Mercurial > repos > artbio > metavisitor_2_workflows
diff Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga @ 0:c375489bbcb0 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows/metavisitor_2_workflows commit ecf95caa7d5e9ab001a75cbf5fb306e7ecd3def3
author | artbio |
---|---|
date | Sun, 21 Jul 2019 19:22:52 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga Sun Jul 21 19:22:52 2019 -0400 @@ -0,0 +1,473 @@ +{ + "a_galaxy_workflow": "true", + "uuid": "691e3812-602f-4492-93f3-f1355698b197", + "tags": [], + "format-version": "0.1", + "version": 1, + "steps": { + "1": { + "tool_id": null, + "errors": null, + "uuid": "9b24b7ef-5eb5-4c87-9272-42f9f05e109f", + "tool_version": null, + "outputs": [], + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "aa452f52-79bc-4b65-b230-6bcd9badfb2f", + "label": null + } + ], + "annotation": "", + "content_id": null, + "input_connections": {}, + "inputs": [], + "position": { + "top": 439, + "left": 304 + }, + "tool_state": "{}", + "label": "de novo assembled Oases contigs", + "type": "data_input", + "id": 1, + "name": "Input dataset" + }, + "0": { + "tool_id": null, + "errors": null, + "uuid": "ed07d831-9b23-4def-b883-f6fe24eb55a0", + "tool_version": null, + "outputs": [], + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "e73d1517-c1f3-4a7f-8fbd-e2297906ee1f", + "label": null + } + ], + "annotation": "", + "content_id": null, + "input_connections": {}, + "inputs": [], + "position": { + "top": 289, + "left": 271 + }, + "tool_state": "{\"collection_type\": \"list\"}", + "label": "Input Dataset Collection of fastq reads", + "type": "data_collection_input", + "id": 0, + "name": "Input dataset collection" + }, + "3": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", + "errors": null, + "uuid": "88093ee6-2279-4398-8350-6c0e6f59720c", + "tool_version": "1.1", + "outputs": [ + { + "type": "fasta", + "name": "output" + } + ], + "post_job_actions": { + "RenameDatasetActionoutput": { + "output_name": "output", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Contig (>300 nt)" + } + } + }, + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "7eaafc91-9c84-4307-bbff-6ad629170bdc", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", + "input_connections": { + "input": { + "output_name": "output", + "id": 1 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool Filter sequences by length" + } + ], + "position": { + "top": 451, + "left": 569 + }, + "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"300\\\"\"}", + "label": null, + "type": "tool", + "id": 3, + "tool_shed_repository": { + "owner": "devteam", + "changeset_revision": "2fd6033d0e9c", + "name": "fasta_filter_by_length", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Filter sequences by length" + }, + "2": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", + "errors": null, + "uuid": "a07a6d78-bdd3-4092-b463-c0bd7f796efe", + "tool_version": "2.3.0", + "outputs": [ + { + "type": "input", + "name": "output" + } + ], + "post_job_actions": { + "RenameDatasetActionoutput": { + "output_name": "output", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Clipped reads" + } + } + }, + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "890a91ad-07e6-421d-a40f-b75aff18f95b", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", + "input_connections": { + "input": { + "output_name": "output", + "id": 0 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool Clip adapter" + } + ], + "position": { + "top": 294, + "left": 587 + }, + "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", + "label": null, + "type": "tool", + "id": 2, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "f7947c5a18b8", + "name": "yac_clipper", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Clip adapter" + }, + "5": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", + "errors": null, + "uuid": "a069c8db-14ef-4708-89be-3a5d5a926498", + "tool_version": "1.0.0", + "outputs": [ + { + "type": "input", + "name": "out_file1" + } + ], + "post_job_actions": { + "RenameDatasetActionout_file1": { + "output_name": "out_file1", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "contig (>300t, simplified names)" + } + } + }, + "workflow_outputs": [ + { + "output_name": "out_file1", + "uuid": "fa095644-f7e0-4c44-a555-4d24f8fddc85", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", + "input_connections": { + "input": { + "output_name": "output", + "id": 3 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool Regex Find And Replace" + } + ], + "position": { + "top": 443, + "left": 842 + }, + "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\"_Confidence_.+\\\", \\\"replacement\\\": \\\"\\\"}]\", \"__page__\": null}", + "label": null, + "type": "tool", + "id": 5, + "tool_shed_repository": { + "owner": "galaxyp", + "changeset_revision": "209b7c5ee9d7", + "name": "regex_find_replace", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Regex Find And Replace" + }, + "4": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", + "errors": null, + "uuid": "a10d3b12-9018-4b96-9492-18e1b1e87a83", + "tool_version": "1.4.1", + "outputs": [ + { + "type": "input", + "name": "paired_output" + }, + { + "type": "input", + "name": "list_output" + }, + { + "type": "input", + "name": "out_file1" + }, + { + "type": "_sniff_", + "name": "paired_out_file" + } + ], + "post_job_actions": { + "HideDatasetActionpaired_out_file": { + "output_name": "paired_out_file", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionout_file1": { + "output_name": "out_file1", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Merged clipped reads" + } + }, + "HideDatasetActionpaired_output": { + "output_name": "paired_output", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionlist_output": { + "output_name": "list_output", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [ + { + "output_name": "out_file1", + "uuid": "362a4d36-9fd9-4f68-a271-d068a245d307", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", + "input_connections": { + "global_condition|inputs": { + "output_name": "output", + "id": 2 + } + }, + "inputs": [ + { + "name": "global_condition", + "description": "runtime parameter for tool Concatenate multiple datasets" + } + ], + "position": { + "top": 221.5, + "left": 831 + }, + "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", + "label": null, + "type": "tool", + "id": 4, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "55cf9d9defd1", + "name": "concatenate_multiple_datasets", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Concatenate multiple datasets" + }, + "7": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0", + "errors": null, + "uuid": "95dc4ba8-402f-4d64-b5e9-8706589bc7fc", + "tool_version": "2.14.0", + "outputs": [ + { + "type": "tabular", + "name": "output_tab" + }, + { + "type": "bed", + "name": "output_bed" + }, + { + "type": "tabular", + "name": "extra_output_tab" + }, + { + "type": "pdf", + "name": "output_pdf" + } + ], + "post_job_actions": { + "HideDatasetActionextra_output_tab": { + "output_name": "extra_output_tab", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionoutput_tab": { + "output_name": "output_tab", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [ + { + "output_name": "output_bed", + "uuid": "cab2a668-47c6-4e86-aab6-22155d6a3e4d", + "label": null + }, + { + "output_name": "output_pdf", + "uuid": "9436b9c9-2dda-4649-8367-10e71d3a429e", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0", + "input_connections": { + "inputs": { + "output_name": "output", + "id": 6 + } + }, + "inputs": [ + { + "name": "inputs", + "description": "runtime parameter for tool small_rna_maps" + } + ], + "position": { + "top": 383, + "left": 1496.5 + }, + "tool_state": "{\"inputs\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__page__\": null, \"series\": \"[{\\\"__index__\\\": 0, \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"normalization\\\": \\\"1.0\\\"}]\", \"__rerun_remap_job_id__\": null, \"ylimits_cond\": \"{\\\"__current_case__\\\": 1, \\\"ylimits\\\": \\\"false\\\"}\", \"minsize\": \"\\\"18\\\"\", \"cluster\": \"\\\"0\\\"\", \"maxsize\": \"\\\"30\\\"\", \"normalization\": \"\\\"1\\\"\", \"plots_options\": \"{\\\"__current_case__\\\": 0, \\\"extra_plot\\\": \\\"Size\\\", \\\"first_plot\\\": \\\"Counts\\\", \\\"plots_options_selector\\\": \\\"two_plot\\\"}\"}", + "label": null, + "type": "tool", + "id": 7, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "14adf24603b6", + "name": "small_rna_maps", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "small_rna_maps" + }, + "6": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", + "errors": null, + "uuid": "7e4be478-ae45-4282-812c-e72dc15c3d2d", + "tool_version": "2.1.1", + "outputs": [ + { + "type": "tabular", + "name": "output" + }, + { + "type": "input", + "name": "aligned" + }, + { + "type": "input", + "name": "unaligned" + } + ], + "post_job_actions": { + "HideDatasetActionunaligned": { + "output_name": "unaligned", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionaligned": { + "output_name": "aligned", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "39529cb2-4ae9-4b89-bab0-9cb59f577046", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", + "input_connections": { + "input": { + "output_name": "out_file1", + "id": 4 + }, + "refGenomeSource|ownFile": { + "output_name": "out_file1", + "id": 5 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool sR_bowtie" + }, + { + "name": "refGenomeSource", + "description": "runtime parameter for tool sR_bowtie" + } + ], + "position": { + "top": 368, + "left": 1164 + }, + "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"a_option\\\"\"}", + "label": "Align reads against contigs", + "type": "tool", + "id": 6, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "0281bb245635", + "name": "sr_bowtie", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "sR_bowtie" + } + }, + "annotation": "", + "name": "Metavisitor: Workflow for small RNA profiling of contigs" +}