Mercurial > repos > artbio > metavisitor_2_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga @ 0:c375489bbcb0 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows/metavisitor_2_workflows commit ecf95caa7d5e9ab001a75cbf5fb306e7ecd3def3
author artbio
date Sun, 21 Jul 2019 19:22:52 -0400
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:c375489bbcb0
1 {
2 "a_galaxy_workflow": "true",
3 "uuid": "691e3812-602f-4492-93f3-f1355698b197",
4 "tags": [],
5 "format-version": "0.1",
6 "version": 1,
7 "steps": {
8 "1": {
9 "tool_id": null,
10 "errors": null,
11 "uuid": "9b24b7ef-5eb5-4c87-9272-42f9f05e109f",
12 "tool_version": null,
13 "outputs": [],
14 "workflow_outputs": [
15 {
16 "output_name": "output",
17 "uuid": "aa452f52-79bc-4b65-b230-6bcd9badfb2f",
18 "label": null
19 }
20 ],
21 "annotation": "",
22 "content_id": null,
23 "input_connections": {},
24 "inputs": [],
25 "position": {
26 "top": 439,
27 "left": 304
28 },
29 "tool_state": "{}",
30 "label": "de novo assembled Oases contigs",
31 "type": "data_input",
32 "id": 1,
33 "name": "Input dataset"
34 },
35 "0": {
36 "tool_id": null,
37 "errors": null,
38 "uuid": "ed07d831-9b23-4def-b883-f6fe24eb55a0",
39 "tool_version": null,
40 "outputs": [],
41 "workflow_outputs": [
42 {
43 "output_name": "output",
44 "uuid": "e73d1517-c1f3-4a7f-8fbd-e2297906ee1f",
45 "label": null
46 }
47 ],
48 "annotation": "",
49 "content_id": null,
50 "input_connections": {},
51 "inputs": [],
52 "position": {
53 "top": 289,
54 "left": 271
55 },
56 "tool_state": "{\"collection_type\": \"list\"}",
57 "label": "Input Dataset Collection of fastq reads",
58 "type": "data_collection_input",
59 "id": 0,
60 "name": "Input dataset collection"
61 },
62 "3": {
63 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1",
64 "errors": null,
65 "uuid": "88093ee6-2279-4398-8350-6c0e6f59720c",
66 "tool_version": "1.1",
67 "outputs": [
68 {
69 "type": "fasta",
70 "name": "output"
71 }
72 ],
73 "post_job_actions": {
74 "RenameDatasetActionoutput": {
75 "output_name": "output",
76 "action_type": "RenameDatasetAction",
77 "action_arguments": {
78 "newname": "Contig (>300 nt)"
79 }
80 }
81 },
82 "workflow_outputs": [
83 {
84 "output_name": "output",
85 "uuid": "7eaafc91-9c84-4307-bbff-6ad629170bdc",
86 "label": null
87 }
88 ],
89 "annotation": "",
90 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1",
91 "input_connections": {
92 "input": {
93 "output_name": "output",
94 "id": 1
95 }
96 },
97 "inputs": [
98 {
99 "name": "input",
100 "description": "runtime parameter for tool Filter sequences by length"
101 }
102 ],
103 "position": {
104 "top": 451,
105 "left": 569
106 },
107 "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"300\\\"\"}",
108 "label": null,
109 "type": "tool",
110 "id": 3,
111 "tool_shed_repository": {
112 "owner": "devteam",
113 "changeset_revision": "2fd6033d0e9c",
114 "name": "fasta_filter_by_length",
115 "tool_shed": "toolshed.g2.bx.psu.edu"
116 },
117 "name": "Filter sequences by length"
118 },
119 "2": {
120 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0",
121 "errors": null,
122 "uuid": "a07a6d78-bdd3-4092-b463-c0bd7f796efe",
123 "tool_version": "2.3.0",
124 "outputs": [
125 {
126 "type": "input",
127 "name": "output"
128 }
129 ],
130 "post_job_actions": {
131 "RenameDatasetActionoutput": {
132 "output_name": "output",
133 "action_type": "RenameDatasetAction",
134 "action_arguments": {
135 "newname": "Clipped reads"
136 }
137 }
138 },
139 "workflow_outputs": [
140 {
141 "output_name": "output",
142 "uuid": "890a91ad-07e6-421d-a40f-b75aff18f95b",
143 "label": null
144 }
145 ],
146 "annotation": "",
147 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0",
148 "input_connections": {
149 "input": {
150 "output_name": "output",
151 "id": 0
152 }
153 },
154 "inputs": [
155 {
156 "name": "input",
157 "description": "runtime parameter for tool Clip adapter"
158 }
159 ],
160 "position": {
161 "top": 294,
162 "left": 587
163 },
164 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}",
165 "label": null,
166 "type": "tool",
167 "id": 2,
168 "tool_shed_repository": {
169 "owner": "artbio",
170 "changeset_revision": "f7947c5a18b8",
171 "name": "yac_clipper",
172 "tool_shed": "toolshed.g2.bx.psu.edu"
173 },
174 "name": "Clip adapter"
175 },
176 "5": {
177 "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0",
178 "errors": null,
179 "uuid": "a069c8db-14ef-4708-89be-3a5d5a926498",
180 "tool_version": "1.0.0",
181 "outputs": [
182 {
183 "type": "input",
184 "name": "out_file1"
185 }
186 ],
187 "post_job_actions": {
188 "RenameDatasetActionout_file1": {
189 "output_name": "out_file1",
190 "action_type": "RenameDatasetAction",
191 "action_arguments": {
192 "newname": "contig (>300t, simplified names)"
193 }
194 }
195 },
196 "workflow_outputs": [
197 {
198 "output_name": "out_file1",
199 "uuid": "fa095644-f7e0-4c44-a555-4d24f8fddc85",
200 "label": null
201 }
202 ],
203 "annotation": "",
204 "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0",
205 "input_connections": {
206 "input": {
207 "output_name": "output",
208 "id": 3
209 }
210 },
211 "inputs": [
212 {
213 "name": "input",
214 "description": "runtime parameter for tool Regex Find And Replace"
215 }
216 ],
217 "position": {
218 "top": 443,
219 "left": 842
220 },
221 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\"_Confidence_.+\\\", \\\"replacement\\\": \\\"\\\"}]\", \"__page__\": null}",
222 "label": null,
223 "type": "tool",
224 "id": 5,
225 "tool_shed_repository": {
226 "owner": "galaxyp",
227 "changeset_revision": "209b7c5ee9d7",
228 "name": "regex_find_replace",
229 "tool_shed": "toolshed.g2.bx.psu.edu"
230 },
231 "name": "Regex Find And Replace"
232 },
233 "4": {
234 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1",
235 "errors": null,
236 "uuid": "a10d3b12-9018-4b96-9492-18e1b1e87a83",
237 "tool_version": "1.4.1",
238 "outputs": [
239 {
240 "type": "input",
241 "name": "paired_output"
242 },
243 {
244 "type": "input",
245 "name": "list_output"
246 },
247 {
248 "type": "input",
249 "name": "out_file1"
250 },
251 {
252 "type": "_sniff_",
253 "name": "paired_out_file"
254 }
255 ],
256 "post_job_actions": {
257 "HideDatasetActionpaired_out_file": {
258 "output_name": "paired_out_file",
259 "action_type": "HideDatasetAction",
260 "action_arguments": {}
261 },
262 "RenameDatasetActionout_file1": {
263 "output_name": "out_file1",
264 "action_type": "RenameDatasetAction",
265 "action_arguments": {
266 "newname": "Merged clipped reads"
267 }
268 },
269 "HideDatasetActionpaired_output": {
270 "output_name": "paired_output",
271 "action_type": "HideDatasetAction",
272 "action_arguments": {}
273 },
274 "HideDatasetActionlist_output": {
275 "output_name": "list_output",
276 "action_type": "HideDatasetAction",
277 "action_arguments": {}
278 }
279 },
280 "workflow_outputs": [
281 {
282 "output_name": "out_file1",
283 "uuid": "362a4d36-9fd9-4f68-a271-d068a245d307",
284 "label": null
285 }
286 ],
287 "annotation": "",
288 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1",
289 "input_connections": {
290 "global_condition|inputs": {
291 "output_name": "output",
292 "id": 2
293 }
294 },
295 "inputs": [
296 {
297 "name": "global_condition",
298 "description": "runtime parameter for tool Concatenate multiple datasets"
299 }
300 ],
301 "position": {
302 "top": 221.5,
303 "left": 831
304 },
305 "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}",
306 "label": null,
307 "type": "tool",
308 "id": 4,
309 "tool_shed_repository": {
310 "owner": "artbio",
311 "changeset_revision": "55cf9d9defd1",
312 "name": "concatenate_multiple_datasets",
313 "tool_shed": "toolshed.g2.bx.psu.edu"
314 },
315 "name": "Concatenate multiple datasets"
316 },
317 "7": {
318 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0",
319 "errors": null,
320 "uuid": "95dc4ba8-402f-4d64-b5e9-8706589bc7fc",
321 "tool_version": "2.14.0",
322 "outputs": [
323 {
324 "type": "tabular",
325 "name": "output_tab"
326 },
327 {
328 "type": "bed",
329 "name": "output_bed"
330 },
331 {
332 "type": "tabular",
333 "name": "extra_output_tab"
334 },
335 {
336 "type": "pdf",
337 "name": "output_pdf"
338 }
339 ],
340 "post_job_actions": {
341 "HideDatasetActionextra_output_tab": {
342 "output_name": "extra_output_tab",
343 "action_type": "HideDatasetAction",
344 "action_arguments": {}
345 },
346 "HideDatasetActionoutput_tab": {
347 "output_name": "output_tab",
348 "action_type": "HideDatasetAction",
349 "action_arguments": {}
350 }
351 },
352 "workflow_outputs": [
353 {
354 "output_name": "output_bed",
355 "uuid": "cab2a668-47c6-4e86-aab6-22155d6a3e4d",
356 "label": null
357 },
358 {
359 "output_name": "output_pdf",
360 "uuid": "9436b9c9-2dda-4649-8367-10e71d3a429e",
361 "label": null
362 }
363 ],
364 "annotation": "",
365 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0",
366 "input_connections": {
367 "inputs": {
368 "output_name": "output",
369 "id": 6
370 }
371 },
372 "inputs": [
373 {
374 "name": "inputs",
375 "description": "runtime parameter for tool small_rna_maps"
376 }
377 ],
378 "position": {
379 "top": 383,
380 "left": 1496.5
381 },
382 "tool_state": "{\"inputs\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__page__\": null, \"series\": \"[{\\\"__index__\\\": 0, \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"normalization\\\": \\\"1.0\\\"}]\", \"__rerun_remap_job_id__\": null, \"ylimits_cond\": \"{\\\"__current_case__\\\": 1, \\\"ylimits\\\": \\\"false\\\"}\", \"minsize\": \"\\\"18\\\"\", \"cluster\": \"\\\"0\\\"\", \"maxsize\": \"\\\"30\\\"\", \"normalization\": \"\\\"1\\\"\", \"plots_options\": \"{\\\"__current_case__\\\": 0, \\\"extra_plot\\\": \\\"Size\\\", \\\"first_plot\\\": \\\"Counts\\\", \\\"plots_options_selector\\\": \\\"two_plot\\\"}\"}",
383 "label": null,
384 "type": "tool",
385 "id": 7,
386 "tool_shed_repository": {
387 "owner": "artbio",
388 "changeset_revision": "14adf24603b6",
389 "name": "small_rna_maps",
390 "tool_shed": "toolshed.g2.bx.psu.edu"
391 },
392 "name": "small_rna_maps"
393 },
394 "6": {
395 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1",
396 "errors": null,
397 "uuid": "7e4be478-ae45-4282-812c-e72dc15c3d2d",
398 "tool_version": "2.1.1",
399 "outputs": [
400 {
401 "type": "tabular",
402 "name": "output"
403 },
404 {
405 "type": "input",
406 "name": "aligned"
407 },
408 {
409 "type": "input",
410 "name": "unaligned"
411 }
412 ],
413 "post_job_actions": {
414 "HideDatasetActionunaligned": {
415 "output_name": "unaligned",
416 "action_type": "HideDatasetAction",
417 "action_arguments": {}
418 },
419 "HideDatasetActionaligned": {
420 "output_name": "aligned",
421 "action_type": "HideDatasetAction",
422 "action_arguments": {}
423 }
424 },
425 "workflow_outputs": [
426 {
427 "output_name": "output",
428 "uuid": "39529cb2-4ae9-4b89-bab0-9cb59f577046",
429 "label": null
430 }
431 ],
432 "annotation": "",
433 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1",
434 "input_connections": {
435 "input": {
436 "output_name": "out_file1",
437 "id": 4
438 },
439 "refGenomeSource|ownFile": {
440 "output_name": "out_file1",
441 "id": 5
442 }
443 },
444 "inputs": [
445 {
446 "name": "input",
447 "description": "runtime parameter for tool sR_bowtie"
448 },
449 {
450 "name": "refGenomeSource",
451 "description": "runtime parameter for tool sR_bowtie"
452 }
453 ],
454 "position": {
455 "top": 368,
456 "left": 1164
457 },
458 "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"a_option\\\"\"}",
459 "label": "Align reads against contigs",
460 "type": "tool",
461 "id": 6,
462 "tool_shed_repository": {
463 "owner": "artbio",
464 "changeset_revision": "0281bb245635",
465 "name": "sr_bowtie",
466 "tool_shed": "toolshed.g2.bx.psu.edu"
467 },
468 "name": "sR_bowtie"
469 }
470 },
471 "annotation": "",
472 "name": "Metavisitor: Workflow for small RNA profiling of contigs"
473 }