --library-type=$advanced_settings.library_type\n+ #if $advanced_settings.mask_file:\n+ --mask-file=$advanced_settings.mask_file\n+ #end if\n+ --inner-mean-dist=$advanced_settings.inner_mean_dist\n+ --inner-dist-std-dev=$advanced_settings.inner_dist_std_dev\n+ --max-mle-iterations=$advanced_settings.max_mle_iterations\n+ --junc-alpha=$advanced_settings.junc_alpha\n+ --small-anchor-fraction=$advanced_settings.small_anchor_fraction\n+ --overhang-tolerance=$advanced_settings.overhang_tolerance\n+ --max-bundle-length=$advanced_settings.max_bundle_length\n+ --max-bundle-frags=$advanced_settings.max_bundle_frags\n+ --min-intron-length=$advanced_settings.min_intron_length\n+ --trim-3-avgcov-thresh=$advanced_settings.trim_three_avgcov_thresh\n+ --trim-3-dropoff-frac=$advanced_settings.trim_three_dropoff_frac\n+ #end if\n+\n </command>\n <inputs>\n <param format="sam,bam" name="input" type="data" label="SAM or BAM file of aligned RNA-Seq reads" help=""/>\n- <param name="max_intron_len" type="integer" value="300000" min="1" max="600000" label="Max Intron Length" help=""/>\n- <param name="min_isoform_fraction" type="float" value="0.10" min="0" max="1" label="Min Isoform Fraction" help=""/>\n- <param name="pre_mrna_fraction" type="float" value="0.15" min="0" max="1" label="Pre MRNA Fraction" help=""/>\n- <param name="do_normalization" type="select" label="Perform quartile normalization" help="Removes top 25% of genes from FPKM denominator to improve accuracy of differential expression calls for low abundance transcripts.">\n- <option value="No" selected="true">No</option>\n- <option value="Yes">Yes</option>\n- </param>\n+ <param name="max_intron_len" type="integer" value="300000" min="1" max="600000" la'..b' format, and is recommended for use with Cufflinks. However Cufflinks will accept SAM alignments generated by any read mapper. Here\'s an example of an alignment Cufflinks will accept::\n \n- s6.25mer.txt-913508\t16\tchr1 4482736 255 14M431N11M * 0 0 \\\n+ s6.25mer.txt-913508 16 chr1 4482736 255 14M431N11M * 0 0 \\\n CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:-\n-\t\n+ \n Note the use of the custom tag XS. This attribute, which must have a value of "+" or "-", indicates which strand the RNA that produced this read came from. While this tag can be applied to any alignment, including unspliced ones, it must be present for all spliced alignment records (those with a \'N\' operation in the CIGAR string).\n The SAM file supplied to Cufflinks must be sorted by reference position. If you aligned your reads with TopHat, your alignments will be properly sorted already. If you used another tool, you may want to make sure they are properly sorted as follows::\n \n@@ -232,9 +298,12 @@\n -m INT This is the expected (mean) inner distance between mate pairs. For, example, for paired end runs with fragments selected at 300bp, where each end is 50bp, you should set -r to be 200. The default is 45bp.\n -s INT The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp.\n -I INT The minimum intron length. Cufflinks will not report transcripts with introns longer than this, and will ignore SAM alignments with REF_SKIP CIGAR operations longer than this. The default is 300,000.\n- -F \t After calculating isoform abundance for a gene, Cufflinks filters out transcripts that it believes are very low abundance, because isoforms expressed at extremely low levels often cannot reliably be assembled, and may even be artifacts of incompletely spliced precursors of processed transcripts. This parameter is also used to filter out introns that have far fewer spliced alignments supporting them. The default is 0.05, or 5% of the most abundant isoform (the major isoform) of the gene.\n+ -F After calculating isoform abundance for a gene, Cufflinks filters out transcripts that it believes are very low abundance, because isoforms expressed at extremely low levels often cannot reliably be assembled, and may even be artifacts of incompletely spliced precursors of processed transcripts. This parameter is also used to filter out introns that have far fewer spliced alignments supporting them. The default is 0.05, or 5% of the most abundant isoform (the major isoform) of the gene.\n -j Some RNA-Seq protocols produce a significant amount of reads that originate from incompletely spliced transcripts, and these reads can confound the assembly of fully spliced mRNAs. Cufflinks uses this parameter to filter out alignments that lie within the intronic intervals implied by the spliced alignments. The minimum depth of coverage in the intronic region covered by the alignment is divided by the number of spliced reads, and if the result is lower than this parameter value, the intronic alignments are ignored. The default is 5%.\n- -G\t Tells Cufflinks to use the supplied reference annotation to estimate isoform expression. It will not assemble novel transcripts, and the program will ignore alignments not structurally compatible with any reference transcript. \n+ -G Tells Cufflinks to use the supplied reference annotation to estimate isoform expression. It will not assemble novel transcripts, and the program will ignore alignments not structurally compatible with any reference transcript. \n -N With this option, Cufflinks excludes the contribution of the top 25 percent most highly expressed genes from the number of mapped fragments used in the FPKM denominator. This can improve robustness of differential expression calls for less abundant genes and transcripts.\n </help>\n+ <citations>\n+ <citation type="doi">10.1038/nbt.1621</citation>\n+ </citations>\n </tool>\n' |
| b |
| diff -r 9aab29e159a7 -r 5346d5eea8b1 test-data/cufflinks_out1.gtf --- a/test-data/cufflinks_out1.gtf Thu Jan 16 13:14:05 2014 -0500 +++ b/test-data/cufflinks_out1.gtf Fri Dec 19 11:58:22 2014 -0500 |
| b |
| @@ -1,4 +1,4 @@ -test_chromosome Cufflinks transcript 53 550 1000 + . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "10679134.4063403048"; frac "1.000000"; conf_lo "8543307.525072"; conf_hi "12814961.287608"; cov "145.770185"; -test_chromosome Cufflinks exon 53 250 1000 + . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "10679134.4063403048"; frac "1.000000"; conf_lo "8543307.525072"; conf_hi "12814961.287608"; cov "145.770185"; -test_chromosome Cufflinks exon 351 400 1000 + . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "2"; FPKM "10679134.4063403048"; frac "1.000000"; conf_lo "8543307.525072"; conf_hi "12814961.287608"; cov "145.770185"; -test_chromosome Cufflinks exon 501 550 1000 + . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "3"; FPKM "10679134.4063403048"; frac "1.000000"; conf_lo "8543307.525072"; conf_hi "12814961.287608"; cov "145.770185"; +test_chromosome Cufflinks transcript 53 550 1000 + . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "10679134.4063403048"; frac "1.000000"; conf_lo "8542701.791788"; conf_hi "12815567.020892"; cov "145.770185"; +test_chromosome Cufflinks exon 53 250 1000 + . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "10679134.4063403048"; frac "1.000000"; conf_lo "8542701.791788"; conf_hi "12815567.020892"; cov "145.770185"; +test_chromosome Cufflinks exon 351 400 1000 + . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "2"; FPKM "10679134.4063403048"; frac "1.000000"; conf_lo "8542701.791788"; conf_hi "12815567.020892"; cov "145.770185"; +test_chromosome Cufflinks exon 501 550 1000 + . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "3"; FPKM "10679134.4063403048"; frac "1.000000"; conf_lo "8542701.791788"; conf_hi "12815567.020892"; cov "145.770185"; |
| b |
| diff -r 9aab29e159a7 -r 5346d5eea8b1 test-data/cufflinks_out2.fpkm_tracking --- a/test-data/cufflinks_out2.fpkm_tracking Thu Jan 16 13:14:05 2014 -0500 +++ b/test-data/cufflinks_out2.fpkm_tracking Fri Dec 19 11:58:22 2014 -0500 |
| b |
| @@ -1,2 +1,2 @@ tracking_id class_code nearest_ref_id gene_id gene_short_name tss_id locus length coverage FPKM FPKM_conf_lo FPKM_conf_hi FPKM_status -CUFF.1.1 - - CUFF.1 - - test_chromosome:52-550 298 142.855 1.04656e+07 8.35119e+06 1.25799e+07 OK +CUFF.1.1 - - CUFF.1 - - test_chromosome:52-550 298 145.77 1.06791e+07 8.5427e+06 1.28156e+07 OK |
| b |
| diff -r 9aab29e159a7 -r 5346d5eea8b1 test-data/cufflinks_out3.fpkm_tracking --- a/test-data/cufflinks_out3.fpkm_tracking Thu Jan 16 13:14:05 2014 -0500 +++ b/test-data/cufflinks_out3.fpkm_tracking Fri Dec 19 11:58:22 2014 -0500 |
| b |
| @@ -1,2 +1,2 @@ tracking_id class_code nearest_ref_id gene_id gene_short_name tss_id locus length coverage FPKM FPKM_conf_lo FPKM_conf_hi FPKM_status -CUFF.1 - - CUFF.1 - - test_chromosome:52-550 - - 1.04656e+07 8.35119e+06 1.25799e+07 OK +CUFF.1 - - CUFF.1 - - test_chromosome:52-550 - - 1.06791e+07 8.5427e+06 1.28156e+07 OK |
| b |
| diff -r 9aab29e159a7 -r 5346d5eea8b1 test-data/cufflinks_out4.txt --- a/test-data/cufflinks_out4.txt Thu Jan 16 13:14:05 2014 -0500 +++ b/test-data/cufflinks_out4.txt Fri Dec 19 11:58:22 2014 -0500 |
| b |
| @@ -1,1 +1,2 @@ -100.000000 +tracking_id class_code nearest_ref_id gene_id gene_short_name tss_id locus length coverage FPKM FPKM_conf_lo FPKM_conf_hi FPKM_status +CUFF.1.1 - - CUFF.1 - - test_chromosome:52-550 298 145.77 1.06791e+07 8.5427e+06 1.28156e+07 OK |
| b |
| diff -r 9aab29e159a7 -r 5346d5eea8b1 tool_dependencies.xml --- a/tool_dependencies.xml Thu Jan 16 13:14:05 2014 -0500 +++ b/tool_dependencies.xml Fri Dec 19 11:58:22 2014 -0500 |
| b |
| @@ -1,6 +1,6 @@ <?xml version="1.0"?> <tool_dependency> - <package name="cufflinks" version="2.1.1"> - <repository changeset_revision="394b13717223" name="package_cufflinks_2_1_1" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" /> + <package name="cufflinks" version="2.2.1"> + <repository changeset_revision="899067a260d1" name="package_cufflinks_2_2_1" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> </tool_dependency> |